阅读说明：本技术 柯萨奇病毒a16型毒株及其应用 (Coxsackie virus A16 type strain and application thereof ) 是由 张改梅 刘建凯 梁祁 潘红星 张黎 赵丽丽 谢学超 陈磊 马廷涛 顾美荣 于 2021-09-23 设计创作，主要内容包括：本发明涉及生物技术领域,具体公开了柯萨奇病毒A16型毒株及其应用。本发明的柯萨奇病毒A16型毒株,其P1结构蛋白的氨基酸序列如SEQ ID NO.1所示。该毒株型内和型间交叉性良好、遗传稳定,可作为柯萨奇病毒A16型血清中和抗体效价检测用毒株,为柯萨奇病毒A16型相关单/多价疫苗研发提供支持。该毒株免疫原性好、滴度高、毒力强,为建立稳定的感染动物模型提供攻击毒株,对于构建CV-A16小鼠模型至关重要。(The invention relates to the technical field of biology, and particularly discloses a coxsackievirus A16 type strain and application thereof. The amino acid sequence of the P1 structural protein of the coxsackie virus A16 strain is shown in SEQ ID NO. 1. The strain has good intra-type and inter-type crossability and stable heredity, can be used as a strain for detecting the neutralizing antibody titer in the Coxsackie virus A16 type serum, and provides support for the research and development of a Coxsackie virus A16 type related single/multi-valent vaccine. The strain has good immunogenicity, high titer and strong toxicity, provides an attacking strain for establishing a stable infection animal model, and is very important for constructing a CV-A16 mouse model.)

1. The coxsackievirus A16 strain is characterized in that the amino acid sequence of the P1 structural protein is shown as SEQ ID NO. 1.

2. The strain of coxsackievirus a16 of claim 1, further comprising non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D;

the amino acid sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown in SEQ ID NO. 4-10.

3. The strain of coxsackievirus A16 according to claim 2, wherein in the genome of the strain, the coding gene sequence of the P1 structural protein is shown as SEQ ID NO.2, and the coding gene sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown as SEQ ID NO. 11-17.

4. The strain of coxsackievirus A16 of claim 1, having a genomic sequence as shown in SEQ ID No.3 or as shown in the complementary sequence of the sequence shown in SEQ ID No. 3.

5. The strain of Coxsackie virus A16 according to any one of claims 1 to 4, which is deposited in the China general microbiological culture Collection center (CGMCC) with the deposit number of CGMCC No. 19534.

6. A biomaterial characterized by being any one of the following (1) to (8):

(1) p1 structural protein with the sequence shown as SEQ ID NO. 1;

(2) nucleic acid molecule of P1 structural protein with the coding sequence shown in SEQ ID NO. 1;

(3) a nucleic acid molecule with a sequence shown as SEQ ID NO.3 or a complementary sequence of the sequence shown as SEQ ID NO. 3;

(4) an expression cassette comprising the nucleic acid molecule of (2) or (3);

(5) a recombinant vector comprising the nucleic acid molecule of (2) or (3);

(6) a recombinant microorganism comprising the nucleic acid molecule of (2) or (3);

(7) a cell line comprising the nucleic acid molecule of (2) or (3);

(8) a primer or a probe for detecting the nucleic acid molecule in (2) or (3).

7. A virus-like particle of a coxsackievirus a16 type strain, which comprises a P1 structural protein and any one or more selected from non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D;

the P1 structural protein has a sequence shown in SEQ ID NO.1, and the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D respectively have sequences shown in SEQ ID NO. 4-10.

8. Any one of the following uses of the coxsackievirus a16 type strain of any one of claims 1 to 5, the biological material of claim 6 or the virus-like particle of claim 7:

(1) the application in the immunogenicity evaluation of Coxsackie virus vaccines;

(2) the application in detecting the content of the immune serum neutralizing antibody of the coxsackie virus;

(3) the application in the protective evaluation of Coxsackie virus vaccines;

(4) the application in preparing animal model infected by Coxsackie virus;

(5) the application in screening or evaluating the drug effect of the drugs for preventing and/or treating diseases caused by the coxsackie virus;

(6) the application in preparing a reagent or a kit for diagnosing coxsackie virus infection;

(7) the application in the epidemiological investigation of the Coxsackie virus;

(8) the application in preparing vaccines for preventing and/or treating diseases caused by coxsackie virus;

(9) the application in preparing the medicine for preventing and/or treating the diseases caused by the coxsackie virus;

(10) the application in preparing the antibody for preventing and/or treating diseases caused by the coxsackie virus;

(11) the application in preparing antiserum for preventing and/or treating diseases caused by coxsackie virus.

9. An antibody or antiserum produced using the coxsackievirus A16 strain of any one of claims 1-5, the biological material of claim 6 or the virus-like particle of claim 7 as an immunogen.

10. A product characterized in that it contains any one or a combination of more of the following (1) to (4):

(1) the strain of coxsackievirus A16 of any one of claims 1-5;

(2) the biomaterial of claim 6;

(3) the virus-like particle of claim 7;

(4) an antibody or antiserum to the coxsackievirus A16 type strain of any one of claims 1-5.

Technical Field

The invention relates to the technical field of biology, in particular to a coxsackievirus A16 type strain and application thereof.

Background

Hand-foot-and-mouth disease (HFMD) is an infectious disease caused by enteroviruses, which include 20 types, wherein coxsackie virus type a16 (Coxsackievirus type a16, CA 16) and enterovirus type 71 (enterovirus 71, EV 71) are two common important pathogens causing hand-foot-and-mouth disease worldwide, and are epidemic spread alternately or simultaneously in one region. Whereas the marketed EV-A71 vaccine has no cross-protection effect on CV-A16. The detection of neutralizing antibodies is one of the key indicators for carrying out CV-A16 epidemiological investigation and vaccine immunogenicity evaluation. The accuracy of the detection of the titer of the neutralizing antibody is closely related to the detection strain used. The genotype standard detection strain which accords with the epidemic characteristics of the diseases is established, the generation of the strain for detection is fixed, the accuracy and the repeatability of the detection of the vaccine neutralizing antibody are improved, and the immunogenicity evaluation of the vaccine in preclinical and clinical tests can be guaranteed. At present, no standard detection strain of Coxsackie virus A16 exists at home and abroad. It is necessary for enterprises to automatically screen and establish standard detection strains.

In addition, Ningqingjie et al (Ningqingjie, Limin, Yanglan, et al. Cox A16 type hand-foot-and-mouth disease suckling mouse animal model establishment and immune and pathological characteristics [ J ]. Chinese veterinary science report, 2013, 33 (11): 1685:1690.) domesticated by 1-day-old C57BL/6J suckling mice to obtain stable lethal 11-day-old mouse adapted strain CA16-TS, wherein the CA16-TS strain can cause paralysis of mouse hind limb and severe muscle necrosis, and then the body mass gradually reduces to death, and the CA16-TS does not show strong nerve tropism but shows stronger muscle invasion and toxicity. MAO, etc. (Mao Q, Wang Y, Gao R, Shao J, Yao X, Lang S, Wang C, Mao P, Liang Z, Wang J. A neonatal mouse model of coxsackievirus A16 for vaccine evaluation. J Virol. 2012 Nov;86(22):11967-76. doi: 10.1128/JViII.00902-12. Epub 2012 Sep 5. PMID: 22951825; PMCID: PMC 3486452.) A CV-A16 clinical isolate BJCA 08/CA 16 was used to infect 1 day old ICR suckling mice by intracerebral injection to prepare an ICR oral disease model, and the infected mice were found to have strong tendency to muscle tissue, and to cause skeletal necrosis and necrosis of the myocardium. The mouse hand-foot-and-mouth disease model caused by CoxA16 shows obvious symptoms of ataxia, acroparalysis, listlessness and the like on animal behaviors, which are consistent with the current mouse adapted strains. Lijing (Lijing. recombinant Coxsackie A16 virus pathogenesis and candidate vaccine to animal model lethality protection mechanism [ D ]. Changchun: Jilin university 2014.) A16 CC024 virus was infected to 1-day-old mice by cranio-luminal injection, and as a result, the challenged mice showed grade 4 clinical symptoms on day 3, and the grade 4 mice showed the clinical symptoms of limb paralysis, limb muscle and spinal muscle fiber rupture, lung tissue injury and congestion. The results of immunohistochemical analysis show that there are a large number of viral antigens in muscle tissue and lung, and there is an obvious specific tropism for lung tissue. The mouse adaptive strain of the Coxsackie virus A16 type and the application thereof are used for preparing the mouse adaptive strain CV-A16 by using a BalB/c suckling mouse with the age of 4-6 days in China, 201310471154.4 [ P ].2015-05-13.

However, at present, no coxsackie virus A16 type related detection standard strain and challenge strain for vaccine protective evaluation exist at home and abroad.

Disclosure of Invention

The invention aims to provide a coxsackie virus A16 strain with good cross neutralization capability, stable heredity and strong toxicity and application thereof.

In order to realize the purpose of the invention, the technical scheme of the invention is as follows:

firstly, the invention provides a coxsackievirus A16 strain, wherein the amino acid sequence of the P1 structural protein is shown as SEQ ID NO. 1.

In the genome of the Coxsackie virus A16 strain, the sequence of the coding gene of the P1 structural protein is shown as SEQ ID NO. 2.

Specifically, the coxsackie virus A16 strain provided by the invention contains P1 structural protein and non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D; wherein, the amino acid sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown in SEQ ID NO. 4-10.

The genome coding sequence of the coxsackievirus A16 strain is P1 structural protein shown as SEQ ID NO.1 and non-structural protein shown as SEQ ID NO. 4-10.

Preferably, in the genome of the coxsackievirus A16 strain, the coding gene sequence of the P1 structural protein is shown as SEQ ID NO.2, and the coding gene sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown as SEQ ID NO. 11-17.

The coding genes of the structural proteins and the non-structural proteins are arranged in the order of VP4, VP2, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C and 3D on the genome of the coxsackievirus A16 strain. VP1, VP2, VP3 and VP4 constitute structural protein P1.

The invention provides a recombinant nucleic acid molecule which is formed by connecting a gene shown as SEQ ID NO.2 and genes shown as SEQ ID NO.11-17 in sequence.

Further preferably, the genome sequence of the coxsackievirus A16 strain is shown as SEQ ID NO.3 or shown as the complementary sequence of the sequence shown as SEQ ID NO. 3. The 1-717bp in the SEQ ID NO.3 is the nucleic acid sequence of 5 'UTR, 718-924bp is the nucleic acid sequence of VP4, 925-1686bp is the nucleic acid sequence of VP2, 1687-2412bp is the nucleic acid sequence of VP3, 2413-3303bp is the nucleic acid sequence of VP1, 3304-3753bp is the nucleic acid sequence of 2A, 3754-4050bp is the nucleic acid sequence of 2B, 4051-5037bp is the nucleic acid sequence of 2C, 5038-5295bp is the nucleic acid sequence of 3A, 5296-5361bp is the nucleic acid sequence of 3B, 5362-5910bp is the nucleic acid sequence of 3C, 5911-7296bp is the nucleic acid sequence of 3D, 59197-7299 bp is a stop codon, and 7300-81 bp is the nucleic acid sequence of 3' UTR.

Specifically, the invention provides a Coxsackie virus A16 type strain R00880662 which is preserved in the China general microbiological culture Collection center (CGMCC for short, the address: Beijing West Lu No.1, the institute of microbiology, China academy of sciences, zip code 100101) at 7.13.7.2021 in the area of the rising area of Beijing and is classified and named as Coxsackie virus A16 type, and the preservation number is CGMCC No. 19534.

The genome coding sequence of the Coxsackie virus A16 type strain R00880662 is a P1 structural protein shown in SEQ ID NO.1 and a non-structural protein shown in SEQ ID NO.4-10, the genome sequence of the protein is shown in SEQ ID NO.3, and the subtype is B1.

The Coxsackie virus A16 strain provided by the invention has strong toxicity, good cross-neutralization capacity in and among genotypes, good immunogenicity, and capability of rapid propagation by taking cells such as RD and the like as stromal cells.

Further, the present invention provides a biomaterial related to the coxsackievirus a16 type, which is any one of the following (1) to (8):

(1) p1 structural protein with the sequence shown as SEQ ID NO. 1;

(2) nucleic acid molecule of P1 structural protein with the coding sequence shown in SEQ ID NO. 1;

(3) a nucleic acid molecule with a sequence shown as SEQ ID NO.3 or a complementary sequence of the sequence shown as SEQ ID NO. 3;

(4) an expression cassette comprising the nucleic acid molecule of (2) or (3);

(5) a recombinant vector comprising the nucleic acid molecule of (2) or (3);

(6) a recombinant microorganism comprising the nucleic acid molecule of (2) or (3);

(7) a cell line comprising the nucleic acid molecule of (2) or (3);

(8) a primer or a probe for detecting the nucleic acid molecule in (2) or (3).

The nucleic acid molecule described in (2) or (3) above may be a DNA molecule or an RNA molecule.

The expression cassette described in (4) above is a recombinant nucleic acid molecule obtained by linking regulatory elements for transcription and translation upstream and downstream of the nucleic acid molecule described in (2) or (3).

The recombinant vector described in (5) above is a plasmid vector, a viral vector, a phage vector or a transposon which carries the nucleic acid molecule described in (2) or (3) and is capable of replication or integration in a host cell.

The recombinant microorganism described in (6) above may be a bacterium or a virus.

The cell line described in (7) above is an animal cell line that is not reproducible as an animal individual, and may be a commonly used animal cell line for virus culture, including but not limited to other cells such as RD, Vero, MRC-5, and the like.

The primer and probe described in (8) above are oligonucleotides capable of binding to the nucleic acid molecule described in (2) or (3) and performing PCR amplification.

The invention also provides virus-like particles of the coxsackievirus A16 strain, which contain P1 structural protein and any one or more selected from non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D; the P1 structural protein has a sequence shown in SEQ ID NO.1, and the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D respectively have sequences shown in SEQ ID NO. 4-10.

The virus-like particles can express the coding genes of the structural proteins and the non-structural proteins by adopting an insect vector system.

The invention also provides an immunogenic composition comprising the strain of coxsackievirus type a16, a biological material or a virus-like particle as described above.

The immunogenic composition can contain an adjuvant which is beneficial to the coxsackievirus A16 strain to exert immunogenicity in addition to the coxsackievirus A16 strain, the biological material or the virus-like particles. The adjuvant includes, but is not limited to, aluminum adjuvants.

Further, the invention provides any one of the following applications of the coxsackievirus A16 type strain or the biological material or the virus-like particle:

(1) the application in the immunogenicity evaluation of Coxsackie virus vaccines;

(2) the application in detecting the content of the immune serum neutralizing antibody of the coxsackie virus;

(3) the application in the protective evaluation of Coxsackie virus vaccines;

(4) the application in preparing animal model infected by Coxsackie virus;

(5) the application in screening or evaluating the drug effect of the drugs for preventing and/or treating diseases caused by the coxsackie virus;

(6) the application in preparing a reagent or a kit for diagnosing coxsackie virus infection;

(7) the application in the epidemiological investigation of the Coxsackie virus;

(8) the application in preparing vaccines for preventing and/or treating diseases caused by coxsackie virus;

(9) the application in preparing the medicine for preventing and/or treating the diseases caused by the coxsackie virus;

(10) the application in preparing the antibody for preventing and/or treating diseases caused by the coxsackie virus;

(11) the application in preparing antiserum for preventing and/or treating diseases caused by coxsackie virus.

In the above (1), the application is specifically to detect a strain as a standard for evaluation of immunogenicity of a vaccine.

In (3) above, the application is specifically as a challenge strain for vaccine protective evaluation.

In the above (4), the animal model is preferably a murine model.

In the above (1) to (11), the coxsackievirus is preferably a coxsackievirus a16 type strain.

In the above (5) and (8) to (11), the disease caused by the coxsackie virus is preferably hand-foot-and-mouth disease.

The invention provides an antibody or antiserum, which is prepared by taking the coxsackie virus A16 type strain or the biological material or the virus-like particles as immunogen.

The invention also provides a method for preparing the antibody or the antiserum, which comprises the following steps: and (3) taking the coxsackie virus A16 type strain, the biological material or the virus-like particles as immunogen immune animals, and separating to obtain an anti-coxsackie virus A16 type antibody or antiserum.

The invention provides a product which contains any one or combination of more of the following (1) to (4):

(1) the above coxsackievirus A16 type strain;

(2) the above-mentioned biological material;

(3) the above virus-like particle;

(4) antibodies or antiserum against the above coxsackie virus A16 type strain.

The product is preferably a product for evaluating the immunogenicity or the protection of a coxsackievirus A16 type vaccine, or a product for constructing an animal model infected by the coxsackievirus A16 type vaccine, or a product for diagnosing, preventing or treating coxsackievirus A16 type infection.

The product may be a reagent, kit, vaccine or medicament.

As an embodiment of the invention, the product is a reagent for immunogenicity or protective evaluation of a coxsackievirus A16 type vaccine, and the reagent contains the coxsackievirus A16 type strain.

As another embodiment of the invention, the product is a reagent for constructing an animal model infected by the coxsackievirus A16, and contains the coxsackievirus A16 strain.

As another embodiment of the present invention, the product is a vaccine for preventing coxsackievirus a16 type infection, which contains the coxsackievirus a16 type strain.

The vaccine of the invention can be a whole virus inactivated vaccine, an attenuated live vaccine, a nucleic acid vaccine, a genetic engineering vaccine (subunit vaccine, live vector vaccine, gene recombinant vaccine, etc.).

Preferably, the vaccine is a whole virus inactivated vaccine, wherein the coxsackievirus a16 type strain is inactivated. The vaccine may also contain adjuvants including, but not limited to, aluminum adjuvants.

The present invention also provides a method for preparing the vaccine described above, the method comprising: culturing the coxsackievirus A16 strain on cells, harvesting virus liquid, inactivating and purifying the harvested virus liquid to obtain vaccine stock solution, and mixing the vaccine stock solution with an adjuvant.

As another embodiment of the present invention, the product is a medicament for treating coxsackievirus a16 type infection, which contains an antibody or antiserum to the coxsackievirus a16 type strain.

The invention also provides application of the product in immunogenicity evaluation or protective evaluation of a coxsackievirus A16 type vaccine and preparation of an animal model infected by the coxsackievirus.

The invention also provides the application of the product in diagnosing, preventing or treating coxsackie virus A16 type infection.

The invention has the beneficial effects that:

the strain with good cross property between genotype and stable heredity is screened out, can be used as a strain for detecting the neutralizing antibody titer in the Coxsackie virus A16 type serum, and provides support for research and development of a Coxsackie virus A16 type related single/multi-valent vaccine. The strain has good immunogenicity and high titer, and is injected into abdominal cavity with 10 percent of injection²CCID₅₀The virus liquid can kill 100% of 1-day-old suckling mice within 7 days. The strain is shown to be a virulent strain, and the virulent strain with high pathogenicity and lethality to the mouse provides an attack strain for establishing a stable infection animal model and is important for constructing a CV-A16 mouse model.

Drawings

FIG. 1 is the result of the strain type cross-neutralization study in example 1 of the present invention.

FIG. 2 is a challenge strain screening-survival curve in example 5 of the present invention.

FIG. 3 shows an LD in embodiment 5 of the present invention₅₀A survival curve was determined.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The basic research method of the invention is as follows:

(1) separating pharynx and anus sample which is detected to be positive by Coxsackie virus A16 through fluorescent quantitative PCR on RD cells, carrying out 3 times of subculture adaptability, and carrying out primary identification on the obtained virus liquid, wherein the primary identification mainly comprises virus titration, molecular biology identification (virus determination, nucleotide sequence determination and analysis subtype), immunogenicity test, cross neutralization capability research, genome sequencing and the like, and suitable neutralizing antibody detection strains and attack strains (primary screening strains) are obtained primarily.

(2) And (3) carrying out plaque purification on the preliminarily screened strains respectively, carrying out 3 times of subculture adaptive culture (P4 generation) on RD cells, and verifying the harvested virus liquid, wherein the verification of the virus liquid mainly comprises virus titration. And (4) establishing an original seed according to the virus detection result in combination with the virus lesion process and the lesion fusion degree, and performing related evaluation research and passage stability research. The evaluation research of the original seeds mainly comprises virus titration, immunogenicity research, pathogenicity research, cross neutralization capacity research and the like. The passage stability research mainly comprises the steps of carrying out continuous passage culture on the RD cells by using the original seed virus liquid according to a certain proportion until 15 th generation, carrying out virus titration on each generation of virus strain in the passage process, and carrying out virus titration and gene sequencing detection (genome sequencing analysis) on the 5 th, 10 th and 15 th generation virus liquids in the passage process. Selecting a strain with wide cross protection range, good immunogenicity and good genetic stability as a neutralizing antibody detection strain according to the research results; the strain with good genetic stability and strong pathogenicity is used as an attack strain for vaccine protective evaluation.

(3) After the neutralizing antibody detection candidate strain was established, it was subjected to virus titration. Then, the titer calibration and specificity evaluation are carried out on the test sample. The indicated titer of the test strain is determined, thereby determining the dilution factor of the test titer strain at the time of the neutralization test. The specificity evaluation aims to verify that the detected strain only has specific neutralization capacity on CV-A16 type immune serum, and does not have cross reaction on other enteroviruses such as EV-A71, CV-A6 and CV-A10 immune serum. Thereby proving that the strain is suitable for detecting the titer of the neutralizing antibody of coxsackie virus A16 type immune serum.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 preliminary screening of Coxsackie virus type A16 Strain

Treatment of clinical samples:

0.25 ml of each sample (pharyngeal anal test sample which has been detected as positive for coxsackievirus type A16 by fluorescent quantitative PCR) was added to a centrifuge tube in a biosafety cabinet. Add 2.5. mu.l of penicillin streptomycin solution, mix well, and stand overnight at 4 ℃. Centrifuged at 2000 rpm for 20min and the supernatant stored at 2-8 ℃ for inoculation.

Virus isolation and culture:

taking prepared healthy and pollution-free RD cells with the density of 80-90%, and discarding the cell culture solution. Inoculating 0.2 ml/well of the treated sample into 6-well plate, inoculating 1 well of each sample, adding 0.2 ml/well virus culture solution, and standing at 35 deg.C with 5% CO₂Adsorbing for 1h in the incubator. Then 3.5ml of virus culture medium was added to each well, and the mixture was placed at 35 ℃ in 5% CO₂And (5) standing and culturing in an incubator. Cells in 2 wells with good growth status and no specimen were set as cell control.

Harvesting viruses and performing adaptive subculture:

characteristic enterovirus cytopathic effect (CPE) profiles of the cells after inoculation were observed and recorded daily. Freezing and thawing once if CPE appears and the CPE degree reaches above + + +, harvesting cell culture, filtering with a 0.2 μm needle filter, filling virus solution with 0.2 ml/branch, storing in a refrigerator at-60 ℃, continuously passaging the virus solution for three times, freezing and thawing once per generation, centrifuging at 2000 rpm and 4 ℃ for 10 min, subpackaging the supernatant, storing in a refrigerator at-60 ℃, marking and recording. If CPE is present within 24h after inoculation, it is likely to be a toxic reaction due to non-specific components in the specimen. Taking positive isolate and transmitting to three generations for continuous observation.

Virus identification:

virus identification tests are carried out on the 3 rd generation virus liquid of the obtained virus isolation positive strains, and the virus identification tests mainly comprise virus titration, molecular biology identification (virus identification and virus genotyping) and immunogenicity tests, cross neutralization capacity research, genome sequencing and the like.

Virus titration:

(1) the detection method comprises the following steps: diluting virus liquid after three passages with serum-free culture solution in centrifuge tube in 10-fold gradient, and gradually diluting^-1~10^-8. The diluted virus was added to a 96-well plate at 8 wells/dilution, 0.1 ml/well. At the same time, 100. mu.l of RD cell suspension (1.5X 10) was added to each well⁵Pieces/ml). And adding 8-16 holes of the cell suspension into the cell suspension, wherein the volume of the cell suspension is 0.1 ml/hole, and supplementing 0.1 ml/hole of the diluent to serve as a cell control. Covering with a sealing plate, gently beating, mixing, standing at 35 deg.C and 5% CO₂And (5) standing and culturing in an incubator, and judging the result on the 7 th day. Each sample was replicated 3 times.

(2) Calculating the virus titer: calculating LgCCID according to Behrens-Karber formula₅₀：

LgCCID₅₀L-d (S-0.5), wherein:

l = log of the lowest dilution of virus used in the experiment;

d = log of dilution gradient;

s = sum of positive fractions at final decision (i.e. sum of proportion of cell pores in which CPE appears). See in particular the ministry of health of the people's republic of China, hand-foot-and-mouth disease prevention and control guidelines (2009 edition) [ EB/OL ] (2009-06-04) http:// www.gov.cn/gzdt/2009-06/04/content _1332078. htm.

Molecular biological identification:

CV-A16 virus was identified by RT-PCR, CV-A16 positive virus strain was subjected to VP1 nucleic acid sequence determination, and CV-A16 genotyping was performed based on VP1 nucleotide sequence.

Identification of CV-A16 virus by RT-PCR:

extracting virus nucleic acid, and identifying the CV-A16 virus by applying the universal primer for EV group enterovirus nucleic acid detection and the CV-A16 nucleic acid detection primer.

(1) The amplification primers were designed as follows:

A. universal primer sequence for detecting human enterovirus nucleic acid (product length 400-

59F: 5’-CYTTGTGCGCCTGTTTT-3’（SEQ ID NO.18）；

588R: 5’-ATTGTCACCATAAGCAGCC-3’（SEQ ID NO.19）；

153F: 5’-CAAGYACTTCTGTMWCCCC-3’（SEQ ID NO.20）；

541R: 5’-CCCAAAGTAGTCGGTTCC-3’（SEQ ID NO.21）。

In the above primers, Y represents C/T, M represents A/C, and W represents A/T.

B. CV-A16 nucleic acid detection primer sequence (product length 1 kb)

CA16-VP1- WHF: 5’- ATTGGTGCTCCCACTACAGC -3’（SEQ ID NO.22）；

CA16-VP1- WHR: 5’- GAGCTGTCCTCCCACACAAG -3’（SEQ ID NO.23）。

(2) Extracting virus nucleic acid:

adding reagents and virus samples into a 96-well plate according to the sequence and the dosage in the specification, then placing the 96-well plate into a nucleic acid extractor, and extracting nucleic acid according to a preset program; subpackaging the extracted nucleic acid into EP tubes, marking the information and date of the sample, and storing the sample in a refrigerator at-60 ℃.

(3) And (3) PCR amplification:

1) HEV-5' UTR universal primer PCR amplification

a. First round PCR amplification:

preparing a PCR amplification reaction system (the formula is shown in table 1) except amplification template components, adding 0.4 mu l of test sample virus genome, mixing uniformly, and putting into a PCR instrument to operate a program (shown in table 2).

TABLE 1 HEV-5' UTR Universal primer first round PCR amplification reaction System

TABLE 2 HEV-5' UTR Universal primer first round PCR amplification procedure

b. Second round of PCR amplification:

preparing a PCR amplification reaction system (the formula is shown in table 3) except amplification template components, adding 0.4 mu l of first round PCR amplification products as a template, and putting the template into a PCR instrument to run a program (shown in table 4).

TABLE 3 HEV-5' UTR Universal primer second round PCR amplification reaction System

TABLE 4 HEV-5' UTR Universal primer second round PCR amplification procedure

2) PCR amplification with CV-A16 VP1 specific primer

Preparing a PCR amplification reaction system (the formula is shown in table 5) except amplification template components, adding 0.4 mu l of test sample virus genome, mixing uniformly, and putting into a PCR instrument to run a program (shown in table 6).

TABLE 5 PCR amplification reaction System with VP1 specific primers

TABLE 6 VP1 specific primer PCR amplification procedure

3) The PCR amplification product was detected by 2% agarose gel electrophoresis.

4) Result judgment

The HEV-5' UTR universal primer amplification positive sample can observe a target band with the size of 400bp, and the VP1 specific primer amplification positive sample can observe a target band with the size of 1 kb. The laboratory diagnosis results of the specimens were judged according to table 7. Wherein HEV (-) represents a target band which is not amplified by the HEV-5 'UTR universal primer, and HEV (+) represents a target band which is amplified by the HEV-5' UTR universal primer; CV-A16 (-) represents the non-amplified target band of the CV-A16 VP1 specific primer, and CV-A16 (+) represents the amplified target band of the CV-A16 VP1 specific primer.

TABLE 7

CV-a16 genotyping:

the virus strains identified as positive for CV-A16 were genotyped for CV-A16 based on the VP1 nucleic acid sequence. The results showed B1 type.

Immunogenicity studies:

strains with high titers were selected and immunogenicity analysis was performed using NIH mice.

The same virus titer (6.0 LgCCID) was prepared from 17 third generation virus fluids₅₀Ml), immunized NIH mice (SPF grade, 18-22g, female), 10 strains per group, numbered separately. And (3) injecting the inactivated virus into the abdominal cavity by 500 mu l/mouse according to a two-needle immunization program for 0 and 14 days, setting a culture medium control group, collecting blood 14 days after the first-time immunization and the second-time immunization respectively, and separating serum. The titer of the anti-specificity neutralizing antibody of the serum is determined by adopting a trace cell pathologic method, and the positive conversion rate and the level of the neutralizing antibody are analyzed.

Neutralizing antibody titer determination step: diluting the serum to be detected at a ratio of 1:8, inactivating at 56 deg.C for 30min, adding into 96-well plate at a concentration of 0.05 ml/well, diluting with 100CCID, respectively₅₀Neutralizing the CV-A16 virus suspension at 37 ℃ for 1-3 h; adding 1.5X 10⁵Each ml of RD cell suspension, 0.1 ml/well, at 35 + -0.5 deg.C and 5% CO₂And (5) culturing in an incubator for 7 d. Will be provided withThe highest dilution that inhibited 50% of the cytopathic effects was designated as the neutralizing titer of CV-A16 antibody and expressed as the reciprocal of the dilution factor. Each test is provided with a virus back-drop test, and the back-drop result is 32-320 CCID₅₀The hole test was confirmed. The neutralizing titer is more than or equal to 8, the CV-A16 neutralizing antibody is positive, and the Geometric Mean Titer (GMT) of the negative samples is calculated according to 4.

Test results show that the primary-immunity positive conversion rate can reach more than 70%, the secondary-immunity positive conversion rate reaches 100%, the titer of a primary-immunity neutralizing antibody is between 1:8 and 1:127, the titer of a secondary-immunity neutralizing antibody is between 1:100 and 1:1042, wherein the titer of a R088 neutralizing antibody can reach 1:1042, and the virus strain is a dominant strain.

Cross-neutralization capacity study:

and (3) carrying out cross neutralization capacity research on the virus strain and the virus strain immune serum, and reflecting the cross neutralization capacity by using the titer difference of neutralizing antibodies of the virus strain to all the serum to be detected. The low fold number difference represents that the strain has more uniform cross neutralization detection capability, and the strain with high neutralizing antibody GMT and low fold difference is screened to be used as a candidate strain for detection.

a. Intratype cross-neutralization study:

6 primary screening strains (R054, R008, R088, R068, R081 and R080) with good immunogenicity are selected for type-in cross-neutralization study (6 strains and 6 corresponding immune serums are subjected to cross-neutralization reaction), and the immune serums are serums collected 14 days after 2 times of immunization of mice (see the measurement of the anti-specific neutralizing antibody titer of the serums in the specific steps). Cross-neutralization capacity is reflected in the neutralizing antibody titers GMT and the difference in fold number (MAX/MIN) of the strains against the whole serum. The results are shown in figure 1, and the primary screening strain numbered R088 detected a neutralizing antibody titer GMT of 1:435 for each immune serum, with a fold difference of 8.

b. Intercotype cross-neutralization studies:

12 CV-A16 strains (strain information is shown in table 8) including 3 strains of A genotype, 8 strains of B genotype and 1 strain of C genotype strains are used for inter-type cross neutralization research (the strain information is entrusted to the China food and drug testing research institute, and the strains and the corresponding immune serum are from the China food and drug testing research institute), and the immune serum is mouse serum collected after 2 times of immunization for 14 days. 12 sera were subjected to cross-neutralization assay with 12 CV-A16 virus strains, respectively. The cross-neutralization detection ability is reflected by the neutralizing antibody titer and fold difference of the strain to the whole serum.

TABLE 8 Strain information

Note: the strains V01-V07 are obtained by self-separation from the mainland of China.

The results show that: detecting different virus strains of the to-be-detected virus strains to obtain an immune serum neutralization titer GMT of 36-875, and detecting different virus strains of the R088 virus strain to obtain an immune serum neutralization titer GMT of 829; the GMT (neutralizing titer) multiple difference of immune serum of all to-be-detected strains in different strains is 11-171, and the R088 strain multiple difference is 11, so that the strains have better cross neutralization detection capability on the existing coxsackie virus A, B, C genotype.

EXAMPLE 2 plaque purification

Virus dilutions of the primary screened strains were inoculated into 6-well cell culture plates for purification.

(1) Cell preparation: the RD cells grown in a monolayer are washed, digested and then inoculated into a 6-well cell culture plate, and the cell culture plate is 7 multiplied by 10⁵Adding RD cell culture solution into each cell/hole, and placing 5% CO₂And (3) standing and culturing in an incubator at 37 +/-1 ℃ until a compact monolayer grows. Discarding the original culture solution, cleaning the cell surface, and washing away the residual bovine serum and dead cells.

(2) Virus preparation: the virus solution was diluted by an appropriate fold.

(3) Virus adsorption: inoculating the diluted virus solution at 0.4 ml/well, setting virus solution control and cell control, and placing in 5% CO₂Adsorbing for 1-2 hours at 35 ℃ in an incubator, and slightly shaking the cell plate for several times every 15-20 min during the adsorption so as to enable the cell plate to contact the whole cell surface.

(4) Covering and culturing: after adsorption, virus solution is discarded, virus control and cell control wells are filled with 3 ml/well of virus maintenance solution. The rest(s)Slowly adding the mixture of agarose and virus-retaining solution into each well along the wall, standing at room temperature for more than 30min for cooling and solidifying to obtain covering layer, and placing the agarose-containing culture plate in an inverted state in 5% CO₂Culturing at 37 + -1 deg.C in incubator, observing and recording plaque condition (form, size and amount) and virus control lesion condition every day.

(5) And (3) plaque culture: picking up single plaque with 200 μ l tip with filter core into 1.5 ml EP tube containing 100 μ l virus maintenance liquid, repeatedly blowing, mixing, inoculating into 6-well cell culture plate with cell grown to monolayer, placing 5% CO₂Incubate at 37. + -. 1 ℃ and observe CPE every day. When 75% of CPE appears in the cells, collecting the supernatant, and storing the supernatant in a refrigerator at 60 ℃ below zero. The virus passage was P2.

(6) Identification and analysis: the P2 virus passage was tested for virus titer.

(7) Strains with higher titers were selected for the second and third plaque purification, as above.

Example 3 determination of detection of candidate strains

Amplifying the strains purified by the three times of plaques to the 5 th generation to establish original seeds, carrying out related verification research and passage stability research on the original seeds, and selecting the strains with wide cross protection range, good genetic stability and high titer as detection candidate strains according to the passage stability research result. The specific study procedure was as described in example 1, unless otherwise specified.

The verification research of the original seed strain mainly comprises immunogenicity, virus titration, genome sequencing analysis and cross neutralization capability research.

The research of passage stability mainly includes that the original seed virus liquid is continuously subcultured on RD cells according to a certain proportion to 15 th generation, and virus titration and genome sequence analysis are carried out on each generation of virus strain in the passage process.

The strain verification research result shows that the strain with the number of R00880662 has good immunogenicity (the positive conversion rate of the blood serum after primary immunization can reach more than 80 percent, the positive conversion rate of the blood serum after secondary immunization is 100 percent, and the GMT value of the neutralizing antibody titer after secondary immunization is 1: 512), and the titer is 8.95LgCCID₅₀And/ml, the genome sequence is consistent with that of the initially screened strain R088.

The results of the intratype cross-neutralization study show that the strain detects GMT value of immune serum neutralizing antibody of 1:488, and the difference of the number of times is 4. The results are detailed in table 9 below. Wherein, the strains R00540613, R00080265, R00681123, R00800833 and R00810253 are original seeds obtained by carrying out multiple plaque-washing purification on the primary strains R054, R008, R068, R080 and R081 in the example 1.

Table 9 type internal cross neutralization experimental results

Further, inter-type cross-neutralization studies of the R00880662 strain were performed on 12 CV-a16 strains (see table 8 above for strain information) including 3a genotype, 8B genotype and 1C genotype strains, and the immune serum was mouse serum collected after 2 immunizations for 14 days. 12 sera were subjected to cross-neutralization assay with 12 CV-A16 virus strains, respectively. The cross-neutralization detection ability is reflected by the neutralizing antibody titer and fold difference of the strain to the whole serum.

The results show that: the neutralizing titer GMT of the immune serum of all to-be-detected strains is 14-598, and the neutralizing titer GMT of the immune serum of R00880662 strains is 598 when the neutralizing titer GMT of the immune serum of different strains is detected; the neutralizing titer GMT multiple difference of immune serum of all to-be-detected strains is 4-171, and the multiple difference of R00880662 strains is 16, which shows that the strains have better cross neutralization detection capability to the existing coxsackie virus A, B, C genotype.

The passage stability research shows that the strain with the number of R00880662 continuously passes 15 generations, and the titer trend of 5-15 generations is stable (8.21-9.17 LgCCID)₅₀Between/ml), the genomic sequences of 5 th, 10 th and 15 th generations were identical.

The strain with the number of R00880662 is preserved in the China general microbiological culture Collection center (CGMCC for short, the address: West Lu No.1 Hospital, Beijing, Chaozhou, Ind. region, No.3, the institute of microbiology, China academy of sciences, postal code 100101) at 7 months and 13 days of 2021, and is classified and named as Coxsackie virus A16 with the preservation number of CGMCC No. 19534.

The genome sequence of the R00880662 strain is shown in SEQ ID NO.3, the coding gene sequence of the P1 protein is shown in SEQ ID NO.2, the amino acid sequence of the P1 protein is shown in SEQ ID NO.1, the amino acid sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are shown in SEQ ID NO.4-10, and the coding gene sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown in SEQ ID NO. 11-17.

Example 4 detection of Strain titer calibration and specificity evaluation

The titer determination was carried out independently for 9 times by 3 subjects, and the result showed that the mean titer was 7.444LgCCID₅₀The concentration of the compound is/ml (95% CI: 7.361-7.528), and the distribution conforms to the normal distribution. The special research shows that the strain is preserved in China general microbiological culture Collection center (CGMCC No.1 institute of microorganisms, China institute of sciences, postal code 100101) on 13 months at 2021 and 13 days (CGMCC for short, address: Beijing western No.3 of south China institute of microorganisms, Japan and Japan, Classification of Coxsackie virus A10 type), enterovirus71 type serum and Coxsackie virus A6 serum (strain preservation No. CGMCC No.19532 for name of R70011631 which has been preserved in China general microbiological culture Collection center (CGMCC for short, China institute of microorganisms, Japan and Japan) 6 for the same enterovirus, the Coxsackie virus A10 serum (strain preservation No. CGMCC No.3 of south China province of Japan, China institute of microorganisms, Japan, and Classification of Japan, 101) is preserved on 13 days at 2021 and the Classification of Coxsackie virus A6 is not cross-linked with the Coxsackie virus A6, see the intra-type cross-neutralization study in example 1.

Example 5 pathogenicity study

According to the immunogenicity results in example 1, the optimal 3 strains are selected for pathogenicity preliminary study, and the most pathogenic strain is selected according to the results for LD₅₀And (5) researching.

Preliminary study frozen 3 strains were thawed quickly and diluted to 10% with virus maintenance solution containing 2% FBS⁵CCID₅₀0.05ml, respectively intraperitoneally inoculating 50 mul of Balb/C suckling mice of 1 day old, 1 nest (5-10) of each strain, and additionally setting virus maintenance liquid containing 2% FBS as a control group. The actual number of mice was recorded. Mice were recorded for 21 consecutive days of morbidity and mortality. The results showed that the same challenge dose, with the strain No. R00880662 killed 100% at day 3 after challenge and the remaining two strains (R00681123, R00540613) killed 100% at day 6 and day 9 after challenge, respectively, as shown in figure 2. The strain numbered R00880662 was shown to be more virulent. The strain was therefore selected as challenge strain for LD₅₀And (5) researching.

Quickly thawing frozen R00880662 strain, diluting 10 times of virus maintenance solution containing 2% FBS in series, and sequentially diluting to 10%³、10²、10¹、10⁰、10^-1CCID₅₀0.05ml five concentrations.

Each diluted virus solution was inoculated to 50. mu.l of 1-day-old Balb/C suckling mice in each peritoneal cavity, and a virus maintenance solution containing 2% FBS was added to the control group at 1 nest (5-10 mice) per dilution. The actual number of mice was recorded. Continuously observing for 21 days, recording the morbidity and mortality of mice, and calculating the cumulative mortality and LD of each virus strain according to the Reed-Muench method₅₀The value is obtained.

The survival rate of the control group for 21 days is 100%, and the test is established. Results display 10² CCID₅₀All suckling mice in the challenge group died in 7 days, while 10 CCID₅₀Mortality rate of the challenge group was 33.3%, compared to 1 CCID₅₀0.1 CCID₅₀The drug-attacking group and the control group did not show clinical symptoms, and the death rate was 0%. Calculated according to the Reed-muench method, using the dilution as a standard, LD₅₀Is 5 x 10^-5(ii) a Using titer as a standard, LD₅₀Is 112.94CCID₅₀The/ml, survival curves are shown in FIG. 3. The strain is shown to be a strain with strong pathogenicity, and can be used for protective evaluation of a coxsackievirus A16 related vaccine.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing Minhai Biotechnology Ltd

<120> coxsackievirus A16 type strain and application thereof

<130> KHP211120537.2YS

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 862

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Gly Ser Gln Val Ser Thr Gln Arg Ser Gly Ser His Glu Asn Ser

1 5 10 15

Asn Ser Ala Ser Glu Gly Ser Thr Ile Asn Tyr Thr Thr Ile Asn Tyr

20 25 30

Tyr Lys Asp Ala Tyr Ala Ala Ser Ala Gly Arg Gln Asp Met Ser Gln

35 40 45

Asp Pro Lys Lys Phe Thr Asp Pro Val Met Asp Val Ile His Glu Met

50 55 60

Ala Pro Pro Leu Lys Ser Pro Ser Ala Glu Ala Cys Gly Tyr Ser Asp

65 70 75 80

Arg Val Ala Gln Leu Thr Ile Gly Asn Ser Thr Ile Thr Thr Gln Glu

85 90 95

Ala Ala Asn Ile Val Ile Ala Tyr Gly Glu Trp Pro Glu Tyr Cys Pro

100 105 110

Asp Thr Asp Ala Thr Ala Val Asp Lys Pro Thr Arg Pro Asp Val Ser

115 120 125

Val Asn Arg Phe Phe Thr Leu Asp Thr Lys Ser Trp Ala Lys Asp Ser

130 135 140

Lys Gly Trp Tyr Trp Lys Phe Pro Asp Val Leu Thr Glu Val Gly Val

145 150 155 160

Phe Gly Gln Asn Ala Gln Phe His Tyr Leu Tyr Arg Ser Gly Phe Cys

165 170 175

Val His Val Gln Cys Asn Ala Ser Lys Phe His Gln Gly Ala Leu Leu

180 185 190

Val Ala Val Leu Pro Glu Tyr Val Leu Gly Thr Ile Ala Gly Gly Thr

195 200 205

Gly Asn Glu Asn Ser His Pro Pro Tyr Ala Thr Thr Gln Pro Gly Gln

210 215 220

Val Gly Ala Val Leu Met His Pro Tyr Val Leu Asp Ala Gly Ile Pro

225 230 235 240

Leu Ser Gln Leu Thr Val Cys Pro His Gln Trp Ile Asn Leu Arg Thr

245 250 255

Asn Asn Cys Ala Thr Ile Ile Val Pro Tyr Met Asn Thr Val Pro Phe

260 265 270

Asp Ser Ala Leu Asn His Cys Asn Phe Gly Leu Leu Val Val Pro Val

275 280 285

Val Pro Leu Asp Phe Asn Thr Gly Ala Thr Ser Glu Ile Pro Ile Thr

290 295 300

Val Thr Ile Ala Pro Met Cys Ala Glu Phe Ala Gly Leu Arg Gln Ala

305 310 315 320

Val Lys Gln Gly Ile Pro Thr Glu Leu Lys Pro Gly Thr Asn Gln Phe

325 330 335

Leu Thr Thr Asp Asp Gly Val Ser Ala Pro Ile Leu Pro Gly Phe His

340 345 350

Pro Thr Pro Pro Ile His Ile Pro Gly Glu Val His Asn Leu Leu Glu

355 360 365

Ile Cys Arg Val Glu Thr Ile Leu Glu Val Asn Asn Leu Lys Thr Asn

370 375 380

Glu Thr Thr Pro Met Gln Arg Leu Cys Phe Pro Val Ser Val Gln Ser

385 390 395 400

Lys Thr Gly Glu Leu Cys Ala Ala Phe Arg Ala Asp Pro Gly Arg Asp

405 410 415

Gly Pro Trp Gln Ser Thr Ile Leu Gly Gln Leu Cys Arg Tyr Tyr Thr

420 425 430

Gln Trp Ser Gly Ser Leu Glu Val Thr Phe Met Phe Ala Gly Ser Phe

435 440 445

Met Ala Thr Gly Lys Met Leu Ile Ala Tyr Thr Pro Pro Gly Gly Asn

450 455 460

Val Pro Ala Asp Arg Ile Thr Ala Met Leu Gly Thr His Val Ile Trp

465 470 475 480

Asp Phe Gly Leu Gln Ser Ser Val Thr Leu Val Val Pro Trp Ile Ser

485 490 495

Asn Thr His Tyr Arg Ala His Ala Arg Ala Gly Tyr Phe Asp Tyr Tyr

500 505 510

Thr Thr Gly Ile Ile Thr Ile Trp Tyr Gln Thr Asn Tyr Val Val Pro

515 520 525

Ile Gly Ala Pro Thr Thr Ala Tyr Ile Val Ala Leu Ala Ala Ala Gln

530 535 540

Asp Asn Phe Thr Met Lys Leu Cys Lys Asp Thr Glu Asp Ile Glu Gln

545 550 555 560

Thr Ala Asn Ile Gln Gly Asp Pro Ile Ala Asp Met Ile Asp Gln Thr

565 570 575

Val Asn Asn Gln Val Asn Arg Ser Leu Thr Ala Leu Gln Val Leu Pro

580 585 590

Thr Ala Ala Asn Thr Glu Ala Ser Ser His Arg Leu Gly Thr Gly Val

595 600 605

Val Pro Ala Leu Gln Ala Ala Glu Thr Gly Ala Ser Ser Asn Ala Ser

610 615 620

Asp Lys Asn Leu Ile Glu Thr Arg Cys Val Leu Asn His His Ser Thr

625 630 635 640

Gln Glu Thr Ala Ile Gly Asn Phe Phe Ser Arg Ala Gly Leu Val Ser

645 650 655

Ile Ile Thr Met Pro Thr Thr Gly Thr Gln Asp Thr Asp Gly Tyr Val

660 665 670

Asn Trp Asp Ile Asp Leu Met Gly Tyr Ala Gln Leu Arg Arg Lys Cys

675 680 685

Glu Leu Phe Thr Tyr Met Arg Phe Asp Ala Glu Phe Thr Phe Val Val

690 695 700

Ala Lys Pro Asn Gly Gly Leu Val Pro Gln Leu Leu Gln Tyr Met Tyr

705 710 715 720

Val Pro Pro Gly Ala Pro Lys Pro Lys Ser Arg Asp Ser Phe Ala Trp

725 730 735

Gln Thr Ala Thr Asn Pro Ser Val Phe Val Lys Met Thr Asp Pro Pro

740 745 750

Ala Gln Val Ser Val Pro Phe Met Ser Pro Ala Ser Ala Tyr Gln Trp

755 760 765

Phe Tyr Asp Gly Tyr Pro Thr Phe Gly Glu His Leu Gln Ala Asn Asp

770 775 780

Leu Asp Tyr Gly Gln Cys Pro Asn Asn Met Met Gly Thr Phe Ser Ile

785 790 795 800

Arg Thr Val Gly Thr Glu Lys Ser Pro His Ser Ile Ala Leu Arg Ile

805 810 815

Tyr Met Arg Ile Lys His Val Arg Ala Trp Ile Pro Arg Pro Leu Arg

820 825 830

Asn Gln Pro Tyr Leu Phe Lys Thr Asn Pro Asn Tyr Lys Gly Asn Asp

835 840 845

Ile Lys Cys Thr Ser Thr Ser Arg Asp Lys Ile Thr Thr Leu

850 855 860

<210> 2

<211> 2586

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggggtcac aagtctctac tcagcggtcc gggtcgcatg agaactcaaa ctccgcatcg 60

gaaggctcaa ccataaatta tacaactata aactactata aggatgcata tgctgcgagt 120

gcggggcgcc aggatatgtc tcaagacccg aagaaattta ccgaccctgt tatggatgtt 180

atacatgaga tggccccacc gctcaagtct ccgagcgctg aggcgtgtgg ttatagtgat 240

cgtgtggccc agcttaccat tgggaattct accattacta cgcaagaagc agctaacata 300

gttatagcct atggggagtg gcctgaatat tgcccagaca cggatgcgac ggcagtcgac 360

aagcccacac gacctgacgt gtcagtgaat agatttttca cactagatac taaatcttgg 420

gcaaaggatt caaagggatg gtattggaaa ttccccgatg ttttgacaga ggtaggcgtg 480

tttggtcaaa atgctcaatt tcactacctg tatcgatctg gattttgcgt gcacgtccag 540

tgtaatgcaa gtaaattcca ccagggtgct ttactggtgg ccgtgctacc tgagtatgtg 600

ctcggcacta tcgcaggggg gactgggaac gagaattctc atcctcccta cgctactaca 660

cagcctggtc aggttggtgc agtcctgatg cacccatatg tactagatgc agggatacct 720

ttgagccaat taaccgtgtg tcctcaccag tggatcaact tgagaaccaa caattgtgca 780

actattatag tcccatacat gaacacggtt ccatttgatt cagctcttaa tcactgcaat 840

tttgggttgc tggtcgtccc ggtggtgcca ttggacttta atacaggtgc cacgtctgaa 900

attcctatta cagtcaccat agctcccatg tgtgcagagt ttgcgggtct gcgccaggca 960

gtgaagcaag gcataccaac agagctcaag cctggtacca atcagtttct cactaccgat 1020

gatggtgtct ctgcaccaat tttaccaggc ttccacccaa ccccccctat acatatacca 1080

ggagaagtgc ataacttatt ggagatatgt agagtggaga ccattttaga agttaacaac 1140

ctgaagacca atgagaccac ccccatgcag cgcttgtgct ttccagtgtc agttcagagc 1200

aaaacaggtg agttgtgtgc tgcctttaga gcagaccctg gaagagatgg tccgtggcag 1260

tccacaatac tgggtcaact ctgcaggtac tacacccagt ggtcgggttc attggaggtg 1320

acatttatgt ttgcgggctc attcatggcc acaggcaaga tgctcatcgc ctacacccca 1380

cctgggggaa atgtgcctgc ggacagaatc acagcaatgt taggaacgca tgtgatctgg 1440

gactttggat tgcaatcctc tgtgacattg gttgtgccat ggattagcaa tacgcattac 1500

agggcgcacg cccgtgctgg gtactttgac tattacacta ccggcattat aactatatgg 1560

tatcaaacca actatgtggt acctattggc gctcccacta cagcatacat cgtagctctg 1620

gcagcagccc aagacaactt taccatgaaa ttatgcaagg atacagagga cattgagcaa 1680

acagctaata tacaagggga tcccattgct gacatgatcg accaaactgt gaataaccaa 1740

gtgaaccgct ccttaaccgc attacaagta ctacctacag ctgccaatac tgaagcaagt 1800

agccacagat taggcactgg tgttgtgcca gcactgcaag ctgcggagac gggggcgtca 1860

tcaaatgcca gtgacaagaa tctcattgag acgagatgtg tgttgaacca tcattccaca 1920

caggagacag ccatcgggaa tttctttagc cgtgctggtt tggttagyat catcacaatg 1980

cccaccacgg gtacacagga cacagacggt tacgtcaact gggacattga cttgatggga 2040

tatgctcaac tacggcgcaa gtgcgagttg ttcacgtata tgcgctttga tgctgaattc 2100

acatttgtcg tagctaaacc caatggcgga ctggtccccc agttactgca gtacatgtat 2160

gtcccaccag gagccccgaa acccaaatct agagattcat ttgcttggca aactgctacc 2220

aacccgtctg tatttgtgaa aatgacagac ccaccagctc aagtgtcagt cccctttatg 2280

tcaccagcca gtgcatacca atggttttac gatggttatc ccactttcgg ggagcatctc 2340

caagcaaatg atctagatta tggccagtgc ccgaacaata tgatgggcac ctttagtatt 2400

agaacagtag ggactgagaa gtcaccacac tccattgctc tgaggatata tatgaggatt 2460

aaacacgtta gagcgtggat tccaaggcct ctgagaaatc aaccctattt gtttaagacc 2520

aacccaaatt ataaagggaa tgacattaag tgtactagta ctagtagaga caagataaca 2580

acatta 2586

<210> 3

<211> 7381

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cacccacagg gcccacgggg cgttagcaca ctggcgttac ggcacctttg tgcgcctgtt 60

ttgtttcccc tcccccccgc aatttagaag ttttgcgcca tggatcaata gcaggtgtgt 120

cgcaccaggc acatctagat caagcacttc tgtttccccg gactgagtat caataggctg 180

ctcacgcggc tgaaggagaa agcgttcgtt atccggccaa ctacttcgag aagcttagta 240

ccaccatgaa cgttgcagag tgtttcgctc agcacatccc cagtgtagat caggtcgatg 300

agtcaccgca ctccccacgg gcgaccgtgg cggtggctgc gttggcggcc tgcctatggg 360

gcaacccata ggacgctcta ataccgacat ggtgcgaaga gcctattgag ctagttggta 420

gtcctccggc ccctgaatgc ggctaatcct aactgcggag catgtactca caatccagtg 480

ggcagcatgt cgtaacgggc aactctgcag cggaaccgac tactttgggt gtccgtgttt 540

ccttttattc ttatattggc tgcttatggt gacaattgaa gaattgttac catatagcta 600

ttggattggc catccggtgt ctaacagagc tattgtttac ctgtttgttg gatacgttcc 660

tctcaatttc aaggtcatta aaactcttaa ttatatacta cttctcaact gtgagaaatg 720

gggtcacaag tctctactca gcggtccggg tcgcatgaga actcaaactc cgcatcggaa 780

ggctcaacca taaattatac aactataaac tactataagg atgcatatgc tgcgagtgcg 840

gggcgccagg atatgtctca agacccgaag aaatttaccg accctgttat ggatgttata 900

catgagatgg ccccaccgct caagtctccg agcgctgagg cgtgtggtta tagtgatcgt 960

gtggcccagc ttaccattgg gaattctacc attactacgc aagaagcagc taacatagtt 1020

atagcctatg gggagtggcc tgaatattgc ccagacacgg atgcgacggc agtcgacaag 1080

cccacacgac ctgacgtgtc agtgaataga tttttcacac tagatactaa atcttgggca 1140

aaggattcaa agggatggta ttggaaattc cccgatgttt tgacagaggt aggcgtgttt 1200

ggtcaaaatg ctcaatttca ctacctgtat cgatctggat tttgcgtgca cgtccagtgt 1260

aatgcaagta aattccacca gggtgcttta ctggtggccg tgctacctga gtatgtgctc 1320

ggcactatcg caggggggac tgggaacgag aattctcatc ctccctacgc tactacacag 1380

cctggtcagg ttggtgcagt cctgatgcac ccatatgtac tagatgcagg gatacctttg 1440

agccaattaa ccgtgtgtcc tcaccagtgg atcaacttga gaaccaacaa ttgtgcaact 1500

attatagtcc catacatgaa cacggttcca tttgattcag ctcttaatca ctgcaatttt 1560

gggttgctgg tcgtcccggt ggtgccattg gactttaata caggtgccac gtctgaaatt 1620

cctattacag tcaccatagc tcccatgtgt gcagagtttg cgggtctgcg ccaggcagtg 1680

aagcaaggca taccaacaga gctcaagcct ggtaccaatc agtttctcac taccgatgat 1740

ggtgtctctg caccaatttt accaggcttc cacccaaccc cccctataca tataccagga 1800

gaagtgcata acttattgga gatatgtaga gtggagacca ttttagaagt taacaacctg 1860

aagaccaatg agaccacccc catgcagcgc ttgtgctttc cagtgtcagt tcagagcaaa 1920

acaggtgagt tgtgtgctgc ctttagagca gaccctggaa gagatggtcc gtggcagtcc 1980

acaatactgg gtcaactctg caggtactac acccagtggt cgggttcatt ggaggtgaca 2040

tttatgtttg cgggctcatt catggccaca ggcaagatgc tcatcgccta caccccacct 2100

gggggaaatg tgcctgcgga cagaatcaca gcaatgttag gaacgcatgt gatctgggac 2160

tttggattgc aatcctctgt gacattggtt gtgccatgga ttagcaatac gcattacagg 2220

gcgcacgccc gtgctgggta ctttgactat tacactaccg gcattataac tatatggtat 2280

caaaccaact atgtggtacc tattggcgct cccactacag catacatcgt agctctggca 2340

gcagcccaag acaactttac catgaaatta tgcaaggata cagaggacat tgagcaaaca 2400

gctaatatac aaggggatcc cattgctgac atgatcgacc aaactgtgaa taaccaagtg 2460

aaccgctcct taaccgcatt acaagtacta cctacagctg ccaatactga agcaagtagc 2520

cacagattag gcactggtgt tgtgccagca ctgcaagctg cggagacggg ggcgtcatca 2580

aatgccagtg acaagaatct cattgagacg agatgtgtgt tgaaccatca ttccacacag 2640

gagacagcca tcgggaattt ctttagccgt gctggtttgg ttagyatcat cacaatgccc 2700

accacgggta cacaggacac agacggttac gtcaactggg acattgactt gatgggatat 2760

gctcaactac ggcgcaagtg cgagttgttc acgtatatgc gctttgatgc tgaattcaca 2820

tttgtcgtag ctaaacccaa tggcggactg gtcccccagt tactgcagta catgtatgtc 2880

ccaccaggag ccccgaaacc caaatctaga gattcatttg cttggcaaac tgctaccaac 2940

ccgtctgtat ttgtgaaaat gacagaccca ccagctcaag tgtcagtccc ctttatgtca 3000

ccagccagtg cataccaatg gttttacgat ggttatccca ctttcgggga gcatctccaa 3060

gcaaatgatc tagattatgg ccagtgcccg aacaatatga tgggcacctt tagtattaga 3120

acagtaggga ctgagaagtc accacactcc attgctctga ggatatatat gaggattaaa 3180

cacgttagag cgtggattcc aaggcctctg agaaatcaac cctatttgtt taagaccaac 3240

ccaaattata aagggaatga cattaagtgt actagtacta gtagagacaa gataacaaca 3300

ttaggaaggt ttgggcagca gtcgggcgcc atatatgtag gcaactatag ggtagtgaat 3360

cggcatcttg ccacacacaa cgactgggca aatcttgtgt gggaggacag ctctagagac 3420

ctgttagttt cttccaccac tgcccagggg tgcgatacca tcgctagatg cgattgtcaa 3480

gccggagtat attattgcaa ctccaagaga aaacactacc cggttagttt caccaagccc 3540

agcctggtat ttgtggaggc tagtgagtat tacccagcta gataccaatc ccaccttatg 3600

cttgctgtag gccattcaga acctggcgac tgtggtggca tcctcagatg ccaacacggt 3660

gtgataggaa ttgtctccac tggtggcaat ggtcttgtgg ggtttgctga catcagagat 3720

ctcctgtggc tggatgaaga agcgatggag caaggagtgt ctgattatat caaaggcctc 3780

ggtgatgctt ttggcatggg cttcactgat gcagtgtcca gggaagtgga ggcattgaag 3840

aaccacttaa tcggttcaga aggggctgtt gaaaaaattc tgaagaattt ggtgaagcta 3900

atttcagcat tagtcatagt cgttaggagt gactatgaca tggtcaccct cacagccacg 3960

cttgccttga ttgggtgcca tggaagccct tgggcatgga taaaagcgaa gacagcctct 4020

attcttggca ttcccatagt gcaaaagcag agcgcttcat ggctaaagaa gtttaatgac 4080

atggctaatg ctgctaaggg acttgagtgg atttctagta aaatcagtaa gtttattgat 4140

tggcttaagg aaaagattat cccagccgct aaagagaagg ttgaattctt gaacaacttg 4200

aagcagcttc ccttactgga gaaccaaatt tcgaatctcg aacagtctgc tgcctcgcag 4260

gaggatctag aagctatgtt tggtaacgtg tcatatttgg cccacttttg ccgcaagttt 4320

cagccactct acgcaaccga agctaaacga gtctatgcgc tggagaaaag gatgaacaac 4380

tacatgcagt tcaagagcaa acaccgtatt gaacccgtat gtttgatcat cagaggctcc 4440

ccaggaacag gcaagtcgct tgccacgggc atcatagcta gagccattgc cgataaatac 4500

cattctagtg tttactcact tcctccagac ccagaccatt tcgatgggta caagcaacag 4560

gtagtcactg ttatggatga tctttgtcaa aacccagatg gaaaggacat gtcactattt 4620

tgccagatgg tttctacagt ggatttcata ccacccatgg catccctgga agagaaggga 4680

gtgtctttca cctctaagtt tgtcattgca tcgaccaatg ctagcaacat agtagttccc 4740

acagtttcag actcagatgc gattcgcaga cggttctaca tggactgtga tatagaggtg 4800

acagattcct acaagacaga ccttggccga cttgatgcag gtagagccgc caagctttgc 4860

acggaaaata ataccgccaa ctttaagaga tgcagcccac tagtgtgtgg caaagctatt 4920

caactaagag ataggaaatc caaagtgaga tacagcattg atactgtagt atcggagcta 4980

atcagagagt acaacaatag atccgccatc ggtaatacta tagaagctct cttccaagga 5040

ccccttaagt tcaagcctat aaggattagc cttgaagaga agccagctcc ggatgccatc 5100

agtgacctac tagctagtgt ggatagcgaa gaggttcggc aatactgcag ggaacagggg 5160

tggataattc cagaaacacc ggccaatgtg gaacgtcacc tcaacagagc agtgctagtg 5220

atgcagtcta tcgccaccgt ggttgcagtt gtgtctcttg tctatgttat ttacaaattg 5280

ttcgctgggt ttcagggtgc ttattctggt gcgcccaaac aagctcttaa gaagcccgtg 5340

ctaagaacag ccacggttca aggaccgagt ttagactttg ccttatccct tttaaggcgt 5400

aacattagac aggtgcaaac tgatcaaggg cacttcacca tgttaggggt acgggaccgc 5460

ctggctgttc tgccacgcca ctcgcaacca ggaaaaacta tttgggtgga acacaaattg 5520

attaatgtgc tagacgctgt tgagttagta gatgaacaag gtgtgaattt ggaacttaca 5580

ctagtaactt tagacaccaa cgaaaagttt agggacatca ccaagtttat tccagagaca 5640

atcactggag caagtgacgc aaccttgatc atcaacactg agcatatgcc ctcaatgttc 5700

gtcccagtgg gtgatgttgt acaatatgga ttcttgaatc ttagcggtaa gcccacacac 5760

cggaccatga tgtataactt ccccacaaag gcaggacagt gtggaggagt agtcacctca 5820

gttggtaaga tcattggagt ccacattggt gggaacggcc gtcaaggttt ctgtgctggg 5880

ttgaagagga gctactttgc cagtgaacag ggagaaatcc agtggatgaa gcccaataag 5940

gagactggga gattgaatgt taatggcccg acccgtacca aattagagcc tagtgtattc 6000

catgatgtgt ttgagggcag caaagaacca gcagtcttaa ccagtaagga ccccagactc 6060

gaggttgatt ttgagcaagc tttgttttcc aagtatgtgg gaaacacctt gcatgagcct 6120

gatgagtatg tgacgcaggc tgctctccac tatgctaacc agttaaaaca attagacatc 6180

aatactaata agatgagcat ggaagaagca tgttatggca ctgaatatct ggaggccata 6240

gaccttcata ccagtgctgg gtatccctat agtgccttgg gcattaagaa aagggacata 6300

ctcgacccgg tcactagaga caccactaaa atgaaattct acatggacaa atatgggtta 6360

gacatgccct attccactta tgtgaaagat gagctcaggt ccttagataa gattaagaag 6420

gggaaatccc gtttgattga agccagcagc ttgaatgatt cagtctatct taggatgacc 6480

tttgggcatc tctatgagac ttttcatgcc aacccgggga ctgtgaccgg atctgcagta 6540

gggtgcaatc ctgatgtgtt ctggagtaaa ttaccgatcc tgttaccggg gtcgctcttt 6600

gcatttgatt attcagggta tgatgcaagc ctcagcccag tgtggttcag agctttagag 6660

gtggtcctcc gtgagattgg ttactcagag gaggctgtgt cactaataga agggatcaac 6720

cacacccatc atgtgtatcg gaacaagaca tattgtgtcc ttggtggaat gccctcaggt 6780

tgttccggca cttccatctt caactctatg atcaataata taataatcag aactcttctg 6840

atcaaaacct ttaaggggat cgatttagat gagttgaaca tggtagctta tggagatgat 6900

gtgctggcta gctatccatt ccctattgac tgttcggagt tggccaagac tggcaaagag 6960

tatggattaa caatgacacc tgctgacaaa tcaccctgct ttaacgaagt cacttgggag 7020

aatgctacat tcttaaagag aggcttcttg ccagatcacc agtttccatt ccttatccac 7080

cccaccatgc ctatgagaga gatccatgag tccattcgtt ggactaagga tgcacgcaac 7140

actcaggacc acgtgcgttc cttgtgccta ttagcatggc ataatgggaa ggaggagtat 7200

gaaaaatttg tgagcacaat tagatcggtt cctattggga aagccttggc tataccaaat 7260

tttgaaaacc tgagaagaaa ttggctcgaa ttattttgat atacagctca aagctgaacc 7320

ccaccagaaa tctggtcatg ttaatgactg gtgggggtaa atttgttata accaagaaat 7380

a 7381

<210> 4

<211> 150

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Gly Arg Phe Gly Gln Gln Ser Gly Ala Ile Tyr Val Gly Asn Tyr Arg

1 5 10 15

Val Val Asn Arg His Leu Ala Thr His Asn Asp Trp Ala Asn Leu Val

20 25 30

Trp Glu Asp Ser Ser Arg Asp Leu Leu Val Ser Ser Thr Thr Ala Gln

35 40 45

Gly Cys Asp Thr Ile Ala Arg Cys Asp Cys Gln Ala Gly Val Tyr Tyr

50 55 60

Cys Asn Ser Lys Arg Lys His Tyr Pro Val Ser Phe Thr Lys Pro Ser

65 70 75 80

Leu Val Phe Val Glu Ala Ser Glu Tyr Tyr Pro Ala Arg Tyr Gln Ser

85 90 95

His Leu Met Leu Ala Val Gly His Ser Glu Pro Gly Asp Cys Gly Gly

100 105 110

Ile Leu Arg Cys Gln His Gly Val Ile Gly Ile Val Ser Thr Gly Gly

115 120 125

Asn Gly Leu Val Gly Phe Ala Asp Ile Arg Asp Leu Leu Trp Leu Asp

130 135 140

Glu Glu Ala Met Glu Gln

145 150

<210> 5

<211> 99

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Gly Val Ser Asp Tyr Ile Lys Gly Leu Gly Asp Ala Phe Gly Met Gly

1 5 10 15

Phe Thr Asp Ala Val Ser Arg Glu Val Glu Ala Leu Lys Asn His Leu

20 25 30

Ile Gly Ser Glu Gly Ala Val Glu Lys Ile Leu Lys Asn Leu Val Lys

35 40 45

Leu Ile Ser Ala Leu Val Ile Val Val Arg Ser Asp Tyr Asp Met Val

50 55 60

Thr Leu Thr Ala Thr Leu Ala Leu Ile Gly Cys His Gly Ser Pro Trp

65 70 75 80

Ala Trp Ile Lys Ala Lys Thr Ala Ser Ile Leu Gly Ile Pro Ile Val

85 90 95

Gln Lys Gln

<210> 6

<211> 329

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Ser Ala Ser Trp Leu Lys Lys Phe Asn Asp Met Ala Asn Ala Ala Lys

1 5 10 15

Gly Leu Glu Trp Ile Ser Ser Lys Ile Ser Lys Phe Ile Asp Trp Leu

20 25 30

Lys Glu Lys Ile Ile Pro Ala Ala Lys Glu Lys Val Glu Phe Leu Asn

35 40 45

Asn Leu Lys Gln Leu Pro Leu Leu Glu Asn Gln Ile Ser Asn Leu Glu

50 55 60

Gln Ser Ala Ala Ser Gln Glu Asp Leu Glu Ala Met Phe Gly Asn Val

65 70 75 80

Ser Tyr Leu Ala His Phe Cys Arg Lys Phe Gln Pro Leu Tyr Ala Thr

85 90 95

Glu Ala Lys Arg Val Tyr Ala Leu Glu Lys Arg Met Asn Asn Tyr Met

100 105 110

Gln Phe Lys Ser Lys His Arg Ile Glu Pro Val Cys Leu Ile Ile Arg

115 120 125

Gly Ser Pro Gly Thr Gly Lys Ser Leu Ala Thr Gly Ile Ile Ala Arg

130 135 140

Ala Ile Ala Asp Lys Tyr His Ser Ser Val Tyr Ser Leu Pro Pro Asp

145 150 155 160

Pro Asp His Phe Asp Gly Tyr Lys Gln Gln Val Val Thr Val Met Asp

165 170 175

Asp Leu Cys Gln Asn Pro Asp Gly Lys Asp Met Ser Leu Phe Cys Gln

180 185 190

Met Val Ser Thr Val Asp Phe Ile Pro Pro Met Ala Ser Leu Glu Glu

195 200 205

Lys Gly Val Ser Phe Thr Ser Lys Phe Val Ile Ala Ser Thr Asn Ala

210 215 220

Ser Asn Ile Val Val Pro Thr Val Ser Asp Ser Asp Ala Ile Arg Arg

225 230 235 240

Arg Phe Tyr Met Asp Cys Asp Ile Glu Val Thr Asp Ser Tyr Lys Thr

245 250 255

Asp Leu Gly Arg Leu Asp Ala Gly Arg Ala Ala Lys Leu Cys Thr Glu

260 265 270

Asn Asn Thr Ala Asn Phe Lys Arg Cys Ser Pro Leu Val Cys Gly Lys

275 280 285

Ala Ile Gln Leu Arg Asp Arg Lys Ser Lys Val Arg Tyr Ser Ile Asp

290 295 300

Thr Val Val Ser Glu Leu Ile Arg Glu Tyr Asn Asn Arg Ser Ala Ile

305 310 315 320

Gly Asn Thr Ile Glu Ala Leu Phe Gln

325

<210> 7

<211> 86

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Gly Pro Leu Lys Phe Lys Pro Ile Arg Ile Ser Leu Glu Glu Lys Pro

1 5 10 15

Ala Pro Asp Ala Ile Ser Asp Leu Leu Ala Ser Val Asp Ser Glu Glu

20 25 30

Val Arg Gln Tyr Cys Arg Glu Gln Gly Trp Ile Ile Pro Glu Thr Pro

35 40 45

Ala Asn Val Glu Arg His Leu Asn Arg Ala Val Leu Val Met Gln Ser

50 55 60

Ile Ala Thr Val Val Ala Val Val Ser Leu Val Tyr Val Ile Tyr Lys

65 70 75 80

Leu Phe Ala Gly Phe Gln

85

<210> 8

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Gly Ala Tyr Ser Gly Ala Pro Lys Gln Ala Leu Lys Lys Pro Val Leu

1 5 10 15

Arg Thr Ala Thr Val Gln

20

<210> 9

<211> 183

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Gly Pro Ser Leu Asp Phe Ala Leu Ser Leu Leu Arg Arg Asn Ile Arg

1 5 10 15

Gln Val Gln Thr Asp Gln Gly His Phe Thr Met Leu Gly Val Arg Asp

20 25 30

Arg Leu Ala Val Leu Pro Arg His Ser Gln Pro Gly Lys Thr Ile Trp

35 40 45

Val Glu His Lys Leu Ile Asn Val Leu Asp Ala Val Glu Leu Val Asp

50 55 60

Glu Gln Gly Val Asn Leu Glu Leu Thr Leu Val Thr Leu Asp Thr Asn

65 70 75 80

Glu Lys Phe Arg Asp Ile Thr Lys Phe Ile Pro Glu Thr Ile Thr Gly

85 90 95

Ala Ser Asp Ala Thr Leu Ile Ile Asn Thr Glu His Met Pro Ser Met

100 105 110

Phe Val Pro Val Gly Asp Val Val Gln Tyr Gly Phe Leu Asn Leu Ser

115 120 125

Gly Lys Pro Thr His Arg Thr Met Met Tyr Asn Phe Pro Thr Lys Ala

130 135 140

Gly Gln Cys Gly Gly Val Val Thr Ser Val Gly Lys Ile Ile Gly Val

145 150 155 160

His Ile Gly Gly Asn Gly Arg Gln Gly Phe Cys Ala Gly Leu Lys Arg

165 170 175

Ser Tyr Phe Ala Ser Glu Gln

180

<210> 10

<211> 462

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Gly Glu Ile Gln Trp Met Lys Pro Asn Lys Glu Thr Gly Arg Leu Asn

1 5 10 15

Val Asn Gly Pro Thr Arg Thr Lys Leu Glu Pro Ser Val Phe His Asp

20 25 30

Val Phe Glu Gly Ser Lys Glu Pro Ala Val Leu Thr Ser Lys Asp Pro

35 40 45

Arg Leu Glu Val Asp Phe Glu Gln Ala Leu Phe Ser Lys Tyr Val Gly

50 55 60

Asn Thr Leu His Glu Pro Asp Glu Tyr Val Thr Gln Ala Ala Leu His

65 70 75 80

Tyr Ala Asn Gln Leu Lys Gln Leu Asp Ile Asn Thr Asn Lys Met Ser

85 90 95

Met Glu Glu Ala Cys Tyr Gly Thr Glu Tyr Leu Glu Ala Ile Asp Leu

100 105 110

His Thr Ser Ala Gly Tyr Pro Tyr Ser Ala Leu Gly Ile Lys Lys Arg

115 120 125

Asp Ile Leu Asp Pro Val Thr Arg Asp Thr Thr Lys Met Lys Phe Tyr

130 135 140

Met Asp Lys Tyr Gly Leu Asp Met Pro Tyr Ser Thr Tyr Val Lys Asp

145 150 155 160

Glu Leu Arg Ser Leu Asp Lys Ile Lys Lys Gly Lys Ser Arg Leu Ile

165 170 175

Glu Ala Ser Ser Leu Asn Asp Ser Val Tyr Leu Arg Met Thr Phe Gly

180 185 190

His Leu Tyr Glu Thr Phe His Ala Asn Pro Gly Thr Val Thr Gly Ser

195 200 205

Ala Val Gly Cys Asn Pro Asp Val Phe Trp Ser Lys Leu Pro Ile Leu

210 215 220

Leu Pro Gly Ser Leu Phe Ala Phe Asp Tyr Ser Gly Tyr Asp Ala Ser

225 230 235 240

Leu Ser Pro Val Trp Phe Arg Ala Leu Glu Val Val Leu Arg Glu Ile

245 250 255

Gly Tyr Ser Glu Glu Ala Val Ser Leu Ile Glu Gly Ile Asn His Thr

260 265 270

His His Val Tyr Arg Asn Lys Thr Tyr Cys Val Leu Gly Gly Met Pro

275 280 285

Ser Gly Cys Ser Gly Thr Ser Ile Phe Asn Ser Met Ile Asn Asn Ile

290 295 300

Ile Ile Arg Thr Leu Leu Ile Lys Thr Phe Lys Gly Ile Asp Leu Asp

305 310 315 320

Glu Leu Asn Met Val Ala Tyr Gly Asp Asp Val Leu Ala Ser Tyr Pro

325 330 335

Phe Pro Ile Asp Cys Ser Glu Leu Ala Lys Thr Gly Lys Glu Tyr Gly

340 345 350

Leu Thr Met Thr Pro Ala Asp Lys Ser Pro Cys Phe Asn Glu Val Thr

355 360 365

Trp Glu Asn Ala Thr Phe Leu Lys Arg Gly Phe Leu Pro Asp His Gln

370 375 380

Phe Pro Phe Leu Ile His Pro Thr Met Pro Met Arg Glu Ile His Glu

385 390 395 400

Ser Ile Arg Trp Thr Lys Asp Ala Arg Asn Thr Gln Asp His Val Arg

405 410 415

Ser Leu Cys Leu Leu Ala Trp His Asn Gly Lys Glu Glu Tyr Glu Lys

420 425 430

Phe Val Ser Thr Ile Arg Ser Val Pro Ile Gly Lys Ala Leu Ala Ile

435 440 445

Pro Asn Phe Glu Asn Leu Arg Arg Asn Trp Leu Glu Leu Phe

450 455 460

<210> 11

<211> 450

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggaaggtttg ggcagcagtc gggcgccata tatgtaggca actatagggt agtgaatcgg 60

catcttgcca cacacaacga ctgggcaaat cttgtgtggg aggacagctc tagagacctg 120

ttagtttctt ccaccactgc ccaggggtgc gataccatcg ctagatgcga ttgtcaagcc 180

ggagtatatt attgcaactc caagagaaaa cactacccgg ttagtttcac caagcccagc 240

ctggtatttg tggaggctag tgagtattac ccagctagat accaatccca ccttatgctt 300

gctgtaggcc attcagaacc tggcgactgt ggtggcatcc tcagatgcca acacggtgtg 360

ataggaattg tctccactgg tggcaatggt cttgtggggt ttgctgacat cagagatctc 420

ctgtggctgg atgaagaagc gatggagcaa 450

<210> 12

<211> 297

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggagtgtctg attatatcaa aggcctcggt gatgcttttg gcatgggctt cactgatgca 60

gtgtccaggg aagtggaggc attgaagaac cacttaatcg gttcagaagg ggctgttgaa 120

aaaattctga agaatttggt gaagctaatt tcagcattag tcatagtcgt taggagtgac 180

tatgacatgg tcaccctcac agccacgctt gccttgattg ggtgccatgg aagcccttgg 240

gcatggataa aagcgaagac agcctctatt cttggcattc ccatagtgca aaagcag 297

<210> 13

<211> 987

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agcgcttcat ggctaaagaa gtttaatgac atggctaatg ctgctaaggg acttgagtgg 60

atttctagta aaatcagtaa gtttattgat tggcttaagg aaaagattat cccagccgct 120

aaagagaagg ttgaattctt gaacaacttg aagcagcttc ccttactgga gaaccaaatt 180

tcgaatctcg aacagtctgc tgcctcgcag gaggatctag aagctatgtt tggtaacgtg 240

tcatatttgg cccacttttg ccgcaagttt cagccactct acgcaaccga agctaaacga 300

gtctatgcgc tggagaaaag gatgaacaac tacatgcagt tcaagagcaa acaccgtatt 360

gaacccgtat gtttgatcat cagaggctcc ccaggaacag gcaagtcgct tgccacgggc 420

atcatagcta gagccattgc cgataaatac cattctagtg tttactcact tcctccagac 480

ccagaccatt tcgatgggta caagcaacag gtagtcactg ttatggatga tctttgtcaa 540

aacccagatg gaaaggacat gtcactattt tgccagatgg tttctacagt ggatttcata 600

ccacccatgg catccctgga agagaaggga gtgtctttca cctctaagtt tgtcattgca 660

tcgaccaatg ctagcaacat agtagttccc acagtttcag actcagatgc gattcgcaga 720

cggttctaca tggactgtga tatagaggtg acagattcct acaagacaga ccttggccga 780

cttgatgcag gtagagccgc caagctttgc acggaaaata ataccgccaa ctttaagaga 840

tgcagcccac tagtgtgtgg caaagctatt caactaagag ataggaaatc caaagtgaga 900

tacagcattg atactgtagt atcggagcta atcagagagt acaacaatag atccgccatc 960

ggtaatacta tagaagctct cttccaa 987

<210> 14

<211> 258

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggacccctta agttcaagcc tataaggatt agccttgaag agaagccagc tccggatgcc 60

atcagtgacc tactagctag tgtggatagc gaagaggttc ggcaatactg cagggaacag 120

gggtggataa ttccagaaac accggccaat gtggaacgtc acctcaacag agcagtgcta 180

gtgatgcagt ctatcgccac cgtggttgca gttgtgtctc ttgtctatgt tatttacaaa 240

ttgttcgctg ggtttcag 258

<210> 15

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggtgcttatt ctggtgcgcc caaacaagct cttaagaagc ccgtgctaag aacagccacg 60

gttcaa 66

<210> 16

<211> 549

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggaccgagtt tagactttgc cttatccctt ttaaggcgta acattagaca ggtgcaaact 60

gatcaagggc acttcaccat gttaggggta cgggaccgcc tggctgttct gccacgccac 120

tcgcaaccag gaaaaactat ttgggtggaa cacaaattga ttaatgtgct agacgctgtt 180

gagttagtag atgaacaagg tgtgaatttg gaacttacac tagtaacttt agacaccaac 240

gaaaagttta gggacatcac caagtttatt ccagagacaa tcactggagc aagtgacgca 300

accttgatca tcaacactga gcatatgccc tcaatgttcg tcccagtggg tgatgttgta 360

caatatggat tcttgaatct tagcggtaag cccacacacc ggaccatgat gtataacttc 420

cccacaaagg caggacagtg tggaggagta gtcacctcag ttggtaagat cattggagtc 480

cacattggtg ggaacggccg tcaaggtttc tgtgctgggt tgaagaggag ctactttgcc 540

agtgaacag 549

<210> 17

<211> 1386

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggagaaatcc agtggatgaa gcccaataag gagactggga gattgaatgt taatggcccg 60

acccgtacca aattagagcc tagtgtattc catgatgtgt ttgagggcag caaagaacca 120

gcagtcttaa ccagtaagga ccccagactc gaggttgatt ttgagcaagc tttgttttcc 180

aagtatgtgg gaaacacctt gcatgagcct gatgagtatg tgacgcaggc tgctctccac 240

tatgctaacc agttaaaaca attagacatc aatactaata agatgagcat ggaagaagca 300

tgttatggca ctgaatatct ggaggccata gaccttcata ccagtgctgg gtatccctat 360

agtgccttgg gcattaagaa aagggacata ctcgacccgg tcactagaga caccactaaa 420

atgaaattct acatggacaa atatgggtta gacatgccct attccactta tgtgaaagat 480

gagctcaggt ccttagataa gattaagaag gggaaatccc gtttgattga agccagcagc 540

ttgaatgatt cagtctatct taggatgacc tttgggcatc tctatgagac ttttcatgcc 600

aacccgggga ctgtgaccgg atctgcagta gggtgcaatc ctgatgtgtt ctggagtaaa 660

ttaccgatcc tgttaccggg gtcgctcttt gcatttgatt attcagggta tgatgcaagc 720

ctcagcccag tgtggttcag agctttagag gtggtcctcc gtgagattgg ttactcagag 780

gaggctgtgt cactaataga agggatcaac cacacccatc atgtgtatcg gaacaagaca 840

tattgtgtcc ttggtggaat gccctcaggt tgttccggca cttccatctt caactctatg 900

atcaataata taataatcag aactcttctg atcaaaacct ttaaggggat cgatttagat 960

gagttgaaca tggtagctta tggagatgat gtgctggcta gctatccatt ccctattgac 1020

tgttcggagt tggccaagac tggcaaagag tatggattaa caatgacacc tgctgacaaa 1080

tcaccctgct ttaacgaagt cacttgggag aatgctacat tcttaaagag aggcttcttg 1140

ccagatcacc agtttccatt ccttatccac cccaccatgc ctatgagaga gatccatgag 1200

tccattcgtt ggactaagga tgcacgcaac actcaggacc acgtgcgttc cttgtgccta 1260

ttagcatggc ataatgggaa ggaggagtat gaaaaatttg tgagcacaat tagatcggtt 1320

cctattggga aagccttggc tataccaaat tttgaaaacc tgagaagaaa ttggctcgaa 1380

ttattt 1386

<210> 18

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cyttgtgcgc ctgtttt 17

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

attgtcacca taagcagcc 19

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caagyacttc tgtmwcccc 19

<210> 21

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cccaaagtag tcggttcc 18

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

attggtgctc ccactacagc 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gagctgtcct cccacacaag 20