anti-PD-L1/anti-LAG 3 bispecific antibodies and uses thereof
阅读说明：本技术 抗pd-l1/抗lag3双特异性抗体及其用途 (anti-PD-L1/anti-LAG 3 bispecific antibodies and uses thereof ) 是由 朴银英 李良順 郑义静 金荣光 金衍周 朴泳燉 李尙勋 刘原圭 郑在浩 方磊 蒋 于 2019-08-21 设计创作，主要内容包括：本披露提供了抗PD-L1/抗LAG3双特异性抗体,其能够有效阻断在PD-L1与其受体PD-1之间以及在LAG3与其配体(例如MHC II类分子和FGL1)之间的相互作用。该双特异性抗体可以对PD-L1蛋白(例如人PD-L1蛋白)和LAG3蛋白(例如人LAG3蛋白)二者均具有高结合亲和力。还提供了对单独的该PD-L1或LAG3蛋白具有特异性的抗体和片段,或具有额外的对一种或多种其他抗原的特异性的抗体和片段。(The present disclosure provides anti-PD-L1/anti-LAG 3 bispecific antibodies that are capable of effectively blocking the interaction between PD-L1 and its receptor PD-1 and between LAG3 and its ligands (e.g., MHC class II molecules and FGL 1). The bispecific antibody may have high binding affinity for both PD-L1 protein (e.g., human PD-L1 protein) and LAG3 protein (e.g., human LAG3 protein). Antibodies and fragments specific for the PD-L1 or LAG3 protein alone, or with additional specificity for one or more other antigens, are also provided.)
1. An anti-PD-L1/anti-LAG 3 bispecific antibody comprising an anti-PD-L1 antibody or antigen-binding fragment thereof and an anti-LAG 3 antibody or antigen-binding fragment thereof, wherein
The anti-PD-L1 antibody or antigen-binding fragment thereof is capable of specifically binding to the immunoglobulin C (Ig C) domain of human programmed death ligand 1(PD-L1) protein, wherein the Ig C domain consists of amino acid residues 133-225; and is
The anti-LAG 3 antibody or antigen-binding fragment thereof comprises: a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460; a VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467; a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs: 120-160, 356 and 468-475; VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490; VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and a VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 218-228, 230-253, 359, and 484-489.
2. The anti-PD-L1/anti-LAG 3 bispecific antibody of claim 1, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof is capable of binding to at least one of amino acid residues Y134, K162, or N183 of the PD-L1 protein.
3. The anti-PD-L1/anti-LAG 3 bispecific antibody of claim 2, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof is capable of binding amino acid residues Y134, K162, and N183 of the PD-L1 protein.
4. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 1-3, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof does not bind to the immunoglobulin V (Ig V) domain of the PD-L1 protein, wherein the Ig V domain consists of amino acid residues 19-127.
5. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 1-4, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof and the anti-LAG 3 antibody or antigen-binding fragment thereof are each independently a chimeric antibody, a humanized antibody, or a fully human antibody.
6. An anti-PD-L1/anti-LAG 3 bispecific antibody comprising an anti-PD-L1 antibody or antigen-binding fragment thereof and an anti-LAG 3 antibody or antigen-binding fragment thereof, wherein
The anti-PD-L1 antibody or antigen-binding fragment thereof comprises:
(1) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO: 61-67;
(2) VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:68-77 and 525-527;
(3) a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NO 3, SEQ ID NO 78-90 and SEQ ID NO 513-519;
(4) VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NO.4, SEQ ID NO. 91-92 and SEQ ID NO. 520-521;
(5) a VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NO:5 and SEQ ID NO: 93-105; and
(6) VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NO 6, SEQ ID NO 106-524 and SEQ ID NO 522-524
The anti-LAG 3 antibody or antigen-binding fragment thereof comprises:
(i) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460;
(ii) a VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467;
(iii) a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs: 120-160, 356 and 468-475;
(iv) VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490;
(v) VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and
(vi) VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 218-228, 230-253, 359 and 484-489.
7. The anti-PD-L1/anti-LAG 3 bispecific antibody of claim 6, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof and the anti-LAG 3 antibody or antigen-binding fragment thereof are each independently a chimeric antibody, a humanized antibody, or a fully human antibody.
8. The anti-PD-L1/anti-LAG 3 bispecific antibody of claim 8, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof and the anti-LAG 3 antibody or antigen-binding fragment thereof are humanized antibodies.
9. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 6-8, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 7-26, 113, 493, 495, 497, 499, 501, 503, 505, 507, 509, and 511 or a polypeptide having at least 90% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 7-26, 113, 493, 495, 497, 499, 501, 503, 505, 507, 509, and 511.
10. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 6-9, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 27-33, 494, 496, 498, 500, 502, 504, 506, 508, 510, and 512 or a peptide having at least 90% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 27-33, 494, 496, 498, 500, 502, 504, 506, 508, 510, and 512.
11. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 6-10, wherein the anti-LAG 3 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NO 254-302, 352, 360-minus 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 441, 443, 445, 447, 449, 451, and 491 or with an amino acid sequence selected from the group consisting of SEQ ID NO 254-302, 352, 360-minus 373, 375, 377, 379, 381, 383, 385, 387, 389, 393, 395, 391, 405, 407, 401, 403, 405, 407, 417, 423, 425, 409, 425, 393, 383, 385, 393, 395, 409, and 491, 427. 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451 and 491.
12. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 6-11, wherein the anti-LAG 3 antibody or antigen-binding fragment thereof comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 303 351, 353, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452 and 492 or with an amino acid sequence selected from the group consisting of SEQ ID NOs 303, 351, 353, 380, 382, 384, 386, 388, 390, 392, 400, 396, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 432, 426, 432, 426, 398, 220, 436. 438, 440, 442, 444, 446, 448, 450, 452 and 378 has at least 90% sequence identity.
13. The anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 1-12 in the form of an IgG-scFv.
14. A pharmaceutical composition for treating or preventing a disease associated with PD-L1, LAG3, or both, the composition comprising the anti-PD-L1/anti-LAG 3 bispecific antibody of any one of claims 1-12, and a pharmaceutically acceptable carrier.
15. The pharmaceutical composition of claim 14, wherein the disease associated with PD-L1, LAG3, or both is cancer or an infection.
16. The pharmaceutical composition of claim 15, wherein the cancer is a solid tumor.
17. The pharmaceutical composition of claim 15, wherein the cancer is selected from the group consisting of: bladder cancer, liver cancer, colon cancer, rectal cancer, endometrial cancer, leukemia, lymphoma, pancreatic cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, urinary tract cancer, head and neck cancer, gastrointestinal cancer, gastric cancer, esophageal cancer, ovarian cancer, renal cancer, melanoma, prostate cancer, and thyroid cancer.
18. An antibody or antigen-binding fragment thereof specific for human PD-L1 protein and comprising:
(1) a VH CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 and 61-67;
(2) a VH CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 68-77 and 525-527;
(3) a VH CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 3, 78-90 and 513-519;
(4) a VL CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 4, 91-92 and 520-521;
(5) a VL CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 and 93-105; and
(6) VL CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 6, 106-524 and 522-111.
19. An antibody or antigen-binding fragment thereof specific for human LAG3 protein and comprising:
(i) a VH CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460;
(ii) a VH CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467;
(iii) a VH CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 120-160, 356 and 468-475;
(iv) VL CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490;
(v) VL CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and
(vi) VL CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 218-228, 230-253, 359 and 484-489.
20. The antibody or fragment of claim 19, wherein the VH CDR1 comprises the amino acid sequence of SEQ ID No. 354, the VH CDR2 comprises the amino acid sequence of SEQ ID No. 461, the VH CDR3 comprises the amino acid sequence of SEQ ID No. 468, the VL CDR1 comprises the amino acid sequence of SEQ ID No. 490, the VL CDR2 comprises the amino acid sequence of SEQ ID No. 358, and the VL CDR3 comprises the amino acid sequence of SEQ ID No. 488.
21. The antibody or fragment of claim 20, comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID No. 443 or a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID No. 443.
22. The antibody or fragment of claim 20 or 21, comprising a light chain variable region comprising the amino acid sequence of SEQ ID No. 444 or a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID No. 444.
23. The antibody or fragment of any one of claims 19-22, which is capable of inhibiting binding of human LAG protein to MHC class II molecules or fibrinogen-like protein 1(FGL 1).
24. An antibody or antigen-binding fragment thereof having specificity for human LAG3 protein and comprising:
a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:443 or a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:443 and having a VH CDR1 comprising the amino acid sequence of SEQ ID NO:354, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:461, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:468, and
a light chain variable region comprising the amino acid sequence of SEQ ID NO:444 or a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:444 and having a VL CDR1 comprising the amino acid sequence of SEQ ID NO:490, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:358, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 488.
25. The antibody or fragment of any one of claims 18-24, which is humanized.
26. One or more polynucleotides encoding the antibody or fragment of any one of claims 18-24.
27. A pharmaceutical composition for treating or preventing cancer, comprising the antibody or fragment of any one of claims 18-24, and a pharmaceutically acceptable carrier.
28. The pharmaceutical composition of claim 27, wherein the cancer is selected from the group consisting of: bladder cancer, liver cancer, colon cancer, rectal cancer, endometrial cancer, leukemia, lymphoma, pancreatic cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, urinary tract cancer, head and neck cancer, gastrointestinal cancer, gastric cancer, esophageal cancer, ovarian cancer, renal cancer, melanoma, prostate cancer, and thyroid cancer.
Technical Field
The invention relates to the field of antibodies, in particular to an anti-PD-L1/anti-LAG 3 bispecific antibody and application thereof.
Background
Programmed death ligand 1(PD-L1), also known as cluster of differentiation 274(CD274) or B7 homolog 1(B7-H1), is a
It has been shown that up-regulation of PD-L1 may allow cancer to evade the host immune system. Analysis of tumor samples from renal cell carcinoma patients found that high tumor expression of PD-L1 was associated with increased tumor invasiveness and increased risk of death. Many PD-L1 inhibitors are under development as immunooncology therapies and are exhibiting good results in clinical trials.
In addition to treating cancer, inhibition of PD-L1 also shows promise in treating infectious diseases. In a mouse model of intracellular infection, listeria monocytogenes (l.monocytogenes) induces expression of PD-L1 protein in T cells, NK cells, and macrophages. PD-L1 blocking (e.g., using blocking antibodies) results in increased mortality in infected mice. Blockade reduces TNF α and nitric oxide production by macrophages, reduces granzyme B production by NK cells, and reduces proliferation of listeria monocytogenes antigen-specific CD 8T cells (but not CD 4T cells). This evidence suggests that PD-L1 acts as a positive co-stimulatory molecule in intracellular infections.
Lymphocyte activation gene-3 (LAG-3), also known as CD223, is a member of the immunoglobulin (Ig) superfamily, is closely related to CD4, and differentially affects T cell function. LAG-3 is expressed on activated T cells, depleted T cells, tumor infiltrating T cells, and regulatory T cells (tregs). LAG-3/MHC class II interactions lead to T cell proliferation, activation and down regulation of homeostasis upon binding to major histocompatibility complex 2(MHC class II).
Like cytotoxic T lymphocyte antigen-4 (CTLA-4), programmed cell death ligand-1 (PD-L1), and programmed cell death-1 (PD-1), LAG-3 represents an important immune checkpoint in cancer. LAG-3 is expressed not only on activated/depleted effector T cells, but also on regulatory T cells. LAG3 antagonism may not only promote effector T cell activation, but may also block regulatory T cell suppressive function. Thus, LAG-3 represents a promising target for cancer immunotherapy, and preclinical evidence suggests that anti-LAG-3 antibodies may promote anti-tumor responses.
In view of the above, there is a need to develop novel agents that modulate LAG-3 activity in a manner that stimulates an immune response that can inhibit the growth of various cancers and tumor cells, and that can be used to treat autoimmune, inflammatory, or viral diseases.
Disclosure of Invention
The present disclosure provides anti-PD-L1/anti-LAG 3 bispecific antibodies that are capable of effectively blocking the interaction between PD-L1 and its receptor PD-1 and between LAG3 and its ligands (e.g., MHC class II molecules). The bispecific antibody may have high binding affinity for both PD-L1 protein (e.g., human PD-L1 protein) and LAG3 protein (e.g., human LAG3 protein).
The anti-PD-L1/anti-LAG 3 bispecific antibody may include an anti-PD-L1 antibody or antigen-binding fragment thereof (as a PD-L1 targeting moiety) capable of specifically recognizing and/or binding to PD-L1 protein, and an anti-LAG 3 antibody or antigen-binding fragment thereof (as a LAG3 targeting moiety) capable of specifically recognizing and/or binding to LAG3 protein.
The anti-PD-L1/anti-LAG 3 bispecific antibody may include an anti-PD-L1 antibody or antigen-binding fragment thereof as a PD-L1 targeting moiety.
In one embodiment, the anti-PD-L1 antibody or fragment thereof included in the bispecific antibody can specifically bind to the immunoglobulin c (igc) domain of a PD-L1 (e.g., human PD-L1) protein. In some embodiments, the IgC domain consists of amino acid residue 133-225 of the human PD-L1 protein. In some embodiments, the anti-PD-L1 antibody or fragment thereof can bind to at least one of amino acid residues Y134, K162, and N183 of human PD-L1 protein. In some embodiments, the anti-PD-L1 antibody or fragment thereof does not bind to the immunoglobulin v (IgV) domain of PD-L1 protein, and for example, the IgV domain consists of amino acid residues 19-127 of human PD-L1 protein. For example, the human PD-L1 protein may be selected from the group consisting of proteins represented by GenBank accession nos. NP _001254635.1, NP _001300958.1, NP _054862.1, etc., but may not be limited thereto. These anti-PD-L1 antibodies are useful for therapeutic purposes, such as the treatment of various types of cancer, infection (inflammation), and the like, and also for diagnostic and prognostic purposes. In one embodiment, the anti-PD-L1 antibody or fragment thereof can be specific for a human PD-L1 protein.
The anti-PD-L1 antibody or fragment thereof may comprise: (1) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO: 61-67; (2) VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:68-77 and 525-527; (3) a VH CDR3 having an amino acid sequence selected from the group consisting of
The anti-PD-L1/anti-LAG 3 bispecific antibody may include an anti-LAG 3 antibody or antigen-binding fragment thereof as a LAG3 targeting moiety. In one embodiment, the anti-LAG 3 antibody or fragment thereof can specifically bind to LAG3 (e.g., human LAG3) protein; for example, an anti-LAG 3 antibody or fragment thereof can bind the extracellular domain of LAG-3.
For example, the anti-LAG 3 antibodies or fragments thereof described herein may inhibit the binding of LAG-3 protein to galectin-3 (LGALS3) and C-type
For example, the human LAG3 protein may be selected from the group consisting of proteins represented by GenBank accession No. NP _002277.4 and the like, but may not be limited thereto. These anti-LAG 3 antibodies are useful for therapeutic purposes, such as treating various types of cancer, infection (inflammation), and the like, and also for diagnostic and prognostic purposes.
In one embodiment, the anti-LAG 3 antibody or fragment thereof can have specificity for a human LAG3 protein. The anti-LAG 3 antibody or fragment thereof may comprise: (i) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460; (ii) a VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467; (iii) a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs: 120-160, 356 and 468-475; (iv) VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490; (v) VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and (vi) a VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs: 218, 230, 253, 359 and 484, 489. For example, an anti-LAG 3 antibody or fragment thereof may comprise: VH CDR1 having the amino acid sequence of SEQ ID NO: 354; VH CDR2 having the amino acid sequence of SEQ ID NO:355 or 461; VH CDR3 having an amino acid sequence of SEQ ID NO 356 or 468; VL CDR1 having the amino acid sequence of SEQ ID NO:357 or 490; VL CDR2 having the amino acid sequence of SEQ ID NO 358; and a VL CDR3 having the amino acid sequence of SEQ ID NO 359 or 488.
Antibodies and fragments specific for the PD-L1 or LAG3 protein alone, or with additional specificity for one or more other antigens, are also provided.
In one embodiment, there is provided an antibody or antigen-binding fragment thereof specific for human PD-L1 protein, comprising: (1) a VH CDR1 comprising an amino acid sequence selected from the group consisting of
In one embodiment, there is provided an antibody or antigen-binding fragment thereof specific for human LAG3 protein, comprising: (i) a VH CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460; (ii) a VH CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467; (iii) a VH CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 120-160, 356 and 468-475; (iv) VL CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490; (v) VL CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and (vi) a VL CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 218, 230, 253, 359 and 484, 489.
Another embodiment provides a pharmaceutical composition comprising a bispecific antibody as described above. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier. The pharmaceutical composition may be used for the treatment and/or prevention of cancer or infection.
Another embodiment provides a method of treating and/or preventing cancer or infection in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a bispecific antibody or pharmaceutical composition. The method may further comprise the step of identifying a subject in need of treatment and/or prevention of cancer or infection prior to the administering step.
Another embodiment provides the use of a bispecific antibody or pharmaceutical composition in the treatment and/or prevention of cancer or infection. Another embodiment provides the use of a bispecific antibody in the manufacture of a pharmaceutical composition for the treatment and/or prevention of cancer or infection.
In the pharmaceutical compositions, methods and/or uses provided herein, the cancer may be a solid cancer or a blood cancer, preferably a solid cancer.
Another embodiment provides a composition for detecting PD-L1, LAG3, or both in a biological sample, the composition comprising a bispecific antibody. Another embodiment provides a method of detecting PD-L1, LAG3, or both in a biological sample, the method comprising contacting the biological sample with a bispecific antibody; and detecting (measuring) an antigen-antibody reaction (binding) between the bispecific antibody and PD-L1, LAG3, or both.
After the detecting step, the method of detecting may further comprise: determining that PD-L1, LAG3, or both are present in the biological sample when an antigen-antibody reaction is detected, and/or determining that PD-L1, LAG3, or both are absent (not present) in the biological sample when an antigen-antibody reaction is not detected.
Another embodiment provides a pharmaceutical composition for diagnosing a disease associated with PD-L1, LAG3, or both, the composition comprising a bispecific antibody. In another embodiment, use of a bispecific antibody for diagnosing a disease associated with PD-L1, LAG3, or both is provided.
Another embodiment provides a method of diagnosing a disease associated with PD-L1, LAG3, or both, the method comprising contacting a biological sample obtained from a patient with a bispecific antibody and detecting an antigen-antibody response or measuring the level of an antigen-antibody response in the biological sample. In some embodiments, the method can further comprise contacting the normal sample with a bispecific antibody and measuring the level of the antigen-antibody response in the normal sample. In addition, after the measuring step, the method may further comprise comparing the level of antigen-antibody reaction in the biological sample and the normal sample. In addition, after the detecting step or the comparing step, the method may further comprise determining the patient as a patient having a disease associated with PD-L1, LAG3, or both, when an antigen-antibody response is detected in the biological sample or the level of the antigen-antibody response in the biological sample is higher than the level of the antigen-antibody response in the normal sample.
The disease associated with PD-L1, LAG3, or both, may be a disease associated with activation (e.g., aberrant activation or over-activation) and/or overproduction (overexpression) of PD-L1, LAG3, or both. For example, as described above, the disease may be cancer or an infection.
One embodiment provides a polynucleotide encoding a bispecific antibody. In particular, the embodiments provide polynucleotides encoding the heavy chain of a bispecific antibody in an IgG-scFv format comprising a full-length IgG and a scFv linked to the C-terminus and/or N-terminus of the full-length IgG. Other embodiments provide polynucleotides encoding the light chain of a bispecific antibody in the form of an IgG-scFv. Another embodiment provides a recombinant vector comprising a polynucleotide encoding a heavy chain of a bispecific antibody, a polynucleotide encoding a light chain of a bispecific antibody, or both. Another embodiment provides a recombinant cell transfected with a recombinant vector.
Another embodiment provides a method of making a bispecific antibody comprising expressing in a cell a polynucleotide encoding a heavy chain of a bispecific antibody, a polynucleotide encoding a light chain of a bispecific antibody. The step of expressing the polynucleotide can be performed by culturing a cell comprising the polynucleotide (e.g., in a recombinant vector) under conditions that allow for expression of the polynucleotide. After the expression or culture step, the method may further comprise isolating and/or purifying the bispecific antibody from the cell culture.
Drawings
FIG. 1 shows that HL1210-3 can bind human PD-L1 with high affinity.
Fig. 2 shows that HL1210-3 can effectively inhibit the binding of human PD-L1 to
Figure 3 shows that HL1210-3 antibody can efficiently inhibit the binding of PD-1 to PD-L1 expressed on mammalian cells.
Figure 4 shows that the anti-PD-L1 antibodies tested can promote human T cell responses.
FIG. 5 shows the binding kinetics of HL1210-3 to recombinant PD-L1.
Figures 6A-6E show that all of the humanized antibodies tested had comparable binding efficacy to the chimeric antibody and to human PD-L1 contacted.
Figures 7A-7C show that all of the humanized antibodies tested can efficiently bind PD-L1 expressed on mammalian cells, comparable to the chimeric antibody.
Figure 8 shows that the humanized antibody Hu1210-41 binds rhesus monkey PD-L1 with lower affinity and is unable to bind rat and mouse PD-L1.
FIG. 9 shows that the Hu1210-41 antibody is only able to specifically bind B7-H1(PD-L1), but not B7-DC, B7-1, B7-2, B7-H2, PD-1, CD28, CTLA4, ICOS and BTLA.
FIG. 10 shows that Hu1210-41 can effectively inhibit the binding of human PD-L1 to human PD1 and B7-1.
FIG. 11 shows that Hu1210-41 can effectively inhibit the binding of human PD-L1 to human PD1 and B7-1.
FIG. 12 shows that humanized antibodies to Hu1210-8, Hu1210-9, Hu1210-16, Hu1210-17, Hu1210-21, and Hu1210-36 can dose-dependently promote IFN γ and IL-2 production in a mixed lymphocyte reaction.
FIG. 13 shows that Hu1210-40, Hu1210-41, and Hu1210-17 humanized antibodies can dose-dependently promote IFN γ production in CMV recall assay.
FIG. 14 shows that Hu1210-31 can inhibit tumor growth by 30% at 5mg/kg in the HCC 827-NSG-xenograft model.
Figure 15 shows that Hu1210-41 antibody can dose-dependently inhibit tumor growth in HCC 827-NSG-xenograft model, while tumor weight is also dose-dependently inhibited by Hu1210-41 antibody.
FIG. 16 plots the mean binding values as a function of expression (control anti-PD-L1 monoclonal antibody reactivity) for each PD-L1 mutant.
Figure 17 illustrates the positions of Y134, K162, and N183, which Y134, K162, and N183 are residues (spheres) involved in binding to the anti-PD-L1 Hu1210-41 antibody.
Figure 18 shows the results of a binding assay for derivatized antibodies (to human PD-L1).
FIG. 19 shows interaction with the parent antibody and TecntriqTM(atelizumab) more efficiently bound to PD-L1 expressed on mammalian cells than antibody B6.
Figure 20 shows the effect of antibodies on IL2 production in Jurkat cells, with B6 also exhibiting higher potency.
FIG. 21 shows that the D1-D2 domain is important for LAG-3 function. The wild-type (WT) LAG3 extracellular domain (ECD) fusion protein (LAG-3-ECD-huFc) fragment can bind to Daudi cells, while the LAG-3-ECD-huFc fragment truncated D1-D2 cannot bind to Daudi cells.
Fig. 22A-22D show binding of human anti-LAG 3 antibody to LAG3 protein derived from various species. The binding properties of anti-LAG-3 antibodies to human, rat and mouse LAG3 were assessed by enzyme-linked immunosorbent assay (ELISA).
Figure 23 shows binding of human anti-LAG 3 antibody to cell surface LAG-3 antigen on activated human primary CD4+ T cells. The binding of anti-LAG-3 antibodies to cell surface LAG-3 antigen at different concentrations (10. mu.g/ml, 3.333. mu.g/ml, 1.111. mu.g/ml, 0.370. mu.g/ml, 0.123. mu.g/ml, 0.041. mu.g/ml, 0.014. mu.g/ml and 0.005. mu.g/ml) on activated human primary CD4+ T cells was evaluated.
FIG. 24 shows inhibition of soluble LAG-3(sLAG) binding to MHC class II receptors by anti-LAG-3 antibodies. The ability of anti-LAG-3 antibodies to block the binding of sLAG-3 to MHC class II receptors was evaluated in an in vitro binding assay using biotin-labeled LAG-3-ECD-huFcLAG-3-Fc fusion proteins and Raji cells expressing MHC class II receptors.
FIG. 25 shows that anti-LAG-3 antibodies stimulate IL-2 production in Peripheral Blood Mononuclear Cells (PBMCs). anti-LAG-3 antibody was administered to staphylococcal enterotoxin b (seb) -stimulated PBMCs at various concentrations starting at 20 μ g/ml at 6 doses serially diluted 1: 3. Three days later, the IL-2 concentration in the culture supernatants was evaluated by enzyme-linked immunosorbent assay (ELISA).
Figure 26 shows reversal of effector T cell (Teff) suppressive function by regulatory T cells (tregs) using anti-LAG-3 antibody. To evaluate the ability of anti-LAG-3 antibodies to reverse the suppressive effect of tregs on Teff, the antibody of example 2.1 was used in an in vitro Treg suppression assay.
Fig. 27A-27C show ELISA results showing EC50 with antibodies binding to the whole extracellular domain of LAG3(D1-D4 huFc), but not LAG3 lacking D1-D2 (△ D1-D2 huFc), indicating that 122H, 147H and 170H are potent and selective binders to the D1 and D2 domains of
Figures 28A-28C show that the 122H, 147H and 170H antibodies dose-dependently inhibited the binding of LAG3 to its receptor MHC class II molecules.
FIG. 29 shows that mouse
FIG. 30 shows that humanized
Figure 31 shows the binding curve of
Figure 32 schematically illustrates an anti-PD-
Figure 33 shows a graph of the binding of anti-PD-
Figure 34 shows SEE results of SEE assay for anti-PD-
Figure 35 shows a graph demonstrating the tumor growth inhibitory effect of an anti-PD-
Figure 36 shows a graph demonstrating T cell promoting activity of an anti-PD-
Figure 37 shows a graph demonstrating T cell promoting activity of an anti-PD-
Fig. 39 shows the Biacore analysis results of B3807.
Figure 40 shows the binding activity of B3807 to human LAG3 on Jurkat and PBMC cells.
Figure 41 shows B3807 inhibition of soluble LAG-3(sLAG) binding to MHC class II receptors.
FIG. 42 shows the effect of B3807 on IL2 production in Jurkat cells.
Fig. 43 shows the effect of B3807 and in combination with anti-PD-L1 antibody on IL2 production in primary T cells.
Figure 44 shows the in vivo results of B3807 alone or in combination with anti-PD-1 or anti-PD-L1 antibodies in inhibiting tumor growth.
Figure 45 compares B3807 and B3807B in IL2 release and cell-based binding assays and demonstrates their high level of similarity.
Figure 46 compares the Biacore assay results between B3807 and B3807B.
Fig. 47 demonstrates that B3807 is effective in inhibiting binding between soluble LAG-3 and
Detailed Description
Definition of
It should be noted that the term "an" or "an" entity refers to one or more of the entity, e.g., "an antibody" should be understood to represent one or more antibodies. Thus, the terms "a" or "an", "one or more" and "at least one" are used interchangeably herein.
As used herein, the term "polypeptide" is intended to encompass both the singular "polypeptide" and the plural "polypeptide" and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, "proteins," "amino acid chains," or any other term used to refer to a chain or chains of two or more amino acids, are included in the definition of "polypeptide," and the term "polypeptide" may be used interchangeably in place of, or in addition to, any of these terms. The term "polypeptide" is also intended to refer to the product of post-expression modifications of the polypeptide including, without limitation, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. The polypeptide may be derived from a natural biological source or produced by recombinant techniques, but is not necessarily translated from a specified nucleic acid sequence. It may be produced in any manner, including by chemical synthesis.
The term "isolated" as used herein with respect to a cell, nucleic acid (e.g., DNA or RNA) refers to a molecule that is correspondingly isolated from other DNA or RNA present in the natural source of the macromolecule. The term "isolated" as used herein also refers to nucleic acids or peptides that are substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In addition, "isolated nucleic acid" is intended to include nucleic acid fragments which do not naturally occur as a fragment and which are not found in the natural state. The term "isolated" is also used herein to refer to cells or polypeptides that are separated from other cellular proteins or tissues. Isolated polypeptides are intended to encompass both purified and recombinant polypeptides.
As used herein, the term "recombinant" when referring to a polypeptide or polynucleotide means a form of the polypeptide or polynucleotide that does not occur in nature, non-limiting examples of which can be produced by combining polynucleotides or polypeptides that would not normally be present together.
"homology" or "identity" or "similarity" refers to the degree of sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing the positions in each sequence that can be aligned for comparison purposes. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence is less than 40% identical, but preferably less than 25% identical to one of the sequences of the present disclosure.
"sequence identity" that a polynucleotide or polynucleotide region (polypeptide or polypeptide region) has a percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) of another sequence means that, when aligned, the percentage of bases (or amino acids) are the same in comparing two sequences. This alignment and percent homology or sequence identity can be determined using software programs known in the art, such as those described in Ausubel et al, eds (2007) Current protocols in Molecular Biology [ Current Molecular Biology protocols ]. Preferably, default parameters are used for alignment. One alignment program is BLAST, using default parameters. Specifically, the programs are BLASTN and BLASTP, using the following default parameters: the genetic code is standard; no filter; two chains; cutoff is 60; desirably 10; BLOSUM 62; describe 50 sequences; the sorting basis is high score; database-not redundant-GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + SwissProtein + SPupdate + PIR. Biologically equivalent polynucleotides are polynucleotides having the above specified percentage of homology and encoding polypeptides having the same or similar biological activity.
The term "equivalent nucleic acid or polynucleotide" refers to a nucleic acid having a nucleotide sequence that has a degree of homology, or sequence identity, to the nucleotide sequence of the nucleic acid or its complement. Homologues of double-stranded nucleic acids are intended to include nucleic acids having a nucleotide sequence that has a degree of homology to the double-stranded nucleic acid or its complement. In one aspect, a homolog of the nucleic acid is capable of hybridizing to the nucleic acid or a complement thereof. Likewise, "equivalent polypeptide" refers to a polypeptide that has a degree of homology or sequence identity to the amino acid sequence of a reference polypeptide. In some aspects, the sequence identity is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%. In some aspects, an equivalent polypeptide or polynucleotide has one, two, three, four, or five additions, deletions, substitutions, and combinations thereof, as compared to a reference polypeptide or polynucleotide. In some aspects, the equivalent sequence retains the activity (e.g., epitope binding) or structure (e.g., salt bridge) of the reference sequence.
Hybridization reactions can be performed under different "stringent" conditions. Typically, low stringency hybridization reactions are performed in a solution of about 10XSSC or equivalent ionic strength/temperature at about 40 ℃. Medium stringency hybridization is typically performed at about 50 ℃ in about 6XSSC, and high stringency hybridization is typically performed at about 60 ℃ in about 1 XSSC. The hybridization reaction can also be carried out under "physiological conditions" well known to those skilled in the art. Non-limiting examples of physiological conditions are temperature, ionic strength, pH and Mg, which are typically found in cells2+The concentration of (c).
The polynucleotide is composed of a specific sequence of the following four nucleotide bases: adenine (a); cytosine (C); guanine (G); thymine (T); and when the polynucleotide is RNA, uracil (U) replaces thymine. Thus, the term "polynucleotide sequence" is a letter representation of a polynucleotide molecule. This letter representation can be entered into a database in a computer with a central processing unit and used for bioinformatics applications such as functional genomics and homology searches. The term "polymorphism" refers to the co-existence of more than one form of a gene or portion thereof. A portion of a gene having at least two different forms (i.e., two different nucleotide sequences) is referred to as a "polymorphic region of the gene". A polymorphic region may be a single nucleotide whose identity differs in different alleles.
The terms "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length (deoxyribonucleotides or ribonucleotides or analogs thereof). The polynucleotide may have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (e.g., a probe, primer, EST, or SAGE tag), an exon, an intron, messenger RNA (mrna), transfer RNA, ribosomal RNA, ribozyme, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotide, branched polynucleotide, plasmid, vector, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probe, and primer. Polynucleotides may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure, if present, may be imparted before or after assembly of the polynucleotide. The sequence of nucleotides may be interrupted by non-nucleotide components. The polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double-stranded and single-stranded molecules. Unless otherwise stated or required, any embodiment of the disclosure as a polynucleotide encompasses both: a double-stranded form, and each of two complementary single-stranded forms known or predicted to constitute the double-stranded form.
The term "encoding" when applied to a polynucleotide refers to a polynucleotide that, if in its native state or when manipulated by methods well known to those skilled in the art, "encodes" a polypeptide that can be transcribed and/or translated to produce mRNA for the polypeptide and/or fragments thereof. The antisense strand is the complement of such a nucleic acid, from which the coding sequence can be deduced.
As used herein, "antibody" or "antigen-binding polypeptide" refers to a polypeptide or polypeptide complex that specifically recognizes and binds an antigen. The antibody may be a whole antibody and any antigen binding fragment or single chain thereof. Thus, the term "antibody" includes any protein or peptide containing a molecule that comprises at least a portion of an immunoglobulin molecule having biological activity of binding an antigen. Examples include, but are not limited to, Complementarity Determining Regions (CDRs) of a heavy or light chain or ligand binding portions thereof, heavy or light chain variable regions, heavy or light chain constant regions, Framework (FR) regions or any portion thereof, or at least a portion of a binding protein.
As used herein, the term "antibody fragment" or "antigen-binding fragment" is a portion of an antibody, e.g., F (ab')2、F(ab)2Fab', Fab, Fv, scFv, etc. Regardless of structure, an antibody fragment binds to the same antigen recognized by an intact antibody. The term "antibody fragment" includes aptamers, spiegelmers, and diabodies. The term "antibody fragment" also includes any synthetic or genetically engineered protein that functions as an antibody by binding to a particular antigen to form a complex.
"Single chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin. In some aspects, these regions are linked to a short linker peptide of 10 to about 25 amino acids. The linker may be glycine rich for flexibility and serine or threonine rich for solubility, and may link the N-terminus of the VH and the C-terminus of the VL together, or vice versa. This protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker. ScFv molecules are known in the art and described, for example, in U.S. patent No.5,892,019.
The term antibody encompasses a wide variety of classes of polypeptides that can be biochemically distinguished. Those skilled in the art will appreciate that heavy chains are classified as gamma, mu, alpha, delta, or epsilon (gamma, mu, alpha, delta, epsilon), with some subclasses (e.g., gamma l-gamma 4). The nature of this chain determines the "class" of an antibody as IgG, IgM, IgA, IgG or IgE, respectively. The immunoglobulin subclasses (isotypes) (e.g., IgG1, IgG2, IgG3, IgG4, IgG5, etc.) are well characterized and are known to confer functional specialization. Modified forms of each of these classes and isoforms are readily discernible to the skilled artisan in view of the present disclosure and, therefore, are within the scope of the present disclosure. All immunoglobulin classes are clearly within the scope of the present disclosure, but the following discussion will be directed generally to the IgG class of immunoglobulin molecules. With respect to IgG, a standard immunoglobulin molecule comprises two identical light chain polypeptides having a molecular weight of about 23,000 daltons and two identical heavy chain polypeptides having a molecular weight of 53,000 and 70,000. The four chains are typically disulfide-linked in a "Y" configuration, with the light chain ranging from the beginning at the "Y" opening alongside the heavy chain and continuing through to the end of the variable region.
Antibodies, antigen-binding polypeptides, variants or derivatives thereof of the present disclosure include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized or chimeric antibodies, single chain antibodies, epitope-binding fragments, e.g., Fab 'and F (ab')2Fd, Fv, single chain Fv (scFv), single chain antibody, disulfide linked Fv (sdFv), fragment comprising VK or VH domain, fragment produced from a Fab expression library, and anti-idiotypic (anti-Id) antibody (including, e.g., anti-Id antibodies to the LIGHT antibodies disclosed herein). The immunoglobulin or antibody molecules of the present disclosure can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules.
Light chains are classified as either kappa or lambda (K, lambda). Each heavy chain species may be associated with a kappa or lambda light chain. Typically, when an immunoglobulin is produced by a hybridoma, B cell, or genetically engineered host cell, the light and heavy chains are covalently bonded to each other, and the "tail" portions of the two heavy chains are bonded to each other by a covalent disulfide linkage or a non-covalent linkage. In the heavy chain, the amino acid sequence extends from the N-terminus of the bifurcated end of the Y configuration to the C-terminus of the bottom of each chain.
Both the light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used functionally. In this regard, it will be appreciated that the variable domains of the light (VK) and heavy (VH) chain portions determine antigen recognition and specificity. In contrast, the constant domains of the light (CK) and heavy (CH1, CH2, or CH3) chains confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement fixation, and the like. By convention, the numbering of the constant region domains increases as they move away from the antigen binding site or amino terminus of the antibody. The N-terminal part is a variable region, and at the C-terminal part is a constant region; the CH3 and CK domains actually comprise the carboxy-terminal ends of the heavy and light chains, respectively.
As indicated above, the variable regions allow the antibody to selectively recognize and specifically bind to an epitope on the antigen. That is, a subset of the VK domain and VH domain or Complementarity Determining Regions (CDRs) of an antibody are combined to form variable regions that define a three-dimensional antigen binding site. This quaternary antibody structure forms the antigen binding site present at the end of each arm of the Y. More specifically, the antigen binding site is defined by three CDRs (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3) on each of the VH and VK chains. In some cases, certain immunoglobulin molecules, e.g., derived from camelid species or engineered based on camelid immunoglobulins (intact immunoglobulin molecules), may consist of only heavy chains, without light chains. See, e.g., Hamers-Casterman et al, Nature [ Nature ]363: 446-.
In naturally occurring antibodies, the six "complementarity determining regions" or "CDRs" present in each antigen binding domain are short, non-contiguous sequences of amino acids specifically positioned to form the antigen binding domain when the antibody assumes its three-dimensional configuration in an aqueous environment. The remaining amino acids in the antigen binding domain, referred to as the "framework" region, exhibit less intermolecular variability. The framework regions adopt predominantly a β -sheet conformation, and the CDRs form loops that connect, and in some cases form part of, the β -sheet structure. Thus, the framework regions act to form a scaffold that provides for positioning the CDRs in the correct orientation through inter-chain, non-covalent interactions. The antigen binding domain formed by the positioned CDRs defines a surface that is complementary to an epitope on the immunoreactive antigen. This complementary surface facilitates non-covalent binding of the antibody to its cognate epitope. The amino acids that make up the CDRs and framework regions, respectively, can be readily identified for any given heavy or light chain variable region by one of ordinary skill in the art because they have been precisely defined (see www.bioinf.org.uk: Dr. Andrew C.R. Martin group; Sequences of Proteins of immunological Interest [ Sequences of Proteins of immunological Interest ], "Kabat, E., et al U.S. department of Health and Human Services [ US department of Health and public Utilities ], (1983); and Chothia and Lesk, J.MoI.biol. [ journal of molecular biology ],196:901-917 (1987)).
Where there are two or more definitions of a term used and/or accepted in the art, the definition of the term as used herein is intended to include all such meanings unless explicitly stated to the contrary. A specific example is the use of the term "complementarity determining regions" ("CDRs") to describe non-contiguous antigen combining sites found in the variable regions of both heavy and light chain polypeptides. This particular region has been identified by Kabat et al, U.S. department of health and public service, "Sequences of Proteins of immunological Interest" (sequence of Proteins of immunological Interest ] "(1983); and Chothia et al, J.MoI.biol. [ J.M. biol. ]196:901-917(1987), which are incorporated herein by reference in their entirety. The definition of CDRs according to Kabat and Chothia includes overlaps or subsets of amino acid residues when compared to each other. However, applying either definition to refer to the CDRs of an antibody or variant thereof is intended to be within the scope of the terms as defined and used herein. Suitable amino acid residues encompassing the CDRs defined by each of the references cited above are listed in the following table for comparison. The exact number of residues covering a particular CDR will vary depending on the sequence and size of the CDR. Given the variable region amino acid sequence of an antibody, one skilled in the art can routinely determine which residues comprise a particular CDR.
[ Table 1]
Kabat et al also define a numbering system for the variable domain sequences applicable to any antibody. One of ordinary skill in the art can unambiguously assign this "Kabat numbering" system to any variable domain sequence without relying on any experimental data other than the sequence itself. As used herein, "Kabat numbering" refers to the numbering system described by Kabat et al, u.s.dept.of Health and Human Services [ american department of Health and public works ], "Sequence of proteins of Immunological Interest ] (1983).
In addition to the above table, the Kabat numbering system describes the CDR regions as follows: CDR-H1 begins at about amino acid 31 (i.e., about 9 residues after the first cysteine residue), includes about 5-7 amino acids, and ends at the next tryptophan residue. CDR-H2 begins at
The antibodies disclosed herein can be from any animal source, including birds and mammals. Preferably, the antibody is a human, murine, donkey, rabbit, goat, guinea pig, camel, llama, horse or chicken antibody. In another example, the variable region may be derived from the class chondrocystes (e.g. from sharks).
As used herein, the term "heavy chain constant region" includes amino acid sequences derived from immunoglobulin heavy chains. The polypeptide comprising a heavy chain constant region comprises at least one of: a CH1 domain, a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. For example, antigen binding polypeptides for use in the present disclosure may include: a polypeptide chain comprising a CH1 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH2 domain; a polypeptide chain comprising a CH1 domain and a CH3 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH3 domain; or a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, a CH2 domain, and a CH3 domain. In another embodiment, a polypeptide of the disclosure includes a polypeptide chain comprising a CH3 domain. Furthermore, an antibody for use in the present disclosure may lack at least a portion of a CH2 domain (e.g., all or part of a CH2 domain). As described above, it will be understood by those of ordinary skill in the art that the heavy chain constant regions may be modified such that they differ in amino acid sequence from naturally occurring immunoglobulin molecules.
The heavy chain constant regions of the antibodies disclosed herein can be derived from different immunoglobulin molecules. For example, the heavy chain constant region of a polypeptide may comprise a CH1 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule. In another example, the heavy chain constant region may comprise a hinge region derived in part from an IgG1 molecule and in part from an IgG3 molecule. In another example, the heavy chain portion may include a chimeric hinge derived in part from an IgG1 molecule and in part from an IgG4 molecule.
As used herein, the term "light chain constant region" includes amino acid sequences derived from an antibody light chain. Preferably, the light chain constant region comprises at least one of a constant kappa domain or a constant lambda domain.
A "light chain-heavy chain pair" refers to a collection of light and heavy chains that can form a dimer between the CL domain of the light chain and the CH1 domain of the heavy chain through disulfide bonds.
As previously mentioned, the subunit structures and three-dimensional configurations of the constant regions of various immunoglobulin classes are well known. As used herein, the term "VH domain" includes the amino-terminal variable domain of an immunoglobulin heavy chain, and the term "
As used herein, the term "
As used herein, the term "hinge region" includes the portion of the heavy chain molecule that connects the CH1 domain with the CH2 domain. This hinge region comprises about 25 residues and is flexible, thus allowing the two N-terminal antigen-binding regions to move independently. The hinge region can be subdivided into three distinct domains: upper, middle and lower hinge domains (Roux et al, J. Immunol [ J. Immunol ]161:4083 (1998)).
As used herein, the term "disulfide bond" includes a covalent bond formed between two sulfur atoms. The amino acid cysteine contains a thiol group, which can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CH1 and CK regions are linked by disulfide bonds, and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 using the Kabat numbering system (positions 226 or 229, EU numbering system).
As used herein, the term "chimeric antibody" will be taken to mean any antibody in which the immunoreactive region or site is obtained or derived from a first species and the constant region (which may be intact, partial or modified according to the present disclosure) is obtained from a second species. In certain embodiments, the target binding region or site is from a non-human source (e.g., mouse or primate) and the constant region is human.
As used herein, "percent humanization" is calculated by determining the number of framework amino acid differences (i.e., non-CDR differences) between the humanized domain and the germline domain, subtracting that number from the total number of amino acids, then dividing by the total number of amino acids and multiplying by 100.
"specifically binds" or "has specificity for … …" generally means that an antibody binds to an epitope through its antigen binding domain, and that binding requires some complementarity between the antigen binding domain and the epitope. According to this definition, an antibody is considered to "specifically bind" to an epitope when it binds to the epitope via its antigen binding domain more readily than it would bind to a random, unrelated epitope. The term "specificity" is used herein to define the relative affinity of a certain antibody for binding to a certain epitope. For example, antibody "a" can be considered to have a higher specificity for a given epitope than antibody "B"; alternatively, antibody "a" can be described as binding epitope "C" with a higher specificity than for the relevant epitope "D". Preferably, the antibody binds to the antigen (or epitope) with "high affinity", i.e., a KD of 1 × 10-7M or less, more preferably 5X10-8M or less, more preferably 3X 10-8M or less, more preferably 1X 10-8M or less, still more preferably 25X 10-9M is less or even more preferably 1X 10-9M or less.
As used herein, the term "treatment" can refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the progression of cancer. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "treatment" may also mean prolonging survival compared to that expected if treatment was not received. Patients in need of treatment include patients already with the condition or disorder, as well as patients susceptible to the condition or disorder, or patients for whom the condition or disorder is to be prevented.
A "subject" or "individual" or "animal" or "patient" or "mammal" may refer to any subject, particularly a mammalian subject, in need of diagnosis, prognosis or treatment. Mammalian subjects include humans, domestic animals, farm animals, and zoo, sports, or pet animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cows, etc.
As used herein, phrases such as "to a patient in need of treatment" or "subject in need of treatment" include subjects (e.g., mammalian subjects) that would benefit from administration of an antibody or composition of the disclosure, e.g., for detection, for diagnostic procedures, and/or for treatment.
The present disclosure provides anti-PD-
The anti-PD-
anti-PD-L1 antibody
The anti-PD-
The PD-L1 protein is a
In particular, the anti-PD-L1 antibody or fragment thereof comprised in the bispecific antibody may specifically bind to the immunoglobulin c (igc) domain of the PD-L1 protein. In the case of the human PD-L1 protein, the Ig C domain comprises or essentially consists of amino acid residue 133-225 of the full-length human PD-L1 protein. More specifically, the anti-PD-L1 antibody or fragment thereof may bind to at least one selected from amino acid residues Y134, K162, and N183 of the human PD-L1 protein. In some embodiments, the anti-PD-L1 antibody or fragment thereof can bind to at least two selected from amino acid residues Y134, K162, and N183 of human PD-L1 protein. In some embodiments, the anti-PD-L1 antibody or fragment thereof does not bind to the immunoglobulin v (IgV) domain of PD-L1 protein, wherein the IgV domain consists of amino acid residues 19-127 of human PD-L1 protein.
In one embodiment, antibodies and fragments thereof are provided that are capable of specifically binding to human PD-L1 protein. These antibodies are useful for therapeutic purposes, e.g., treatment of various types of cancer, infection (inflammation), etc., and also for diagnostic and prognostic purposes.
The anti-PD-L1 antibody or fragment thereof may comprise: (1) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO: 61-67; (2) VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:68-77 and 525-527; (3) a VH CDR3 having an amino acid sequence selected from the group consisting of
[ Table 2] CDRs of anti-PD-L1 antibody
In some embodiments, the antibody or fragment thereof comprises no more than one, no more than two, or no more than three of the substitutions described above. In some embodiments, the antibody or fragment thereof comprises VH CDR1 of SEQ ID NO.1 or any of SEQ ID NO. 61-67, VH CDR2 of SEQ ID NO.2, 525, 526 or 527, VH CDR3 of SEQ ID NO.3, VL CDR1 of SEQ ID NO.4, VL CDR2 of SEQ ID NO.5, and VL CDR3 of SEQ ID NO. 6.
In some embodiments, the antibody or fragment thereof comprises VH CDR1 of SEQ ID NO.1, VH CDR2 of SEQ ID NO.2 or any of SEQ ID NO. 68-77, 525, 526 or 527, VH CDR3 of SEQ ID NO.3, VL CDR1 of SEQ ID NO.4, VL CDR2 of SEQ ID NO.5, and VL CDR3 of SEQ ID NO. 6.
In some embodiments, the antibody or fragment thereof comprises VH CDR1 of SEQ ID NO.1, VH CDR2 of SEQ ID NO.2, 525, 526 or 527, VH CDR3 of any of SEQ ID NO.3 or SEQ ID NO. 78-90 and 513-519, VL CDR1 of SEQ ID NO.4, VL CDR2 of SEQ ID NO.5, and VL CDR3 of SEQ ID NO. 6.
In some embodiments, the antibody or fragment thereof comprises VH CDR1 of SEQ ID NO.1, VH CDR2 of SEQ ID NO.2, 525, 526 or 527, VH CDR3 of SEQ ID NO.3, VL CDR1 of any of SEQ ID NO.4 or SEQ ID NO. 91-92 and 520-521, VL CDR2 of SEQ ID NO.5, and VL CDR3 of SEQ ID NO. 6.
In some embodiments, the antibody or fragment thereof comprises VH CDR1 of SEQ ID NO.1, VH CDR2 of SEQ ID NO.2, 525, 526 or 527, VH CDR3 of SEQ ID NO.3, VL CDR1 of SEQ ID NO.4, VL CDR2 of any of SEQ ID NO.5 or SEQ ID NO. 93-105, and VL CDR3 of SEQ ID NO. 6.
In some embodiments, the antibody or fragment thereof comprises VH CDR1 of SEQ ID NO.1, VH CDR2 of SEQ ID NO.2, 525, 526 or 527, VH CDR3 of SEQ ID NO.3, VL CDR1 of SEQ ID NO.4, VLCDR2 of SEQ ID NO.5, and VL CDR3 of any one of SEQ ID NO.6 or SEQ ID NO. 106-.
For example, an anti-PD-L1 antibody or fragment thereof can comprise: VH CDR1 having the amino acid sequence of
In some embodiments, provided are anti-PD-L1 antibodies or fragments thereof comprising: a VH CDR1 having the amino acid sequence of SEQ ID NO: 1; VH CDR2 having the amino acid sequence of SEQ ID NO: 525; a VH CDR3 having the amino acid sequence of SEQ ID NO. 3; VL CDR1 having the amino acid sequence of SEQ ID NO. 4; VL CDR2 having the amino acid sequence of SEQ ID NO. 5; and a VL CDR3 having the amino acid sequence of
In some embodiments, provided are anti-PD-L1 antibodies or fragments thereof comprising: a VH CDR1 having the amino acid sequence of SEQ ID NO: 1; VH CDR2 having the amino acid sequence of SEQ ID NO: 526; VH CDR3 having the amino acid sequence of SEQ ID NO: 515; VL CDR1 having the amino acid sequence of SEQ ID NO. 4; VL CDR2 having the amino acid sequence of SEQ ID NO. 5; and a VL CDR3 having the amino acid sequence of
Non-limiting examples of VH (heavy chain variable region) are provided in SEQ ID NOS:7-26, 113, 493, 495, 497, 499, 501, 503, 505, 507, 509, and 511, where SEQ ID NO:113 is a mouse VH, SEQ ID NO:7-26 is a humanized sequence, and SEQ ID NO:493, 495, 497, 499, 501, 503, 505, 507, 509, and 511 are affinity matured sequences of humanized antibodies. Furthermore, in the humanized VH, SEQ ID NOs 9-15, 17-21 and 23-26 include one or more back mutations to the mouse form. Likewise, non-limiting examples of VL (VK; light chain (kappa-type) variable regions) are provided in SEQ ID NOs 27-33, 494, 496, 498, 500, 502, 504, 506, 508, 510, and 512. 28 and 30 are the original derived, CDR-grafted and humanized sequences as shown in the examples, and 29 and 31-33 are humanized VLs with back mutations.
Back mutations can be used to retain certain characteristics of anti-PD-L1 antibodies. In some embodiments, an anti-PD-L1 antibody of the disclosure, particularly human or humanized, can comprise one or more back mutations. In some embodiments, the back mutation (i.e., the amino acid included at the specified position) in the heavy chain variable region (VH) is one or more selected from the group consisting of: according to Kabat numbering, the heavy chain variable region is (a) Ser at position 44, (b) Ala at position 49, (c) Ala at position 53, (d) Ile at position 91, (e) Glu at
In some embodiments, the back mutation in the light chain variable region (VL) is one or more selected from the group consisting of: according to Kabat numbering, the light chain variable region is (a) Ser at position 22, (b) gin at position 42, (c) Ser at position 43, (d) Asp at
In some embodiments, an anti-PD-L1 antibody or fragment thereof of the disclosure may comprise: a VH selected from SEQ ID NOs 7-26, 113, 493, 495, 497, 499, 501, 503, 505, 507, 509, and 511, a VL selected from SEQ ID NOs 27-33, 494, 496, 498, 500, 502, 504, 506, 508, 510, and 512, or their respective biological equivalents as described above. Biological equivalents of VH and/or VL can have amino acid sequences that comprise specified amino acids (e.g., CDRs) while having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity. For example, a biological equivalent of SEQ ID NO:20 can be a VH having overall 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:20 but retaining the CDRs (SEQ ID NO:1-6 or variants thereof), and optionally retaining one or more or all back mutations.
Non-limiting examples of antibodies or fragments thereof may comprise: a heavy chain variable region comprising or consisting essentially of the amino acid sequence of
In some embodiments, the anti-PD-L1 antibody or fragment thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the light chain constant region can be a kappa or lambda chain constant region. In some embodiments, the antibody is an isotype of IgG, IgM, IgA, IgE, or IgD (e.g., human IgG, human IgM, human IgA, human IgE, or human IgD). In some embodiments, the isotype can be IgG, e.g., human IgG, e.g., IgG1, IgG2, IgG3, or
Without limitation, the anti-PD-L1 antibody or fragment thereof is a chimeric, humanized, or fully human antibody. In one aspect, the antibody or fragment thereof is not naturally occurring, or is chemically or recombinantly synthesized.
Given that each of these antibodies can bind to PD-L1 (e.g., human PD-L1), CDR sequences or VHAnd VLSequences can be "mixed and matched" toGenerating other anti-LAG-3 binding molecules of the disclosure. Preferably, when the CDR sequence or VHAnd VLWhen chains are mixed and matched, e.g. from a particular VH/VLPaired VHV whose sequence is structurally similarHAnd (4) replacing the sequence. Also, preferably, from a particular VH/VLPaired VLV whose sequence is structurally similarLAnd (4) replacing the sequence.
anti-LAG 3 antibodies
The anti-PD-
In one embodiment, antibodies and fragments thereof are provided that can specifically bind LAG3 (e.g., human LAG3) protein. For example, an anti-LAG 3 antibody or fragment thereof can bind the extracellular domain of LAG-3.
For example, the human LAG3 protein may be selected from the group consisting of proteins represented by GenBank accession No. NP _002277.4 and the like, but may not be limited thereto. These anti-LAG 3 antibodies are useful for therapeutic purposes, such as treating various types of cancer, infection (inflammation), and the like, and also for diagnostic and prognostic purposes.
The term "LAG-3" or "
As demonstrated in the experimental examples, some of the anti-LAG-3 antibodies disclosed herein exhibit activities not shown with known anti-LAG-3 antibodies. For example, antibodies of the disclosure may inhibit the binding of LAG-3 protein to galectin-3 (LGALS3) and C-type
These anti-LAG 3 antibodies are useful for therapeutic purposes, such as treating various types of cancer, infection (inflammation), and the like, and also for diagnostic and prognostic purposes.
In one embodiment, an antibody or fragment thereof capable of having specificity for human LAG3 protein is provided. The anti-LAG 3 antibody or fragment thereof may comprise: (i) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460; (ii) a VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467; (iii) a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs: 120-160, 356 and 468-475; (iv) VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490; (v) VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and (vi) a VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs: 218, 230, 253, 359 and 484, 489. For example, an anti-LAG 3 antibody or fragment thereof may comprise: VH CDR1 having the amino acid sequence of SEQ ID NO: 354; VH CDR2 having the amino acid sequence of SEQ ID NO:355 or 461; VH CDR3 having an amino acid sequence of SEQ ID NO 356 or 468; VL CDR1 having the amino acid sequence of SEQ ID NO:357 or 490; VL CDR2 having the amino acid sequence of SEQ ID NO 358; and a VL CDR3 having the amino acid sequence of SEQ ID NO 359 or 488.
[ Table 3] CDRs of
In a non-limiting example, an antibody or fragment specific for LAG3 has a combination of VH CDR1, VH CDR2, VHCDR3, VL CDR1, VL CDR2, and VL CDR3 as set forth in any of the antibodies listed in table 27. For example, the CDR may be a CDR from 147H3807 comprising the VH CDR1 of SEQ ID NO:354, the VH CDR2 of SEQ ID NO:461, the VH CDR3 of SEQ ID NO:468, the VL CDR1 of SEQ ID NO:490, the VL CDR2 of SEQ ID NO:358, and the VL CDR3 of SEQ ID NO: 488. Variants of these antibodies, e.g., variants of antibodies having at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% sequence identity to the heavy/light chain variable region and retaining the corresponding CDR sequences, are also provided.
In one embodiment, for example, there is provided an antibody or antigen-binding fragment thereof specific for human LAG3 protein and comprising: a heavy chain variable region comprising the amino acid sequence of SEQ ID No. 443 or a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID No. 443 and having a VH CDR1 comprising the amino acid sequence of SEQ ID No. 354, a VH CDR2 comprising the amino acid sequence of SEQ ID No. 461, and a VH CDR3 comprising the amino acid sequence of SEQ ID No. 468; and a light chain variable region comprising the amino acid sequence of SEQ ID NO:444 or a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:444 and having a VL CDR1 comprising the amino acid sequence of SEQ ID NO:490, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:358, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 488.
In a non-limiting example of an anti-LAG 3 antibody or fragment thereof,
(1) the heavy chain variable region may comprise or consist essentially of a polypeptide having an amino acid sequence of the group consisting of seq id no:254, 352, 360, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, and 491 or may comprise or consist essentially of a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the above amino acid sequences; and/or
(2) The light chain variable region may comprise or consist essentially of a polypeptide having an amino acid sequence of the group consisting of seq id no:303-351, 353, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452 and 492, or may comprise or consist essentially of a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequences described above.
Non-limiting examples of
For humanized antibodies or fragments, certain back mutations may be incorporated. In some embodiments, the heavy chain variable region comprises one or more amino acid residues selected from the group consisting of:
(a) ala at position 71 (A),
(b) leu (L) at position 69,
(c) lys (K) at position 66,
(d) ala at position 67 (A),
(e) ile (i) at position 48;
(f) ile (I) at position 37,
(g) lys (K) at position 38,
(h) phe (F) in position 91, and
(i) glu (E) at
In some embodiments, the heavy chain variable region comprises ala (a) at position 71. In some embodiments, the heavy chain variable region comprises leu (l) at position 69. In some embodiments, the heavy chain variable region comprises lys (k) at position 66. In some embodiments, the heavy chain variable region comprises ala (a) at position 67. In some embodiments, the heavy chain variable region comprises ile (i) at position 48. In some embodiments, the heavy chain variable region comprises ile (i) at position 37. In some embodiments, the heavy chain variable region comprises lys (k) at position 38. In some embodiments, the heavy chain variable region comprises a phe (f) at position 91. In some embodiments, the heavy chain variable region comprises glu (e) at
In some embodiments, the heavy chain variable region comprises one or more amino acid residues selected from the group consisting of
(a) Ala at position 71 (A),
(b) leu (L) at position 69,
(c) lys (K) at position 66,
(d) ala at position 67 (A),
(e) ile (i) at position 48;
(f) ile (I) at position 37, and
(g) lys (K) at position 38, and combinations thereof. In some embodiments, the heavy chain variable region comprises all of the above residues.
Antibodies of the present disclosure are characterized by a particular functional characteristic or property of the antibody. For example, the antibody specifically binds human LAG-3, and may bind LAG-3 from some other species, e.g., monkey LAG-3, e.g., cynomolgus monkey, rhesus monkey, but may not substantially bind LAG-3 from some other species (e.g., mouse LAG-3). Preferably, the antibodies of the present disclosure bind human LAG-3 with high affinity.
The ability of an antibody to stimulate an immune response, e.g., an antigen-specific T cell response, can be indicated by, e.g., the ability of the antibody to stimulate the production of interleukin-2 (IL-2) or interferon gamma (IFN- γ) in the antigen-specific T cell response. In certain embodiments, the antibodies of the disclosure bind human LAG-3 and exhibit the ability to stimulate an antigen-specific T cell response. In other embodiments, antibodies of the disclosure bind human LAG-3, but do not exhibit the ability to stimulate an antigen-specific T cell response. Other means of assessing the ability of an antibody to stimulate an immune response include: such as the ability of an antibody to inhibit tumor growth, or the ability of an antibody to stimulate an autoimmune response, in an in vivo tumor graft model, such as the ability to promote the development of an autoimmune disease in an autoimmune model, such as the ability to promote the development of diabetes in an NOD mouse model.
Binding of the antibodies of the present disclosure to LAG-3 can be assessed using one or more techniques well established in the art. For example, in a preferred embodiment, the assay can be by flow cytometry assayAn antibody, wherein the antibody reacts with a cell line expressing human LAG-3 (e.g., CHO cells that have been transfected to express LAG-3, e.g., human LAG-3 or monkey LAG-3 (e.g., rhesus monkey or cynomolgus monkey LAG-3) or mouse LAG-3, on their cell surface). Other suitable cells for flow cytometry assays include anti-CD 3-stimulated CD4+An activated T cell that expresses native LAG-3. Additionally or alternatively, binding of an antibody can be tested in a BIAcore binding assay, including binding kinetics (e.g., K)DValue). Still other suitable binding assays include ELISA assays using, for example, recombinant LAG-3 protein. Preferably, the antibodies of the disclosure are at 5 × 10-8K of M or lessDBind LAG-3 protein at 2X 10-8K of M or lessDBind LAG-3 protein at 5X10-9K of M or lessDBind LAG-3 protein at 4X 10-9K of M or lessDBind LAG-3 protein at 3X 10-9K of M or lessDBind LAG-3 protein at 2X 10- 9K of M or lessDBind LAG-3 protein at 125X 10-9K of M or lessDBind LAG-3 protein at 5X10-10K of M or lessDBinding to LAG-3 protein, or at 1X 10-10K of M or lessDBinds to LAG-3 protein.
In some embodiments, the anti-LAG 3 antibody or fragment thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the light chain constant region can be a kappa or lambda chain constant region. In some embodiments, the antibody is an isotype of IgG, IgM, IgA, IgE, or IgD (e.g., human IgG, human IgM, human IgA, human IgE, or human IgD). In some embodiments, the isotype can be IgG, e.g., human IgG, e.g., IgG1, IgG2, IgG3, or
Without limitation, the anti-LAG 3 antibody or fragment thereof is a chimeric, humanized, or fully human antibody. In one aspect, the antibody or fragment thereof is not naturally occurring, or is chemically or recombinantly synthesized.
Whereas each of these antibodies may bind LAG-3 (e.g., human LAG-3), CDR sequences or VHAnd VLThe sequences may be "mixed and matched" to produce other anti-LAG-3 binding molecules of the present disclosure. Preferably, when the CDR sequence or VHAnd VLWhen chains are mixed and matched, e.g. from a particular VH/VLPaired VHV whose sequence is structurally similarHAnd (4) replacing the sequence. Also, preferably, from a particular VH/VLPaired VLV whose sequence is structurally similarLAnd (4) replacing the sequence.
anti-PD-
In a bispecific antibody comprising a PD-L1 targeting moiety and a LAG3 targeting moiety, one of the PD-L1 targeting moiety and the LAG3 targeting moiety may be a full-length antibody, and the other may be an antigen-binding fragment (e.g., scFv) comprising heavy chain CDRs, light chain CDRs, or a combination thereof. A full-length antibody targeting one of the PD-L1 and LAG3 proteins and an antigen-binding fragment targeting the other protein may be chemically linked (e.g., covalently linked) either directly or through a peptide linker. An antigen-binding fragment (e.g., an scFv) can be linked, either directly or through a peptide linker, to the N-terminus of a full-length antibody (e.g., the N-terminus of a light chain or heavy chain of a full-length antibody), the C-terminus of a full-length antibody (e.g., the C-terminus of a heavy chain (or Fc or CH3 domain) of a full-length antibody), or both (see fig. 32).
In one embodiment, a bispecific antibody may comprise a full-length anti-PD-L1 antibody, an antigen-binding fragment (e.g., scFv) of an anti-LAG 3 antibody, and a peptide linker therebetween. In other embodiments, the bispecific antibody may comprise a full-length anti-LAG 3 antibody, an antigen-binding fragment (e.g., scFv) of an anti-PD-L1 antibody, and a peptide linker therebetween.
In one embodiment, the scFv comprised in the bispecific antibody may comprise a heavy chain variable region and a light chain variable region in any order. For example, the scFv comprised in the bispecific antibody may comprise the heavy chain variable region and the light chain variable region, and optionally a peptide linker therebetween, in the N-terminal to C-terminal direction, or alternatively, the scFv comprised in the bispecific antibody may comprise the light chain variable region and the heavy chain variable region, and optionally a peptide linker therebetween, in the N-terminal to C-terminal direction.
The use of peptide linkers for bispecific antibodies can result in antibodies of high purity.
As used herein, the term "peptide linker" may be those comprising any amino acid from 1 to 100, in particular from 2 to 50, and may comprise any kind of amino acid without any limitation. The peptide linker may comprise, for example, Gly, Asn and/or Ser residues, and also neutral amino acids, such as Thr and/or Ala. Amino acid sequences suitable for use in a peptide linker may be those known in the relevant art. Meanwhile, the length of the peptide linker can be variously determined within such a limit that the function of the fusion protein is not affected. For example, a peptide linker may be formed by including a total of about 1 to about 100, about 2 to about 50, or about 5 to about 25 one or more selected from the group consisting of Gly, Asn, Ser, Thr, and Ala. In one embodiment, the peptide linker may be represented as (G)mSl)n(m, l and n are independently an integer of from about 1 to about 10, particularly from about 2 to about 5). For example, examples of peptide linkers are summarized below:
in another embodiment, the PD-L1 targeting moiety and the LAG3 targeting moiety may both be full length antibodies or antigen binding fragments comprising heavy chain CDRs, light chain CDRs, or a combination thereof.
In another embodiment, the bispecific antibody may be in a heterodimeric form comprising a first arm comprising a pair of a first heavy chain and a first light chain targeting one of PD-L1 and LAG3, and a second arm comprising a pair of a second heavy chain and a second light chain targeting the other.
In one embodiment, the full-length antibody can be in the form of a full-length immunoglobulin (e.g., IgG, IgM, IgA, IgE, or IgD, e.g., human IgG, human IgM, human IgA, human IgE, or human IgD), and the antigen-binding fragment can be selected from the group consisting of Fab, Fab ', F (ab')2Fd, Fv, scFv, single-chain antibody, sdFv, etc., as described above. For example, the full-length antibody may be in the form of a full-length human IgG (human IgG1, human IgG2, human IgG3, or human IgG4), and the antigen-binding fragment may be an scFv.
For example, the antibodies described herein may comprise a flexible linker sequence, or may be modified to add a functional moiety (e.g., PEG, drug, toxin, or label).
In some embodiments, bispecific or multispecific antibodies are provided comprising an anti-PD-L1 antibody or antigen-binding fragment thereof and an anti-LAG 3 antibody or antigen-binding fragment thereof, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof is capable of specifically binding to the immunoglobulin C (Ig C) domain of human programmed death ligand 1(PD-L1) protein, wherein the Ig C domain consists of amino acid residues 133-225; and the anti-LAG 3 antibody or antigen-binding fragment thereof is capable of binding to MHC class II molecules and/or
In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises: a VH CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 1 and 61-67; a VH CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 68-77 and 525-527; a VH CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 3, 78-90 and 513-519; a VL CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 4, 91-92 and 520-521; a VL CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 5 and 93-105; and a VLCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 6, 106-111 and 522-524, and the anti-LAG 3 antibody or antigen-binding fragment thereof comprises: a VH CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 116-117, 354 and 453-460; a VH CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 118-119, 355 and 461-467; a VH CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 120-160, 356 and 468-475; VL CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 163-195, 229, 357 and 490; VL CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 196-217, 358 and 476-483; and a VL CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 218-228, 230-253, 359, and 484-489.
In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises: a VH CDR1 having the amino acid sequence of SEQ ID NO: 1; VH CDR2 having the amino acid sequence of SEQ ID NO: 525; a VH CDR3 having the amino acid sequence of SEQ ID NO. 3; VL CDR1 having the amino acid sequence of SEQ ID NO. 4; VL CDR2 having the amino acid sequence of SEQ ID NO. 5; and a VL CDR3 having the amino acid sequence of SEQ ID No.6, and an anti-LAG 3 antibody or antigen-binding fragment thereof comprising: VH CDR1 comprising the amino acid sequence of SEQ ID NO. 354, VH CDR2 comprising the amino acid sequence of SEQ ID NO. 461, VH CDR3 comprising the amino acid sequence of SEQ ID NO. 468, VL CDR1 comprising the amino acid sequence of SEQ ID NO. 490, VL CDR2 comprising the amino acid sequence of SEQ ID NO. 358, and VL CDR3 comprising the amino acid sequence of SEQ ID NO. 488.
In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises: a VH CDR1 having the amino acid sequence of SEQ ID NO: 1; VH CDR2 having the amino acid sequence of SEQ ID NO: 526; VH CDR3 having the amino acid sequence of SEQ ID NO: 515; VL CDR1 having the amino acid sequence of SEQ ID NO. 4; VL CDR2 having the amino acid sequence of SEQ ID NO. 5; and a VL CDR3 having the amino acid sequence of SEQ ID No.6, and an anti-LAG 3 antibody or antigen-binding fragment thereof comprising: VH CDR1 comprising the amino acid sequence of SEQ ID NO. 354, VH CDR2 comprising the amino acid sequence of SEQ ID NO. 461, VH CDR3 comprising the amino acid sequence of SEQ ID NO. 468, VL CDR1 comprising the amino acid sequence of SEQ ID NO. 490, VL CDR2 comprising the amino acid sequence of SEQ ID NO. 358, and VL CDR3 comprising the amino acid sequence of SEQ ID NO. 488. The antibodies or variants described herein may include derivatives that are modified, for example, by: any type of molecule is covalently attached to the antibody such that the covalent attachment does not interfere with the binding of the antibody to the antigen (e.g., epitope). For example, but not by way of limitation, an antibody may be modified, for example, by at least one means selected from the group consisting of: glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, attachment to cellular ligands or other proteins, and the like. Any of a number of chemical modifications may be made by known techniques, including but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. In addition, the antibody may comprise one or more non-canonical amino acids.
The antibody or fragment thereof may be detectably labeled by labeling (coupling) with a conventional labeling material selected from chemiluminescent compounds, fluorescent compounds (e.g., a fluorescent emitting metal), radioisotopes, dyes, and the like. The presence of the tagged antibody or fragment thereof can be detected by measuring the signal generated during the chemical reaction between the antibody (or fragment thereof) and the labeling substance. Examples of particularly useful marking materials may be at least one selected from the group consisting of: luminol, isoluminol, thermostable acridinium esters, imidazoles, acridinium salts, oxalate esters, fluorescence emitting metals, and the like. For example, the fluorescence emitting metal may be152Eu, or other lanthanide metals. These metals can be attached to the antibody using metal chelating groups such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
In certain embodiments, bispecific antibodies are prepared that do not elicit a deleterious immune response in the animal (e.g., human) to be treated. In one embodiment, the bispecific antibody can be modified to reduce its immunogenicity using any conventional technique. For example, the bispecific antibody can be a humanized, primatized, deimmunized or chimeric antibody. These types of antibodies are derived from non-human antibodies, typically murine or primate antibodies, which retain or substantially retain the antigen binding properties of the parent antibody but are less immunogenic in humans. This can be achieved by various methods, including (a) grafting the entire non-human variable domain onto a human constant region to produce a chimeric antibody; (b) grafting at least a portion of one or more non-human Complementarity Determining Regions (CDRs) into a human framework and constant region, with or without retention of critical framework residues; or (c) transplanting whole non-human variable domains, but "stealth" them with human-like parts by replacing surface residues.
Deimmunization may also be used to reduce the immunogenicity of antibodies. As used herein, the term "deimmunization" can include altering an antibody to modify a T cell epitope (see, e.g., International application publication Nos.: WO/
The binding specificity and/or affinity of the bispecific antibody for each target protein can be determined by any conventional assay, such as, but not limited to, an in vitro assay, e.g., immunoprecipitation, Radioimmunoassay (RIA), or enzyme-linked immunosorbent assay (ELISA).
Alternatively, the techniques used to generate single stranded units (U.S. patent No.4,694,778, etc.) can be adapted to generate single stranded units of the present disclosure. The heavy and light chain fragments of the Fv region are joined by an amino acid bridge (peptide linker) to produce a single chain fusion peptide (scFv) to form a single chain unit. Techniques for assembling functional Fv fragments in E.coli can also be used.
Examples of techniques that can be used to produce single chain fv (scfv) and antibodies include those described in U.S. Pat. nos. 4,946,778, 5,258,498, and the like. For some uses, including the use of antibodies in vivo and in vitro detection assays in humans, it may be preferred to use chimeric, humanized or human antibodies. Chimeric antibodies are molecules in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods of producing chimeric antibodies are known in the art. See, for example, U.S. patent nos. 5,807,715, 4,816,567, and 4,816,397, which are incorporated herein by reference in their entireties.
Humanized antibodies are antibody molecules derived from antibodies of non-human species that bind the desired antigen, having one or more Complementarity Determining Regions (CDRs) from the non-human species and framework regions from human immunoglobulin molecules. Framework residues in human framework regions will often be substituted with corresponding residues from a CDR donor antibody in order to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interaction of the CDRs and framework residues to identify framework residues important for antigen binding and sequence comparison to identify aberrant framework residues at specific positions (see, e.g., Queen et al, U.S. patent No.5,585,089, which is incorporated herein by reference in its entirety). Antibodies can be humanized using a variety of techniques known in the art, including, for example, CDR-grafting (U.S. Pat. nos. 5,225,539, 5,530,101, 5,585,089, etc., each of which is incorporated by reference in its entirety), veneering or resurfacing (EP 592,106; EP 519,596, each of which is incorporated by reference in its entirety), and chain shuffling (U.S. Pat. No.5,565,332, which is incorporated by reference in its entirety).
Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences also see U.S. Pat. nos. 4,444,887, 4,716,111, and the like, each of which is incorporated herein by reference in its entirety.
Human antibodies can also be produced using transgenic mice that are incapable of expressing functional endogenous immunoglobulins, but that express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced into mouse embryonic stem cells, either randomly or by homologous recombination. Alternatively, in addition to human heavy and light chain genes, human variable, constant and diversity regions (diversity regions) may be introduced into mouse embryonic stem cells. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional alone or by homologous recombination while introducing the human immunoglobulin locus. Specifically, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells were expanded and microinjected into the embryo sac to generate chimeric mice. The chimeric mice are then bred to produce homozygous progeny expressing human antibodies. Transgenic mice are immunized in the normal manner with a selected antigen, e.g., all or part of a desired target polypeptide. Monoclonal antibodies directed against the antigen can be obtained from immunized transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes possessed by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using this technique, it is possible to produce therapeutically useful IgG, IgA, IgM, and IgE antibodies.
Fully human antibodies that recognize selected epitopes can also be generated using a technique known as "guided selection". In this method, a selected non-human monoclonal antibody (e.g., a mouse antibody) is used to direct the selection of a fully human antibody that recognizes the same epitope.
In another example, DNA encoding the desired monoclonal antibody can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Isolated and subcloned hybridoma cells are used as a preferred source of such DNA. Once isolated, the DNA can be placed into an expression vector and then transfected into prokaryotic or eukaryotic host cells that do not otherwise produce immunoglobulins, such as e.g., e.coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells. More specifically, isolated DNA (which may be synthesized as described herein) may be used to clone constant and variable region sequences to make antibodies, as described in U.S. patent No.5,658,570 to Newman et al, which is incorporated herein by reference. Essentially, this requires extraction of RNA from selected cells, conversion to cDNA, and amplification by PCR using Ig-specific primers. Suitable primers for this purpose are also described in U.S. Pat. No.5,658,570. As will be discussed in more detail below, transformed cells expressing the desired antibody can be grown in relatively large quantities to provide a clinical and commercial supply of immunoglobulin.
In addition, using conventional recombinant DNA techniques, one or more CDRs of the bispecific antibody can be inserted into a framework region, e.g., into a human framework region, to humanize the non-human antibody. The framework regions may be naturally occurring or consensus framework regions, and are preferably human framework regions (see, e.g., Chothia et al, J.mol.biol. [ J.Mol.Biol. [ J.Mol. ]278:457-479 (1998)). For example, the polynucleotides produced by the combination of framework regions and CDRs encode antibodies that specifically bind to at least one epitope of a desired polypeptide (e.g., LIGHT). Preferably, one or more amino acid substitutions may be made within the framework regions, and preferably the amino acid substitutions improve binding of the antibody to its antigen (or epitope). In addition, such methods can be used to make amino acid substitutions or deletions of one or more variable region cysteine residues involved in an intrachain disulfide bond to produce an antibody molecule lacking one or more intrachain disulfide bonds. Other variations on the polynucleotides are encompassed by the present disclosure and are within the skill of the art.
In addition, techniques developed for producing "chimeric antibodies" by splicing together genes from mouse antibody molecules with appropriate antigen specificity and genes from human antibody molecules with appropriate biological activity can be used. As used herein, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as an antibody having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region.
Alternatively, antibody-producing cell lines can be selected and cultured using techniques well known to the skilled artisan. Such techniques are described in various laboratory manuals and major publications.
In addition, standard techniques known to those skilled in the art, including but not limited to site-directed mutagenesis to generate amino acid substitutions and PCR-mediated mutagenesis, can be used to introduce mutations into the nucleotide sequences encoding the antibodies of the disclosure. Preferably, the variant (including derivatives) encodes less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to a reference variable heavy chain region, CDR-H1, CDR-H2, CDR-H3, variable light chain region, CDR-L1, CDR-L2, or CDR-L3. Alternatively, mutations can be introduced randomly along all or part of the coding sequence by, for example, saturation mutagenesis, and the resulting mutants can be screened for biological activity to identify mutants that retain activity.
Therapeutic uses of antibodies
The bispecific antibodies provided herein are capable of simultaneously blocking the activity of PD-L1 and LAG3, thereby exhibiting improved efficacy in immunotherapy and/or cancer therapy by, for example, activating an immune response (see fig. 33). In view of the ability of the bispecific antibodies of the disclosure to inhibit the binding of LAG-3 to MHC class II molecules and stimulate antigen-specific T cell responses, the disclosure also provides compositions or in vitro and in vivo methods of using the antibodies of the disclosure to stimulate, enhance or up-regulate antigen-specific T cell responses.
One embodiment provides a pharmaceutical composition comprising a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody as described above. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier. The pharmaceutical compositions may be used to stimulate an immune response (e.g., an antigen-specific T cell response), and/or to treat and/or prevent a disease associated with PD-L1, LAG3, or both.
Another embodiment provides a method of stimulating an immune response (e.g., an antigen-specific T cell response) and/or treating and/or preventing a disease associated with PD-L1, LAG3, or both in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a bispecific antibody, an anti-PD-L1 antibody or an anti-LAG 3 antibody, or a pharmaceutical composition. The method may further comprise the step of identifying a subject in need of treatment and/or prevention of a disease associated with PD-L1, LAG3, or both, prior to the step of administering.
Diseases associated with PD-L1, LAG3, or both, may be selected from cancer (or tumors), infectious diseases, autoimmune reactions, neurological disorders, and the like.
In one embodiment, the subject may be selected from a mammal, including a human, such as a mammal (e.g., a human) having cancer and/or infected mammalian cells. In other embodiments, the subject may be a cell isolated (sequestered) from a mammal, e.g., a mammal having a disease selected from cancer, an infectious disease, an autoimmune response, a nervous system disorder, etc. (the cell is, e.g., a cancer cell, or a cell isolated (sequestered) from an infected area of a mammal, or a T cell such as a tumor infiltrating T lymphocyte, CD4+ T cell, CD8+ T cell, or a combination thereof).
Another embodiment provides the use of a bispecific antibody, an anti-PD-L1 or anti-LAG 3 antibody or pharmaceutical composition in the treatment and/or prevention of cancer or infection. Another embodiment provides the use of a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody in the manufacture of a pharmaceutical composition for the treatment and/or prevention of cancer or infection.
In the pharmaceutical compositions, methods and/or uses provided herein, the disease associated with PD-L1, LAG3, or both, can be a disease associated with activation (e.g., aberrant activation or overactivation) and/or overproduction (overexpression) of PD-L1, LAG3, or both. For example, the disease may be cancer or an infection.
The cancer may be a solid cancer or a blood cancer, preferably a solid cancer. The cancer may be any tumor expressing PD-L1 protein and may be selected from the group consisting of: bladder cancer, liver cancer, colon cancer, rectal cancer, endometrial cancer, leukemia, lymphoma, pancreatic cancer, lung cancer (e.g., small cell lung cancer, non-small cell lung cancer, etc.), breast cancer, urinary tract cancer, head and neck cancer, gastrointestinal cancer, gastric cancer, esophageal cancer, ovarian cancer, kidney cancer, melanoma, prostate cancer, thyroid cancer, and the like, but may not be limited thereto. In some embodiments, the cancer is selected from the group consisting of: bladder cancer, liver cancer, pancreatic cancer, non-small cell lung cancer, breast cancer, urinary tract cancer, colorectal cancer, head and neck cancer, squamous cell cancer, Merkel (Merkel) cell cancer, gastrointestinal cancer, gastric cancer, esophageal cancer, ovarian cancer, renal cancer, small cell lung cancer, and the like. The cancer may be a primary or metastatic cancer.
The specific dosage and treatment regimen for any particular patient will depend upon a variety of factors including the particular antibody, variant or derivative thereof employed, the age, body weight, general health, sex and diet of the patient, and the time of administration, rate of excretion, drug combination, and the severity of the particular disease being treated. Judgment of such factors by a medical caregiver is within the ordinary skill in the art. The amount will also depend on the individual patient to be treated, the route of administration, the type of formulation, the characteristics of the compound used, the severity of the disease and the desired effect. The amount used can be determined by pharmacological and pharmacokinetic principles well known in the art.
The administration of the bispecific antibody or the anti-PD-L1 or anti-LAG 3 antibody may be performed by at least one selected from the group consisting of: intraperitoneal, intravenous, subcutaneous, intradermal, intramuscular, intranasal, epidural, and oral routes, but are not limited thereto. The bispecific antibody or anti-PD-L1 or anti-LAG 3 antibody or composition can be administered by any convenient route, e.g., by infusion or bolus injection, absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and can be administered with other bioactive agents. Thus, a pharmaceutical composition containing an antigen-binding polypeptide of the present disclosure can be administered orally, parenterally, intracisternally, intravaginally, intraperitoneally, rectally, topically (e.g., by powder, ointment, drops, or transdermal patch), buccally, or as an oral or nasal spray.
The term "parenteral" as used herein refers to modes of administration including intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
Administration may be systemic or local. Furthermore, it may be desirable to introduce the antibodies of the present disclosure into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be assisted by an intraventricular catheter attached to, for example, a reservoir (e.g., an Ommaya reservoir). Pulmonary administration can also be employed, for example, by using an inhaler or nebulizer and formulation with an aerosolizing agent.
It may be desirable to administer a bispecific antibody of the disclosure, or an anti-PD-L1 or anti-LAG 3 antibody, or a composition locally to an area in need of treatment; this may be achieved, for example and without limitation, by: local infusion during surgery, topical application (e.g. in conjunction with a post-operative wound dressing), by injection, by catheter, by suppository, or by implant (which is a porous, non-porous or gelatinous material including membranes, such as elastic membranes or fibers). Preferably, when administering proteins of the present disclosure (including antibodies), care must be taken to use materials that are not absorbed by the protein.
In another embodiment, the bispecific antibody or anti-PD-L1 or anti-LAG 3 antibody or composition can be delivered in a vesicle (specifically a liposome). In yet another embodiment, the bispecific antibody or anti-PD-L1 or anti-LAG 3 antibody or composition can be delivered in a controlled release system. In one embodiment, for a controlled release system, any pharmaceutically acceptable pump and/or polymeric material may be used.
The pharmaceutically effective amount of the bispecific antibody or the anti-PD-L1 or anti-LAG 3 antibody for treating, inhibiting, ameliorating and/or preventing an inflammatory, immune or malignant disease, disorder or condition can be determined by standard clinical techniques. In addition, in vitro assays may optionally be used to help identify optimal dosage ranges. The precise dose employed in the formulation will also depend on the route of administration and the severity of the disease, disorder or condition, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.
Methods of treating infectious or malignant diseases (e.g., cancer), conditions or disorders comprising administering a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody are typically tested in vitro and then in an acceptable animal model in vivo for the desired therapeutic or prophylactic activity prior to use in humans. Suitable animal models, including transgenic animals, are well known to those of ordinary skill in the art. For example, in vitro assays for demonstrating the therapeutic utility of a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody include the effect of the bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody on a cell line or patient tissue sample. The effect of a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody on a cell line and/or tissue sample can be determined using techniques known to those of skill in the art (e.g., assays disclosed elsewhere herein). In accordance with the present disclosure, in vitro assays useful for determining whether to administer a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody are indicated include in vitro cell culture assays in which a patient tissue sample is grown in culture and exposed to or otherwise administered a compound, and the effect of such compound on the tissue sample is observed.
Various delivery systems are known and can be used to administer antibodies of the disclosure or polynucleotides encoding antibodies of the disclosure, for example: recombinant cells encapsulated in liposomes, microparticles, microcapsules, capable of expressing compounds, receptor-mediated endocytosis, constructing nucleic acids as part of a retrovirus or other vector, and the like.
The pharmaceutical composition may comprise an effective amount of the bispecific antibody or anti-PD-L1 or anti-LAG 3 antibody, and an acceptable carrier. In some embodiments, the composition further comprises a second anti-cancer agent (e.g., an immune checkpoint inhibitor).
In a particular embodiment, the term "pharmaceutically acceptable" may refer to those approved by a regulatory agency of the federal or a state government or listed in the U.S. pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. In addition, a "pharmaceutically acceptable carrier" is typically a non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation aid of any type.
The term "carrier" may refer to a diluent, adjuvant, excipient, or vehicle with which a therapeutic agent is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions may also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. If desired, the composition may also contain minor amounts of wetting or emulsifying agents or pH buffering agents (e.g., acetates, citrates or phosphates). Antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; agents for adjusting tonicity, such as sodium chloride or dextrose. These compositions may take the form of: solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations, and the like. The compositions may be formulated as suppositories using conventional binders and carriers such as triglycerides. Oral formulations may include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. Examples of suitable Pharmaceutical carriers are described in Remington's Pharmaceutical Sciences [ Remington Pharmaceutical Sciences ] of e.w. martin, which is incorporated herein by reference. Such compositions will contain a therapeutically effective amount of the antigen binding polypeptide, preferably in purified form, together with a suitable amount of carrier so as to provide the patient with a form for proper administration. The formulation should conform to the mode of administration. The parenteral formulations may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
In one embodiment, the composition is formulated in accordance with conventional procedures as a pharmaceutical composition suitable for intravenous administration in humans. Typically, compositions for intravenous administration are sterile isotonic aqueous buffer solutions. If necessary, the composition may also include a solubilizing agent and a local anesthetic (such as lidocaine) to relieve pain at the injection site. Typically, the ingredients are provided separately or mixed together in unit dosage form, e.g., as a dry lyophilized powder or anhydrous concentrate in a sealed container, e.g., an ampoule or sachet, which indicates the amount of active agent. Where the composition is administered by infusion, the dosage may be administered in an infusion bottle containing sterile pharmaceutical grade water or saline. In administering the composition by injection, an ampoule of sterile water for injection or saline may be provided so that the ingredients may be mixed prior to administration.
The compounds of the present disclosure may be formulated in neutral or salt form. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, and the like; and those formed from cations such as hydroxides derived from sodium, potassium, ammonium, calcium, iron, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
Diagnostic use of antibodies
Overexpression and/or overactivation of PD-L1 and/or LAG3 was observed in a biological sample (e.g., cell, tissue, blood, serum, etc.) from a patient with a certain cancer and/or infection (e.g., tumor cells, or tissue, blood, or serum from an infected patient), and/or patients with PD-L1 and/or LAG3 overexpressing cells may be responsive to treatment with bispecific antibodies or anti-PD-L1 or anti-LAG 3 antibodies. Thus, bispecific antibodies of the disclosure, either anti-PD-L1 or anti-LAG 3 antibodies, can also be used for diagnostic and prognostic purposes.
One embodiment provides a pharmaceutical composition for diagnosing a disease associated with PD-L1, LAG3, or both, the composition comprising a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody. In another embodiment, use of a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody for diagnosing a disease associated with PD-L1, LAG3, or both is provided.
Another embodiment provides a method of diagnosing a disease associated with PD-L1, LAG3, or both, the method comprising contacting a biological sample obtained from a patient with a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody, and detecting an antigen-antibody response or measuring the level of an antigen-antibody response in the biological sample. In this method, when an antigen-antibody reaction is detected in the biological sample, or the level of the antigen-antibody reaction in the biological sample is higher than in a normal sample, the patient providing the biological sample may be determined to be a patient having a disease associated with PD-L1, LAG3, or both. Thus, in some embodiments, the method may further comprise contacting the normal sample with a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody and measuring the level of the antigen-antibody response in the normal sample. In addition, after the measuring step, the method may further comprise comparing the level of antigen-antibody reaction in the biological sample and the normal sample. In addition, after the detecting step or the comparing step, the method may further comprise determining the patient as a patient having a disease associated with PD-L1, LAG3, or both, when an antigen-antibody response is detected in the biological sample or the level of the antigen-antibody response in the biological sample is higher than the level of the antigen-antibody response in the normal sample.
The disease associated with PD-L1, LAG3, or both, may be a disease associated with activation (e.g., aberrant activation or over-activation) and/or overproduction (overexpression) of PD-L1, LAG3, or both. For example, as described above, the disease may be cancer or an infection.
In the diagnostic compositions and methods, the biological sample may be at least one selected from the group consisting of: cells, tissues, body fluids (e.g., blood, serum, lymph, etc.), and the like. The normal sample may be at least one selected from the group consisting of obtained (isolated) from a patient having a disease associated with PD-L1, LAG3, or both: cells, tissues, body fluids (e.g., blood, serum, lymph, urine, etc.), and the like. The patient may be selected from a mammal, such as a human. Following optional pretreatment of the sample, the sample may be incubated with a bispecific antibody of the present disclosure or an anti-PD-L1 or anti-LAG 3 antibody under conditions that allow the antibody to interact with PD-L1 and/or LAG3 proteins that may be present in the sample.
The presence and/or level (concentration) of PD-L1 and/or LAG3 protein in a sample can be used to identify patients eligible for treatment with a bispecific antibody or anti-PD-L1 or anti-LAG 3 antibody, or patients who are responsive or susceptible to treatment with a bispecific antibody or anti-PD-L1 or anti-LAG 3 antibody.
One embodiment provides a pharmaceutical composition that identifies a patient suitable for treatment with, or is responsive to treatment with, a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody, comprising a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody. In another embodiment, there is provided the use of a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody for identifying a patient suitable for treatment with the bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody, or a patient responsive or susceptible to treatment with the bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody. Another embodiment provides a method of identifying a patient suitable for treatment with a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody, or a patient responsive or susceptible to treatment with a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody, the method comprising contacting a biological sample obtained from the patient with a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody, and detecting an antigen-antibody response or measuring the level of an antigen-antibody response in the biological sample.
One embodiment provides a composition for detecting PD-L1, LAG3, or both in a biological sample, the composition comprising a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody. Another embodiment provides a method of detecting PD-L1, LAG3, or both in a biological sample, the method comprising contacting the biological sample with a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody; and detecting (measuring) an antigen-antibody reaction (binding) between the bispecific antibody or the anti-PD-L1 or anti-LAG 3 antibody and PD-L1, LAG3, or both.
In the test compositions and test methods, the term "detecting PD-L1, LAG3, or both" can refer to, but is not limited to, detecting the presence (and/or absence) and/or level of PD-L1, LAG3, or both in a biological sample.
In the detection method, when an antigen-antibody reaction is detected, PD-L1, LAG3, or both may be determined to be present in the biological sample, and when an antigen-antibody reaction is not detected, PD-L1, LAG3, or both may be determined to be absent (not present) in the biological sample. Thus, after the detecting step, the method of detecting may further comprise: determining that PD-L1, LAG3, or both are present in the biological sample when an antigen-antibody reaction is detected, and/or determining that PD-L1, LAG3, or both are absent (not present) in the biological sample when an antigen-antibody reaction is not detected.
In the detection method, the level of PD-L1, LAG3, or both, may be determined according to the extent of the antigen-antibody reaction (e.g., the amount of antigen-antibody complex formed by the antigen-antibody reaction, the intensity of any signal obtained by the antigen-antibody reaction, etc., which may be measured by any conventional means).
The biological sample may comprise at least one obtained or isolated from a mammal (e.g., a human) selected from the group consisting of: cells (e.g., tumor cells), tissues (e.g., tumor tissue), body fluids (e.g., blood, serum, etc.), and the like. The steps of the detection method may be performed in vitro.
In the diagnostic method and/or the detection method, the step of detecting an antigen-antibody reaction or measuring the level of an antigen-antibody reaction may be performed by any general method known in the related art, such as general enzymatic reaction, fluorescent reaction, luminescence reaction, and/or detection of radiation. For example, this step may be performed by a method selected from, but not limited to, the group consisting of: immunochromatography, Immunohistochemistry (IHC), enzyme-linked immunosorbent assay (ELISA), Radioimmunoassay (RIA), Enzyme Immunoassay (EIA), Fluorescence Immunoassay (FIA), Luminescence Immunoassay (LIA), western blot, microarray, flow cytometry, Surface Plasmon Resonance (SPR), and the like, but are not limited thereto.
Polynucleotides encoding antibodies and methods of making antibodies
One embodiment provides a polynucleotide encoding a bispecific antibody or an anti-PD-L1 or anti-LAG 3 antibody. In particular, one embodiment provides a polynucleotide encoding the heavy chain of a bispecific antibody in the form of an IgG-scFv. Other embodiments provide polynucleotides encoding the light chain of a bispecific antibody in the form of an IgG-scFv. The IgG-scFv format can refer to a bispecific antibody comprising a full length IgG antibody targeting (binding to) one of the PD-L1 and LAG3 proteins and a scFv fragment targeting (binding to) the other, wherein the scFv is linked to the C-terminus and/or N-terminus of the full length IgG antibody, either directly (without a peptide linker) or via a peptide linker.
In one embodiment, when the bispecific antibody in IgG-scFv format comprises a full length IgG antibody against PD-L1 and a scFv fragment against LAG3, the polynucleotide encoding the heavy chain of the bispecific antibody can encode a full length IgG antibody against PD-L1 and a heavy chain of a scFv fragment against LAG3, which scFv fragment against LAG3 is linked to the C-terminus and/or N-terminus of the full length IgG antibody, either directly or through a peptide linker; and the polynucleotide encoding the light chain of the bispecific antibody can encode the light chain of a full length IgG antibody directed to PD-L1.
In another embodiment, when the bispecific antibody in IgG-scFv format comprises a full length IgG antibody against LAG3 and a scFv fragment against PD-L1, the polynucleotide encoding the heavy chain of the bispecific antibody can encode a full length IgG antibody against LAG3 and a heavy chain of a scFv fragment against PD-L1, which scFv fragment against PD-L1 is linked to the C-terminus and/or N-terminus of the full length IgG antibody, either directly or through a peptide linker; and the polynucleotide encoding the light chain of the bispecific antibody may encode the light chain of a full length IgG antibody directed to
Another embodiment provides a recombinant vector comprising a polynucleotide encoding a heavy chain of a bispecific antibody, a polynucleotide encoding a light chain of a bispecific antibody, or both. Another embodiment provides a recombinant cell transfected with a recombinant vector.
Another embodiment provides a method of making a bispecific antibody comprising expressing in a cell a polynucleotide encoding a heavy chain of a bispecific antibody, a polynucleotide encoding a light chain of a bispecific antibody. The step of expressing the polynucleotide can be performed by culturing a cell comprising the polynucleotide (e.g., in a recombinant vector) under conditions that allow for expression of the polynucleotide. After the expression or culture step, the method may further comprise isolating and/or purifying the bispecific antibody from the cell culture.
Examples of the invention
Hereinafter, the present invention will be described in detail by way of examples.
The following examples are intended only to illustrate the invention and should not be construed as limiting the invention.
Example 1: preparation of anti-PD-L1 monoclonal antibody
1.1. Preparation and analysis of anti-human PD-L1 mouse monoclonal antibody
Anti-human PD-L1 mouse monoclonal antibodies were generated using hybridoma technology.
Antigen: human PD-L1-Fc protein and human PD-L1 high expression CHOK1 cell line (PDL1-CHOK1 cell line).
Immunization: to generate mouse monoclonal antibodies against human PD-L1, 1.5
The amino acid and polynucleotide sequences of the variable region of hybridoma HL1210-3 are provided in Table 5 below.
[ Table 5] HL1210-3 variable region sequences
Activity of HL1210-3 mouse monoclonal antibody
To evaluate the binding activity of hybridoma clone HL1210-3, purified mAb from this clone was subjected to an ELISA test. Briefly, microtiter plates were coated overnight at 4 ℃ with 0.1. mu.g/ml human PD-L1-Fc protein in PBS at 100. mu.l/well and then blocked with 100. mu.l/well of 5% BSA. A three-fold dilution of HL1210-3 antibody starting at 0.2. mu.g/ml was added to each well and incubated for 1-2 hours at room temperature. Plates were washed with PBS/Tween and then incubated with goat anti-mouse IgG antibody conjugated with horseradish peroxidase (HRP) for 1 hour at room temperature. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. As shown in FIG. 1, HL1210-3 may have high activity (EC)505.539ng/ml) binds to human PD-L1.
To evaluate the activity of HL1210-3 mouse mab in blocking the binding of human PD-L1 to its receptor PD-1, a receptor blocking assay was performed by using recombinant human PD-L1.
To evaluate the effect of HL1210-3 mouse mab in blocking the binding of recombinant human PD-L1 to its receptor PD-1, an ELISA-based receptor blocking assay was used. Briefly, microtiter plates were coated overnight at 4 ℃ with 1. mu.g/ml human PD-L1-Fc protein in PBS at 100. mu.l/well and then blocked with 100. mu.l/well of 5% BSA. Mu.l biotin-labeled human PD-1-Fc protein and 50. mu.l HL1210-3 antibody starting from 2. mu.g/mlA 3-fold dilution of the body was added to each well and incubated at 37 ℃ for 1 hour. Plates were washed with PBS/Tween and then incubated with streptavidin-HRP for 1 hour at 37 ℃. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. As shown in FIG. 2, HL1210-3 may be on an IC50Binding of human PD-L1 to human PD1 was effectively inhibited at 0.7835 nM.
In addition, receptor blockade assays were also performed by using human PD-L1 expressed by mammalian cells.
To evaluate the effect of HL1210-3 mouse mab in blocking the binding of human PD-L1 expressed on mammalian cells to its receptor PD-1, a FACS-based receptor blocking assay was used. Briefly, PDL1-CHOK1 cells were first incubated with HL1210-3 mouse monoclonal antibody in 3-fold serial dilutions starting at 20. mu.g/ml for 1 hour at room temperature. After washing with FACS buffer (PBS containing 2% FBS), biotin-labeled huPD-1 was added to each well and incubated at room temperature for 1 hour. Then, after washing twice with FACS buffer, streptavidin-PE was added to each well for 0.5 hours. The Mean Fluorescence Intensity (MFI) of PE was evaluated by FACSAriaIII. As shown in FIG. 3, HL1210-3 antibody can effectively inhibit the combination of PD-1 and PD-L1 expressed on mammalian cells, the IC50 is 2.56nM, and the highest inhibition rate is 92.6%.
Effect of HL1210-3 mouse monoclonal antibody
To evaluate the effect of HL1210-3 mouse mab in promoting human T cell immune response, human T cell responses were evaluated in a mixed lymphocyte reaction setting. Human DCs were allowed to differentiate from CD14+ monocytes in the presence of GM-CSF and IL-4 for 7 days. CD4+ T cells isolated from another donor were then co-cultured with serial dilutions of DCs and anti-PD-L1 blocking antibody. On
Binding affinities of HL1210-3 mouse monoclonal antibodies
Use of BIACORE for captureTMHL1210-3 antibody was tested for binding to recombinant PD-L1 protein (human PD-L1-his tag). The HL1210-3 mouse mab was captured using an anti-mouse Fc antibody coated on a CM5 chip. Serial dilutions of human PD-L1-his tag protein were injected at a flow rate of 25 μ g/ml over the captured antibody for 3 min. The antigen was dissociated for 900 s. All experiments were performed on Biacore T200. Data analysis was performed using Biacore T200 evaluation software. The results are shown in fig. 5 and table 6 below.
[ Table 6] binding kinetics of HL1210-3 to recombinant human PD-L1
Antibodies
ka(1/Ms)
kd(1/s)
KD(M)
HL1210-3
1.61E+05
4.69E-05
2.93E-10
Humanization of HL1210-3 mouse monoclonal antibodies
The monoclonal antibody HL1210-3 variable region gene was used to generate humanized monoclonal antibodies. In the first step of this process, the amino acid sequences of VH and VK of the single anti-HL 1210-3 were compared to available databases of human Ig gene (IgG1) sequences to find the overall best matching human germline Ig gene sequence. For the light chain, the closest human matches are the O18/Jk2 and KV1-39 × 01/KJ2 × 04 genes, while for the heavy chain, the closest human matches are the VH3-21 genes. Due to their close match, VH3-11, VH3-23, VH3-7 x 01 and VH3-48 genes were also selected.
Humanized variable domain sequences were then designed in which the CDR1(SEQ ID No.4), 2(SEQ ID No.5) and 3(SEQ ID No.6) of the HL1210-3 light chain were grafted onto the framework sequences of the O18/Jk2 and KV1-39 a 01/
TABLE 7 humanization design
The amino acid and nucleotide sequences of some humanized antibodies are listed in table 8 below.
[ Table 8] humanized antibody sequences (CDR indicated in bold)
Humanized VH and VK genes were produced synthetically and then cloned into vectors containing
[ Table 9] humanized antibody and VH and VL regions thereof
1.6. Antigen binding properties of humanized PD-L1 antibodies
To evaluate the antigen binding activity, an ELISA test was performed on the humanized antibody. Briefly, microtiter plates were coated overnight at 4 ℃ with 0.1. mu.g/ml human PD-L1-Fc protein in PBS at 100. mu.l/well and then blocked with 100. mu.l/well of 5% BSA. Ten-fold dilutions of humanized antibody starting at 10. mu.g/ml were added to each well and incubated for 1-2 hours at room temperature. Plates were washed with PBS/Tween and then incubated with goat anti-mouse IgG antibody conjugated with horseradish peroxidase (HRP) for 1 hour at room temperature. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. As shown in fig. 6A-6E, all of the humanized antibodies showed comparable binding efficacy to the chimeric antibody and to the contacted human PD-L1.
To evaluate the antigen binding properties, binding of the humanized antibody to mammalian-expressed PD-L1 was analyzed by FACS. Briefly, PDL1-CHOK1 cells were first incubated with 5-fold serial dilutions of humanized antibody starting at 2 μ g/ml for 1 hour at room temperature. After washing with FACS buffer (PBS containing 2% FBS), alexa 488-anti-human IgG antibody was added to each well and incubated for 1 hour at room temperature. The MFI of Alexa 488 was evaluated by FACSAriaIII. As shown in fig. 7A-7C, all humanized antibodies can efficiently bind PD-L1 expressed on mammalian cells, which is comparable to chimeric antibodies.
To explore the binding kinetics of the humanized antibodies, this example was affinity ranked by using Octet Red 96. As shown in Table 10, Hu1210-3, Hu1210-8, Hu1210-9, Hu1210-14, Hu1210-17, Hu1210-1 and Hu1210-22 showed better affinity, which is comparable to the chimeric antibody.
[ Table 10] affinity ranking of humanized antibodies
By BIACORE using the capture methodTMHumanized antibodies were tested for binding to recombinant PD-L1 protein (human PD-L1-his tag). The HL1210-3 mouse mab was captured using an anti-mouse Fc antibody coated on a CM5 chip. Serial dilutions of human PD-L1-his tag protein were injected at a flow rate of 25 μ g/ml over the captured antibody for 3 min. The antigen was dissociated for 900 s. All experiments were performed on Biacore T200. Data analysis was performed using Biacore T200 evaluation software and is shown in table 11 below.
[ Table 11] affinity by Biacore
Antibodies
ka(1/Ms)
kd(1/s)
KD(M)
Hu1210-8
9.346E+4
7.169E-5
7.671E-10
Hu1210-9
9.856E+4
4.528E-5
4.594E-10
Hu1210-14
1.216E+5
5.293E-5
4.352E-10
Hu1210-16
9.978E+4
6.704E-5
6.720E-10
Hu1210-17
1.101E+5
2.128E-5
1.933E-10
Hu1210-28
1.289E+5
1.080E-4
8.378E-10
Hu1210-31
1.486E+5
1.168E-4
7.862E-10
Hu1210-36
1.461E+5
7.852E-5
5.376E-10
Hu1210-40
8.77E+04
1.31E-04
1.49E-09
Hu1210-41
9.17E+04
3.46E-05
3.78E-10
Hu1210-42
8.68E+04
7.53E-05
8.67E-10
1210 chimera
1.236E+5
3.265E-5
2.642E-10
1.7. Cross-species activity
To evaluate the binding of humanized antibodies to huPD-L1, mouse PD-L1, rat PD-L1, rhesus monkey PD-L1, an antibody ELISA test was performed. Briefly, microtiter plates were coated overnight at 100. mu.l/well with 1. mu.g/ml human, mouse, rat and rhesus PD-L1-Fc protein in PBS at 4 ℃ and then blocked with 100. mu.l/well of 5% BSA. Three-fold dilutions of humanized antibody starting at 1 μ g/ml were added to each well and incubated for 1-2 hours at room temperature. Plates were washed with PBS/Tween and then incubated with goat anti-mouse IgG antibody conjugated with horseradish peroxidase (HRP) for 1 hour at room temperature. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. The Hu1210-41 antibody bound rhesus monkey PD-L1 with lower affinity and failed to bind rat and mouse PD-L1 (fig. 8 and table 12).
[ Table 12]
Human being
Rhesus monkey
Rat
Mouse
EC50
0.215nM
0.628nM
Without bonding
Without bonding
To evaluate binding of the humanized anti-PD-L1 antibody to human B7 family and other immune checkpoints, binding of the antibody to B7-H1(PD-L1), B7-DC, B7-1, B7-2, B7-H2, PD-1, CD28, CTLA4, ICOS and BTLA was evaluated. As shown in FIG. 9, the Hu1210-41 antibody was only able to specifically bind B7-H1 (PD-L1).
1.8. Humanized anti-PD-L1 antibodies block the activity of human PD-L1 to bind PD-1
Cell-based receptor blocking assays
To evaluate the effect of the humanized antibodies in blocking the binding of human PD-L1 expressed on mammalian cells to its receptor PD-1, a FACS-based receptor blocking assay was used. Briefly, PDL1-CHOK1 cells were first incubated with HL1210-3 mouse monoclonal antibody in 3-fold serial dilutions starting at 20. mu.g/ml for 1 hour at room temperature. After washing with FACS buffer (PBS containing 2% FBS), biotin-labeled huPD-1 was added to each well and incubated at room temperature for 1 hour. Then, after washing twice with FACS buffer, streptavidin-PE was added to each well for 0.5 hours. The Mean Fluorescence Intensity (MFI) of PE was evaluated by FACSAriaIII.
As shown in Table 13 below, the Hu1210-3, Hu1210-9, Hu1210-8, Hu1210-14, Hu1210-17, Hu1210-19 and Hu1210-22 antibodies show efficacy in blocking PD-L1 binding to PD-1 comparable to chimeric antibodies.
[ Table 13] PD-1 receptor blockade assay
Receptor blockade assay by using recombinant human PD-L1
For human PD-L1, there are two receptors, PD-1 and B7-1. To explore the blocking properties of the humanized PD-L1 antibody for both proteins, a protein-based receptor blocking assay was used herein. Briefly, microtiter plates were coated overnight at 100. mu.l/well with 1. mu.g/ml human PD-L1-Fc protein in PBS at 4 ℃ and then blocked with 200. mu.l/well of 5% BSA for 2 hours at 37 ℃. Mu.l of biotin-labeled human PD-1-Fc or B7-1 protein and 50. mu.l of a 5-fold dilution of PD-L1 antibody starting at 100nM were added to each well and incubated at 37 ℃ for 1 hour. Plates were washed with PBS/Tween and then incubated with streptavidin-HRP for 1 hour at 37 ℃. After washing, the plate was developed with TMB substrate and analyzed with a spectrophotometer at OD 450 nm. As shown in FIGS. 10 and 11, Hu1210-41 effectively inhibited the binding of human PD-L1 to human PD1 and B7-1.
1.9. Activity of humanized anti-PD-L1 antibodies to promote human T cell immune response
Mixed lymphocyte reaction assay
To evaluate the in vitro function of humanized antibodies, human T cell responses were evaluated in a mixed lymphocyte reaction setup. Human DCs were allowed to differentiate from CD14+ monocytes in the presence of GM-CSF and IL-4 for 7 days. CD4+ T cells isolated from another donor were then co-cultured with serial dilutions of DCs and anti-PD-L1 blocking antibody. On
CMV recall assay
To evaluate the in vitro function of the humanized antibodies, the human T cell response was evaluated in a CMV recall assay. Human PBMC were stimulated with 1. mu.g/ml CMV antigen in the presence of serial dilutions of humanized antibody. As shown in FIGS. 12 and 13, Hu1210-40, Hu1210-41 and Hu1210-17 can dose-dependently promote IFN γ production.
1.10. Inhibition of tumor growth by anti-PD-L1 monoclonal antibody.
Cells from the human lung adenocarcinoma cell line HCC827 were transplanted into NOD scid γ (NSG) mice. NSG mice are NOD scid γ deficient and most immunodeficient mice, making them ideal recipients for transplantation of human tumor cells and PBMCs. Human PBMCs were transplanted into tumor-bearing
1.11. Computer modeling of further variation and optimization of humanized antibodies
It is contemplated that certain amino acid residues within a CDR region or framework region may be altered to further improve or retain the activity and/or stability of the antibody. The structural, conformational and functional properties of the variants were tested using computational tools (VectorNTI, available at www.ebi.ac.Uk/tools/msa/clustalo) and those showing promise (within the CDR regions) are listed in the table below.
[ Table 14] VH and VL CDRs and variants thereof suitable for inclusion in humanized antibodies
(in Table 14, hotspot mutation residues and their substitutions underlined)
Identification of the PD-L1 epitope
This study was performed to identify the amino acid residues involved in the binding of PD-L1 to antibodies of the present disclosure.
An alanine scanning library of PD-L1 was constructed. Briefly, 217 PD-L1 mutant clones were generated on the protein engineering platform of Integral Molecular. Binding of the Hu1210-41 Fab to each variant in the PD-L1 mutation library was determined in duplicate by high throughput flow cytometry. Background fluorescence was subtracted from each raw data point and normalized for reactivity with PD-L1 Wild Type (WT). Mean binding values as a function of expression (control anti-PD-L1 mab reactivity) were plotted for each PD-L1 variant. To identify primary key clones (circles with crosses), a threshold of > 70% WT binding to control mab and < 30% WT reactivity to Hu1210-41 Fab was applied (dashed lines) (figure 16). Y134, K162 and N183 of PDL1 were identified as essential residues for Hu1210-41 binding. The low reactivity of the N183A clone with the Hu1210-41 Fab suggests that it is a major strong contributor to Hu1210-41 binding, while the contribution of Y134 and K162 is minor.
Key residues (spheres) were identified on the 3D PD-L1 structure, as shown in figure 17. Thus, these residues Y134, K162, and N183 constitute an epitope of PD-L1, responsible for binding to antibodies of various embodiments of the disclosure.
Notably, Y134, K162 and N183 are located within the IgC domain of PD-L1 protein. The extracellular portions of both PD-1 and PD-L1 have IgV and IgC domains. It is well known that PD-L1 binds to PD-1 through binding between their IgV domains. However, unlike such conventional antibodies, Hu1210-41 binds to the IgC domain, and Hu1210-41 is expected to be ineffective in inhibiting PD-1/PD-L1 binding. Surprisingly, this different epitope of Hu1210-41 may contribute to the superior activity of Hu 1210-41.
1.13. Antibody engineering of
Examples 1.13-1.15 attempted to identify further improved antibodies based on Hu1210-41 using mutagenesis.
Four sub-libraries were constructed for antibody engineering of anti-PD-L1 monoclonal antibodies using either of the following strategies. In
Biological elutriation: the phage panning process was adjusted by shortening the incubation/binding time prior to harsh wash conditions. Briefly, 100. mu.l of magnetic streptavidin beads (Invitrogen, USA) were blocked with 1ml MPBS for 1 hour at room temperature. In another tube, library phage were preincubated with 100. mu.l magnetic streptavidin beads (5 x10 ^ 11-12 per round) in 1ml MPBS to remove unwanted binders. Phage and beads were separated using a magnetic particle concentrator. Biotinylated PD-L1 protein was added to the phage and incubated at room temperature for 2 hours with gentle mixing using an overhead shaker. Phage-bearing beads were separated from the solution in a magnetic particle concentrator and the supernatant was discarded. Beads were washed with fresh wash buffer, ten times with PBST and ten times with PBS (pH 7.4). 0.8ml of a 0.25% trypsin solution in PBS (Sigma, USA) was added and incubated at 37 ℃ for 20min to elute the phage. The output phage were titrated and rescued for the next round of panning, reducing antigen concentration from round to round.
ELISA screening and On/off Rate ranking
Selecting clones from the desired elutriation output and inducing; performing phage ELISA for primary screening; positive clones were analyzed by sequencing; unique hot spots were found. Table 15 shows the identified mutations. As shown below, FGK residues in CDRH3 are hot-spot residues for generating improved antibodies.
[ Table 15] mutations in CDRs
(. WT differs from Hu1210-41 in the substitution of S60R (Kabat numbering) in the heavy chain to increase affinity.)
The amino acid sequences of the variable regions of these antibodies are shown in table 16 below.
[ Table 16] antibody sequences
Antigen binding Properties of PD-L1 antibody
As shown in tables 15 and 16, a total of 9 unique clones were characterized and transformed into full-length IgG.
Binding characteristics to recombinant human PD-L1
To evaluate antigen binding activity, the antibodies were subjected to ELISA tests. Briefly, microtiter plates were coated overnight at 4 ℃ with 2. mu.g/ml human PD-L1-Fc protein in PBS at 100. mu.l/well and then blocked with 100. mu.l/well of 5% BSA. A 4-fold dilution of humanized antibody starting at 10 μ g/ml was added to each well and incubated at room temperature for 1-2 hours. Plates were washed with PBS/Tween and then incubated with goat anti-mouse IgG antibody conjugated with horseradish peroxidase (HRP) for 1 hour at room temperature. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. As shown in fig. 18, all humanized antibodies showed excellent binding efficacy to human PD-L1, and B6 and C3 performed better than the parental clone WT.
Binding characteristics to mammalian-expressed human PD-L1
To evaluate the antigen binding properties, the binding of the antibody to mammalian-expressed PD-L1 was analyzed by FACS. Briefly, PDL1-Raji cells were first incubated with 5-fold serial dilutions of humanized antibody starting at 2. mu.g/ml for 1 hour at room temperature. After washing with FACS buffer (PBS containing 2% FBS), Alexa 488-anti-human IgG antibody was added to each well and incubated at room temperature for 1 hour. The MFI of Alexa 488 was evaluated by FACSAriaIII. As shown in fig. 19, B6 bound PD-L1 expressed on mammalian cells more potently and efficiently than the parent antibody WT.
Affinity ranking of humanized antibodies by Biacore
To explore the binding kinetics of humanized antibodies, this example uses Biacore for affinity ranking. As shown in table 17, B6, C3, C6, a1, and A3 showed better affinity than the parent antibody WT.
[ Table 17] affinity ranking
Antibodies
ka(1/Ms)
kd(1/s)
KD(M)
WT
1.77E+05
4.64E-04
2.63E-09
B3
1.19E+05
2.96E-04
2.49E-09
C4
1.13E+05
5.06E-04
4.50E-09
B1
1.63E+05
2.61E-04
1.60E-09
B6
2.42E+05
2.46E-04
1.02E-09
C3
2.18E+05
2.99E-04
1.37E-09
C6
2.06E+05
3.34E-04
1.63E-09
A1
2.03E+05
2.76E-04
1.36E-09
A2
1.87E+05
4.75E-04
2.55E-09
A3
2.18E+05
3.24E-04
1.49E-09
1.15. Cell-based function of
To test the ability of
EXAMPLE 2 preparation of
2.1. Screening of fully human monoclonal antibodies against LAG-3
anti-LAG 3 human monoclonal antibodies (alpha-LAG-3 monoclonal antibody) were generated by screening a fully human Fab phage display library. The wild-type LAG-3-ECD-huFc fragment could bind to Daudi cells, whereas the LAG-3-ECD-huFc fragment truncated by D1-D2 was unable to bind to Daudi cells (FIG. 21). Thus, the D1-D2 domain is critical for LAG-3 function.
Antigens for panning of phage display libraries. LAG-3 is a single-pass type I membrane protein belonging to the immunoglobulin (Ig) superfamily and contains 4 extracellular Ig-like domains (ECDs): domains (D)1, D2, D3, and D4. Recombinant human LAG-3-ECD-human IgG1(LAG-3-huFc) fusion protein or human D1-D2 truncated LAG-3-ECD-human IgG1(Δ D1D2-LAG-3-huFc) fusion protein was expressed in 293T cell system.
A phage library. Ig gene segments in mammals are arranged in groups of variable (V), diverse (D), junction (J) and constant (C) exons. Construction of a human Fab phage library using phage vectors consisting of: 1) all human variable region kappa (VK) pools; and 2) VH that are the VH3-23 and VH1-69 germline genes, respectively, with genetically randomized CDR3 regions from healthy human subjects.
Antigen screening and generation. To select D1-D2 domain-specific phage binders, the phage library was subjected to antigen-based panning.
I) Phage library solution panning against LAG-3.
293F cells were transfected with a plasmid containing the LAG-3(Δ D1D2-LAG-3) sequence lacking D1-D2 (with a FLAG-tag at the N-terminus). Δ D1D 2-LAG-3293F cells were used for
II) phage library immune tube panning against LAG-3
Sequential negative screening using phage library: casein coated immune tubes, Δ D1D2-LAG-3 transfected 293F cells and human IgG1Fc protein. The resulting library was then incubated for 2 hours in LAG3-huFc coated immune tubes under movement. Unbound phage were removed by washing 5-20 times with PBST. Similar to cell-based panning, a total of three rounds of phage library screening were performed.
The output-3 phage library was diluted and plated for growth at 37 ℃ for 8 hours and captured overnight at 22 ℃ through anti-kappa antibody-coated filters. Biotinylated LAG-3-huFc (50nM) and NeutrAvidin-AP conjugate were applied to filters to detect antigen binding against LAG3 phage. Positive plaques were picked and eluted into 100. mu.L phage elution buffer. Approximately 10-15 μ L of eluted phage was then used to infect 1mL XL1-Blue competent cells to prepare High Titer (HT) phage for phage spot ELISA (SPE) (ELISA immobilized substrate was coated with 50nM of each protein tested).
The VL and VH gene sequences of all hits were cloned into the expression vectors pFUSE2ss-CLIg-hk (light chain, InvivoGen Cat. No. pFUSE2ss-hclk) and pFUSs-CHIg-hG 1 (heavy chain, InvivoGen Cat. No. pffusss-hcg 1). The antibodies were expressed in HEK293 cells and purified using protein a PLUS-agarose. The sequences of the antibodies and their CDR regions are provided in the table below.
[ Table 18] heavy chain variable region
[ Table 19] heavy chain CDR
[ TABLE 20] light chain variable region
[ Table 21] light chain CDR
2.2. Binding of human anti-LAG 3 antibody to LAG3 protein derived from various species.
To evaluate the ability of anti-LAG-3 antibodies to bind human, rat, and mouse LAG3, the binding characteristics of the antibodies identified in example 2.1 were evaluated by ELISA. Human, rat and mouse LAG3 ECD-Fc protein at 1. mu.g/ml was coated on ELISA plates at 100. mu.l/well. The antibodies from example 1 were serially diluted with ELISA dilution buffer. To assess binding, various concentrations (10. mu.g/ml, 3.333. mu.g/ml, 1.111. mu.g/ml, 0.370. mu.g/ml, 0.123. mu.g/ml, 0.041. mu.g/ml, 0.014. mu.g/ml, 0.005. mu.g/ml, 0.0015. mu.g/ml and 0.0005. mu.g/ml) of LAG-3 antibody were then added to the LAG3 antigen-coated plates at room temperature for 1.5 hours. The resulting plate was washed and then labeled with anti-human igg (fab) -HRP antibody. S31 could only bind
2.3. Binding of human anti-LAG 3 antibody to cell surface LAG-3 antigen on activated human primary CD4+ T cells.
LAG-3 is expressed on activated or depleted T cells. CD4+ T cells were isolated using CD4 magnetic beads. By using
2.4. anti-LAG-3 antibodies inhibit binding of soluble LAG-3(sLAG) to MHC class II receptors
To evaluate the ability of anti-LAG-3 antibodies to block the binding of sLAG-3 to MHC class II receptors, in vitro binding assays were designed using biotin-labeled LAG-3-ECD-huFc fusion proteins and Raji cells expressing MHC class II receptors. The antibody from example 1 was serially diluted from 20. mu.g/mL with FACS buffer and preincubated with 6. mu.g/mL biotin-LAG-3-ECD-huFcc for 30min at room temperature. The antibody mixture was then added to FcR blocked Raji cells and incubated on ice for 30 min. The cells were then washed with FACS buffer, and then stained with streptavidin PE on ice for 30min, and then washed once with FACS buffer. In BD FACSCaliburTMWherein the fluorescence intensity of the labeled cells is evaluated by flow cytometry. As shown in figure 24, the S27, S31, S119, and T99 antibodies can dose-dependently inhibit the binding of LAG3 to its receptor MHC class II molecules.
2.5. The anti-LAG-3 antibody stimulates IL-2 production in Peripheral Blood Mononuclear Cells (PBMCs).
Staphylococcal enterotoxin b (seb) is a superantigen that binds both MHC class II antigens and T Cell Receptors (TCR) bringing them together in such a way as to induce T cell proliferation and cytokine production.
2.6. Reversing regulatory T cells (T) using anti-LAG-3 antibodiesreg) For effector T cells (T)eff) Inhibition of (3).
LAG-3 high expressionAt Treg(CD4+CD25Height of) And mediate TregInhibitory function of (Journal of immunology)]184:6545-51,2010). To evaluate the reversal of T by anti-LAG-3 antibodyregFor effector T cells (CD 4)+CD25-CD127Height of) The antibody of example 1 was used in an in vitro inhibition assay. First, T is paired by using the BD FACSAria II systemreg(CD4+CD25Height ofCD127Is low in) And Teff(CD4+CD25CD127Height of) FACS sorting was performed. Then T is addedeffLabeled with carboxyfluorescein succinimidyl ester (CFSE) and treated with T at a 1:1 ratio in the presence of plate-bound
LAG-3 antibody BIACORE analysis
Binding of the S20, S24, S27, S31, S87, S119, S120, S128, S136, S161 and T99 antibodies to the recombinant his-tagged human LAG3-ECD protein was examined by Biacore T200 using a capture method. anti-LAG 3 antibody was captured using anti-human Fc antibody. Anti-human Fc antibodies were coated on the chip. Consecutive concentrations of his-tagged human LAG3-ECD protein (0-4nM) were injected at a flow rate of 30. mu.l/min onto the capture antibody. The dissociation period is 900s or 550 s. The results are shown in table 22 below. Biacore results of
[ Table 22]
Ka(M-1s-1)
kd(s-1)
KD(M)
S20
1.65E+05
7.33E-06
4.43E-11
S24
1.79E+06
1.20E-02
6.73E-09
S27
7.04E+06
1.10E-04
1.56E-11
S31
2.08E+06
6.25E-05
3.00E-11
S87
9.28E+05
2.33E-06
2.51E-12
S119
2.17E+07
1.49E-04
6.87E-12
S120
1.40E+06
2.64E-03
1.88E-09
S128
1.00E+06
8.17E-04
8.15E-10
S136
7.98E+05
8.27E-05
1.04E-10
S161
6.20E+05
5.53E-04
8.92E-10
T99
7.62E+06
1.70E-04
2.24E-11
2.8. Generation of mouse monoclonal antibodies against human LAG3
This example shows how anti-human LAG3 mouse monoclonal antibodies were generated using hybridoma technology.
Antigen:recombinant human LAG-3 fusion protein was used as an immunogen to generate anti-human LAG-3 antibodies. A fusion protein comprising the entire extracellular region (domains 1-4) of human LAG-3 fused to a mouse immunoglobulin Fc domain (D1-D4 mFc) was used as an immunogen. For ELISA binding assays, the fusion protein contained the entire extracellular region (domains 1-4) of human LAG-3 fused to the human immunoglobulin Fc domain or noneThe extracellular region of the D1-D2 domain (D1-D4 huFc or Δ D1-D2 huFc, respectively). LAG-3 fusion proteins were prepared using standard recombinant DNA techniques.
Immunization:
LAG-3 fusion proteins were prepared using standard recombinant DNA techniques. Mice were immunized Intraperitoneally (IP) and/or Subcutaneously (SC). Mice were first SC immunized with 50mg of immunogen and then IP immunized biweekly with 25 μ g of immunogen. Immune responses were monitored by retroorbital bleeds. Plasma was screened by ELISA and cell-based receptor blocking assays (described below). Mice with sufficient titers of anti-LAG-3D 1-D2 domain immunoglobulin and functional LAG3 blocker were used for fusion. Mice were boosted intraperitoneally with 25 μ g of antigen followed by a subsequent boost with 25 μ g of antigen prior to sacrifice and removal of the spleen. Spleen was used for fusion. Hybridoma supernatants were tested for anti-LAG-3D 1-D2 domain binding and the function of the antibody to block LAG3 binding to its receptor by a cell-based receptor blocking assay.
Mice were selected that produced
To select mice that produce anti-LAG 3 blocking antibodies, sera from immunized mice were tested for binding to the D1-D2 domain by ELISA. Briefly, sera were evaluated for binding to D1-D4huFc and were back-screened for binding to Δ D1-D2 huFc. Briefly, D1-D4huFc or Δ D1-D2 huFc was coated overnight at 0.5ug/ml and then blocked with 5% BSA in PBS. Serial dilutions of serum were incubated with coated antigen for 1h at room temperature. The resulting plates were washed with PBS/T and incubated with goat anti-mouse IgG-HRP for 1h at room temperature. The plate was developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. In parallel, the function of serum to block the binding of LAG3 to MHCII molecules expressed on Raji cells was evaluated as described in example 2.4. Mice with high titers specific for the LAG 3D1-D2 domain and with the function of blocking the binding of LAG3 to Raji cells were selected for fusion and further screening.
2.9. Binding characteristics of
This example tested the binding properties of
D1-D2 specific binders:
to evaluate binding specificity, purified 122H, 147H and 170H mouse monoclonal antibodies were subjected to ELISA binding assays against the D1-D4huFc and Δ D1-D2 huFc antigens. Briefly, D1-D4huFc or Δ D1-D2 huFc was coated overnight at 0.5 μ g/ml and then blocked with 5% BSA in PBS. Serially diluted antibodies (starting at 1. mu.g/ml and 10 doses serially diluted 1: 3) were incubated with the coated antigen for 1 hour at room temperature. The resulting plates were washed with PBS/T and incubated with goat anti-mouse IgG-HRP for 1h at room temperature. The plate was developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm.
The results of the ELISA are summarized in fig. 27A-27C, showing strong binding to the whole extracellular domain of LAG3(D1-D4 huFc) rather than LAG3 lacking D1-D2 (Δ D1-D2 huFc), confirming that 122H, 147H and 170H are potent selective binders of the D1 and D2 domains of
2.10. Functional Properties of
Blocking binding of LAG3 to its receptor
To evaluate the ability of anti-LAG-3 antibodies to block the binding of sLAG-3 to MHC class II receptors, in vitro binding assays were designed using biotin-labeled LAG-3-ECD-huFc fusion proteins and Raji cells expressing MHC class II receptors. Mouse
Stimulation of human T cell responses by
To test the ability of the anti-LAG 3 antibody to stimulate T cell responses, Jurkat T cell stimulation assay was used. Jurkat is a human T cell leukemia cell line that can produce IL2 upon TCR stimulation. In this assay, Jurkat cells transfected with human LAG3 gene by lentivirus were used as responder cells. The Raji cells expressing MHCII were used as Antigen Presenting Cells (APC). Staphylococcal Enterotoxin (SE) is a superantigen that can cross-link MHCII molecules with T cell receptor beta (TCRV β) and stimulate T cell responses. SE was used as a stimulus in this assay. In this system, ectopically expressed huLAG3 inhibited IL-2 production by Jurkat cells stimulated by SE, while
2.11.147H mouse monoclonal antibody humanization design
The
[ Table 23] mouse antibody sequences
The amino acid sequence of the humanized antibody is listed: 147H-1, 147H-2, 147H-3, 147H-4, 147H-5, 147H-6, 147H-7, 147H-8, 147H-9, 147H-10, 147H-11, 147H-12, 147H-13, and 147H-14, each having a different heavy chain but all sharing a common light chain.
[ Table 24] humanized antibody and Back-mutation
Humanized VH and VK genes were produced synthetically and then cloned into vectors containing
2.12. Binding characteristics of anti-LAG 3147H humanized monoclonal antibody
To explore the binding kinetics of the humanized antibodies, this example was affinity ranked by using Octet Red 96. As shown in Table 25 below, 147H-6, 147H-7, 147H-13 and 147H-14 showed better affinities.
[ Table 25]
To explore the binding kinetics of humanized antibodies, this example was further subjected to a full kinetic affinity assay by running various doses of antigen (50nM, 25nM, 12.5nM, 6.15nM, 3.125nM) using Octet Red 96. By passingThe software in the RED96 system calculates the binding affinity. As shown in Table 26, 147H-6, 147H-7, 147H-13 and 147H-14 show comparable affinities to the 147H chimeric antibody.
[ Table 26]
Antibodies
KD(M)
kon(1/Ms)
kdis(1/s)
147H chimeras
2.71E-08
8.01E+04
2.17E-03
147H-6
2.48E-08
1.05E+05
2.59E-03
147H-7
2.65E-08
1.18E+05
3.12E-03
147H-13
1.82E-08
1.04E+05
1.90E-03
147H-14
2.07E-08
9.87E+04
2.04E-03
2.13. Functional Properties of
Stimulation of human T cell responses by
To test the ability of
2.14. Affinity maturation of humanized monoclonal antibodies against LAG 3147H
To improve antigen binding affinity, this example used phage display technology for 147H4-13 affinity maturation. Strategy 1: 147H-13 CDRH3 and CDRL3 were targeted for codon-based mutagenesis. CDRH3 and CDRL3 were randomized at positions H95-H102 and L89-L97(Kabat numbering), respectively. Strategy 2: each CDR was targeted for single codon based mutagenesis using a CDR stepping approach. CDRH1, CDRH2, CDRL1 were then combined into
In both strategies, the library undergoes three or four rounds of affinity-based solution phase phage display selection, with antigen concentration progressively decreasing for each round. The first round used a relatively high antigen concentration (10 nM). The antigen concentration was reduced 10-fold for each subsequent three rounds, or 100-fold for each subsequent two rounds to select for high affinity variants. Individual variants from the last round were tested for positive binding to antigen by ELISA screening. The off-rate ordering of individual variants was determined by Octet Red96 (Fortebio, usa). Mutations with improved affinity were combined to generate a new LAG3 antibody. Affinity was further confirmed by Biacore, which showed that N58V of CDR H2 significantly increased Koff, while N91Y of CDR L3 improved Kon.
[ Table 27] antibody affinity maturation
Table 28 summary of mutations and mutated CDR regions:
2.15. binding characteristics of affinity matured anti-LAG 3147H humanized monoclonal antibody
The binding kinetics of affinity matured antibodies to recombinant his-tagged human LAG3-ECD protein was examined by Biacore T200 as described in example 2.7. The results are shown in the following table. Biacore results showed that these anti-LAG 3 antibodies had better affinity than the
[ Table 29]
KD(M)
kon(1/Ms)
kdis(1/s)
147H-13
1.4E-08
2.2E+06
3.0E-02
147H 3421
8.1E-09
1.4E+06
1.2E-02
147H 3508
1.4E-09
2.9E+06
4.2E-03
147H 3549
9.2E-10
7.4E+06
6.8E-03
147H 3550
9.8E-10
8.7E+06
8.5E-03
147H 3663
6.8E-09
7.9E+05
5.4E-03
147H 3669
8.8E-09
7.2E+05
6.3E-03
147H 3790
5.9E-09
7.7E+05
4.5E-03
147H 3791
1.2E-09
2.1E+06
2.5E-03
147H 3792
5.9E-10
4.9E+06
2.9E-03
147H 3793
1.3E-09
1.8E+06
2.3E-03
147H 3794
7.2E-10
3.7E+06
2.7E-03
147H 3807b
5.1E-10
4.0E+06
2.0E-03
147H 3808
7.5E-10
4.3E+06
3.2E-03
147H 3809
4.7E-10
4.3E+06
2.0E-03
147H 3810
4.1E-10
4.7E+06
1.9E-03
147H 3811
5.9E-10
4.9E+06
2.9E-03
To demonstrate the ability of the affinity matured anti-LAG-3 antibody to bind human LAG3, the 2 antibodies with the highest affinities (B3807B and B3810) and the
[ Table 30]
Name (R)
EC50(nM)
147H-13
6.5
147H 3807b
0.41
147H 3810
0.49
To further demonstrate that affinity matured anti-LAG-3 antibodies can bind cell-derived human LAG3, both induced hLAG 3-expressing Jurkat cells and activated PBMCs were used to test the binding capacity of B3807B and B3810. Briefly, Jurkat cells were resuspended in FACS buffer. anti-LAG 3 antibody and isotype control were serially diluted 4-fold in FACS buffer at doses ranging from 20nM to 30 pM. Serially diluted antibodies were added to the cell suspension and incubated on ice for 30 minutes. Cells were then stained with anti-human IgG conjugated to Alexa Fluor 633 (zemer (Thermo), a21091) after removal of unbound antibody. Fluorescence measurements were obtained on a FACSCelesta flow cytometer and analyzed in Flowjo to determine Mean Fluorescence Intensity (MFI). To test the ability of
[ Table 31]
2.16. Characterization of monoclonal antibody 147H3807 (B3807)
Binding of B3807 to LAG3 protein
This example evaluated the ability of anti-LAG-3 antibody 147H3807 (B3807) to bind to human LAG3 protein. Mu.g/ml streptavidin was coated at 100. mu.l/well on ELISA plates. 100 μ l of 1.0 μ g/ml Bio-LAG3 was then incubated with streptavidin for 1 hour at room temperature. B3807 was serially diluted with ELISA dilution buffer along with positive control 25F7 and negative control IgG. To assess binding, various concentrations of antibody were added to LAG3 protein coated plates for 1.5 hours at room temperature. The resulting plate was washed and then labeled with anti-human igg (fab) -HRP antibody.
As shown in figure 38, both B3807 and 25F7 bound to human LAG3 in a dose-dependent manner, with B3807 showing higher potency and lower EC50(0.06nM versus 0.22nM for 25F 7).
Biacore analysis
Binding of B3807 to recombinant His-tagged human LAG3-ECD protein was examined by Biacore T200 using a capture method. B3807 was captured using protein a immobilized on a CM5 sensor chip. Consecutive concentrations of his-tagged human LAG3-ECD protein (0-12nM) were injected at a flow rate of 30. mu.l/min onto the capture antibody. The dissociation period is 900s or 550 s. The results are shown in fig. 39, exhibiting that B3807 binds human LAG3 with high affinity
Jurkat cells and PBMC-based binding assays
To further demonstrate that B3807 can bind to cell-derived human LAG3, B3807 was tested for binding capacity using both induced Jurkat cells expressing human LAG3 and activated PBMCs. Briefly, Jurkat cells were resuspended in FACS buffer. B3807, 25F7 and isotype control were serially diluted 3-fold in FACS buffer at doses ranging from 20nM to 9 pM. Serially diluted antibodies were added to the cell suspension and incubated on ice for 30 minutes. Cells were then stained with anti-human IgG conjugated to Alexa Fluor 633 (zemer (Thermo), a21091) after removal of unbound antibody. Fluorescence measurements were obtained on a FACSCelesta flow cytometer and analyzed in Flowjo to determine Mean Fluorescence Intensity (MFI). To test the ability of the antibodies to bind native human LAG3, PBMCs from healthy donors were stimulated with anti-CD 3(BD, 555336) and anti-CD 28(BD, 555725) at concentrations of 1 μ g/ml each. After 3 days of stimulation, cells were harvested and incubated with
The results of the cytometric analysis are presented in fig. 40. The EC50 of the test antibody is also shown in the figure. In both tests, B3807 exhibited stronger binding than
D. Blocking binding of LAG3 to MHC class II
To measure the ability of B3807 to block the interaction between human LAG3 and MHCII, LAG3 and MHC II binding assays (Cisbio, 64ICP03PEG) were performed using the homogeneous TR-FRET technique, following the protocol provided by the kit manufacturer. B3807 was diluted 3-fold, ranging from 100nM to 5pM (10 dots). Fluorescence data were obtained on a perkin elmer Envision plate reader and four parameter dose-response curves were fitted to obtain the IC50 for each antibody. IC50 was 0.41nM for B3807 (fig. 41), demonstrating potent blocking activity.
E. Stimulation of human T cell response
To test the ability of
F. Release of IL2 in Primary T cells
Primary T cells expressing hLAG3 were also tested for the ability of the antibody to stimulate a T cell response. At all four doses tested, B3807 was superior to 25F7 (fig. 43, left panel). When used with anti-PD-L1 antibody, the IL2 release profile (fig. 43, right panel) exhibited a synergistic effect between
Humanized mice expressing the extracellular domain of human LAG3 were used. As shown in the left panel of fig. 44, B3807 and 25F7 exhibited some effect of inhibiting tumor growth when combined with anti-PD-1 antibody.
However, in the right panel of fig. 44, it is evident that both B3807 and 25F7 have significant synergistic effects when used with the commercially available anti-PD-L1 antibody Tecentriq.
Comparison of B3807 with B3807B
B3807 and B3807B were compared for their ability to promote IL2 release in Jurkat cells (see experimental procedure in example 2.16 (E)) and to bind to LAG3 on Jurkat cells (see experimental procedure in example 2.16 (C)).
The comparison results are presented in fig. 45. In both experiments, B3807 and B3807B exhibited highly similar activity curves, demonstrating that the sequence differences of CDRL1 between the two antibodies did not affect their activity.
Moreover, as shown in figure 46, Biacore data (see experimental procedure in example 2.16 (B)) further exhibited similarity between the two antibodies. Bispecific antibodies were further tested and prepared using B3807 in the following examples.
Example 3 preparation of anti-PD-
The Hu1210-41(Hu1210 VH.4dxHu1210Vk.1; see Table 8; hereinafter, "H12") and B6 (see Table 16) clones in the anti-PD-L1 clone prepared in example 1, and the 147H (also referred to as "147", see Table 23) and 147H3807 (also referred to as "147 (H3807)", see Table 27) clones in the
A
The sequences of the heavy chain, light chain, scFv and DNA fragments are summarized in tables 32 and 33:
[ Table 32] bispecific antibody comprising anti-PD-L1 clone in IgG format and anti-LAG 3 clone in scFv format (PD-L1xLAG3)
[ Table 33] bispecific antibody comprising anti-LAG 3 clone in IgG format and anti-PD-L1 clone in scFv format (LAG3xPD-L1)
Expifeacmine was usedTMCHO kit (Sermer, A29129), the vector constructed was introduced into ExpicCHO-STMTransient expression in cells (Sermer Feishel (Thermo Fisher), A29127), ExpicHOTMExpression Medium (Thermo, A29100-01) in CO equipped with a rotating shaker2Culturing at 30-37 deg.C for 7-15 days in an incubator. Plasmid DNA (250. mu.g) and Expifeactamin CHO reagent (800. mu.L) were mixed with
Each BsAb was purified from the cell culture supernatant by recombinant protein A affinity chromatography (Hitrap Mabselect Sure, general medicine (GE Healthcare), 28-4082-55) and gel filtration chromatography using a HiLoad 26/200 Superdex200 preparative column (general medicine, 28-9893-36). SDS-PAGE (NuPage 4-12% Bis-Tris gel, NP0321) and size exclusion HPLC (Agilent, 1200 series) using SE-HPLC columns (SWXL SE-HPLC column, TOSOH, G3000SWXL) were performed to detect and confirm the size and purity of each BsAb. The purified protein was concentrated in PBS by ultrafiltration using an Amicon Ultra 1530K apparatus (Merck, UFC903096) and the protein concentration was estimated using Nanodrop (sermer, nano, Nanodrop One). When a two-vector system is used, the ratio between the light chain and the heavy chain may be 1:1 to 1:3 (by weight). Alternatively, a single vector system comprising both strands in a single vector may be used.
The prepared anti-PD-
Example 4 characterization of bispecific antibodies H12x147 and 147xH12
4.1. Binding of bispecific antibodies
To evaluate the activity of the bispecific antibodies (BsAb; H12x147 and 147xH12) prepared in example 3 to bind to PD-L1 and LAG3, an ELISA test was performed on BsAb. Briefly, human PD-L1-Fc protein (Xinbaino (Sinobio), 10084-H02H) and human LAG3-His protein (Xinbaino, 16498-H08H) were used at 0.5. mu.g/ml in PBS at 4 ℃)Each of which was coated onto microtiter plates at 100. mu.l/well overnight and then blocked with 100. mu.l/well of 5% BSA. Four-fold dilutions of each BsAb starting at 100nM were added to each well and incubated for 1-2 hours at room temperature. Plates were washed with PBS/Tween and then conjugated with horseradish peroxidase (HRP)(Pierce, catalog number 31413)The goat anti-human IgG antibody was incubated at room temperature for 1 hour. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. The results are shown in fig. 33. As shown in fig. 33, all of the bsabs tested were able to bind both human PD-L1 and human LAG3 proteins with high activity.
4.2. Binding affinity of bispecific antibodies
By BIACORETMThe bispecific antibodies (BsAb; 147XH12, 147H3807xB6 and B6x147H3807) prepared in example 3 were tested for binding affinity to PD-L1 protein and human LAG3 protein (bispecific antibody binds to PD-L1 and LAG3) using a capture method.
The results are shown in Table 34.
[ Table 34]
Antibodies
Human PD-L1(KD (M))
Human LAG3(KD (M))
147xH12
2.74E-08
1.35E-08
147H3807xB6
5.94E-09
1.63E-09
B6x147H3807
1.18E-09
8.87E-09
As shown in table 34 and figure 33, the bispecific antibodies tested showed relatively high binding affinity to both human PD-L1 and human LAG3 protein.
In addition, SEE assays were performed and the results obtained are shown in figure 34, indicating that the bispecific antibodies tested inhibited binding between MHC II and LAG3, thereby increasing T cell activity via MHC II and TCR.
4.3. Activity of bispecific antibodies to promote human T cell immune response
To test the ability of bispecific antibodies to stimulate T cell responses, Jurkat cell activation assays were used. Jurkat cells transfected with human Lag3 and Pd1 by lentivirus were used as responder cells. Raji cells overexpressing PDL1 were used as Antigen Presenting Cells (APC). Staphylococcal enterotoxin e (see) is a superantigen which is used as a stimulator in this assay. In this system, ectopically expressed huLAG3 and huPD-1 inhibited IL-2 production by Jurkat cells stimulated by SE, while
To further evaluate the in vitro function of bispecific antibodies against primary T cells, a mixed lymphocyte reaction was performed. Human Dendritic Cells (DCs) were differentiated from CD14+ monocytes in the presence of GM-CSF and IL-4 for 7 days. CD4+ T cells isolated from another donor were then co-cultured with DCs and serially diluted antibodies. The culture supernatants were assayed for
4.4. Tumor growth inhibition by bispecific antibodies (in vivo assay)
A double humanized mouse was used that expresses the extracellular domains of human PD-1 and
Example 5 characterization of bispecific antibodies 147XH12 and 147(H3807) XH12
5.1. Binding of bispecific antibodies
To evaluate the binding activity of LAG3 of the bispecific antibodies (BsAb; 147xH12 and 147(H3807) xH12) prepared in example 3, an ELISA test was performed on BsAb. Briefly, microtiter plates were plated with 0.5. mu.g/ml human LAG3-His protein in PBS at 4 ℃(Xinbainuo, 16498-H08H)Coated overnight at 100. mu.l/well and then blocked with 100. mu.l/well of 5% BSA. Four-fold dilutions of each BsAb starting at 100nM were added to each well and incubated for 1-2 hours at room temperature. Plates were washed with PBS/Tween and then incubated with goat anti-human IgG antibody conjugated with horseradish peroxidase (HRP) (Pierce, cat # 31413) for 1 hour at room temperature. After washing, the plates were developed with TMB substrate and analyzed by spectrophotometer at OD 450-630 nm. As shown in fig. 33, BsAb 147(H3807) xH12 showed more improved binding activity to human LAG3 protein.
5.2. Activity of bispecific antibodies to promote human T cell immune response
The effect of the bispecific antibody prepared in example 3 was further investigated using PBMCs from healthy donors. Briefly, human DCs were allowed to differentiate for 7 days from CD14+ monocytes. Purified CD4+ T cells isolated from another donor were stimulated with
In addition, the effect of the bispecific antibody prepared in example 3 was investigated using PBMCs from healthy donors. Briefly, human DCs were allowed to differentiate from CD14+ monocytes for 5 days, followed by LPS treatment for maturation. Whole T cells were isolated from another donor PBMC. Serial dilutions of the antibodies were then added to mature DC and T cell co-cultures and incubated for 5 days, and the media was collected to obtain IFN γ levels. As shown in figure 37, bispecific antibodies significantly stimulated IFN γ production in primary whole T cells over their corresponding combination of single antibodies. Data are shown as mean ± SD from duplicate wells.
5.3. Developability of bispecific antibodies
The developability regarding physicochemical properties of PD-L1 and LAG-3 bispecific antibodies (BsAb; B6x147H3807 and 147(H3807) xB6) was evaluated. The quality attributes of BsAb were evaluated by several analytical methods. Briefly, purity was measured by size exclusion-high performance liquid chromatography (SE-HPLC), and both bsabs showed high purity of over 99%. The thermostability was analyzed by protein thermal translocation (PTS) with fluorescently labeled real-time polymerase chain reaction (RT-PCR). Their melting temperatures were observed above 67 ℃, indicating that the test articles had stable structural integrity. To assess the solubility of the molecules, the proteins were concentrated to 20mg/mL using ultrafiltration (Amicon Ultra-15 rotary concentrator). As a result, no visible particles were observed by visual inspection, and no increase in aggregates was confirmed by SE-HPLC. The isoelectric point (pI) of each bsab measured by capillary isoelectric focusing (cIEF) was 8.26 and 8.35, respectively. This pI range is suitable for downstream process and formulation development. In general, as shown in table 19. It shows that the BsAb tested (B6x147H3807 and 147(H3807) xB6) have suitable physicochemical properties for successful development.
[ Table 35]
Example 6 effect of B3807 on inhibition of binding of FGL1 to LAG3
This example tested the activity of
It has recently been reported that fibrinogen-like protein 1(FGL1) is another functional ligand of LAG3 (Cell [ Cell ]. 2019; 176:1-14) in addition to MHC-II. FGL-1 is secreted by the liver and is highly produced by cancer cells. FGL-1 inhibits antigen-specific T cell activation, whereas blocking FGL-1 enhances the anti-tumor response. The interaction between FGL-1 and LAG3 may represent another mechanism of immune evasion.
Recombinant FGL-1 was coated at a concentration of 1. mu.g/ml in 96-well plates and incubated overnight at 4 ℃. Serial dilutions of
The scope of the present disclosure is not to be limited by the specific examples described, which are intended as illustrations of individual aspects of the disclosure, and any compositions or methods that are functionally equivalent are within the scope of the disclosure. It will be apparent to those skilled in the art that various modifications and variations can be made in the methods and compositions of the present disclosure without departing from the spirit or scope of the disclosure. Thus, it is intended that the present disclosure cover the modifications and variations of this disclosure provided they come within the scope of the appended claims and their equivalents.
All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
SEQUENCE LISTING
<110> environmental organisms
<120> anti-PD-
<130>P19113680CP
<150>PCT/CN2018/101547
<151>2018-08-21
<150>PCT/CN2019/087943
<151>2019-05-22
<160>555
<170>PatentIn version 3.5
<210>1
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>1
Ser Tyr Asp Met Ser
1 5
<210>2
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>2
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>3
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>3
Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>4
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>4
Lys Ala Ser Gln Asp Val Thr Pro Ala Val Ala
1 5 10
<210>5
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>5
Ser Thr Ser Ser Arg Tyr Thr
1 5
<210>6
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>6
Gln Gln His Tyr Thr Thr Pro Leu Thr
1 5
<210>7
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>7
Glu Val Lys Leu Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Thr Pro Glu Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Ser Val Thr Val Ser Ser
115
<210>8
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>8
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>9
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>9
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>10
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>10
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>11
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>11
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>12
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>12
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>13
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>13
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>14
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>14
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>15
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>15
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>16
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>16
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ser Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>17
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>17
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>18
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>18
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>19
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>19
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 1015
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Glu Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>20
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>20
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys AlaAla Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>21
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>21
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Val Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>22
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>22
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>23
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>23
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>24
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>24
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 4045
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>25
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>25
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser AspGly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>26
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>26
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Thr Pro Glu Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>27
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>27
Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly
1 5 10 15
Asp Arg Val Ser Ile Ser Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala
65 70 75 80
Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
100 105
<210>28
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>28
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>29
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>29
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>30
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>30
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>31
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>31
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>32
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>32
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>33
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>33
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Ser Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>34
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>34
gaggtgaagc tggtggagag cggcggagat ctggtgaagc ctggcggcag cctgaagctg 60
agctgtgccg ccagcggctt caccttcagc agctacgaca tgagctgggt gaggcagacc 120
cccgagaaga gcctggagtg ggtggccacc atcagcgatg gcggcggcta catctactac 180
agcgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa caacctgtac 240
ctgcagatga gcagcctgag gagcgaggac accgccctgt acatctgcgc cagggagttc 300
ggcaagaggt acgccctgga ctactgggga cagggcacca gcgtgaccgt gagcagc 357
<210>35
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>35
gaggtgcagc tggtggagag cggaggagga ctggtgaagc ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaag gcctggagtg ggtgagcacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>36
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>36
gaggtgcagc tggtggagag cggaggagga ctggtgaagc ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaag gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>37
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>37
gaggtgcagc tggtggagag cggaggagga ctggtgaagc ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>38
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>38
gaggtgcagc tggtggagag cggaggagga ctggtgaagc ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctggat cagacaggcc 120
cctggcaaag gcctggagtg ggtgagcacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>39
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>39
gaggtgcagc tggtggagag cggaggagga ctggtgaagc ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctggat cagacaggcc 120
cctggcaaag gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>40
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>40
gaggtgcagc tggtggagag cggaggagga ctggtgaagc ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>41
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>41
gaggtgcagc tgctggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaag gcctggagtg ggtgagcacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>42
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>42
gaggtgcagc tgctggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acagcaagaa caccctgtac 240
ctgcagatga acagcctgag ggccgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>43
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>43
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaag gcctggagtg ggtgagcacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>44
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>44
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaag gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt actactgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>45
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>45
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>46
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>46
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgaag gcggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>47
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>47
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg cgggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>48
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>48
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg ttggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagc 357
<210>49
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>49
gaggtgcagc tggtggagtc cggaggaggc ctggtgcaac ctggaggctc cctgaggctg 60
tcctgtgccg cttccggctt caccttcagc tcctacgata tgagctgggt gaggcaggct 120
cctggaaagg gcctggagtg ggtggccacc atctccgacg gaggcggcta catctactac 180
tccgactccg tgaagggcag gttcaccatc tcccgggaca acgccaagaa ctccctgtac 240
ctgcagatga actctctcag ggctgaggac accgccgtgt attactgcgc cagggagttt 300
ggcaagaggt acgccctgga ttactggggc cagggcacac tggtgacagt gagctcc 357
<210>50
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>50
gaggtgcagc tggtggagtc cggaggaggc ctggtgcaac ctggaggctc cctgaggctg 60
tcctgtgccg cttccggctt caccttcagc tcctacgata tgagctgggt gaggcaggct 120
cctggaaagg gcctggagtg ggtggccacc atctccgacg gaggcggcta catctactac 180
tccgactccg tgaagggcag gttcaccatc tcccgggaca acgccaagaa ctccctgtac 240
ctgcagatga actctctcag ggctgaggac accgccgtgt atatctgcgc cagggagttt 300
ggcaagaggt acgccctgga ttactggggc cagggcacac tggtgacagt gagctcc 357
<210>51
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>51
gaggtgcagc tggtggagtc cggaggaggc ctggtgcaac ctggaggctc cctgaggctg 60
tcctgtgccg cttccggctt caccttcagc tcctacgata tgagctgggt gaggcaggct 120
cctggaaagg gcctggagtg ggtggccacc atctccgacg gaggcggcta catctactac 180
tccgactccg tgaagggcag gttcaccatc tcccgggaca acgccaagaa caacctgtac 240
ctgcagatga actctctcag ggctgaggac accgccgtgt atatctgcgc cagggagttt 300
ggcaagaggt acgccctgga ttactggggc cagggcacac tggtgacagt gagctcc 357
<210>52
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>52
gaggtgcagc tggtggagtc cggaggaggc ctggtgcaac ctggaggctc cctgaggctg 60
tcctgtgccg cttccggctt caccttcagc tcctacgata tgagctgggt gaggcagacc 120
cctgagaaga gcctggagtg ggtggccacc atctccgacg gaggcggcta catctactac 180
tccgactccg tgaagggcag gttcaccatc tcccgggaca acgccaagaa caacctgtac 240
ctgcagatga actctctcag ggctgaggac accgccgtgt atatctgcgc cagggagttt 300
ggcaagaggt acgccctgga ttactggggc cagggcacac tggtgacagt gagctcc 357
<210>53
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>53
gaggtgcagc tggtggagtc cggaggaggc ctggtgcaac ctggaggctc cctgaggctg 60
tcctgtgccg cttccggctt caccttcagc tcctacgata tgagctgggt gaggcaggct 120
cctggaaagg gcctggagtg ggtggccacc atctccgacg gaggcggcta catctactac 180
tccgactccg tgaagggcag gttcaccatc tcccgggaca acgccaagaa ctccctgtac 240
ctgcagatga actctctcag ggctgaggac accgccgtgt atatctgcgc cagggagttt 300
ggcaagaggt acgccctgga ttactggggc cagggcacaa ccgtgacagt gagctcc 357
<210>54
<211>321
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>54
gacatcgtga tgacccagag ccacaagttc atgagcacca gcgtgggcga tagggtgagc 60
atcagctgca aggccagcca ggatgtgacc cctgccgtgg cctggtacca gcagaagccc 120
ggccagagcc ccaagctgct gatctacagc accagcagca ggtacaccgg cgtgcccgac 180
aggttcacag gaagcggcag cggcaccgac ttcaccttca ccatcagcag cgtgcaggcc 240
gaggacctgg ccgtgtacta ctgccagcag cactacacca cccctctgac cttcggcgcc 300
ggcaccaagc tggagctgaa g 321
<210>55
<211>321
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>55
gacatccaga tgacccagag ccctagcagc ctgagcgcta gcgtgggcga cagggtgacc 60
atcacctgca aggccagcca ggatgtgacc cctgccgtgg cctggtacca gcagaagccc 120
ggcaaggccc ccaagctgct gatctacagc accagcagca ggtacaccgg cgtgcccagc 180
aggtttagcg gaagcggcag cggcaccgac ttcaccttca ccatcagcag cctgcagccc 240
gaggacatcg ccacctacta ctgccagcag cactacacca cccctctgac cttcggccag 300
ggcaccaagc tggagatcaa g 321
<210>56
<211>321
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>56
gacatccaga tgacccagag ccctagcagc ctgagcgcta gcgtgggcga cagggtgacc 60
atcacctgca aggccagcca ggatgtgacc cctgccgtgg cctggtacca gcagaagccc 120
ggcaagtccc ccaagctgct gatctacagc accagcagca ggtacaccgg cgtgcccagc 180
aggtttagcg gaagcggcag cggcaccgac ttcaccttca ccatcagcag cctgcagccc 240
gaggacatcg ccacctacta ctgccagcag cactacacca cccctctgac cttcggccag 300
ggcaccaagc tggagatcaa g 321
<210>57
<211>324
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>57
gacattcaga tgacccagtc ccctagcagc ctgtccgctt ccgtgggcga cagggtgacc 60
atcacctgca aggccagcca ggacgtgaca cctgctgtgg cctggtatca acagaagcct 120
ggcaaggctc ctaagctcct gatctacagc acatcctccc ggtacaccgg agtgccctcc 180
aggtttagcg gcagcggctc cggcaccgat ttcaccctga ccatttcctc cctgcagccc 240
gaggacttcg ccacctacta ctgccagcag cactacacca cacccctgac cttcggccag 300
ggcaccaagc tggagatcaa gcgg 324
<210>58
<211>324
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>58
gacattcaga tgacccagtc ccctagcagc ctgtccgctt ccgtgggcga cagggtgacc 60
atcacctgca aggccagcca ggacgtgaca cctgctgtgg cctggtatca acagaagcct 120
ggcaaggctc ctaagctcct gatctacagc acatcctccc ggtacaccgg agtgcccgac 180
aggtttaccg gcagcggctc cggcaccgat ttcaccctga ccatttcctc cctgcagccc 240
gaggacttcg ccacctacta ctgccagcag cactacacca cacccctgac cttcggccag 300
ggcaccaagc tggagatcaa gcgg 324
<210>59
<211>324
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>59
gacattcaga tgacccagtc ccctagcagc ctgtccgctt ccgtgggcga cagggtgacc 60
atcacctgca aggccagcca ggacgtgaca cctgctgtgg cctggtatca acagaagcct 120
ggccagagcc ctaagctcct gatctacagc acatcctccc ggtacaccgg agtgcccgac 180
aggtttaccg gcagcggctc cggcaccgat ttcaccctga ccatttcctc cctgcagccc 240
gaggacttcg ccacctacta ctgccagcag cactacacca cacccctgac cttcggccag 300
ggcaccaagc tggagatcaa gcgg 324
<210>60
<211>324
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>60
gacattcaga tgacccagtc ccctagcagc ctgtccgctt ccgtgggcga cagggtgacc 60
atcagctgca aggccagcca ggacgtgaca cctgctgtgg cctggtatca acagaagcct 120
ggccagagcc ctaagctcct gatctacagc acatcctccc ggtacaccgg agtgcccgac 180
aggtttaccg gcagcggctc cggcaccgat ttcaccctga ccatttcctc cctgcagccc 240
gaggacttcg ccacctacta ctgccagcag cactacacca cacccctgac cttcggccag 300
ggcaccaagc tggagatcaa gcgg 324
<210>61
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>61
Thr Tyr Asp Met Ser
1 5
<210>62
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>62
Cys Tyr Asp Met Ser
1 5
<210>63
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>63
Ser Phe Asp Met Ser
1 5
<210>64
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>64
Ser His Asp Met Ser
1 5
<210>65
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>65
Ser Trp Asp Met Ser
1 5
<210>66
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>66
Ser Tyr Asp Met Thr
1 5
<210>67
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>67
Ser Tyr Asp Met Cys
1 5
<210>68
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>68
Thr Ile Ser Asp Gly Gly Ala Tyr Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>69
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>69
Thr Ile Ser Asp Gly Gly Pro Tyr Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>70
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>70
Thr Ile Ser Asp Gly Gly Gly Phe Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>71
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>71
Thr Ile Ser Asp Gly Gly Gly His Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>72
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>72
Thr Ile Ser Asp Gly Gly Gly Trp Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>73
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>73
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Thr Val Lys
1 5 10 15
Gly
<210>74
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>74
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Cys Val Lys
1 5 10 15
Gly
<210>75
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>75
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Leu Lys
1 5 10 15
Gly
<210>76
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>76
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Ile Lys
1 5 10 15
Gly
<210>77
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>77
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Met Lys
1 5 10 15
Gly
<210>78
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>78
Gln Phe Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>79
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>79
Asp Phe Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>80
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>80
Asn Phe Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>81
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>81
Glu Tyr Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>82
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>82
Glu His Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>83
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>83
Glu Trp Gly Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>84
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>84
Glu Phe Ala Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>85
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>85
Glu Phe Pro Lys Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>86
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>86
Glu Phe Gly Arg Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>87
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>87
Glu Phe Gly Lys Lys Tyr Ala Leu Asp Tyr
1 5 10
<210>88
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>88
Glu Phe Gly Lys Arg Phe Ala Leu Asp Tyr
15 10
<210>89
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>89
Glu Phe Gly Lys Arg His Ala Leu Asp Tyr
1 5 10
<210>90
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>90
Glu Phe Gly Lys Arg Trp Ala Leu Asp Tyr
1 5 10
<210>91
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>91
Lys Ala Thr Gln Asp Val Thr Pro Ala Val Ala
1 5 10
<210>92
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>92
Lys Ala Cys Gln Asp Val Thr Pro Ala Val Ala
1 5 10
<210>93
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>93
Thr Thr Ser Ser Arg Tyr Thr
1 5
<210>94
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>94
Cys Thr Ser Ser Arg Tyr Thr
1 5
<210>95
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>95
Ser Ser Ser Ser Arg Tyr Thr
1 5
<210>96
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>96
Ser Met Ser Ser Arg Tyr Thr
1 5
<210>97
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>97
Ser Val Ser Ser Arg Tyr Thr
1 5
<210>98
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>98
Ser Thr Thr Ser Arg Tyr Thr
1 5
<210>99
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>99
Ser Thr Cys Ser Arg Tyr Thr
1 5
<210>100
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>100
Ser Thr Ser Thr Arg Tyr Thr
1 5
<210>101
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>101
Ser Thr Ser Cys Arg Tyr Thr
1 5
<210>102
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>102
Ser Thr Ser Ser Lys Tyr Thr
1 5
<210>103
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>103
Ser Thr Ser Ser Arg Phe Thr
1 5
<210>104
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>104
Ser Thr Ser Ser Arg His Thr
1 5
<210>105
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>105
Ser Thr Ser Ser Arg Trp Thr
1 5
<210>106
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>106
Glu Gln His Tyr Thr Thr Pro Leu Thr
1 5
<210>107
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>107
Asp Gln His Tyr Thr Thr Pro Leu Thr
1 5
<210>108
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>108
Asn Gln His Tyr Thr Thr Pro Leu Thr
1 5
<210>109
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>109
Gln Glu His Tyr Thr Thr Pro Leu Thr
1 5
<210>110
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>110
Gln Asp His Tyr Thr Thr Pro Leu Thr
1 5
<210>111
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>111
Gln Asn His Tyr Thr Thr Pro Leu Thr
1 5
<210>112
<211>357
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>112
gaagtgaaac tggtggagtc tgggggagac ttagtgaagc ctggagggtc cctgaaactc 60
tcctgtgcag cctctggatt cactttcagt agctatgaca tgtcttgggt tcgccagact 120
ccggagaaga gtctggagtg ggtcgcaacc attagtgatg gtggtggtta catctactat 180
tcagacagtg tgaaggggcg atttaccatc tccagagaca atgccaagaa caacctgtac 240
ctgcaaatga gcagtctgag gtctgaggac acggccttgt atatttgtgc aagagaattt 300
ggtaagcgct atgctttgga ctactggggt caaggaacct cagtcaccgt ctcctca 357
<210>113
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>113
Glu Val Lys Leu Val Glu Ser Gly Gly Asp Leu Val Lys Pro Gly Gly
1 5 10 15
Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Thr Pro Glu Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr
65 70 75 80
Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Ser Val Thr
115
<210>114
<211>321
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>114
gacattgtga tgacccagtc tcacaaattc atgtccacat cggtaggaga cagggtcagc 60
atctcctgca aggccagtca ggatgtgact cctgctgtcg cctggtatca acagaagcca 120
ggacaatctc ctaaactact gatttactcc acatcctccc ggtacactgg agtccctgat 180
cgcttcactg gcagtggatc tgggacggat ttcactttca ccatcagcag tgtgcaggct 240
gaagacctgg cagtttatta ctgtcagcaa cattatacta ctccgctcac gttcggtgct 300
gggaccaagc tggagctgaa a 321
<210>115
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>115
Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly
1 5 10 15
Asp Arg Val Ser Ile Ser Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Val Gln Ala
65 70 75 80
Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys
100 105
<210>116
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>116
Ser Tyr Ala Ile Ser
1 5
<210>117
<211>5
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>117
Ser Tyr Ala Met Ser
1 5
<210>118
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>118
Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe Gln
1 5 10 15
Gly
<210>119
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>119
Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys
1 5 10 15
Gly
<210>120
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>120
Ala Arg Gly Ser Ser Trp Phe Asp Tyr
1 5
<210>121
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>121
Ala Ser Ser Tyr His Gly Gly Gly Tyr His Arg Tyr
1 5 10
<210>122
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>122
Thr Thr Ser Lys Tyr Ser Gly Ser Ala Leu Arg Tyr
1 5 10
<210>123
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>123
Ala Arg Asp Arg Thr Gly Ala Phe Asp Tyr
1 5 10
<210>124
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>124
Ala Arg His Glu Thr Val Ala Gly Ser Phe Asp Tyr
1 5 10
<210>125
<211>15
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>125
Ala Arg Thr Gly Tyr Tyr Gly Gly Asn Ser Gly Ala Phe Asp Ile
1 5 10 15
<210>126
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>126
Ala Arg Ala Gly Thr Gly Met Asp Leu Val Phe Asn Ser
1 5 10
<210>127
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>127
Ala Arg Gly Leu Ala Arg Gly Asp Leu Asn Phe Gly Tyr
1 5 10
<210>128
<211>8
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>128
Thr Arg Glu Pro His Phe Asp Tyr
1 5
<210>129
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>129
Thr Thr Ala Ala Pro Gly Ser Tyr Tyr Leu Val Phe His Tyr
1 5 10
<210>130
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>130
Ala Arg Asp Ala Gly Pro Val Gly Tyr Tyr Gly Met Asp Val
1 5 10
<210>131
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>131
Ala Gly Asp Gly Leu Tyr Gly Ser Gly Ser Phe Gly Tyr
1 5 10
<210>132
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>132
Ala Lys Asp Ile Arg Trp Phe Tyr Gly Met Asp Val
1 5 10
<210>133
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>133
Ala Arg His Glu Ser Gly Ile Ala Gly Gly His Phe Asp Tyr
1 5 10
<210>134
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>134
Ala Lys Asp Ile Arg Trp Tyr Tyr Gly Met Asp Val
1 5 10
<210>135
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>135
Ala Lys Gly Val Arg Gly Thr Tyr Gln Ile Gly Tyr Tyr Gly Met Asp
1 5 10 15
Val
<210>136
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>136
Ala Arg Gln Gly Thr Ala Met Ala Leu Asp Tyr
1 5 10
<210>137
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>137
Val Arg Asp Leu Gln Asp Trp Asn Tyr Gly Gly Ala Ala Tyr
1 5 10
<210>138
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>138
Ala Arg Asp Asp Tyr Tyr Tyr Gly Gln Phe Asp Ser
1 5 10
<210>139
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>139
Ala Arg Glu Ile Thr Gly Thr Ser Tyr Thr Ala Leu Asp Ser
1 5 10
<210>140
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>140
Ala Arg Gly His Ile Asp Gly Gln Ala Ala Gly Asp Tyr
1 5 10
<210>141
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>141
Ala Ala Ser Thr Leu Arg Val Pro Asn Pro Pro Tyr
1 5 10
<210>142
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>142
Ala Arg Ser Gly Asp Arg Tyr Asp Phe Trp Ser Gly Tyr
15 10
<210>143
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>143
Thr Arg Gly Gln Asp Ser Thr Trp Tyr Ser Ser Phe Asp Tyr
1 5 10
<210>144
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>144
Ala Ala Ser Thr Leu Arg Leu Pro Asn Pro Pro Tyr
1 5 10
<210>145
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>145
Ala Thr Thr Gln Thr Ser Phe Tyr Ser His Gly Met Asp Val
1 5 10
<210>146
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>146
Ala Arg Val Arg Lys Thr Pro Phe Trp Gly Ala Leu Asp Ser
1 5 10
<210>147
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>147
Ala Arg Gly Phe Thr Tyr Gly Asp Phe Ile Phe Asp Tyr
1 5 10
<210>148
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>148
Ala Arg Asp Val Arg Gly Val Thr Tyr Leu Gly Met Asp Val
1 5 10
<210>149
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>149
Ala Arg Val ArgLys Thr Pro Phe Trp Gly Thr Leu Asp Ser
1 5 10
<210>150
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>150
Ala Arg Val Arg Arg Thr Pro Phe Trp Gly Ala Leu Asp Ser
1 5 10
<210>151
<211>18
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>151
Ala Lys Arg Lys Gly Leu Gly Ser Pro Thr Asp Tyr Tyr Tyr Gly Met
1 5 10 15
Asp Val
<210>152
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>152
Val Arg Pro Glu Tyr Asp Thr Tyr Tyr Tyr Gly Met Asp Val
1 5 10
<210>153
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>153
Ala Lys Gly Gly Gly Ser Tyr Asp Tyr
1 5
<210>154
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>154
Ala Arg Ala Leu Asn Gly Met Asp Val
1 5
<210>155
<211>20
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>155
Thr Arg Pro Leu Gln Gly Ile Ala Ala Ala Asp Ser Tyr Tyr Tyr Tyr
1 5 10 15
Ala Met Asp Val
20
<210>156
<211>13
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>156
Ala Arg Leu His Ser Tyr Leu Ser Glu Glu Phe Asp Pro
1 5 10
<210>157
<211>12
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>157
Ala Lys Leu Ser Ala Val Asn Thr Tyr Ile Asp Asp
1 5 10
<210>158
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>158
Ala Arg Val Thr Lys Thr Pro Phe Trp Gly Thr Leu Asp Tyr
1 5 10
<210>159
<211>14
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>159
Ala Arg Val Ser Gln Ser Pro Val Trp Gly TyrPhe Asp Tyr
1 5 10
<210>160
<211>15
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>160
Ala Lys Asp Gly Tyr Tyr Asp Phe Trp Ser Gly Tyr Ser Asp Tyr
1 5 10 15
<210>161
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>161
Gln Ala Asn Gln Asp Ile His His Tyr Leu Asn
1 5 10
<210>162
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>162
Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Ser Asn Lys Asn Tyr Leu
1 5 10 15
Ala
<210>163
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>163
Lys Ser Ser Gln Ser Val Leu Tyr Ser Ser Asn Asn Lys Asn Tyr Leu
1 5 10 15
Ala
<210>164
<211>16
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>164
Arg Ser Ser Gln Asn Leu Leu His Ser Asp Gly Tyr Asn Tyr Leu Asn
1 5 10 15
<210>165
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>165
Lys Ser Ser Gln Ser Val Leu Tyr Thr Ser Asn Asn Lys Asn Tyr Leu
1 5 10 15
Ala
<210>166
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>166
Gln Ala Ser Gln Asp Ile Asn Arg Tyr Leu Ser
1 5 10
<210>167
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>167
Gln Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn
1 5 10
<210>168
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>168
Arg Ala Ser Gln Thr Ile Ser Ser His Leu Asn
1 5 10
<210>169
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>169
Arg Ala Ser Gln Gly Ile Ala Gly Trp Leu Ala
1 5 10
<210>170
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>170
Arg Ala Ser Gln Gly Val Ser Ser Trp Leu Ala
1 5 10
<210>171
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>171
Lys Ser Ser Gln Ser Leu Phe Tyr His Ser Asn Asn His Asn Tyr Leu
1 5 10 15
Ala
<210>172
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>172
Arg Ala Ser Gln Gly Ile Ser Ser Ser Leu Ala
1 5 10
<210>173
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>173
Gln Ala Ser Arg Asp Ile Ser Asn Ser Leu Ser
1 5 10
<210>174
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>174
Arg Ala Ser Gln Ser Ile Ser Arg Tyr Leu Asn
1 5 10
<210>175
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>175
Arg Ala Ser Arg Ser Ile Ser Asn Trp Leu Ala
1 5 10
<210>176
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>176
Lys Ser Ser Gln Ser Val Phe Tyr Arg Ser Asn Gln Lys Asn Tyr Leu
1 5 10 15
Ala
<210>177
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>177
Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala
1 5 10
<210>178
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>178
Arg Ala Ser Arg Gly Ile Ser Ser Trp Leu Ala
1 5 10
<210>179
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>179
Arg Ala Ser Gln Gly Ile Ser Ser Trp Leu Ala
1 5 10
<210>180
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>180
Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn
1 5 10
<210>181
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>181
Arg Ala Ser Gln Ala Ile Ser Asn Leu Leu Ala
1 5 10
<210>182
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>182
Arg Ala Ser Gln Gly Ile Ser Thr Trp Leu Ala
1 5 10
<210>183
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>183
Arg Ala Ser Gln Gly Ile Ala Ser Asn Leu Ala
1 5 10
<210>184
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>184
Arg Ala Ser Gln Gly Val Ser Ser Tyr Leu Ala
1 5 10
<210>185
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>185
Arg Ala Ser Gln Ser Ile Tyr Thr Tyr Leu Asn
1 5 10
<210>186
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>186
Arg Ala Ser Gln Phe Val Ser Asp Trp Leu Ala
1 5 10
<210>187
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>187
Arg Ala Ser Gln Thr Ile Ser Thr Trp Leu Ala
1 5 10
<210>188
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>188
Arg Ala Ser Gln Gly Ile Ser Ser Tyr Leu Ala
1 5 10
<210>189
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>189
Arg Ala Ser Gln Ser Ile Gly Tyr Trp Leu Ala
1 5 10
<210>190
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>190
Arg Ala Thr Gln Ser Ile Ser Ser Trp Leu Ala
1 5 10
<210>191
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>191
Arg Ala Ser Gln Gly Val Arg Asn Trp Leu Ala
1 5 10
<210>192
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>192
Arg Ala Ser Gln Ser Ile Asn Asn Tyr Leu Ala
1 5 10
<210>193
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>193
Arg Ala Ser Gln Asp Ile Thr Ser Trp Leu Ala
1 5 10
<210>194
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>194
Arg Ala Ser Gln Gly Ile Tyr Asp Tyr Leu Ala
1 5 10
<210>195
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>195
Arg Ala Ser Glu Gly Ile Ser Gly Trp Leu Ala
1 5 10
<210>196
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>196
Asp Ala Ser Ile Leu Gln Ser
1 5
<210>197
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>197
Trp Ala Ser Thr Arg Glu Ser
1 5
<210>198
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>198
Leu Gly Ser Asn Arg Ala Thr
1 5
<210>199
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>199
Asp Ala Ser Asn Leu Glu Thr
1 5
<210>200
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>200
Ala Ala Ser Ser Leu Gln Ser
1 5
<210>201
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>201
Ala Ala Ser Thr Leu Gln Ser
1 5
<210>202
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>202
Ala Ala Phe Ser Leu Gln Ser
1 5
<210>203
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>203
Gly Ala Ser Ser Arg Ala Thr
1 5
<210>204
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>204
Gly Ile Ser Ser Arg Ala Thr
1 5
<210>205
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>205
Ala Val Ser Thr Leu Gln Ser
1 5
<210>206
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>206
Asp Ile Ser Thr Leu Gln Asn
1 5
<210>207
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>207
Gly Ala Ser Thr Leu Gln Ser
1 5
<210>208
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>208
Gly Ala Ser Ser Leu Gln Ser
1 5
<210>209
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>209
Ala Ala Ser Thr Leu Glu Ser
1 5
<210>210
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>210
Asp Ala Ser Ser Leu Gln Ser
1 5
<210>211
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>211
Lys Ala Ser Asn Leu Gln Ser
1 5
<210>212
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>212
Thr Ala Ser Thr Leu Gln Asn
1 5
<210>213
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>213
Arg Ala Ser Ser Leu Gln Ser
1 5
<210>214
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>214
Ala Ala Ser His Leu Gln Ser
1 5
<210>215
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>215
Asp Ala Ser Thr Leu Gln Ser
1 5
<210>216
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>216
Ala Ala Ser Asn Leu Glu Arg
1 5
<210>217
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>217
Ala Ala Ser Ser Leu Glu Thr
1 5
<210>218
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>218
Gln Gln Ala Asp Ser Phe Pro Ile Thr
1 5
<210>219
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>219
Gln Gln Ser Tyr Ser Thr Pro Trp Thr
1 5
<210>220
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>220
Gln Gln Tyr Tyr Ser Thr Pro Trp Thr
1 5
<210>221
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>221
Gln Gln Ser Phe Thr Thr Pro Trp Thr
1 5
<210>222
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>222
Gln Gln Tyr Asp Asn Leu Pro Pro Thr
1 5
<210>223
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>223
Gln Gln Ser Tyr Gly Ser Pro Val Thr
1 5
<210>224
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>224
Gln Gln Gly Asn Ser Phe Pro Phe Thr
1 5
<210>225
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>225
Gln Gln Ala Lys Ser Phe Pro Leu Thr
1 5
<210>226
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>226
Gln Gln Val Lys Ser Phe Pro Leu Thr
1 5
<210>227
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>227
Gln Gln Tyr Tyr Asn Thr Pro Trp Thr
1 5
<210>228
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>228
Gln Gln Thr Lys Asn Phe Pro Leu Thr
1 5
<210>229
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>229
Arg Ala Ser Gln Asp Ile Val Asn Trp Leu Ala
1 5 10
<210>230
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>230
Gln Gln Thr Lys Ser Phe Pro Leu Thr
1 5
<210>231
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>231
Gln Gln Ser Tyr Asn Thr Pro Arg Thr
1 5
<210>232
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>232
Gln Gln Ser Tyr Arg Ala Pro Trp Thr
1 5
<210>233
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>233
Gln Gln Ala Asn Asn Phe Pro Leu Thr
1 5
<210>234
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>234
Gln Gln Gly Asn Ser Phe Pro Leu Thr
1 5
<210>235
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>235
Gln Gln Ser Lys Asn Phe Pro Val Thr
1 5
<210>236
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>236
Gln Gln Ala Asn Ser Phe Pro Leu Thr
1 5
<210>237
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>237
Gln Gln Leu Glu Ser Tyr Pro Leu Thr
1 5
<210>238
<211>8
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>238
Gln Gln Tyr Tyr Ser Ser Pro Thr
1 5
<210>239
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>239
Gln Gln Leu Lys Thr Phe Pro Leu Thr
1 5
<210>240
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>240
Gln Gln Thr Asn Trp Phe Pro Leu Thr
1 5
<210>241
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>241
Gln Gln Ala Gln Ser Phe Pro Ile Thr
1 5
<210>242
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>242
Gln Gln Ala His Ser Phe Pro Leu Thr
1 5
<210>243
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>243
Leu Gln Asp Tyr His Phe Pro Leu Thr
1 5
<210>244
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>244
Gln Gln Gly His Ser Phe Pro Leu Thr
1 5
<210>245
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>245
Gln Gln Ser Tyr Ile Phe Pro Leu Thr
1 5
<210>246
<211>8
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>246
Gln Gln Tyr Asp Thr Tyr Trp Thr
1 5
<210>247
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>247
Gln Gln Leu Asn Ser Tyr Pro Leu Phe Thr
1 5 10
<210>248
<211>8
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>248
Gln Gln Tyr Ser Ser Tyr Trp Thr
1 5
<210>249
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>249
Leu Gln His Asn Thr Tyr Pro Phe Thr
1 5
<210>250
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>250
Gln Gln Gly His Ser Phe Pro Leu Thr
1 5
<210>251
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>251
Gln Gln Ala His Ser Phe Pro Phe Thr
1 5
<210>252
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>252
Gln Gln Ala Asn Met Phe Pro Leu Thr
1 5
<210>253
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>253
Gln Gln Ala Asp Ser Phe Pro Phe Thr
1 5
<210>254
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>254
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
6570 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Gly Ser Ser Trp Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val
100 105 110
Thr Val Ser Ser
115
<210>255
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>255
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ser Ser Tyr His Gly Gly Gly Tyr His Arg Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>256
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>256
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Thr Thr Ser Lys Tyr Ser Gly Ser Ala Leu Arg Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>257
<211>117
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>257
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 9095
Ala Arg Asp Arg Thr Gly Ala Phe Asp Tyr Trp Gly Gln Gly Thr Leu
100 105 110
Val Thr Val Ser Ser
115
<210>258
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>258
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg His Glu Thr Val Ala Gly Ser Phe Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>259
<211>122
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>259
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Thr Gly Tyr Tyr Gly Gly Asn Ser Gly Ala Phe Asp Ile Trp
100 105 110
Gly Gln Gly Thr Met Val Thr Val Ser Ser
115 120
<210>260
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>260
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Ala Gly Thr Gly Met Asp Leu Val Phe Asn Ser Trp Gly Gln
100 105110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>261
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>261
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Gly Leu Ala Arg Gly Asp Leu Asn Phe Gly Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>262
<211>115
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>262
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Thr Arg Glu Pro His Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr
100 105 110
Val Ser Ser
115
<210>263
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>263
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Thr Thr Ala Ala Pro Gly Ser Tyr Tyr Leu Val Phe His Tyr Trp Gly
100 105 110
Gln Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>264
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>264
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Asp Ala Gly Pro Val Gly Tyr Tyr Gly Met Asp Val Trp Gly
100 105 110
Gln Gly Thr Thr Val Thr Val Ser Ser
115 120
<210>265
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>265
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Gly Asp Gly Leu Tyr Gly Ser Gly Ser Phe Gly Tyr Trp Gly Gln
100 105 110
Gly Thr Pro Val Thr Val Ser Ser
115 120
<210>266
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>266
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Asp Ile Arg Trp Phe Tyr Gly Met Asp Val Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser Trp
115 120
<210>267
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>267
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg His Glu Ser Gly Ile Ala Gly Gly His Phe Asp Tyr Trp Gly
100 105 110
Gln Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>268
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>268
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Asp Ala Gly Pro Val Gly Tyr Tyr Gly Met Asp Val Trp Gly
100 105 110
Gln Gly Thr Thr Val Thr Val Ser
115 120
<210>269
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>269
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Asp Ile Arg Trp Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>270
<211>124
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>270
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Phe Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Lys Gly Val Arg Gly Thr Tyr Gln Ile Gly Tyr Tyr Gly Met Asp
100 105 110
Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
115 120
<210>271
<211>118
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>271
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Gln Gly Thr Ala Met Ala Leu Asp Tyr Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser
115
<210>272
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>272
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Val Arg Asp Leu Gln Asp Trp Asn Tyr Gly Gly Ala Ala Tyr Trp Gly
100 105 110
Gln Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>273
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>273
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Asp Asp Tyr Tyr Tyr Gly Gln Phe Asp Ser Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>274
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>274
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 510 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Glu Ile Thr Gly Thr Ser Tyr Thr Ala Leu Asp Ser Trp Gly
100 105 110
Gln Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>275
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>275
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Gly His Ile Asp Gly Gln Ala Ala Gly Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>276
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>276
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala SerGly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Ser Thr Leu Arg Val Pro Asn Pro Pro Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>277
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>277
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Ser Gly Asp Arg Tyr Asp Phe Trp Ser Gly Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>278
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>278
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Ser Thr Leu Arg Val Pro Asn Pro Pro Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>279
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>279
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro GlyGln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Asp Ala Gly Pro Val Gly Tyr Tyr Gly Met Asp Val Trp Gly
100 105 110
Gln Gly Thr Met Val Thr Val Ser Ser
115 120
<210>280
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>280
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Thr Arg Gly Gln Asp Ser Thr Trp Tyr Ser Ser Phe Asp Tyr Trp Gly
100 105 110
Gln Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>281
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>281
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 4045
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Ser Thr Leu Arg Leu Pro Asn Pro Pro Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>282
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>282
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile IlePro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Thr Thr Gln Thr Ser Phe Tyr Ser His Gly Met Asp Val Trp Gly
100 105 110
Gln Gly Thr Thr Val Thr Val Ser Ser
115 120
<210>283
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>283
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Lys Thr Pro Phe Trp Gly Ala Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>284
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>284
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 5560
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Gly Phe Thr Tyr Gly Asp Phe Ile Phe Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>285
<211>121
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>285
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr
20 25 30
Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe
50 55 60
Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Asp Val Arg Gly Val Thr Tyr Leu Gly Met Asp Val Trp Gly
100 105 110
Gln Gly Thr Thr Val Thr Val Ser Ser
115 120
<210>286
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>286
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn ThrLeu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Lys Thr Pro Phe Trp Gly Thr Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>287
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>287
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
6570 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Arg Thr Pro Phe Trp Gly Ala Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>288
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>288
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Lys Thr Pro Phe Trp Gly Ala Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>289
<211>123
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>289
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys
85 90 95
Arg Lys Gly Leu Gly Ser Pro Thr Asp Tyr Tyr Tyr Gly Met Asp Val
100 105 110
Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
115 120
<210>290
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>290
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Lys Thr Pro Phe Trp Gly Ala Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>291
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>291
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Lys Thr Pro Phe Trp Gly Thr Leu Asp Ser Trp Gly Arg Gly
100 105 110
Ser Leu Val Thr Val Ser Ser
115
<210>292
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>292
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Val Arg
85 90 95
Pro Glu Tyr Asp Thr Tyr Tyr Tyr Gly Met Asp Val TrpGly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>293
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>293
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys
85 90 95
Gly Gly Gly Ser Tyr Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val
100105 110
Ser Ser
<210>294
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>294
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Ala Leu Asn Gly Met Asp Val Trp Gly Gln Gly Thr Met Val Thr Val
100 105 110
Ser Ser
<210>295
<211>125
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>295
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Thr Arg
85 90 95
Pro Leu Gln Gly Ile Ala Ala Ala Asp Ser Tyr Tyr Tyr Tyr Ala Met
100 105 110
Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
115 120 125
<210>296
<211>118
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>296
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Leu His Ser Tyr Leu Ser Glu Glu Phe Asp Pro Trp Gly Gln Gly Thr
100 105 110
Leu Val Thr Val Ser Ser
115
<210>297
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>297
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Lys Thr Pro Phe Trp Gly Ala Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>298
<211>117
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>298
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys
85 90 95
Leu Ser Ala Val Asn Thr Tyr Ile Asp Asp Trp Gly Gln Gly Thr Leu
100 105 110
Val Thr Val Ser Ser
115
<210>299
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>299
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Thr Lys Thr Pro Phe Trp Gly Thr Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>300
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>300
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Arg Arg Thr Pro Phe Trp Gly Ala Leu Asp Ser Trp Gly Arg Gly
100 105 110
Thr Leu Val Thr Val Ser Ser
115
<210>301
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>301
Gln LeuLeu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg
85 90 95
Val Ser Gln Ser Pro Val Trp Gly Tyr Phe Asp Tyr Trp Gly Gln Gly
100 105 110
Met Leu Val Thr Val Ser Ser
115
<210>302
<211>120
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>302
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu
1 5 10 15
Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met
20 25 30
Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala
35 40 45
Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
50 55 60
Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln
65 70 75 80
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys
85 90 95
Asp Gly Tyr Tyr Asp Phe Trp Ser Gly Tyr Ser Asp Tyr Trp Gly Gln
100 105 110
Gly Thr Leu Val Thr Val Ser Ser
115 120
<210>303
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>303
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Phe Val Gly
1 510 15
Asp Arg Val Thr Ile Thr Cys Gln Ala Asn Gln Asp Ile His His Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Ile Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Ala Asp Ser Phe Pro Ile
85 90 95
Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg
100 105
<210>304
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>304
Glu Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser
20 25 30
Ser Ser Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
85 90 95
Ser Tyr Ser Thr Pro Trp Thr Phe Gly Pro Gly Thr Lys Leu Glu Ile
100 105 110
Lys Arg
<210>305
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>305
Asp Ile Gln Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser
20 25 30
Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly His
35 40 45
Pro Pro Lys Leu Leu Val Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Ala Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Thr Leu Ala
65 70 75 80
Ile Ser Asn Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln
85 90 95
Tyr Tyr Ser Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
100 105 110
Lys Arg
<210>306
<211>113
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>306
Glu Ile Val Leu Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn Leu Leu His Ser
20 25 30
Asp Gly Tyr Asn Tyr Leu Asn Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Thr Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile
65 70 75 80
Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser
85 90 95
Tyr Ser Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg
<210>307
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>307
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Thr
20 25 30
Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ser Gly SerGly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Ile Tyr Tyr Cys Gln Gln
85 90 95
Tyr Tyr Ser Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile
100 105 110
Lys Arg
<210>308
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>308
Ala Ile Gln Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser
20 25 30
Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Ala Glu Asp Ser Ala Thr Tyr Tyr Cys Gln Gln
85 90 95
Ser Phe Thr Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
100 105 110
Lys Arg
<210>309
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>309
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Asn Arg Tyr
20 25 30
Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Ala Ser Gly Thr Asp Phe Thr Phe Ala Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp Asn Leu Pro Pro
85 90 95
Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg
100 105
<210>310
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>310
Glu Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Ser Tyr Tyr Cys Gln Gln Ser Tyr Gly Ser Pro Val
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>311
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>311
Glu Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Arg Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Ala Asp Ser Phe Pro Ile
85 90 95
Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg
100 105
<210>312
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>312
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Thr Ile Ser Ser His
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Val Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Ser Phe Pro Phe
85 90 95
Thr Phe Gly Pro Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>313
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>313
Ala Ile Arg Met Thr Gln Ser ProSer Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ala Gly Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Ala Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>314
<211>113
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>314
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser
20 25 30
Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ser Gly Thr Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln
85 90 95
Ser Tyr Ser Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile
100 105 110
Lys
<210>315
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>315
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Val Ser Ala Phe Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Ser Ser Trp
20 25 30
Leu Ala Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Arg Gly Tyr Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Leu Ala Thr Tyr Tyr Cys Gln Gln Val Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Asp Ile Lys Arg
100 105
<210>316
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>316
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Phe Tyr His
20 25 30
Ser Asn Asn His Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg GlnSer Gly Val
50 55 60
Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln
85 90 95
Tyr Tyr Asn Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
100 105 110
Lys Arg
<210>317
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>317
Ala Ile Arg Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ala Gly Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser AlaSer Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>318
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>318
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Val Ser Ala Phe Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Ser Ser Trp
20 25 30
Leu Ala Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Arg Gly Tyr Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Leu Ala Thr Tyr Tyr Cys Gln Gln Val Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Asp Ile Lys Arg
100 105
<210>319
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>319
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Ser
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile
35 40 45
Tyr Thr Ala Ser Thr Leu Gln Asn Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Gly Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Lys Asn Phe Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg
100 105
<210>320
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>320
Glu Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser
20 25 30
Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Arg Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Ser Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Ala Asp Phe Ser Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln
85 90 95
Tyr Tyr Ser Thr Pro Trp Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile
100 105 110
Lys Arg
<210>321
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>321
Val Ile Trp Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Ser Val Thr Ile Thr Cys Gln Ala Ser Arg Asp Ile Ser Asn Ser
20 25 30
Leu Ser Trp His Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>322
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>322
Glu Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Ser Ile Ser Arg Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Phe Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Asn Thr Pro Arg
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>323
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>323
Asp Val Val Met Thr Gln Ser Pro Ser Thr Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Ile Thr Ile Thr Cys Arg Ala Ser Arg Ser Ile Ser Asn Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105
<210>324
<211>114
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>324
Asp Ile Gln Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Phe Tyr Arg
2025 30
Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Thr Pro Arg Leu Leu Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile
50 55 60
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr
65 70 75 80
Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln
85 90 95
Ser Tyr Arg Ala Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile
100 105 110
Lys Arg
<210>325
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>325
Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Gly Ile Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Asn Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>326
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>326
Glu Ile Val Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Arg Gly Ile Ser Ser Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
5055 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>327
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>327
Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly
1 5 10 15
Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile
35 40 45
Tyr Gly Ile Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 7580
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Asn Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>328
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>328
Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Lys Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>329
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>329
Ala Ile Arg Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile
35 40 45
Tyr Ala Val Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Val Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Asn Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>330
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>330
Asp Ile Gln Leu Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ala Ile Ser Asn Leu
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro Pro Asn Leu Leu Ile
35 40 45
Tyr Asp Ile Ser Thr Leu Gln Asn Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Ile Tyr Tyr Cys Gln Gln Ser Lys Asn Phe Pro Val
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>331
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>331
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Ala Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu
85 90 95
Thr Phe Ala Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>332
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>332
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Thr Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Asn Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Lys Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Glu Ser Tyr Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>333
<211>113
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>333
Ala Ile Arg Met Thr Gln Ser Pro Asp Ser Leu Val Val Ser Leu Gly
1 5 10 15
Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser
2025 30
Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln
35 40 45
Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val
50 55 60
Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser
65 70 75 80
Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln
85 90 95
Tyr Tyr Ser Ser Pro Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg
<210>334
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>334
Asp Val Val Met Thr Gln Ser Pro Phe Phe Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ala Ser Asn
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Thr Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Val Thr Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Lys Thr Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>335
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>335
Val Ile Trp Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
5055 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Asn Trp Phe Pro Leu
85 90 95
Thr Phe Gly Pro Gly Thr Arg Leu Glu Ile Lys Arg
100 105
<210>336
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>336
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Thr Ser Ala Gly
1 5 10 15
Asp Thr Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Thr Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Asn Leu Leu Ile
35 40 45
Tyr Gly Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 7580
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Gln Ser Phe Pro Ile
85 90 95
Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Arg
100 105
<210>337
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>337
Val Ile Trp Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala His Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>338
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>338
Ala Ile Gln Leu Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Phe Val Ser Asp Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Leu Ala Thr Tyr Tyr Cys Leu Gln Asp Tyr His Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>339
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>339
Asp Val Val Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Val Asn Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Glu Ser Gly Ala Pro Ser Arg Phe Ser Ala
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly His Ser Phe Pro Leu
85 90 95
Thr Phe Gly Pro Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>340
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>340
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Tyr Thr Tyr
20 25 30
Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Tyr Gly Thr Glu Phe Thr Leu Thr Ile Ser Gly Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ile Phe Pro Leu
85 90 95
Thr Phe Gly Arg Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>341
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>341
Ala Ile Arg Met Thr Gln Ser Pro Ser Phe Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Ala Cys Arg Ala Ser Gln Thr Ile Ser Thr Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Val Leu Ile
35 40 45
Ser Lys Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp Thr Tyr Trp Thr
85 90 95
Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>342
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>342
Ala Ile Arg Met Thr Gln Ser Pro Ser Phe Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Ala Cys Arg Ala Ser Gln Thr Ile Ser Thr Trp
2025 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Val Leu Ile
35 40 45
Ser Lys Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Asp Thr Tyr Trp Thr
85 90 95
Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>343
<211>109
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>343
Asp Ile Val Met Thr Gln Ser Pro Ser Phe Val Ser Ala Ser Val Gly
1 5 10 15
Asp Thr Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu
85 90 95
Phe Thr Phe Gly Pro Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>344
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>344
Asp Ile Gln Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Gly Tyr Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Arg Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly SerAla Thr Glu Phe Thr Leu Thr Ile Thr Ser Leu Gln Pro
65 70 75 80
Asp Asp Phe Ala Thr Tyr Phe Cys Gln Gln Tyr Ser Ser Tyr Trp Thr
85 90 95
Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>345
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>345
Glu Ile Val Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Thr Val Thr Ile Thr Cys Arg Ala Thr Gln Ser Ile Ser Ser Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Arg Leu Ile
35 40 45
Ser Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Gly Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Leu Gln His Asn Thr Tyr Pro Phe
85 90 95
Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>346
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>346
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Arg Asn Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser His Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Thr
65 70 75 80
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly His Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>347
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>347
Asp Ile Val Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Arg Asn Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser His Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Thr
65 70 75 80
Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Gly His Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>348
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>348
Val Ile Trp Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asn Asn Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Asp Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Gly Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn Ser Leu Gln Pro
65 70 75 80
Asp Asp Phe Ala Ser Tyr Tyr Cys Gln Gln Ala His Ser Phe Pro Phe
85 90 95
Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>349
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>349
Glu Ile Val Met Thr Gln Ser Pro Ser Ser Val Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Ile Thr Ser Trp
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Thr Gly Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Met Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>350
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>350
Ala Ile Arg Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Tyr Asp Tyr
20 25 30
Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Ser Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Asn Leu Glu Arg Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Lys Tyr Phe Ile Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asn Ser Phe Pro Leu
85 90 95
Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>351
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>351
Ala Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Gly Ile Ser Gly Trp
20 25 30
Leu Ala Trp Tyr GlnGln Ile Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ala Ala Ser Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Tyr Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asp Ser Phe Pro Phe
85 90 95
Thr Phe Gly Pro Gly Thr Lys Val Glu Ile Lys Arg
100 105
<210>352
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>352
Gln Val Gln Leu Gln Gln Ser Gly Ser Glu Leu Val Arg Pro Gly Thr
1 5 10 15
Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Ser Ala Asp Thr Ser Ser Ser Thr Ala Tyr
65 70 75 80
Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Ser Val
100 105 110
Thr Val Ser Ser
115
<210>353
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>353
Asp Ile Val Met Thr Gln Ala Ala Phe Ser Asn Pro Val Thr Leu Gly
1 5 10 15
Thr Ser Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 5560
Gly Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys
100 105 110
<210>354
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>354
Gly Tyr Thr Phe Thr Asn Tyr Trp Leu Gly
1 5 10
<210>355
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>355
Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>356
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>356
Pro Asn Leu Pro Gly Asp Tyr
1 5
<210>357
<211>16
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>357
Arg Ser Ser Lys Ser Leu Leu His Ser Asn Gly Ile Thr Tyr Leu Tyr
1 5 10 15
<210>358
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>358
Gln Val Ser Asn Leu Ala Ser
1 5
<210>359
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>359
Ala Gln Asn Leu Glu Leu Pro Trp Thr
1 5
<210>360
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>360
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>361
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>361
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Arg Val Thr Met Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>362
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>362
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Arg Val Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>363
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>363
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>364
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>364
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>365
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>365
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>366
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>366
Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>367
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>367
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>368
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>368
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Arg Val Thr Met Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>369
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>369
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Arg Val Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>370
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>370
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 2530
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>371
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>371
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>372
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>372
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
3540 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>373
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>373
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp IleTyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Phe Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>374
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>374
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>375
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>375
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>376
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>376
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>377
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>377
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asp Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>378
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>378
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>379
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>379
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Gly Leu Pro Lys Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>380
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>380
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>381
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>381
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>382
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>382
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>383
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>383
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Arg Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>384
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>384
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
15 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>385
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>385
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Gly Leu Pro Arg Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>386
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>386
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>387
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>387
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Gly Leu Pro Gln Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>388
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>388
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>389
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>389
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asp Leu Pro Lys Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>390
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>390
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>391
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>391
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>392
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>392
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>393
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>393
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>394
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>394
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Met Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>395
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>395
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>396
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>396
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Asn
85 90 95
Leu Glu Met Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>397
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>397
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>398
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>398
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Glu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>399
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>399
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>400
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>400
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>401
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>401
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>402
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>402
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>403
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>403
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>404
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>404
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 7580
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Glu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>405
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>405
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>406
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>406
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>407
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>407
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Glu Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>408
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>408
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Arg Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>409
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>409
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Met Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>410
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>410
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Lys Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>411
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>411
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Asp Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Ile Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>412
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>412
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Val Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>413
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>413
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Gly Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Val Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>414
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>414
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 2530
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Leu Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>415
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>415
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Trp Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 4045
Gly Asp Ile Phe Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>416
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>416
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Asp Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>417
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>417
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr SerIle Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>418
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>418
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Thr Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 7075 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>419
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>419
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Leu Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>420
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>420
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>421
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>421
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>422
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>422
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr His Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>423
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>423
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Trp Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Leu Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>424
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>424
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr His Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>425
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>425
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Ser Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp His Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>426
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>426
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu ProVal Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>427
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>427
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Trp Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Glu Ile Tyr Pro Gly Gly Asp Tyr Ile Thr Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>428
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>428
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
2025 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Arg Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>429
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>429
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
3540 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>430
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>430
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Asp Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>431
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>431
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr LeuThr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>432
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>432
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
6570 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>433
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>433
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>434
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>434
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Thr Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>435
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>435
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>436
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>436
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>437
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>437
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>438
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>438
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>439
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>439
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Leu Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>440
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>440
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>441
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>441
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser CysLys Ala Ser Gly Tyr Leu Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>442
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>442
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>443
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>443
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>444
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>444
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Gln Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>445
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>445
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>446
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>446
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>447
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>447
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Leu Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>448
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>448
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>449
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>449
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Leu Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>450
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>450
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Thr Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>451
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>451
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Leu Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>452
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>452
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Thr Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>453
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>453
Gly Tyr Thr Phe Glu Asn Tyr Trp Leu Gly
1 5 10
<210>454
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>454
Gly Tyr Met Phe Thr Asn Tyr Trp Leu Gly
1 5 10
<210>455
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>455
Gly Tyr Thr Phe Asp Asn Tyr Trp Leu Gly
1 5 10
<210>456
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>456
Gly Tyr Thr Phe Gly Asn Tyr Trp Leu Gly
1 5 10
<210>457
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>457
Gly Tyr Thr Phe Thr Asn Tyr Trp Leu Trp
1 5 10
<210>458
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>458
Gly Tyr Leu Phe Thr Asn Tyr Trp Leu Gly
1 5 10
<210>459
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>459
Gly Tyr Thr Phe Thr Asn Tyr Trp Leu Ser
1 5 10
<210>460
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>460
Gly Phe Thr Phe Thr Asn Tyr Trp Leu Gly
1 5 10
<210>461
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>461
Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>462
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>462
Asp Ile Tyr Pro Gly Gly Asp Ile Ile Asn Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>463
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>463
Asp Ile Tyr Pro Gly Gly Asp Val Ile Asn Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>464
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>464
Asp Ile Phe Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>465
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>465
Asp Ile Tyr Pro Gly Gly Asp Leu Ile Asn Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>466
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>466
Asp Ile Tyr Pro Gly Gly Asp His Ile Asn Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>467
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>467
Glu Ile Tyr Pro Gly Gly Asp Tyr Ile Thr Tyr Asn Glu Lys Phe Lys
1 5 10 15
Gly
<210>468
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>468
Pro Asn Leu Pro Lys Asp His
1 5
<210>469
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>469
Pro Asp Leu Pro Gly Asp Tyr
1 5
<210>470
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>470
Pro Gly Leu Pro Lys Asp Tyr
1 5
<210>471
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>471
Pro Asn Leu Pro Lys Asp Tyr
1 5
<210>472
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>472
Pro Asn Leu Pro Arg Asp Tyr
1 5
<210>473
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>473
Pro Gly Leu Pro Arg Asp Tyr
15
<210>474
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>474
Pro Gly Leu Pro Gln Asp Tyr
1 5
<210>475
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>475
Pro Asp Leu Pro Lys Asp Tyr
1 5
<210>476
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>476
Gln Val Ser Asn Leu Ala Arg
1 5
<210>477
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>477
Gln Lys Ser Asn Leu Ala Ser
1 5
<210>478
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>478
Gln Val Ser Asn Leu Ala Val
1 5
<210>479
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>479
Gln Val Ser Asn Leu Ala Leu
1 5
<210>480
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>480
Gln Val Asp Asn Leu Ala Ser
1 5
<210>481
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>481
Gln Val Ser Asn Leu Ala Thr
1 5
<210>482
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>482
His Val Ser Asn Leu Ala Ser
1 5
<210>483
<211>7
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>483
Gln Val Ser Asn Arg Ala Ser
1 5
<210>484
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>484
Gly Gln Asn Leu Glu Leu Pro Trp Thr
1 5
<210>485
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>485
Ala Gln Asn Leu Glu Met Pro Trp Thr
1 5
<210>486
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>486
Gly Gln Asn Leu Glu Met Pro Trp Thr
1 5
<210>487
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>487
Ala Gln Tyr Leu Glu Glu Pro Trp Thr
1 5
<210>488
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>488
Ala Gln Tyr Leu Glu Leu Pro Trp Thr
1 5
<210>489
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>489
Gly Gln Tyr Leu Glu Leu Pro Trp Thr
1 5
<210>490
<211>16
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>490
Arg Ser Ser Lys Ser Leu Leu His Ser Gln Gly Ile Thr Tyr Leu Tyr
1 5 10 15
<210>491
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>491
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>492
<211>112
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>492
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Ala Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
<210>493
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>493
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>494
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>494
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>495
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>495
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
6570 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>496
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>496
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Lys Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Met Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>497
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>497
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Ser Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>498
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>498
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Trp Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Ser Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>499
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>499
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Ile Phe Asn Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>500
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>500
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>501
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>501
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu Pro Trp Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>502
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>502
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>503
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>503
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 510 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu His Phe Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>504
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>504
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
AspArg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>505
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>505
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu Tyr Phe Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>506
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>506
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
3540 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>507
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>507
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu Leu His Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>508
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>508
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>509
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>509
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu Arg Gly Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>510
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>510
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 9095
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>511
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>511
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>512
<211>107
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>512
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Ser Asp Ala Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys
100 105
<210>513
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>513
Glu Phe Gly Lys Arg Tyr Ala Leu Asp Ser
1 5 10
<210>514
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>514
Glu Ile Phe Asn Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>515
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>515
Glu Leu Pro Trp Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>516
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>516
Glu Leu His Phe Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>517
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>517
Glu Leu Tyr Phe Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>518
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>518
Glu Leu Leu His Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>519
<211>10
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>519
Glu Leu Arg Gly Arg Tyr Ala Leu Asp Tyr
1 5 10
<210>520
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>520
Lys Ala Lys Gln Asp Val Thr Pro Ala Val Ala
1 5 10
<210>521
<211>11
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>521
Lys Ala Ser Gln Asp Val Trp Pro Ala Val Ala
1 5 10
<210>522
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>522
Met Gln His Tyr Thr Thr Pro Leu Thr
1 5
<210>523
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>523
Gln Gln His Ser Thr Thr Pro Leu Thr
1 5
<210>524
<211>9
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>524
Gln Gln His Ser Asp Ala Pro Leu Thr
1 5
<210>525
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>525
Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val Lys
1 5 10 15
Gly
<210>526
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>526
Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val Lys
1 5 10 15
Gly
<210>527
<211>17
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>527
Thr Ile Ser Asp Gly Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val Lys
1 5 10 15
Gly
<210>528
<211>449
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>528
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 7580
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe
115 120 125
Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu
130 135 140
Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp
145 150 155 160
Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu
165 170 175
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser
180 185 190
Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro
195 200 205
Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys
210 215 220
Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro
225 230 235 240
Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser
245 250 255
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp
260 265 270
Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
275 280 285
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg Val
290 295 300
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu
305 310 315 320
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys
325 330 335
Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr
340 345 350
Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr
355 360 365
Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu
370 375 380
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
385 390 395 400
Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
405 410 415
Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu
420 425 430
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly
435 440 445
Lys
<210>529
<211>18
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>529
Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser
1 5 10 15
Gly Ser
<210>530
<211>113
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>530
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Cys Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg
<210>531
<211>20
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>531
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly
1 5 10 15
Gly Gly Gly Ser
20
<210>532
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>532
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Cys Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>533
<211>2151
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>533
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg cgggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagcgct 360
agcaccaagg gcccctctgt gttccctctg gccccttcct ctaaatccac ctctggcgga 420
accgctgctc tgggctgtct ggtcaaggac tacttccctg agcccgtgac cgtgtcttgg 480
aattctggcg ctctgaccag cggagtgcac acctttccag ctgtgctgca gtcctccggc 540
ctgtactctc tgtcctctgt cgtgacagtg ccttccagct ctctgggcac ccagacctac 600
atctgcaacg tgaaccacaa gccctccaac accaaggtgg acaagaaggt ggaacccaag 660
tcctgcgaca agacccacac ctgtcctcca tgtcctgctc cagaactgct gggcggaccc 720
tccgtgttcc tgttccctcc aaagcctaag gacaccctga tgatctcccg gacccctgaa 780
gtgacctgcg tggtggtgga tgtgtcccac gaggatcccg aagtgaagtt caattggtac 840
gtggacggcg tggaagtgca caacgccaag accaagccta gagaggaaca gtacgcctcc 900
acctaccggg tggtgtccgt gctgaccgtt ctgcaccagg attggctgaa cggcaaagag 960
tacaagtgca aggtgtccaa caaggccctg cctgccccta tcgaaaagac catctctaag 1020
gccaagggcc agccccggga acctcaagtg tacaccttgc ctcccagccg ggaagagatg 1080
accaagaacc aggtgtccct gacctgcctg gttaagggct tctacccctc cgatatcgcc 1140
gtggaatggg agtctaatgg ccagcctgag aacaactaca agaccacacc tcctgtgctg 1200
gactccgacg gctcattctt cctgtactcc aagctgaccg tggacaagtc cagatggcag 1260
cagggcaacg tgttctcctg ctccgtgatg cacgaggccc tgcacaatca ctacacccag 1320
aagtccctgt ctctgtcccc tggcaaaggc tccggatctg gttctggatc cggaagcggt 1380
tctggcagcg gctctggatc tgacatcgtg atgacccagt ctccactgag cctgcctgtg 1440
acacctggcg agcctgcttc catctcctgc cggtcctcta agtccctgct gcactctaac 1500
ggcatcacct acctgtactg gtatctgcag aagcccggcc agtctcctca gctgctgatc 1560
taccaggtgt ccaacctggc ttctggcgtg cccgatagat tctccggtag cggatctgga 1620
accgacttca ccctgaagat ctccagagtg gaagccgagg acgtgggcgt gtactactgt 1680
gcccagaacc tggaactgcc ctggaccttt ggctgtggca ccaaggtgga aatcaagaga 1740
ggcggcggag gatctggcgg aggtggaagc ggaggcggag gaagcggtgg cggcggatct 1800
gaagttcagt tggttcagtc tggcgccgaa gtgaagaaac ctggcgcctc tgtgaaggtg 1860
tcctgcaagg cttccggcta cacctttacc aactactggc tcggctggat caagcaggcc 1920
cctggacagt gtctggaatg gatcggcgac atctaccctg gcggcgacta catcaactac 1980
aacgagaagt tcaagggcaa agctaccctg accgccgaca cctctatctc caccgcctac 2040
atggaactgt cccggctgag atctgacgacaccgccgtgt actattgcgc cagacctaac 2100
ctgcctggcg actattgggg ccagggcaca acagtgaccg tgtcctctta a 2151
<210>534
<211>214
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>534
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala Ala
100 105 110
Pro Ser Val PheIle Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly
115 120 125
Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala
130 135 140
Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln
145 150 155 160
Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser
165 170 175
Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr
180 185 190
Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser
195 200 205
Phe Asn Arg Gly Glu Cys
210
<210>535
<211>645
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>535
gacatccaga tgacccagag ccctagcagc ctgagcgcta gcgtgggcga cagggtgacc 60
atcacctgca aggccagcca ggatgtgacc cctgccgtgg cctggtacca gcagaagccc 120
ggcaaggccc ccaagctgct gatctacagc accagcagca ggtacaccgg cgtgcccagc 180
aggtttagcg gaagcggcag cggcaccgac ttcaccttca ccatcagcag cctgcagccc 240
gaggacatcg ccacctacta ctgccagcag cactacacca cccctctgac cttcggccag 300
ggcaccaagc tggagatcaa gagaaccgtg gccgctccct ccgtgttcat cttcccacca 360
tctgacgagc agctgaagtc cggcaccgct tctgtcgtgt gcctgctgaa caacttctac 420
cctcgggaag ccaaggtgca gtggaaggtg gacaatgccc tgcagtccgg caactcccaa 480
gagtctgtga ccgagcagga ctccaaggac agcacctact ccctgtcctc taccctgacc 540
ctgtccaagg ccgactacga gaagcacaag gtgtacgcct gcgaagtgac ccaccaggga 600
ctgtctagcc ccgtgaccaa gtccttcaac agaggcgagt gctga 645
<210>536
<211>113
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>536
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Gln Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Cys Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg
<210>537
<211>116
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>537
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Cys Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser
115
<210>538
<211>2151
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>538
gaggtgcagc tggtggagag cggaggagga ctggtgcaac ccggaggcag cctgagactg 60
agctgcgctg ccagcggctt caccttcagc agctacgaca tgagctgggt gagacaggcc 120
cctggcaaaa gcctggagtg ggtggccacc atctccgatg cgggcggcta catctattac 180
tccgacagcg tgaagggcag gttcaccatc agcagggaca acgccaagaa cagcctgtac 240
ctgcagatga acagcctgag ggatgaggac accgccgtgt acatctgcgc cagggagttc 300
ggcaaaaggt acgccctgga ctactggggc cagggcacaa ccgtgaccgt gagcagcgct 360
agcaccaagg gcccctctgt gttccctctg gccccttcct ctaaatccac ctctggcgga 420
accgctgctc tgggctgtct ggtcaaggac tacttccctg agcccgtgac cgtgtcttgg 480
aattctggcg ctctgaccag cggagtgcac acctttccag ctgtgctgca gtcctccggc 540
ctgtactctc tgtcctctgt cgtgacagtg ccttccagct ctctgggcac ccagacctac 600
atctgcaacg tgaaccacaa gccctccaac accaaggtgg acaagaaggt ggaacccaag 660
tcctgcgaca agacccacac ctgtcctcca tgtcctgctc cagaactgct gggcggaccc 720
tccgtgttcc tgttccctcc aaagcctaag gacaccctga tgatctcccg gacccctgaa 780
gtgacctgcg tggtggtgga tgtgtcccac gaggatcccg aagtgaagtt caattggtac 840
gtggacggcg tggaagtgca caacgccaag accaagccta gagaggaaca gtacgcctcc 900
acctaccggg tggtgtccgt gctgaccgtt ctgcaccagg attggctgaa cggcaaagag 960
tacaagtgca aggtgtccaa caaggccctg cctgccccta tcgaaaagac catctctaag 1020
gccaagggcc agccccggga acctcaagtg tacaccttgc ctcccagccg ggaagagatg 1080
accaagaacc aggtgtccct gacctgcctg gttaagggct tctacccctc cgatatcgcc 1140
gtggaatggg agtctaacgg ccagcccgag aacaactaca agaccacccc tcctgtgctg 1200
gactccgacg gctcattctt cctgtactcc aagctgaccg tggacaagtc tcggtggcag 1260
cagggcaacg tgttctcctg ctctgtgatg cacgaggccc tgcacaacca ctacacccag 1320
aagtccctgt ccctgtctcc cggcaaaggc tccggatctg gttctggatc cggaagcggt 1380
tctggcagcg gctctggatc tgacattgtg atgacccaga gccccctgag cctccccgtg 1440
acccctggag aacccgccag cataagctgc agatcctcca aaagcctgct gcactcccag 1500
ggaataacct acctgtattg gtacctgcag aaacccggcc aatcccccca actcctgata 1560
taccaagtgt ccaacctggc ctccggcgtg cccgacagat tctccggctc cggcagcggt 1620
accgacttca ccctcaaaat ctccagagtg gaagcagaag acgtcggcgt gtactactgc 1680
gcccagtacc tggaactgcc ctggaccttc ggctgtggca ccaaggtgga aatcaagaga 1740
ggcggcggag gaagcggagg cggcggttct ggtggtggcg gtagcggagg tggtggatct 1800
gaggtgcagc tggtgcagag cggagcagag gtgaagaagc caggggccag cgtgaaggtg 1860
agctgtaagg ctagtgggta cacatttaca aactattggc tgggatggat taagcaggcc 1920
ccaggccaat gcctggagtg gataggagac atataccccg gaggagacta tatcgtgtac 1980
aacgagaagt tcaagggcaa ggccacactc accgctgata caagcatcag caccgcctac 2040
atggagctga gccgactgag aagcgacgac acagcagtgt attactgcgc cagacccaac 2100
ctgcccaagg accactgggg acaaggcacc accgtgaccg tgagcagctg a 2151
<210>539
<211>449
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>539
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Ser Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu Pro Trp Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe
115 120 125
Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu
130 135 140
Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp
145 150 155 160
Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu
165 170 175
Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser
180 185 190
Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro
195 200 205
Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys
210 215 220
Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro
225 230 235 240
Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser
245 250 255
Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp
260 265 270
Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
275 280 285
Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Ala Ser Thr Tyr Arg Val
290 295 300
Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu
305 310 315 320
Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys
325 330 335
Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr
340 345 350
Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr
355 360 365
Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu
370 375 380
Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
385 390 395 400
Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys
405 410 415
Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu
420 425 430
Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly
435 440 445
Lys
<210>540
<211>2151
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>540
gaagtgcagc tggttgaatc tggcggcgga ttggttcagc ctggcggatc tctgagactg 60
tcttgtgccg cctccggctt caccttctcc agctacgata tgtcctgggt ccgacaggcc 120
cctggcaagt ctttggaatg ggtcgccacc atctctgacg ctggcggcta catctactac 180
cgggactctg tgaagggcag attcaccatc agccgggaca acgccaagaa ctccctgtac 240
ctgcagatga acagcctgcg cgacgaggat accgccgtgt acatctgtgc tagagagctg 300
ccttggagat acgccctgga ttattggggc cagggcacca cagtgaccgt gtcctctgct 360
tctaccaagg gacccagcgt gttccctctg gctccttcca gcaagtctac ctctggcgga 420
acagctgctc tgggctgcct ggtcaaggac tactttcctg agcctgtgac agtgtcctgg 480
aactctggcg ctctgacatc tggcgtgcac acctttccag cagtgctgca gtcctccggc 540
ctgtactctc tgtcctctgt cgtgaccgtg ccttccagct ctctgggcac ccagacctac 600
atctgcaacg tgaaccacaa gccctccaac accaaggtgg acaagaaggt ggaacccaag 660
tcctgcgaca agacccacac ctgtcctcca tgtcctgctc cagaactgct gggcggaccc 720
tccgtgttcc tgttccctcc aaagcctaag gacaccctga tgatctcccg gacccctgaa 780
gtgacctgcg tggtggtgga tgtgtcccac gaggatcccg aagtgaagtt caattggtac 840
gtggacggcg tggaagtgca caacgccaag accaagccta gagaggaaca gtacgcctcc 900
acctaccggg tggtgtccgt gctgaccgtt ctgcaccagg attggctgaa cggcaaagag 960
tacaagtgca aggtgtccaa caaggccctg cctgccccta tcgaaaagac catctctaag 1020
gccaagggcc agccccggga acctcaagtg tacaccttgc ctcccagccg ggaagagatg 1080
accaagaacc aggtgtccct gacctgcctg gttaagggct tctacccctc cgatatcgcc 1140
gtggaatggg agtctaatgg ccagcctgag aacaactaca agaccacacc tcctgtgctg 1200
gactccgacg gctcattctt cctgtactcc aagctgaccg tggacaagtc cagatggcag 1260
cagggcaacg tgttctcctg ctccgtgatg cacgaggccc tgcacaatca ctacacccag 1320
aagtccctgt ctctgtcccc tggcaaaggc tccggatctg gttctggatc cggaagcggt 1380
tctggcagcg gctctggatc tgacatcgtg atgacccagt ctccactgag cctgcctgtg 1440
acacctggcg agcctgcttc catctcctgc cggtcctcta agtccctgct gcactctaac 1500
ggcatcacct acctgtactg gtatctgcag aagcccggcc agtctcctca gctgctgatc 1560
taccaggtgt ccaacctggc ttctggcgtg cccgatagat tctccggtag cggatctgga 1620
accgacttca ccctgaagat ctccagagtg gaagccgagg acgtgggcgt gtactactgt 1680
gcccagaacc tggaactgcc ctggaccttt ggctgtggca ccaaggtgga aatcaagaga 1740
ggcggcggag gatctggcgg aggtggaagc ggaggcggag gaagcggtgg cggcggatct 1800
gaagttcagt tggttcagtc tggcgccgaa gtgaagaaac ctggcgcctc tgtgaaggtg 1860
tcctgcaagg cttccggcta cacctttacc aactactggc tcggctggat caagcaggcc 1920
cctggacagt gtctggaatg gatcggcgac atctaccctg gcggcgacta catcaactac 1980
aacgagaagt tcaagggcaa agctaccctg accgccgaca cctctatctc caccgcctac 2040
atggaactgt cccggctgag atctgacgac accgccgtgt actattgcgc cagacctaac 2100
ctgcctggcg actattgggg ccagggcaca acagtgaccg tgtcctctta a 2151
<210>541
<211>2151
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>541
gaagtgcagc tggttgaatc tggcggcgga ttggttcagc ctggcggatc tctgagactg 60
tcttgtgccg cctccggctt caccttctcc agctacgata tgtcctgggt ccgacaggcc 120
cctggcaagt ctttggaatg ggtcgccacc atctctgacg ctggcggcta catctactac 180
cgggactctg tgaagggcag attcaccatc agccgggaca acgccaagaa ctccctgtac 240
ctgcagatga acagcctgcg cgacgaggat accgccgtgt acatctgtgc tagagagctg 300
ccttggagat acgccctgga ttattggggc cagggcacca cagtgaccgt gtcctctgct 360
tctaccaagg gacccagcgt gttccctctg gctccttcca gcaagtctac ctctggcgga 420
acagctgctc tgggctgcct ggtcaaggac tactttcctg agcctgtgac agtgtcctgg 480
aactctggcg ctctgacatc tggcgtgcac acctttccag cagtgctgca gtcctccggc 540
ctgtactctc tgtcctctgt cgtgaccgtg ccttccagct ctctgggcac ccagacctac 600
atctgcaacg tgaaccacaa gccctccaac accaaggtgg acaagaaggt ggaacccaag 660
tcctgcgaca agacccacac ctgtcctcca tgtcctgctc cagaactgct gggcggaccc 720
tccgtgttcc tgttccctcc aaagcctaag gacaccctga tgatctcccg gacccctgaa 780
gtgacctgcg tggtggtgga tgtgtcccac gaggatcccg aagtgaagtt caattggtac 840
gtggacggcg tggaagtgca caacgccaag accaagccta gagaggaaca gtacgcctcc 900
acctaccggg tggtgtccgt gctgaccgtt ctgcaccagg attggctgaa cggcaaagag 960
tacaagtgca aggtgtccaa caaggccctg cctgccccta tcgaaaagac catctctaag 1020
gccaagggcc agccccggga acctcaagtg tacaccttgc ctcccagccg ggaagagatg 1080
accaagaacc aggtgtccct gacctgcctg gttaagggct tctacccctc cgatatcgcc 1140
gtggaatggg agtctaacgg ccagcccgag aacaactaca agaccacccc tcctgtgctg 1200
gactccgacg gctcattctt cctgtactcc aagctgaccg tggacaagtc tcggtggcag 1260
cagggcaacg tgttctcctg ctctgtgatg cacgaggccc tgcacaacca ctacacccag 1320
aagtccctgt ccctgtctcc cggcaaaggc tccggatctg gttctggatc cggaagcggt 1380
tctggcagcg gctctggatc tgacattgtg atgacccaga gccccctgag cctccccgtg 1440
acccctggag aacccgccag cataagctgc agatcctcca aaagcctgct gcactcccag 1500
ggaataacct acctgtattg gtacctgcag aaacccggcc aatcccccca actcctgata 1560
taccaagtgt ccaacctggc ctccggcgtg cccgacagat tctccggctc cggcagcggt 1620
accgacttca ccctcaaaat ctccagagtg gaagcagaag acgtcggcgt gtactactgc 1680
gcccagtacc tggaactgcc ctggaccttc ggctgtggca ccaaggtgga aatcaagaga 1740
ggcggcggag gaagcggagg cggcggttct ggtggtggcg gtagcggagg tggtggatct 1800
gaggtgcagc tggtgcagag cggagcagag gtgaagaagc caggggccag cgtgaaggtg 1860
agctgtaagg ctagtgggta cacatttaca aactattggc tgggatggat taagcaggcc 1920
ccaggccaat gcctggagtg gataggagac atataccccg gaggagacta tatcgtgtac 1980
aacgagaagt tcaagggcaa ggccacactc accgctgata caagcatcag caccgcctac 2040
atggagctga gccgactgag aagcgacgac acagcagtgt attactgcgc cagacccaac 2100
ctgcccaagg accactgggg acaaggcacc accgtgaccg tgagcagctg a 2151
<210>542
<211>443
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>542
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Asn Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Gly Asp Tyr Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala
115 120 125
Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu
130 135 140
Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly
145 150 155 160
Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser
165 170 175
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu
180 185 190
Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr
195 200 205
Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro
210 215 220
Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
225 230 235 240
Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr
245 250 255
Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn
260 265 270
Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg
275 280 285
Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val
290 295 300
Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser
305 310 315 320
Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys
325 330 335
Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu
340 345 350
Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe
355 360 365
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu
370 375 380
Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe
385 390 395 400
Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly
405 410 415
Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr
420 425 430
Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys
435 440
<210>543
<211>15
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>543
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
<210>544
<211>108
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>544
Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly
1 5 10 15
Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Val Thr Pro Ala
20 25 30
Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45
Tyr Ser Thr Ser Ser Arg Tyr Thr Gly Val Pro Ser Arg Phe Ser Gly
50 55 60
Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro
65 70 75 80
Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln His Tyr Thr Thr Pro Leu
85 90 95
Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>545
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>545
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Cys Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Ser Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Phe Gly Lys Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>546
<211>2118
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>546
gaggtgcagc tggtgcagag cggagcagag gtgaagaagc caggggccag cgtgaaggtg 60
agctgtaagg ctagtgggta cacatttaca aactattggc tgggatggat taagcaggcc 120
ccaggccaag gactggagtg gataggagac atataccccg gaggagacta tatcaattac 180
aacgagaagt tcaagggcaa ggccacactc accgctgata caagcatcag caccgcctac 240
atggagctga gccgactgag aagcgacgac acagcagtgt attactgcgc cagacccaac 300
ctgcccggcg actactgggg acaaggcacc accgtgaccg tgtcttccgc tagcaccaag 360
ggcccctccg tgttccctct ggccccatgc tcccggtcca cctccgagtc caccgccgct 420
ctgggctgtc tggtgaagga ctacttccct gagcccgtga ccgtgagctg gaactctggc 480
gccctgacct ccggcgtgca caccttccct gccgtgctgc agtcctccgg cctgtactcc 540
ctgtcctccg tggtgaccgt gccttcctcc tccctgggca ccaagaccta cacctgcaac 600
gtggaccaca agccttccaa caccaaggtg gacaagcggg tggagtccaa gtacggccct 660
ccttgccctc cctgccctgc ccctgagttc ctgggcggac cctccgtgtt cctgttccct 720
cctaagccta aggacaccct gatgatctcc cggacccctg aggtgacctg cgtggtggtg 780
gacgtgtccc aggaagatcc tgaggtccag ttcaattggt acgtggatgg cgtggaggtg 840
cacaacgcca agaccaagcc tcgggaggaa cagttcaact ccacctaccgggtggtgtct 900
gtgctgaccg tgctgcacca ggactggctg aacggcaagg aatacaagtg caaggtcagc 960
aacaagggcc tgccctcctc catcgagaaa accatctcca aggccaaggg ccagcctcgc 1020
gagcctcagg tgtacaccct gcctcctagc caggaagaga tgaccaagaa tcaggtgtcc 1080
ctgacatgcc tggtgaaggg cttctaccct tccgatatcg ccgtggagtg ggagagcaac 1140
ggccagccag agaacaacta caagaccacc cctcctgtgc tggactccga cggctccttc 1200
ttcctgtact ccaggctgac cgtggacaag tcccggtggc aggaaggcaa cgtcttttcc 1260
tgctccgtga tgcacgaggc cctgcacaac cactacaccc agaagtccct gtccctgtct 1320
ctgggcaagg gtggaggtgg gtctgggggt ggcgggtcag gtggaggagg ttcagacatc 1380
cagatgaccc agagccctag cagcctgagc gctagcgtgg gcgacagggt gaccatcacc 1440
tgcaaggcca gccaggatgt gacccctgcc gtggcctggt accagcagaa gcccggcaag 1500
gcccccaagc tgctgatcta cagcaccagc agcaggtaca ccggcgtgcc cagcaggttt 1560
agcggaagcg gcagcggcac cgacttcacc ttcaccatca gcagcctgca gcccgaggac 1620
atcgccacct actactgcca gcagcactac accacccctc tgaccttcgg ctgtggcacc 1680
aagctggaga tcaagagagg tggaggcggc tcaggggggg gtggatcagg gggaggagga 1740
tcagggggag gcggtagtga ggtgcagctg gtggagagcg gaggaggact ggtgcaaccc 1800
ggaggcagcc tgagactgag ctgcgctgcc agcggcttca ccttcagcag ctacgacatg 1860
agctgggtga gacaggcccc tggcaaatgt ctggagtggg tggccaccat ctccgatgcg 1920
ggcggctaca tctattactc cgacagcgtg aagggcaggt tcaccatcag cagggacaac 1980
gccaagaaca gcctgtacct gcagatgaac agcctgaggg atgaggacac cgccgtgtac 2040
atctgcgcca gggagttcgg caaaaggtac gccctggact actggggcca gggcacaacc 2100
gtgaccgtga gcagctga 2118
<210>547
<211>219
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>547
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Asn Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Asn
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu
115 120 125
Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
130 135 140
Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln
145 150 155 160
Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser
165 170 175
Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu
180 185 190
Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser
195 200 205
Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys
210 215
<210>548
<211>660
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>548
gacattgtga tgacccagag ccccctgagc ctccccgtga cccctggaga acccgccagc 60
ataagctgca gatcctccaa aagcctgctg cactccaacg gaataaccta cctgtattgg 120
tacctgcaga aacccggcca atccccccaa ctcctgatat accaagtgtc caacctggcc 180
tccggcgtgc ccgacagatt ctccggctcc ggcagcggta ccgacttcac cctcaaaatc 240
tccagagtgg aagcagaaga cgtcggcgtg tactactgcg cccagaatct ggaactgccc 300
tggaccttcg gcggcggcac caaggtggaa atcaagagaa ccgtggccgc tccctccgtg 360
ttcatcttcc caccatctga cgagcagctg aagtccggca ccgcttctgt cgtgtgcctg 420
ctgaacaact tctaccctcg ggaagccaag gtgcagtgga aggtggacaa tgccctgcag 480
tccggcaact cccaagagtc tgtgaccgag caggactcca aggacagcac ctactccctg 540
tcctctaccc tgaccctgtc caaggccgac tacgagaagc acaaggtgta cgcctgcgaa 600
gtgacccacc agggactgtc tagccccgtg accaagtcct tcaacagagg cgagtgctga 660
<210>549
<211>119
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>549
Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr
20 25 30
Asp Met Ser Trp Val Arg Gln Ala Pro Gly Lys Cys Leu Glu Trp Val
35 40 45
Ala Thr Ile Ser Asp Ala Gly Gly Tyr Ile Tyr Tyr Arg Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Arg Asp Glu Asp Thr Ala Val Tyr Ile Cys
85 90 95
Ala Arg Glu Leu Pro Trp Arg Tyr Ala Leu Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Thr Val Thr Val Ser Ser
115
<210>550
<211>2118
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>550
gaggtgcagc tggtgcagag cggagcagag gtgaagaagc caggggccag cgtgaaggtg 60
agctgtaagg ctagtgggta cacatttaca aactattggc tgggatggat taagcaggcc 120
ccaggccaag gactggagtg gataggagac atataccccg gaggagacta tatcaattac 180
aacgagaagt tcaagggcaa ggccacactc accgctgata caagcatcag caccgcctac 240
atggagctga gccgactgag aagcgacgac acagcagtgt attactgcgc cagacccaac 300
ctgcccggcg actactgggg acaaggcacc accgtgaccg tgtcttccgc tagcaccaag 360
ggcccctccg tgttccctct ggccccatgc tcccggtcca cctccgagtc caccgccgct 420
ctgggctgtc tggtgaagga ctacttccct gagcccgtga ccgtgagctg gaactctggc 480
gccctgacct ccggcgtgca caccttccct gccgtgctgc agtcctccgg cctgtactcc 540
ctgtcctccg tggtgaccgt gccttcctcc tccctgggca ccaagaccta cacctgcaac 600
gtggaccaca agccttccaa caccaaggtg gacaagcggg tggagtccaa gtacggccct 660
ccttgccctc cctgccctgc ccctgagttc ctgggcggac cctccgtgtt cctgttccct 720
cctaagccta aggacaccct gatgatctcc cggacccctg aggtgacctg cgtggtggtg 780
gacgtgtccc aggaagatcc tgaggtccag ttcaattggt acgtggatgg cgtggaggtg 840
cacaacgcca agaccaagcc tcgggaggaa cagttcaact ccacctaccg ggtggtgtct 900
gtgctgaccg tgctgcacca ggactggctg aacggcaagg aatacaagtg caaggtcagc 960
aacaagggcc tgccctcctc catcgagaaa accatctcca aggccaaggg ccagcctcgc 1020
gagcctcagg tgtacaccct gcctcctagc caggaagaga tgaccaagaa tcaggtgtcc 1080
ctgacatgcc tggtgaaggg cttctaccct tccgatatcg ccgtggaatg ggagagcaat 1140
ggccagcctg agaacaacta caagacaacc cctcctgtgc tggactccga cggctccttc 1200
tttctgtact ctcgcctgac cgtggacaag tccagatggc aagagggcaa cgtgttctcc 1260
tgctccgtga tgcacgaggc cctgcacaat cactacaccc agaagtccct gtctctgtcc 1320
ctcggaaaag gcggcggagg atctggcgga ggcggtagcg gtggtggcgg atctgatatt 1380
cagatgaccc agtctccttc cagcctgtcc gcttctgtgg gcgacagagtgaccatcaca 1440
tgcaaggcca gccaggatgt gacccctgct gtggcttggt atcagcagaa gcctggcaag 1500
gcccctaagc tgctgatcta ctccacctcc tccagataca caggcgtgcc ctccagattc 1560
tccggctctg gctctggcac cgactttacc tttacaatct ccagcctgca gcctgaggac 1620
attgccacct actactgcca gcagcactac accacacctc tgacctttgg ctgcggcacc 1680
aagctggaaa tcaagagagg tggcggagga agcggaggcg gcggttcagg tggcggtggt 1740
tcaggcggtg gtggatctga agttcagctg gtggaatctg gcggcggatt ggttcaacca 1800
ggcggctctc tgagactgtc ttgtgccgct tccggcttca ccttctccag ctacgacatg 1860
tcctgggtcc gacaggcccc tggaaagtgt ctggaatggg tcgccaccat ctctgacgct 1920
ggcggctaca tctactaccg ggactctgtg aagggcagat tcaccatcag ccgggacaat 1980
gccaagaact ccctgtacct gcagatgaac agtctgcgcg acgaggacac cgccgtgtac 2040
atctgtgcta gagagctgcc ttggcgctac gccctggatt attggggcca gggcacaaca 2100
gtgacagtgt cctcttga 2118
<210>551
<211>443
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>551
Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala
1 5 10 15
Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr PheThr Asn Tyr
20 25 30
Trp Leu Gly Trp Ile Lys Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile
35 40 45
Gly Asp Ile Tyr Pro Gly Gly Asp Tyr Ile Val Tyr Asn Glu Lys Phe
50 55 60
Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ile Ser Thr Ala Tyr
65 70 75 80
Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Arg Pro Asn Leu Pro Lys Asp His Trp Gly Gln Gly Thr Thr Val
100 105 110
Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala
115 120 125
Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu
130 135 140
Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly
145 150 155 160
Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser
165 170 175
Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu
180 185 190
Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr
195 200 205
Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro
210 215 220
Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
225 230 235 240
Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr
245 250 255
Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn
260 265 270
Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg
275 280 285
Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val
290 295 300
Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser
305 310 315 320
Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys
325 330 335
Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu
340 345 350
Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe
355 360 365
Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu
370 375 380
Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe
385 390 395 400
Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly
405 410 415
Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr
420 425 430
Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys
435 440
<210>552
<211>2118
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>552
gaggtgcagc tggtgcagag cggagcagag gtgaagaagc caggggccag cgtgaaggtg 60
agctgtaagg ctagtgggta cacatttaca aactattggc tgggatggat taagcaggcc 120
ccaggccaag gactggagtg gataggagac atataccccg gaggagacta tatcgtgtac 180
aacgagaagt tcaagggcaa ggccacactc accgctgata caagcatcag caccgcctac 240
atggagctga gccgactgag aagcgacgac acagcagtgt attactgcgc cagacccaac 300
ctgcccaagg accactgggg acaaggcacc accgtgaccg tgtcttccgc tagcaccaag 360
ggcccctccg tgttccctct ggccccatgc tcccggtcca cctccgagtc caccgccgct 420
ctgggctgtc tggtgaagga ctacttccct gagcccgtga ccgtgagctg gaactctggc 480
gccctgacct ccggcgtgca caccttccct gccgtgctgc agtcctccgg cctgtactcc 540
ctgtcctccg tggtgaccgt gccttcctcc tccctgggca ccaagaccta cacctgcaac 600
gtggaccaca agccttccaa caccaaggtg gacaagcggg tggagtccaa gtacggccct 660
ccttgccctc cctgccctgc ccctgagttc ctgggcggac cctccgtgtt cctgttccct 720
cctaagccta aggacaccct gatgatctcc cggacccctg aggtgacctg cgtggtggtg 780
gacgtgtccc aggaagatcc tgaggtccag ttcaattggt acgtggatgg cgtggaggtg 840
cacaacgcca agaccaagcc tcgggaggaa cagttcaact ccacctaccg ggtggtgtct 900
gtgctgaccg tgctgcacca ggactggctg aacggcaagg aatacaagtg caaggtcagc 960
aacaagggcc tgccctcctc catcgagaaa accatctcca aggccaaggg ccagcctcgc 1020
gagcctcagg tgtacaccct gcctcctagc caggaagaga tgaccaagaa tcaggtgtcc 1080
ctgacatgcc tggtgaaggg cttctaccct tccgatatcg ccgtggagtg ggagagcaac 1140
ggccagccag agaacaacta caagaccacc cctcctgtgc tggactccga cggctccttc 1200
ttcctgtact ccaggctgac cgtggacaag tcccggtggc aggaaggcaa cgtcttttcc 1260
tgctccgtga tgcacgaggc cctgcacaac cactacaccc agaagtccct gtccctgtct 1320
ctgggcaagg gtggaggtgg gtctgggggt ggcgggtcag gtggaggagg ttcagacatc 1380
cagatgaccc agagccctag cagcctgagc gctagcgtgg gcgacagggt gaccatcacc 1440
tgcaaggcca gccaggatgt gacccctgcc gtggcctggt accagcagaa gcccggcaag 1500
gcccccaagc tgctgatcta cagcaccagc agcaggtaca ccggcgtgcc cagcaggttt 1560
agcggaagcg gcagcggcac cgacttcacc ttcaccatca gcagcctgca gcccgaggac 1620
atcgccacct actactgcca gcagcactac accacccctc tgaccttcgg ctgtggcacc 1680
aagctggaga tcaagagagg tggaggcggc tcaggggggg gtggatcagg gggaggagga 1740
tcagggggag gcggtagtga ggtgcagctg gtggagagcg gaggaggact ggtgcaaccc 1800
ggaggcagcc tgagactgag ctgcgctgcc agcggcttca ccttcagcag ctacgacatg 1860
agctgggtga gacaggcccc tggcaaatgt ctggagtggg tggccaccat ctccgatgcg 1920
ggcggctaca tctattactc cgacagcgtg aagggcaggt tcaccatcag cagggacaac 1980
gccaagaaca gcctgtacct gcagatgaac agcctgaggg atgaggacac cgccgtgtac 2040
atctgcgcca gggagttcgg caaaaggtac gccctggact actggggcca gggcacaacc 2100
gtgaccgtga gcagctga 2118
<210>553
<211>219
<212>PRT
<213>Artificial Sequence
<220>
<223> Synthesis
<400>553
Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly
1 5 10 15
Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Ser
20 25 30
Gln Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser
35 40 45
Pro Gln Leu Leu Ile Tyr Gln Val Ser Asn Leu Ala Ser Gly Val Pro
50 55 60
Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80
Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gln Tyr
85 90 95
Leu Glu Leu Pro Trp Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys
100 105 110
Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu
115 120 125
Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
130 135 140
Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln
145 150 155 160
Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser
165 170 175
Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu
180 185 190
Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser
195 200 205
Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys
210 215
<210>554
<211>660
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>554
gacattgtga tgacccagag ccccctgagc ctccccgtga cccctggaga acccgccagc 60
ataagctgca gatcctccaa aagcctgctg cactcccagg gaataaccta cctgtattgg 120
tacctgcaga aacccggcca atccccccaa ctcctgatat accaagtgtc caacctggcc 180
tccggcgtgc ccgacagatt ctccggctcc ggcagcggta ccgacttcac cctcaaaatc 240
tccagagtgg aagcagaaga cgtcggcgtg tactactgcg cccagtacct ggaactgccc 300
tggaccttcg gcggcggcac caaggtggaa atcaagagaa ccgtggccgc tccctccgtg 360
ttcatcttcc caccatctga cgagcagctg aagtccggca ccgcttctgt cgtgtgcctg 420
ctgaacaact tctaccctcg ggaagccaag gtgcagtgga aggtggacaa tgccctgcag 480
tccggcaact cccaagagtc tgtgaccgag caggactcca aggacagcac ctactccctg 540
tcctctaccc tgaccctgtc caaggccgac tacgagaagc acaaggtgta cgcctgcgaa 600
gtgacccacc agggactgtc tagccccgtg accaagtcct tcaacagagg cgagtgctga 660
<210>555
<211>2118
<212>DNA
<213>Artificial Sequence
<220>
<223> Synthesis
<400>555
gaggtgcagc tggtgcagag cggagcagag gtgaagaagc caggggccag cgtgaaggtg 60
agctgtaagg ctagtgggta cacatttaca aactattggc tgggatggat taagcaggcc 120
ccaggccaag gactggagtg gataggagac atataccccg gaggagacta tatcgtgtac 180
aacgagaagt tcaagggcaa ggccacactc accgctgata caagcatcag caccgcctac 240
atggagctga gccgactgag aagcgacgac acagcagtgt attactgcgc cagacccaac 300
ctgcccaagg accactgggg acaaggcacc accgtgaccg tgtcttccgc tagcaccaag 360
ggcccctccg tgttccctct ggccccatgc tcccggtcca cctccgagtc caccgccgct 420
ctgggctgtc tggtgaagga ctacttccct gagcccgtga ccgtgagctg gaactctggc 480
gccctgacct ccggcgtgca caccttccct gccgtgctgc agtcctccgg cctgtactcc 540
ctgtcctccg tggtgaccgt gccttcctcc tccctgggca ccaagaccta cacctgcaac 600
gtggaccaca agccttccaa caccaaggtg gacaagcggg tggagtccaa gtacggccct 660
ccttgccctc cctgccctgc ccctgagttc ctgggcggac cctccgtgtt cctgttccct 720
cctaagccta aggacaccct gatgatctcc cggacccctg aggtgacctg cgtggtggtg 780
gacgtgtccc aggaagatcc tgaggtccag ttcaattggt acgtggatgg cgtggaggtg 840
cacaacgcca agaccaagcc tcgggaggaa cagttcaact ccacctaccg ggtggtgtct 900
gtgctgaccg tgctgcacca ggactggctg aacggcaagg aatacaagtg caaggtcagc 960
aacaagggcc tgccctcctc catcgagaaa accatctcca aggccaaggg ccagcctcgc 1020
gagcctcagg tgtacaccct gcctcctagc caggaagaga tgaccaagaa tcaggtgtcc 1080
ctgacatgcc tggtgaaggg cttctaccct tccgatatcg ccgtggaatg ggagagcaat 1140
ggccagcctg agaacaacta caagacaacc cctcctgtgc tggactccga cggctccttc 1200
tttctgtact ctcgcctgac cgtggacaag tccagatggc aagagggcaa cgtgttctcc 1260
tgctccgtga tgcacgaggc cctgcacaat cactacaccc agaagtccct gtctctgtcc 1320
ctcggaaaag gcggcggagg atctggcgga ggcggtagcg gtggtggcgg atctgatatt 1380
cagatgaccc agtctccttc cagcctgtcc gcttctgtgg gcgacagagt gaccatcaca 1440
tgcaaggcca gccaggatgt gacccctgct gtggcttggt atcagcagaa gcctggcaag 1500
gcccctaagc tgctgatcta ctccacctcc tccagataca caggcgtgcc ctccagattc 1560
tccggctctg gctctggcac cgactttacc tttacaatct ccagcctgca gcctgaggac 1620
attgccacct actactgcca gcagcactac accacacctc tgacctttgg ctgcggcacc 1680
aagctggaaa tcaagagagg tggcggagga agcggaggcg gcggttcagg tggcggtggt 1740
tcaggcggtg gtggatctga agttcagctg gtggaatctg gcggcggatt ggttcaacca 1800
ggcggctctc tgagactgtc ttgtgccgct tccggcttca ccttctccag ctacgacatg 1860
tcctgggtcc gacaggcccc tggaaagtgt ctggaatggg tcgccaccat ctctgacgct 1920
ggcggctaca tctactaccg ggactctgtg aagggcagat tcaccatcag ccgggacaat 1980
gccaagaact ccctgtacct gcagatgaac agtctgcgcg acgaggacac cgccgtgtac 2040
atctgtgcta gagagctgcc ttggcgctac gccctggatt attggggcca gggcacaaca 2100
gtgacagtgt cctcttga 2118
- 上一篇：一种医用注射器针头装配设备
- 下一篇：环境友好的纤维素废料再循环