阅读说明：本技术 腺相关病毒对cln3多核苷酸的递送 (Delivery of CLN3 polynucleotides by adeno-associated viruses ) 是由 K·迈尔 B·K·卡斯帕 K·福斯特 于 2020-02-04 设计创作，主要内容包括：本公开涉及对蜡样脂褐质沉积症神经元3(CLN3)多核苷酸的重组腺相关病毒(rAAV)递送。本公开提供了rAAV和使用所述rAAV对神经元蜡样脂褐质沉积症或CLN3-巴藤病进行CLN3基因疗法的方法。(The present disclosure relates to recombinant adeno-associated virus (rAAV) delivery of ceroid lipofuscinosis neuron 3(CLN3) polynucleotides. The present disclosure provides rAAV and methods of using the rAAV for CLN3 gene therapy for neuronal ceroid lipofuscinosis or CLN3-batten disease.)

1. A self-complementary recombinant adeno-associated virus 9(scAAV9) encoding a CLN3 polypeptide, comprising a scAAV9 genome, said scAAV9 genome comprising, in 5 'to 3' order: a P546 promoter comprising the nucleotide sequence of SEQ ID NO 3; and a polynucleotide encoding said CLN3 polypeptide of SEQ ID NO. 1.

2. The scAAV9 of claim 1, wherein the scAAV9 genome comprises, in 5 'to 3' order: a P546 promoter comprising the nucleotide sequence of SEQ ID NO 3; the SV40 intron; and a polynucleotide encoding said CLN3 polypeptide of SEQ ID NO. 1.

3. The scAAV9 of claim 1, wherein the scAAV9 genome comprises, in 5 'to 3' order: a P546 promoter including the sequence of SEQ ID NO 3; a polynucleotide encoding said CLN3 polypeptide of SEQ ID NO. 1; and bovine growth hormone polyadenylation polyA sequence.

4. The scAAV9 of any one of claims 1-3, further comprising two AAV inverted terminal repeats.

5. The scAAV9 of any one of claims 1-4, wherein the polynucleotide encoding the CLN3 polypeptide comprises a sequence at least 90% identical to SEQ ID No. 2.

6. The scAAV9 of any one of claims 1-4, wherein the polynucleotide encoding the CLN3 polypeptide comprises the nucleic acid sequence of SEQ ID No. 2.

7. The scAAV9 of any one of claims 1-6, wherein the scAAV9 genome comprises a nucleic acid sequence at least 90% identical to SEQ ID No. 4

8. The scAAV9 of any one of claims 1-6, wherein the scAAV9 genome comprises a nucleic acid sequence at least 95% identical to SEQ ID No. 4.

9. The scAAV9 of any one of claims 1-6, wherein the scAAV9 genome comprises the nucleic acid sequence of SEQ ID No. 4.

10. The scAAV9 of any one of claims 1-9, wherein the AAV inverted terminal repeat sequence is AAV2 inverted terminal repeat sequence.

11. The scAAV9 of any one of claims 1-10, wherein the rAAV9 genome comprises a single-stranded genome.

12. A nucleic acid molecule, comprising: a first AAV inverted terminal repeat sequence; a P546 promoter including the sequence of SEQ ID NO 3; a nucleic acid sequence encoding the CLN3 polypeptide of SEQ ID NO. 1; and a second inverted terminal repeat.

13. The nucleic acid molecule of claim 12, comprising: a first AAV inverted terminal repeat sequence; a P546 promoter comprising the nucleotide sequence of SEQ ID NO 3; the SV40 intron; a nucleic acid sequence encoding said CLN3 polypeptide of SEQ ID NO. 1; and a second AAV inverted terminal repeat sequence.

14. The nucleic acid molecule of claim 12, comprising a first AAV inverted terminal repeat sequence; a P546 promoter comprising the nucleotide sequence of SEQ ID NO 3; a nucleic acid encoding said CLN3 polypeptide of SEQ ID No. 1; a bovine growth hormone polyadenylation polyA sequence; and a second AAV inverted terminal repeat sequence.

15. The nucleic acid molecule of any one of claims 12-14, wherein said nucleic acid encoding said CLN3 polypeptide comprises a sequence at least 90% identical to SEQ ID No. 2.

16. The nucleic acid molecule of any one of claims 12-14, wherein the nucleic acid encoding the CLN3 polypeptide comprises the nucleic acid sequence of SEQ ID No. 2.

17. The nucleic acid molecule according to any one of claims 12 to 16, comprising a nucleic acid sequence which is at least 90% identical to the nucleic acid sequence of SEQ ID NO. 4

18. The nucleic acid molecule according to any one of claims 12 to 16, comprising a nucleic acid sequence which is at least 95% identical to the nucleic acid sequence of SEQ ID No. 4.

19. The nucleic acid molecule of any one of claims 12 to 17, comprising the nucleic acid sequence of SEQ ID No. 4.

20. The nucleic acid molecule of any one of claims 15-20, wherein the AAV inverted terminal repeat sequence is AAV2 inverted terminal repeat sequence.

21. A self-complementary recombinant adeno-associated virus 9(scAAV9) comprising the nucleic acid molecule according to any one of claims 12 to 20.

22. The scAAV9 of claim 21, wherein the scAAV9 comprises a single-stranded genome.

23. A rAAV particle comprising the nucleic acid molecule of any one of claims 12-20.

24. The rAAV particle of claim 23, wherein the rAAV particle comprises a single-stranded genome.

25. A recombinant adeno-associated virus 9(rAAV9) viral particle encoding a CLN3 polypeptide comprising a rAAV9 genome, the rAAV9 genome comprising, in 5 'to 3' order: a P546 promoter and a polynucleotide encoding said CLN3 polypeptide.

26. The rAAV9 viral particle of claim 25, wherein the rAAV9 genome comprises a self-complementary genome.

27. The rAAV9 viral particle of claim 25, wherein the rAAV9 genome comprises a single-stranded genome.

28. The rAAV9 viral particle of any one of claims 25 to 27, wherein the rAAV9 genome comprises, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; the P546 promoter; said polynucleotide encoding said CLN3 polypeptide; and a second AAV inverted terminal repeat sequence.

29. The rAAV9 viral particle according to any one of claims 25 to 28, wherein the P546 promoter comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID No. 3.

30. The rAAV9 viral particle according to any one of claims 25 to 29, wherein the CLN3 polypeptide comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID No. 1.

31. The rAAV9 viral particle of any one of claims 25 to 30, wherein the polynucleotide encoding the CLN3 polypeptide comprises a sequence at least 90% identical to the nucleic acid sequence of SEQ ID No. 2.

32. The rAAV9 viral particle of any one of claims 25 to 31, wherein the rAAV9 genome comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID No. 4.

33. The rAAV9 viral particle of any one of claims 25 to 31, wherein the rAAV9 genome comprises a sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID No. 4.

34. The rAAV9 viral particle according to any one of claims 28-33, wherein the AAV inverted terminal repeat sequence is AAV2 inverted terminal repeat sequence.

35. The rAAV9 viral particle according to any one of claims 25-34, wherein the rAAV9 genome further comprises an SV40 intron.

36. The rAAV9 viral particle of any one of claims 25 to 35, wherein the rAAV9 genome further comprises a BGH poly-a sequence.

37. A nucleic acid molecule comprising a rAAV9 genome, the rAAV9 genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; the P546 promoter; a polynucleotide encoding a CLN3 polypeptide; and a second AAV inverted terminal repeat sequence.

38. The nucleic acid molecule of claim 37, wherein the rAAV9 comprises a self-complementary genome.

39. The nucleic acid molecule of claim 37, wherein the rAAV9 comprises a single-stranded genome.

40. The nucleic acid molecule of any one of claims 37-39, wherein the rAAV9 genome comprises, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; the P546 promoter; said polynucleotide encoding said CLN3 polypeptide; and a second AAV inverted terminal repeat sequence.

41. The nucleic acid molecule of any one of claims 37-40, wherein the P546 promoter comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO. 3.

42. The nucleic acid molecule of any one of claims 37 and 41, wherein the CLN3 polypeptide comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID NO 1.

43. The nucleic acid molecule of any one of claims 37-42, wherein said polynucleotide encoding said CLN3 polypeptide comprises a sequence at least 90% identical to the nucleic acid sequence of SEQ ID NO 2.

44. The nucleic acid molecule of any one of claims 37-43, wherein the rAAV9 genome comprises a sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NO 4.

45. The nucleic acid molecule of any one of claims 37-44, wherein the AAV inverted terminal repeat is an AAV2 inverted terminal repeat.

46. The nucleic acid molecule of any one of claims 37-4537, wherein the rAAV9 genome comprises a sequence that is at least 90% identical to the nucleic acid sequence of SEQ ID No. 4.

47. The nucleic acid molecule of any one of claims 377-46, wherein the rAAV9 genome further comprises the SV40 intron.

48. The nucleic acid molecule of any one of claims 37-47, wherein the rAAV9 genome further comprises a Bovine Growth Hormone (BGH) poly-A sequence.

49. A composition, comprising: the scAAV of any one of claims 1-12, 21 or 22; the nucleic acid molecule of any one of claims 12-20 or 37-48; the rAAV9 viral particle of any one of claims 23-36; and a pharmaceutically acceptable excipient, carrier or diluent.

50. The composition of claim 49, wherein the excipient comprises a non-ionic, low-permeability compound, buffer, polymer, salt, or a combination thereof.

51. A method of treating CLN 3-barnacle disease (CLN3-BattenDisease) in a subject, the method comprising administering to the subject a composition comprising therapeutically effective amounts of: the scAAV of any one of claims 1-12, 21 or 22; the nucleic acid molecule of any one of claims 12-20 or 37-48; the rAAV9 viral particle of any one of claims 23-36; a nucleic acid according to any one of claims 37 to 48; or a composition according to claim 49 or claim 50.

52. The method of claim 51, wherein the composition is administered by a route selected from the group consisting of: intrathecal, intraventricular, intraparenchymal, intravenous, and combinations thereof.

53. The method of claim 51, wherein the composition is administered intrathecally.

54. The method of claim 51, wherein the composition is administered intracerebroventricularly.

55. The method of claim 51, wherein the composition is administered intravenously.

56. The method of any one of claims 51 or 55, wherein about 1x 10¹²To about 1X 10¹⁵vg of the rAAV9 viral particle is administered.

57. The method of any one of claims 51 or 56, wherein about 6 x 10¹³To about 1.2X 10¹⁴The rAAV9 viral particle of (a) is administered.

58. The method of any one of claims 51-57, wherein said treatment reduces one or more symptoms of CLN 3-barbiers disease selected from the group consisting of:

(a) reduced or slowed lysosomal accumulation of autofluorescent storage materials;

(b) reduced or slowed lysosomal accumulation of ATP synthase subunit C;

(c) reduced or slowed activation of glial cells (astrocytes and/or microglia);

(d) reduced or slowed astrocytosis;

(e) a reduction or slowing of brain loss as measured by MRI;

(f) reduced or slowed seizures;

(g) a stabilization, a reduction or delay in progression, or an increase in one or more of the UBDRS assessment scales, wherein the reduction, stabilization, or increase is compared to the subject or an untreated CLN3-batten disease patient prior to administration of the composition.

59. The method of any one of claims 51-58, further comprising placing the subject in a Trendelenberg position following administration of the rAAV9 viral particle.

60. A method of treating CLN3 disease in a subject in need thereof, the method comprising delivering to the brain or spinal cord of a subject in need thereof a composition comprising: the scAAV of any one of claims 1-12, 21 or 22; the nucleic acid molecule of any one of claims 12-20 or 37-48; the rAAV9 viral particle of any one of claims 23-36.

61. The method of claim 60, wherein the composition is delivered by intrathecal injection, intraventricular injection, intraparenchymal injection, or intravenous injection, or a combination thereof.

62. The method of claim 61, further comprising placing the subject in a trendelenberg location following intrathecal injection of the composition.

63. The method of any one of claims 60-62, wherein the composition comprises a non-ionic low-permeability contrast agent.

64. The method of claim 6363, wherein the non-ionic low-permeability contrast agent is selected from the group consisting of: iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and combinations thereof.

65. The method of any one of claims 60-64, wherein delivering to the brain or the spinal cord comprises delivering to a brainstem.

66. The method of any one of claims 60-64, wherein delivering to the brain or the spinal cord comprises delivering to the cerebellum.

67. The method of any one of claims 60-64, wherein delivering to the brain or the spinal cord comprises delivering to the visual cortex.

68. The method of any one of claims 60-64, wherein delivering to the brain or the spinal cord comprises delivering to the motor cortex.

69. The method of any one of claims 60-64, wherein delivering to the brain or the spinal cord comprises delivering to nerve cells, glial cells, or both.

70. The method according to any one of claims 60-69, wherein delivery to the brain or the spinal cord comprises delivery to neurons, lower motor neurons, microglia, oligodendrocytes, astrocytes, Schwann cells (Schwann cells), or a combination thereof.

71. The method of any one of claims 60-70, wherein the treatment results in one or more of:

(a) reduced lysosomal accumulation of autofluorescent storage materials;

(b) reduced lysosomal accumulation of ATP synthase subunit C;

(c) reduced activation of glial cells (astrocytes and/or microglia);

(d) decreased astrocytosis;

(e) a reduction in brain loss as measured by MRI;

(f) a reduction in seizures; and

(g) one or more increases in a stability, reduction in progression, or UBDRS assessment scale, wherein the reduction, stabilization, or increase is compared to the subject or an untreated CLN3-batten disease patient prior to delivery of the composition.

Technical Field

The present disclosure relates to recombinant adeno-associated virus (rAAV) delivery of ceroid lipofuscinosis neuron 3(CLN3) polynucleotides. The present disclosure provides rAAV and methods of using rAAV for CLN3 gene therapy for Neuronal Ceroid Lipofuscinosis (NCL) or CLN 3-baryosis.

Background

Neuronal Ceroid Lipofuscinosis (NCL) is a serious group of neurodegenerative diseases.

Mutations in the CLN3 gene lead to juvenile NCL or CLN3-batten disease (KitzMu et al, Human Molecular Genetics 2008; 17 (2): 303-312; Munroe et al, J.Man Genet 1997; 61: 310-316), also known as Spielmeyer-Sjogren-Vogt disease. Mutations interfere with lysosomal storage clearance processes. At this time, 67 disease-causing mutations have been described. However, 85% of patients are homozygous for the 1.02kb deletion, resulting in the deletion of exon 7 and exon 8. The CLN3 mutation found in patients mainly resulted in a reduction in the abundance or function of the protein (battenin).

The classic age onset of CLN3-batten disease is between 4 and 7 years of age with potential but rapidly progressing vision loss. Children with young NCL change from normal vision to blindness within months, but can maintain a perception of darkness after several years. Cognitive and motor decline is often accompanied by behavioral problems such as well-being (8 to 10 years) followed by (7 to 10 years) and then seizures (10 to 12 years). The characteristic progression of Parkinson's disease (Parkinsonian) is between the ages of 11 and 13. In later stages of the disease, abnormalities in cardiac conduction in individuals have been reported. There was high phenotypic variability in individuals with CLN 3-barbiers disease, but all patients had common low vision or progressive blindness. In addition, the physical part of the Unified Barnacle Disease Rating Scale (UBDRS) that had been validated in 82 patients showed a steady and measurable drop of 2.86 points per year (2.27-3.45, p < 0.0001). The average survival period is typically 15 years from symptom onset to end of life.

CLN 3-barnacle disease has a wide range of therapeutic measures aimed at alleviating the disease. These include drug therapies such as EGIS-8332 and talampanel (talampanel) targeting AMPA receptors; drugs that allow read-through to stop the mutation prematurely; a drug that helps to decompose the accumulated storage material (cysteamine bitartrate (cystagon)/cysteamine (cysteamine)); and even immunosuppressive therapy (mycophenolate mofetil, prednisolone). Enzyme replacement and stem cell therapy were also evaluated. Although many therapeutic approaches have been investigated, few have been evaluated in a clinical setting. There is no method available to slow progression or cure the disease. Patients and families rely on treatment to improve symptoms and palliative treatment.

Cln3^Δex7/8A mouse model was created at the beginning of the 21 st century to mimic the most common pathogenic mutation in CLN3-batten disease patients: the approximately 1kb mutation of exons 7 and 8 was eliminated from the CLN3 gene (Cotman et al, human molecular genetics 2002; 11 (22): 2709. sup. 2721; Mole et al, Eur. J. paediatric neurology 2001; 5: 7-10). The mutation was found in homozygous fashion in 85% of patients and in another 15% of patients as a heterozygous mutation in combination with a point mutation on another allele. Truncated protein products that are predicted to produce a frame shift mutation resulting in loss or reduction of activity as a result of exon loss (Lerner et al, Cell (Cell) 1995, 9.22 days; 82 (6): 949-57; Kitzmuller et al, 2008, 1.15 days; 17 (2): 303-12). In the initial study, Cotman et al demonstrated CLN3^Δex7/8MouseThe model successfully recapitulated several aspects of CLN3 disease. CLN3^Δex7/8Animals accumulate autofluorescence storage material and ATP synthase subunit C in the nervous system at different time points and begin to exhibit astrocytic reactivity in the brain at 10 months of age. Subsequent studies detail alterations in glutamate receptor function in the cerebellum, corresponding to motor deficits in accelerated rotarod assays (Cotman et al, human molecular genetics 2002; 11 (22): 2709-2721). In terms of behavior, Cln3^Δex7/8Mice have been characterized at young and mature time points, with hypokinesia in neurodevelopment observed in primary and young adult mice, and defects in gait and hindlimb clasping observed at 10-12 months of age (Cotman et al, human molecular genetics 2002; 11 (22): 2709-. CLN3^Δex7/8Mice do not appear to exhibit functional visual impairment, but have a slight survival defect compared to 12-month old mouse controls (Cotman et al, human molecular genetics 2002; 11 (22): 2709-2721; Seigel et al, molecular and cellular neuroscience 2002, 4 months; 19 (4): 515-27). In summary, Cln3 carrying the most common human mutations^Δex7/8The mouse model exhibited many cellular and behavioral changes consistent with CLN 3-barnacle disease, making it a suitable model for testing therapies.

Thus, there remains a need in the art for the treatment of CLN 3-barnacle disease.

Disclosure of Invention

Provided herein are methods and products for CLN3 gene therapy using recombinant AAV.

Provided herein is a recombinant adeno-associated virus 9(rAAV9) encoding a CLN3 polypeptide, comprising a rAAV9 genome, the rAAV9 genome comprising, in 5 'to 3' order: a P546 promoter and a polynucleotide encoding said CLN3 polypeptide. In some embodiments, the rAAV9 genome comprises a self-complementary genome. In some embodiments, the rAAV9 genome comprises a single-stranded genome.

A self-complementary recombinant adeno-associated virus 9(scAAV9) is provided that encodes the amino acid sequence of SEQ ID NO:1, wherein the genome of the scAAV9 comprises in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; encoding the amino acid sequence of SEQ ID NO:1, a polynucleotide of CLN3 polypeptide set forth in 1; and a second AAV inverted terminal repeat sequence. The polynucleotide encoding the CLN3 polypeptide may be identical to SEQ ID NO:2 are at least 90% identical.

Also provided is scAAV9 having a genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; the SV40 intron; encoding the amino acid sequence of SEQ ID NO:1, CLN3 polypeptide; and a second AAV inverted terminal repeat sequence; scAAV9 having a genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; encoding the amino acid sequence of SEQ ID NO:1 of said CLN3 polypeptide; a bovine growth hormone polyadenylation poly A sequence; and a second AAV inverted terminal repeat sequence. In an exemplary embodiment, the scAAV9 has a sequence comprising SEQ ID NO:4, or a genome of the gene cassette shown in fig. 4.

Provided is a single stranded recombinant adeno-associated virus 9(ssAAV9) encoding the amino acid sequence of SEQ ID NO:1, wherein the genome of said ssAAV9 comprises in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; encoding the amino acid sequence of SEQ ID NO:1, a polynucleotide of CLN3 polypeptide set forth in 1; and a second AAV inverted terminal repeat sequence. The polynucleotide encoding the CLN3 polypeptide may be identical to SEQ ID NO:2 are at least 90% identical. Also provided is ssAAV9 having a genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; the SV40 intron; encoding the amino acid sequence of SEQ ID NO:1, CLN3 polypeptide; and a second AAV inverted terminal repeat sequence; ssAAV9 having a genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; encoding the amino acid sequence of SEQ ID NO:1 of said CLN3 polypeptide; a bovine growth hormone polyadenylation poly A sequence; and a second AAV inverted terminal repeat sequence.

SEQ ID NO:4 is the gene cassette provided in figure 1A. Provided is a rAAV9 having a scAAV9 genome or a ssAAV9 genome comprising a nucleotide sequence identical to SEQ ID NO:4 or at least 90% identical to the nucleic acid sequence of SEQ ID NO:4 or at least 95% identical to the nucleic acid sequence of SEQ ID NO:4 is at least 98% identical to the nucleic acid sequence of seq id no.

Also provided is a vector comprising a first AAV inverted terminal repeat sequence, comprising SEQ ID NO:3, a P546 promoter encoding the sequence of SEQ ID NO:1 and a second AAV inverted terminal repeat. In some embodiments, the polynucleotide encoding CLN3 polypeptide hybridizes with SEQ id no:2 are at least 90% identical.

Also provided are nucleic acid molecules comprising: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; the SV40 intron; encoding the amino acid sequence of SEQ ID NO:1, the nucleic acid sequence of said CLN3 polypeptide; and a second AAV inverted terminal repeat sequence. Further provided are polynucleotides comprising: a first AAV inverted terminal repeat sequence; comprises the amino acid sequence of SEQ ID NO:3, the P546 promoter; encoding the amino acid sequence of SEQ ID NO:1 of the CLN3 polypeptide; a bovine growth hormone polyadenylation poly A sequence; and a second AAV inverted terminal repeat sequence. In any of the polynucleotides provided, the CLN3 polypeptide can consist of SEQ ID NO:2 or a nucleotide sequence identical to SEQ ID NO:2 at least 90% identical.

rAAV9, scAAV9, or ssAAV9 are provided, including any polynucleotide. Also provided are raavs having single-stranded genomes.

Further provided is a rAAV9 viral particle encoding a CLN3 polypeptide, wherein the rAAV9 genome comprises, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises a nucleotide sequence similar to SEQ ID NO:3 a P546 promoter of a nucleic acid sequence that is at least 90% identical; encoding a polypeptide substantially similar to SEQ ID NO:1, a CLN3 polypeptide having an amino acid sequence at least 90% identical; and a second AAV inverted terminal repeat sequence. Provided rAAV9 particles can include a polynucleotide encoding a CLN3 polypeptide that includes a sequence identical to SEQ ID NO:1 amino acid sequence which is at least 90% identical. Additionally, the rAAV9 viral particle may comprise an AAV9 genome comprising an amino acid sequence identical to SEQ ID NO:4, is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4 or at least 95% identical to the nucleic acid sequence of SEQ ID NO:4 is at least 98% identical to the nucleic acid sequence of seq id no. Any rAAV9 viral particle may further include the SV40 intron and/or the BGH poly-a sequence.

In any of the rAAV, ssav, and scAAV provided, the AAV inverted terminal repeat sequence can be an AAV2 inverted terminal repeat sequence.

Also provided are nucleic acid molecules comprising a rAAV9 genome, the rAAV9 genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises a nucleotide sequence similar to SEQ ID NO:3 a P546 promoter of a nucleic acid sequence that is at least 90% identical; and encoding a polypeptide substantially similar to SEQ ID NO:1, and a CLN3 polypeptide having an amino acid sequence at least 90% identical thereto. The provided nucleic acid molecules may include self-complementary genomes or single-stranded genomes.

Further provided are nucleic acid molecules comprising a rAAV9 genome, the rAAV9 genome comprising, in 5 'to 3' order: a first AAV inverted terminal repeat sequence; comprises a nucleotide sequence similar to SEQ ID NO:3 a P546 promoter of a nucleic acid sequence that is at least 90% identical; encoding a polypeptide substantially similar to SEQ ID NO:1, a CLN3 polypeptide having an amino acid sequence at least 90% identical; and a second AAV inverted terminal repeat sequence. The provided nucleic acid molecules can include a polynucleotide encoding a CLN3 polypeptide comprising a sequence identical to SEQ ID NO:1, an amino acid sequence which is at least 90% identical to the amino acid sequence of 1. In addition, the nucleic acid molecule can include an AAV9 genome, the AAV9 genome including a nucleotide sequence identical to SEQ ID NO:4, is at least 90% identical to the nucleic acid sequence of SEQ ID NO:4, is at least 95% identical to the nucleic acid sequence of SEQ ID NO:4 is at least 98% identical to the nucleic acid sequence of seq id no. Any of the nucleic acid molecules provided may further include the SV40 intron and/or the BGH poly-a sequence.

Further provided is a composition comprising: a scAAV9 described herein, an ssAAV9 described herein, a nucleic acid molecule described herein or an rAAV viral particle described herein, and at least one pharmaceuticalAn acceptable excipient. In some cases, the pharmaceutically acceptable excipient comprises a non-ionic low permeability compound, a buffer, a polymer, a salt, or a combination thereof. In some embodiments, the polymer is a copolymer. In some embodiments, the copolymer is a poloxamer. For example, the composition may include at least a pharmaceutically acceptable excipient, which includes a non-ionic, low permeability compound. For example, a pharmaceutically acceptable excipient includes about 20 to 40% of a non-ionic, low-permeability compound or about 25% to about 35% of a non-ionic, low-permeability compound. An exemplary composition includes Tris (pH 8.0) formulated at 20mM, MgCl formulated at 1mM₂200mM NaCl, 0.001% poloxamer 188, and from about 25% to about 35% of a non-ionic low permeability compound. Another exemplary composition includes scAAV formulated in 1X PBS and 0.001% pluronic F68.

Still further provided is a method of treating CLN 3-barnacle disease in a subject, the method comprising administering to the subject a composition comprising therapeutically effective amounts of: any rAAV9 viral particle disclosed herein, any scAAV9 disclosed herein, any ssAAV9 disclosed herein, any nucleic acid molecule described herein, or any composition described herein.

In any of the methods provided, the composition, rAAV9, ssAAV9, scAAV9, and/or the nucleic acid molecule is administered by a route selected from the group consisting of: intrathecal, intraventricular, intraparenchymal, intravenous, and combinations thereof.

Use of a therapeutically effective amount of any rAAV9 viral particle disclosed herein, any scAAV9 disclosed herein, any ssAAV9 disclosed herein, any nucleic acid molecule described herein, or any composition described herein, for the manufacture of a medicament for treating CLN3-batten disease in a subject in need thereof.

Also provided are compositions comprising therapeutically effective amounts of: any rAAV9 viral particle disclosed herein, any scAAV9 disclosed herein, any ssAAV9 disclosed herein, any nucleic acid molecule described herein, or any composition described for use in treating CLN 3-barbie disease in a subject in need thereof.

An exemplary dose of scAAV9, ssav 9, or rAAV9 administered by the intrathecal route is about 1x 1011vg of scAAV9, ssav 9, or rAAV9 viral particles per subject to about 2 x 1015vg per subject, or about 1x 1011vg of scAAV9, ssav 9, or rAAV9 viral particles per subject to about 1x 1015vg of scAAV9, ssav 9, or AAV9 viral particles per subject, or about 1x 1012vg of scAAV9, ssav 9, or rAAV9 viral particles per subject to about 1x 1014vg of scAAV9, ssav 9, or AAV9 viral particles per subject, or about 1x vv1012 g of scAAV9, ss 9, or rAAV9 viral particles per subject to about 1x 1015vg of AAV9, ssAAV9, or AAV9 viral particles per subject. For example, about 1x 1013vg of scAAV9, ssav 9, or AAV9 virions is administered to a subject, or about 1.5 x 1013vg of scAAV9, ssav 9, or AAV9 virions is administered to a subject, or about 3.4 x 1013vg of scAAV9, ssav 9, or AAV9 virions is administered to a subject, or about 6 x 1013vg of scAAV9, ssav 9, or AAV9 virions is administered to a subject, or about 1.2 x 1014vg of scAAV9, ssav 9, or AAV9 virions is administered to a subject, or about 2 x 1014vg of scAAV9, ssav 9, or AAV9 virions is administered to a subject.

The method, medicament or composition for treatment results in the subject obtaining one or more of the following, compared to the subject before treatment or to an untreated CLN 3-baten patient: (a) reduced or slowed lysosomal accumulation of autofluorescent storage materials; (b) reduced or slowed lysosomal accumulation of ATP synthase subunit C; (c) reduced or slowed activation of glial cells (astrocytes and/or microglia); (d) reduced or slowed astrocytosis; (e) a reduction or slowing of brain loss as measured by MRI; (f) reduced or slowed seizures; and (g) a scale that stabilizes, reduces or slows progression, or is used to assess the progression and/or improvement of CLN3 barnacle disease, such as the Unified Barnacle Disease Rating System (UBDRS) assessment scale or one or more increases in the Hamburg Motor and language scale. After administration of the rAAV9, ssAAV9, or scAAV or nucleic acid molecules disclosed herein, the subject may remain in a Trendelenberg position.

Still further provided is a method of treating CLN3 disease in a patient in need thereof, the method comprising delivering to the brain or spinal cord of a patient in need thereof a composition comprising: any one of the rAAV viruses provided herein, any scAAV9 disclosed herein, any ssAAV9 disclosed herein, any nucleic acid molecule described herein, any composition described herein, or any drug described herein.

In any of the methods or uses provided, the composition or drug may be delivered by intrathecal, intracerebroventricular, intraparenchymal, or intravenous injection, or a combination thereof. Any of the methods provided can further comprise placing the patient in a trendelenberg location following intrathecal injection of a composition disclosed herein, a rAAV9 viral particle, or a scAAV or nucleic acid molecule.

In any of the methods or uses provided, the composition or medicament may include a non-ionic low permeability contrast agent. For example, the composition comprises a non-ionic low-permeability contrast agent, wherein the non-ionic low-permeability contrast agent is selected from the group consisting of: iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, and combinations thereof.

The composition or medicament administered may include a pharmaceutically acceptable excipient. For example, a pharmaceutically acceptable excipient includes about 20 to 40% of a non-ionic, low-permeability compound or about 25% to about 35% of a non-ionic, low-permeability compound. One exemplary composition includes a scAAV formulated in 20mM Tris (pH 8.0), 1mM MgCl2, 200mM NaCl, 0.001% poloxamer 188, and from about 25% to about 35% of a non-ionic low permeability compound. Another exemplary composition includes scAAV formulated in 1X PBS and 0.001% pluronic F68.

In any of the methods or uses provided, when the composition or drug is delivered to the brain or spinal cord, the composition can be delivered to the brainstem or can be delivered to the cerebellum or can be delivered to the visual cortex or can be delivered to the motor cortex. Further, in any of the methods or uses provided, when delivering a composition or drug to the brain or spinal cord, the composition can be delivered to nerve cells, glial cells, or both. For example, wherein delivery to the brain or spinal cord comprises delivery to cells of the nervous system, such as neurons, lower motor neurons, microglia, oligodendrocytes, astrocytes, schwann cells, or a combination thereof.

The method, use or administration of the composition or medicament results in the subject obtaining one or more of the following, as compared to a pre-treatment subject or an untreated subject: (a) reduced or slowed lysosomal accumulation of autofluorescent storage materials; (b) reduced or slowed lysosomal accumulation of ATP synthase subunit C; (c) reduced or slowed activation of glial cells (astrocytes and/or microglia); (d) reduced or slowed astrocytosis; (e) a reduction or slowing of brain loss as measured by MRI; (f) reduced or slowed seizures; and (g) a scale that stabilizes, reduces or slows progression, or is used to assess the progression and/or improvement of CLN3 barnacle disease, such as one or more increases in the unified barnacle rating system (UBDRS) assessment scale or the hamburger movement and language scale.

Headings herein are for the convenience of the reader and are not limiting.

The use of "may" and "can" herein is to describe various embodiments contained in the claims, rather than to indicate an uncertainty as to the scope of the claims.

Drawings

Figure 1 provides (figure 1A) a schematic of the scaav9.p546.cln3 gene cassette and (figure 1B) the plasmid construct paav.p546.cln3 for the production of scaav9.p546.cln 3. Human CLN3 cDNA was inserted between Inverted Terminal Repeat (ITR) constructs derived from AAV2 under the control of the P546 promoter. The SV40 intron (upstream of the human CLN3 cDNA) and bovine growth hormone polyadenylation (BGH Poly a) terminator sequence (downstream of the human CLN3 cDNA) contribute to mRNA processing and enhance transgene expression. SEQ ID NO: the sequence of the plasmid construct paav.p546.cln3.kan is shown in 5. The genome is packaged in AAV9 capsid protein.

Figure 2 provides CLN3 shown in injection scaav9.p546.CLN3^Δex7/8Images of the presence of human CLN3 transcript in mice.

Figure 3 provides CLN3 shown in injection scaav9.p546.CLN3^Δex7/8In mice on post-injectionGraphs with earlier reduction in ASM accumulation at 2 months. The y-axis shown on all graphs represents the total area of ASM accumulation. Black bars indicate wild type mice (WT-PBS), light gray bars indicate CLN3 injected with PBS^Δex7/8Mice, and dark grey mice represent CLN3 injected with scaav9.p546.CLN3^Δex7/8A mouse.

Figure 4 provides CLN3 injected with scaav9.p546.CLN3^Δex7/8Graphs of mice showing CLN3 in PBS-injected wild-type mice ("WT"), PBS-injected CLN3^Δex7/8("CLN 3") and CLN3 for injection of scAAV9.P546.CLN3^Δex7/8Accumulation of ASM strongly decreased at months 4 and 6 after injection in various brain regions of the("CLN 3-AAV").

Figure 5 provides images and graphs demonstrating reduction of scaav9.p546. clnn 3 administration to ICV by 4 months of age and 6 months of age CLN3^Δex7/8Abnormal lysosomal accumulation of the mitochondrial protein ATP synthase subunit C in mouse brain. Representative images of frozen tissue sections stained for ATP synthase subunit C and visualized by DAB staining at 6 month time points are provided in the upper panel. The graphs in the lower panel provide somatosensory 1 barrel field (S1BF) in the cortex at 4 months (4M) and 6 months (6M) post-injection, ventral posteromedial/ventral posterolateral nucleus (VPM/VPL) at 4 months and 6 months post-injection, PBS-injected WT ("WT"), PBS-injected CLN3^Δex7/8("CLN 3") and CLN3 for injecting scAAV9.P546.CLN3^Δex7/8Quantification of subunit C accumulation in mice ("CLN 3-AAV"). In untreated CLN3^Δex7/8And between scaav9.P546. CLN3-treated animals and wild-type animals, N ═ 5, p ≦ 0.0001, in SIBF at 4 and 6 months post-injection, wild-type and treated CLN3^Δex7/8P is less than or equal to 0.5 between mice.

Figure 6 provides images and graphs of ICV administration scaav9.p546.CLN3, which resulted in CLN3 for 4 months and 6 months of age^Δex7/8Astrocytosis in the mouse brain was reduced. The upper diagram: representative images of fixed tissue sections stained for GFAP as an activated astrocyte marker and visualized by DAB staining (6 month time point). The following figures: 4 and 6 months after injection, WT in PBS was injected ("WT"), injectedCLN3 of PBS^Δex7/8("CLN 3") and CLN3 for injecting scAAV9.P546.CLN3^Δex7/8Quantification of GFAP-positive area in the mice ("CLN 3-AAV"). For each set and time point, N is 5. S1BF ═ barrel skin. VPM/VPL is ventral posteromedial/ventral posterolateral nucleus.

Figure 7 provides images and graphs of ICV administration of scaav9.p546.hcln3, which resulted in CLN3 for 4 months and 6 months of age^Δex7/8Microglial activation in mouse brain is reduced. The upper diagram: representative images of fixed tissue sections stained for CD68 as a marker for activated microglia and visualized by DAB staining (6 month time point). The following figures: 4 and 6 months after injection, PBS-injected WT ("WT"), PBS-injected CLN3^Δex7/8("CLN 3") and CLN3 for injecting scAAV9.P546.CLN3^Δex7/8Quantification of CD 68-positive area in the mice ("CLN 3-AAV"). For each set and time point, N is 5. S1BF ═ barrel skin. VPM/VPL is ventral posteromedial/ventral posterolateral nucleus.

FIG. 8 provides a graph showing that wild type and PBS or treated CLN3 were present up to 18 months after injection^Δex7/8Graph of rotarod analysis of mice. All mice were gender-independent (upper panel), male only (middle panel), female only (lower panel).

Figure 9 provides CLN3 showing wild type and treatment with PBS or scaav9.p546.CLN3^Δex78Graph of Morris water maze performance at the age of 18 months in mice. All mice (top panel), only male (middle panel), only female (bottom panel).

Figure 10 provides CLN3 shown in treatment with scaav9.p546.CLN3^Δex7/8Graph of performance in a pole climbing assay for mice and PBS treated mice. In pole climbing assays, the mice are placed face up on a vertical pole and allowed to turn and fall over time with the number of falls to measure balance and agility. All mice (top panel), only male (middle panel), only female (bottom panel).

FIG. 11 provides a graph showing CLN3 treated with PBS^Δex7/8CLN3 treated with scaav9.p546.CLN3 compared to mice^Δex7/8Mice generally dropped less of the graph from the vertical pole. The mice were faced upPlaced on a vertical pole and measured for fall times when trying to turn around to measure balance and agility. All mice (top panel), only male (middle panel), only female (bottom panel).

Figure 12 provides images showing immunofluorescence western blot detection of GFP protein in individual brain regions as well as peripheral mouse tissues three weeks after injection with scaav9.p546. GFP.

FIG. 13 provides a 3X 10 lumbar injection shown intrathecally¹³Graph of reverse transcription quantitative PCR of expression of human CLN3 in various brain regions of a four year old cynomolgus monkey 12 weeks after scaav9.p546.CLN3 of vg. The values were normalized to CLN3 protein levels in the lumbar spinal cord 4-7.

The nucleic acid sequence of the scAAV9.P546.CLN3 gene cassette is provided in FIG. 14 (SEQ ID NO: 4). The AAV2 ITR nucleic acid sequence is shown in italics (5 'ITR is shown in SEQ ID NO: 6 and 3' ITR is shown in SEQ ID NO: 9), the P546 promoter nucleic acid sequence (SEQ ID NO: 3) is underlined with a single line, the SV40 intron nucleic acid sequence (SEQ ID NO: 7) is underlined with a double line, the nucleic acid sequence of the human CLN3 cDNA sequence (SEQ ID NO: 2) is shown in bold, and the nucleic acid sequence of the BGH polyA terminator (SEQ ID NO: 8) is underlined with a dashed line.

FIG. 15 provides the nucleic acid sequence of full-length AAV.P546.CLN3 (SEQ ID NO: 5).

Figure 16 provides a graph demonstrating that treatment with scaav9.p546.Cln3 results in Cln3^Δ7/8The expression level of hCLN3 transcript in the cerebral cortex and spinal cord of mice increased as measured by qPCR up to data for 24 months of age. Mean ± SEM, common one-way variance analysis per month, × p < 0.05, × p < 0.01, × p < 0.001, × p < 0.0001.

Figure 17 provides a graph showing treatment of scaav9.p546.Cln3 at Cln3^Δ7/8Stable hCLN3 transcripts were produced throughout the brain of mice, as measured by RNAscope (red fluorescence), up to images of 24 months of age. Images taken at 20X.

Figure 18 provides Cln3 demonstrating treatment of scaav9.p546.Cln3 at up to 24 months of age^Δ7/8Data for prevention and reduction of ASM accumulation in two regions of mouse brain. Mean. + -. SEM, common one-way variance per monthAnalysis, p < 0.05, p < 0.01, p < 0.001, p < 0.0001. Images taken at 20X.

Figure 19 provides Cln3 demonstrating treatment of scaav9.p546.Cln3 at up to 24 months of age^Δ7/8Data preventing the accumulation of a large number of subunits C (components of ASM) in two regions of the mouse brain. Mean ± SEM, common one-way variance analysis per month, × p < 0.05, × p < 0.01, × p < 0.001, × p < 0.0001. Images taken at 20X.

Figure 20 provides Cln3 demonstrating treatment of scaav9.p546.Cln3 at up to 24 months of age^Δ7/8Prevention of astrocyte activation (GFAP) in two regions of the brain⁺) The data of (1). Mean ± SEM, common one-way variance analysis per month, × p < 0.05, × p < 0.01, × p < 0.001, × p < 0.0001. Images taken at 20X.

Figure 21 provides Cln3 demonstrating treatment of scaav9.p546.Cln3 at up to 24 months of age^Δ7/8Prevention of some microglial activation in two regions of the brain (CD 68)⁺) Depending on the data at the point in time. Mean ± SEM, common one-way variance analysis per month, × p < 0.05, × p < 0.01, × p < 0.001, × p < 0.0001. Images taken at 20X.

Figure 22 provides a graph demonstrating that scaav9.cb. Cln3 treatment prevented Cln3 at 6 and 12 months of age^Δ7/8Data similarly valid for various barnacle pathology in mice. Mean ± SEM, common two-way anova, # p < 0.05, # p < 0.01, # p < 0.001, # p < 0.0001.

FIG. 23 provides a schematic representation of Cln3^Δ7/8Data without red blood cell abnormalities, as measured up to 24 months of age. Mean. + -. SEM, common two-way analysis of variance

FIG. 24 provides Cln3^Δ7/8Mice had no data on leukocyte abnormalities as measured up to 24 months of age. Mean. + -. SEM, common two-way analysis of variance

Figure 25 shows that mice treated with scaav9.p546.cln3 showed different levels of accumulation of SubC in the hippocampus CA3 region based on gender at 12 months of age. Mean ± SEM, common two-way analysis of variance with post-plot test (Tukey1s post-hoc test), p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 26 shows that scaav9.p546.cln3 mice showed subtle, varying levels of SubC accumulation in the Piriform Cortex (Piriform Cortex; PIRC) at various time points based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 27 shows scaav9.p546.cln3 mice show different levels of subcoc accumulation in Reticulo Thalamic Nuclei (RTN) at various time points based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 28 shows that scaav9.p546.cln3 mice showed different levels of accumulation of SubC in the somatosensory cortex based on gender at 12 months. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 29 shows that scaav9.p546.cln3 mice showed different levels of accumulation of SubC in VPM/VPL of the thalamus at 12 months based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

FIG. 30 shows that scAAV9.p546.CLN3 mice show different levels of SubC accumulation in Basolateral Amygdala (BLA) at 12 months based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 31 provides that scaav9.p546.cln3 mice showed different levels of SubC accumulation in the Dentate Gyrus (DG) polytypic layer at 12 months and 18 months based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 32 shows that scaav9.p546. clnn 3 mice showed different levels of accumulation of subcoc in reins (Hab) at 12 months and 18 months, based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 33 provides data showing that scaav9.p546.cln3 mice show different levels of SubC accumulation in the dorsal inner Nucleus (Mediodorsal Nucleus; MD) at 12 months and 18 months, based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

FIG. 34 shows that there was no difference in the level of SubC accumulation in posterior Cortex (Retrosplenial Cortex; RSC) in scaaV9.p546.CLN3 mice based on gender. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 35 shows that scaav9.p546.cln3 mice showed different levels of activated microglia in the somatosensory cortex (S1BF) at 6 months based on gender (CD 68)⁺). Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

FIG. 36 shows that scAAV9.p546.CLN3 mice show different levels of microglia in VPM-VPL (thalamus) based on gender (CD 68)⁺) And (4) activating. Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Figure 37 shows that scaav9.p546.cln3 mice show different levels of activated microglia in the dorsal inner nucleus (MD) based on gender (CD 68)⁺). Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

FIG. 38 shows that scAAV9.p546.CLN3 mice show different levels of activated microglia in the medial Nucleus (SM) based on sex (CD 68)⁺). Mean ± SEM, common two-way analysis of variance with graph-based post-test, p < 0.05, p < 0.01, p < 0.001, p < 0.0001.

Detailed Description

The present disclosure provides methods and products for treating CLN 3-barnacle disease. The methods involve the use of rAAV as a gene delivery vector to deliver CLN3 polynucleotides to a subject.

Adeno-associated virus (AAV) is a replication-defective parvovirus whose single-stranded DNA genome is approximately 4.7kb in length, contains 145 nucleotides of Inverted Terminal Repeats (ITRs) and can be used to refer to the virus itself or derivatives thereof. The term encompasses all subtypes as well as naturally occurring and recombinant forms, unless otherwise specified. There are a number of serotypes of AAV. Serotypes of AAV are each associated with a particular clade, and the members thereof have serological and functional similarities. Thus, clade may also refer to AAV. For example, the AAV9 sequence is referred to as the "clade F" sequence (Gao et al, J.Virol., 78: 6381-6388 (2004).) the present disclosure contemplates the use of any sequence within a particular clade, e.g., the nucleotide sequence of the genome of the clade F.AAV serotype is known.e.g., the complete genome of AAV-1 is provided in GenBank accession NC-002077; the complete genome of AAV-2 is provided in GenBank accession NC-001401 and Srivastava et al, J.Virol., 45: 555-564{ 1983); the complete genome of AAV-3 is provided in GenBank accession NC-1829; the complete genome of AAV-4 is provided in GenBank accession NC-001829; the AAV-5 genome is provided in GenBank accession No. AF 085716; the complete genome of AAV-6 is provided in GenBank accession No. NC _ 001862; at least part of the AAV-7 and AAV-8 genomes are provided in GenBank accession Nos. AX753246 and AX753249, respectively; AAV-9 genome is described in Gao et al, J.Virol. 78: 6381-6388 (2004); AAV-10 genome was characterized by infection in molecular therapy (mol. ther.), 13 (1): 67-76 (2006); AAV-11 genome is described in Virology (Virology), 330 (2): 375-; parts of the AAV-12 genome are provided in Genbank accession number DQ 813647; a portion of the AAV-13 genome is provided in Genbank accession number EU 285562. See U.S. patent 9,434,928, which is incorporated herein by reference, for sequences of the aavrh.74 genome. Sequence of the AAV-B1 genome in Choudhury et al, molecular therapy, 24 (7): 1247, and 1257 (2016). Cis-acting sequences that direct viral DNA replication (rep), encapsidation/packaging, and chromosomal integration of the host cell are contained in the ITRs. Three AAV promoters, whose relative map positions are designated p5, p19, and p40, drive expression of two AAV internal open reading frames encoding rep and cap genes. The differential splicing of the two rep promoters (p5 and p19) to a single AAV intron (at nucleotides 2107 and 2227) results in the production of four rep proteins (rep 78, rep 68, rep 52 and rep 40) from the rep gene. The Rep proteins have a variety of enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins, VP1, VP2 and VP 3. Alternative splicing and non-consensus translational start sites are responsible for the production of three related capsid proteins. The single consensus polyadenylation site is located at map position 95 of the AAV genome. AAV has a life cycle and genetics described in Muzyczka, "Current Topics in Microbiology and Immunology" (Current Topics in Microbiology and Immunology), 158: 97-129 (1992).

AAV has unique characteristics that make it attractive as a vector for delivering exogenous DNA to cells, for example, in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infections in humans and other animals are silent and asymptomatic. In addition, AAV infects many mammalian cells, allowing the possibility of targeting many different tissues in vivo. In addition, AAV transduces slowly dividing and non-dividing cells, and can essentially last the life of these cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in a plasmid, which makes the construction of recombinant genomes possible. In addition, since the signals directing AAV replication, genome encapsidation and integration are contained in the ITRs of the AAV genome, part or all of the internal approximately 4.3kb genome (encoding replication and structural capsid proteins, rep-cap) can be replaced with exogenous DNA such as a gene cassette containing a promoter, DNA of interest and polyadenylation signals. In some cases, rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and robust virus. It is susceptible to the conditions used to inactivate adenovirus (56 ℃ to 65 ℃ for hours), making cold storage of AAV less important. AAV may even be lyophilized. Finally, AAV-infected cells are intolerant to repeated infections.

The term "AAV" as used herein refers to a wild-type AAV virus or viral particle. The terms "AAV," "AAV virus," and "AAV viral particle" are used interchangeably herein. The term "rAAV" refers to a recombinant AAV virus or a recombinant infectious encapsulated viral particle. The terms "rAAV", "rAAV virus" and "rAAV viral particle" are used interchangeably herein.

The term "rAAV genome" refers to a polynucleotide sequence derived from a native AAV genome that has been modified. In some embodiments, the rAAV genome has been modified to remove native cap and rep genes. In some embodiments, the rAAV genome comprises endogenous 5 'and 3' Inverted Terminal Repeats (ITRs). In some embodiments, the rAAV genome comprises ITRs from an AAV serotype that is different from the AAV serotype from which the AAV genome was derived. In some embodiments, the rAAV genome comprises a transgene of interest (e.g., a polynucleotide encoding CLN3) flanked by Inverted Terminal Repeats (ITRs) at the 5 'and 3' ends. In some embodiments, the rAAV genome comprises a "gene cassette". Exemplary gene cassettes are shown in fig. 1A and SEQ ID NO:4 is shown in the nucleic acid sequence of seq id no. The rAAV genome may be a self-complementary (sc) genome, referred to herein as an "scAAV genome". Alternatively, the rAAV genome may be a single-stranded (ss) genome, referred to herein as a "ssAAV genome".

The term "scAAV" refers to a rAAV virus or rAAV viral particle that includes a self-complementary genome. The term "ssAAV" refers to a rAAV virus or rAAV viral particle comprising a single-stranded genome.

The rAAV genomes provided herein can include a polynucleotide encoding a CLN3 polypeptide. The CLN3 polypeptide comprises SEQ ID NO:1, or has an amino acid sequence identical to that shown in SEQ ID NO:1, and which encodes a polypeptide having CLN3 activity (e.g., at least one of increased clearance of lysosomal autofluorescent storage material, decreased lysosomal accumulation of ATP synthase subunit C, and decreased activation of astrocytes and microglia in a patient when treated as compared to, e.g., a patient prior to treatment).

In some cases, the rAAV genomes provided herein comprise a polynucleotide encoding a CLN3 polypeptide, wherein the polynucleotide has the sequence of SEQ ID NO:2, or a nucleotide sequence corresponding to SEQ ID NO:2, and encodes a polypeptide having CLN3 activity (e.g., at least one of increased clearance of lysosomal autofluorescent storage material, decreased lysosomal accumulation of ATP synthase subunit C, and decreased activation of astrocytes and microglia in a patient, when treated as compared to, e.g., a patient prior to treatment).

In some embodiments, the rAAV genomes provided herein comprise nucleic acid sequences encoding a polypeptide having CLN3 activity and that hybridizes under stringent conditions to SEQ ID NO:2 or the complement thereof. The term "stringent" is used to refer to conditions that are generally understood in the art to be stringent. The stringency of hybridization is determined primarily by temperature, ionic strength, and concentration of denaturing agents such as formamide. Examples of stringent conditions for hybridization and washing include, but are not limited to, 0.015M sodium chloride, 0.0015M sodium citrate at 65 ℃ to 68 ℃, or 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide at 42 ℃. See, e.g., Sambrook et al, molecular cloning: a Laboratory Manual, 2 nd edition, Cold Spring Harbor Laboratory (Cold Spring Harbor Laboratory) (Cold Spring Harbor, N.Y. 1989).

In some embodiments, the rAAV genomes provided herein comprise one or more AAV ITRs flanked by a polynucleotide encoding a CLN3 polypeptide. The CLN3 polynucleotide is operably linked to transcriptional control elements (including but not limited to promoters, enhancers, and/or polyadenylation signal sequences) that function in the target cell to form a gene cassette. Examples of promoters are the chicken beta actin promoter and the P546 promoter. Other promoters are contemplated herein, including but not limited to simian virus 40(SV40) early promoter, Mouse Mammary Tumor Virus (MMTV), Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr virus (Epstein-Barr virus) immediate early promoter, Rous sarcoma virus (Rous sarcoma virus) promoter, and human gene promoters, such as but not limited to actin promoter, myosin promoter, elongation factor-1 a promoter, hemoglobin promoter, and creatine kinase promoter. Further provided herein are SEQ ID NOs: 3, and a promoter sequence that is identical to the P546 promoter sequence shown in SEQ ID NO:3, a promoter sequence which is at least 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence set forth in seq id No. 3, which is a promoter having P546 transcription promoting activity. Other examples of transcriptional control elements are tissue-specific control elements, e.g., promoters that allow for specific expression in neurons or specific expression in astrocytes. Examples include neuron-specific enolase and gliobfibrillary acidic protein promoters. Inducible promoters are also contemplated. Non-limiting examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline regulated promoters. The gene cassette may also comprise an intron sequence to facilitate processing of the CLN3 RNA transcript when expressed in a mammalian cell. An example of such an intron is the SV40 intron. By "packaging" is meant a series of intracellular events that result in the assembly and encapsidation of AAV particles. The term "production" refers to the process of producing rAAV (infectious, encapsulated rAAV particles) by a packaging cell.

The AAV "rep" and "cap" genes refer to polynucleotide sequences encoding replication and encapsidation proteins of adeno-associated virus, respectively. AAV rep and cap are referred to herein as AAV "packaging genes".

A "helper virus" of an AAV refers to a virus that allows an AAV (e.g., a wild-type AAV) to be replicated and packaged by a mammalian cell. Various such helper viruses for AAV are known in the art, including adenovirus, herpes virus, and poxviruses such as vaccinia virus. Adenoviruses can cover many different subgroups, although the most common is adenovirus type 5 of subunit C. Many human, non-human mammalian and avian adenoviruses are known and available from deposits such as ATCC and the like. Viruses of the herpes virus family include, for example, Herpes Simplex Virus (HSV) and epstein-barr virus (EBV), as well as Cytomegalovirus (CMV) and pseudorabies virus (PRV); these can also be obtained from deposits such as ATCC.

"helper virus function(s)" refers to one or more functions encoded in the helper virus genome that allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein). As described herein, "helper virus functions" can be provided in a variety of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the necessary functions to a producer cell in trans.

The rAAV genomes provided herein lack AAV rep and cap DNA. The AAVDNA in the rAAV genomes (e.g., ITRs) contemplated herein may be from any AAV serotype suitable for the derivation of recombinant viruses, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV rh.74, and AAV-B1. As described above, the nucleotide sequences of the genomes of the various AAV serotypes are known in the art. rAAV with capsid mutations are also contemplated. See, e.g., Marsic et al, molecular therapy, 22 (11): 1900-1909(2014). Modified capsids are also contemplated herein, and include capsids with various post-translational modifications, such as glycosylation and deamidation. Deamidation of the asparagine or glutamine side chain results in conversion of the asparagine residue to an aspartic acid or isoaspartic acid residue, and conversion of glutamine to glutamic acid or isoglutamic acid is contemplated in the rAAV capsids provided herein. See, e.g., Giles et al, "molecular therapy," 26 (12): 2848-2862(2018). It is also contemplated herein that the modified capsid includes targeting sequences that direct the rAAV to the affected tissue and organ in need of treatment.

The DNA plasmids provided herein include the rAAV genomes described herein. The DNA plasmid can be transferred into cells that allow infection with AAV helper virus (e.g., adenovirus, E1-deleted adenovirus, or herpes virus) to assemble the rAAV genome into infectious viral particles having AAV9 capsid proteins. Techniques for producing rAAV are standard in the art, wherein the rAAV genome to be packaged, the rep and cap genes, and helper virus functions are provided to the cell. The production of rAAV particles requires the following components to be present within a single cell (denoted herein as a packaging cell): rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be from any AAV serotype from which recombinant viruses may be derived, and may be from an AAV serotype different from the rAAV genomic ITRs. Production of pseudotyped rAAV is disclosed, for example, in WO 01/83692, which is incorporated by reference herein in its entirety. In various embodiments, AAV capsid proteins can be modified to enhance delivery of recombinant rAAV. Modifications to capsid proteins are generally known in the art. See, e.g., US 2005/0053922 and US 2009/0202490, the disclosures of which are incorporated herein by reference in their entirety.

The method of generating packaging cells is to create cell lines that stably express all the essential components for rAAV production. For example, a plasmid (or plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker such as a neomycin resistance gene, can be integrated into the genome of the cell. rAAV genomes can be introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al, 1982, Proc. Natl.Acad.S. 6.USA, 79: 2077. 2081), adding synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al, 1983, Gene (Gene), 23: 65-73) or by direct blunt-end ligation (Senapahy and Carter, 1984, J.Biol.Chem., 259: 4661. 4666). The packaging cell line can then be infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Other non-limiting examples of suitable methods use adenovirus or baculovirus rather than plasmid to introduce rAAV genome and/or rep and cap genes into packaging cells.

The general principles of rAAV particle production are described, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, "current topic of microbiology and immunology (curr. topics in microbiological. and Immunol.), 158: 97-129). Various methods are described in Ratschin et al, molecular and cellular biology (mol. cell. biol.) 4: 2072 (1984); hermonat et al, Proc. Natl. Acad. Sci. USA, 81: 6466 (1984); tratschin et al, molecular and cellular biology 5: 3251 (1985); McLaughlin et al, J.Virol, 62: 1963 (1988); and Lebkowski et al, 1988, molecular and cellular biology, 7: 349(1988). Samulski et al, (1989, J. Virol., 63: 3822-3828); U.S. Pat. nos. 5,173,414; WO 95/13365 and corresponding U.S. patent No. 5,658.776; WO 95/13392; WO 96/17947; PCT/US 98/18600; WO 97/09441(PCT/US 96/14423); WO 97/08298(PCT/US 96/13872); WO 97/21825(PCT/US 96/20777); WO 97/06243(PCT/FR 96/01064); WO 99/11764; perrin et al (1995) Vaccine (Vaccine) 13: 1244-; paul et al (1993) Human Gene Therapy (Human Gene Therapy) 4: 609-615; clark et al (1996) Gene Therapy (Gene Therapy) 3: 1124 and 1132; U.S. patent No. 5,786,211; U.S. patent No. 5,871,982; and U.S. patent No. 6,258,595. The foregoing documents are hereby incorporated by reference in their entirety, with particular emphasis on those portions of the documents relating to rAAV particle production.

Further provided herein are packaging cells that produce infectious rAAV particles. In one example, the packaging cell can be a stably transformed cancer cell, such as HeLa cells, 293 cells, and perc.6 cells (homologous 293 line). In another example, the packaging cell can be a cell of an untransformed cancer cell, such as a low passage 293 cell (human embryonic kidney cell transformed with adenovirus E1), MRC-5 cell (human embryonic fibroblast), WI-38 cell (human embryonic fibroblast), Vero cell (monkey kidney cell), and FRhL-2 cell (rhesus embryo lung cell).

Also provided herein are raavs (e.g., infectious encapsidated rAAV particles) comprising the rAAV genomes of the present disclosure. The genome of the rAAV lacks AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between ITRs of the genome of the rAAV. The rAAV genome may be a self-complementary (sc) genome. Raavs with sc genomes are referred to herein as scAAV. The rAAV genome may be a single-stranded (ss) genome. Raavs having a single-stranded genome are referred to herein as ssavs.

An exemplary rAAV provided herein is a scAAV designated "scaav9.p546.cln 3". scAAV9.P546.CLN3 scAAV contains a scAAV genome, which includes the human CLN3 cDNA under the control of the P546 promoter (SEQ ID NO: 3). The scAAV genome also includes the SV40 intron (upstream of the human CLN3 cDNA) and the bovine growth hormone polyadenylation (BGH PolyA) terminator sequence (downstream of the human CLN3 cDNA). The sequence of the scAAV9.P546.CLN3 gene box is shown as SEQ ID NO:4, respectively. The scAAV genome is packaged in the AAV9 capsid and comprises AAV2 ITRs (one ITR upstream of the P546 promoter and another ITR downstream of the BGH Poly a terminator sequence).

rAAV can be purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purification of rAAV from helper viruses are known in the art and can be included, for example, in Clark et al, human gene therapy, 10 (6): 1031-1039 (1999); schenpp and Clark, Methods of molecular medicine (med.), 69: 427-443 (2002); the methods disclosed in U.S. Pat. No. 6,566,118 and WO 98/09657.

Compositions comprising rAAV are also provided. Compositions include rAAV encoding CLN3 polypeptides. The composition may comprise two or more raavs encoding different polypeptides of interest. In some embodiments, the rAAV is a scAAV or a ssAAV.

The compositions provided herein include a rAAV and one or more excipients that are pharmaceutically acceptable. Acceptable excipients are non-toxic to the recipient and are preferably at the dosages and concentrations employedIs inert and includes, but is not limited to, buffers such as phosphates [ e.g., Phosphate Buffered Saline (PBS)]Citrate or other organic acids; antioxidants, such as ascorbic acid; a low molecular weight polypeptide; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or a non-ionic surfactant, such as a tween, a co-polymer such as poloxamer 188, pluronic (such as pluronic F68) or polyethylene glycol (PEG). The compositions provided herein may include a pharmaceutically acceptable aqueous excipient containing a non-ionic, low permeability compound, such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, ioxilan, wherein the aqueous excipient containing a non-ionic, low permeability compound may have one or more of the following properties: about 180mgI/mL, an osmotic pressure of about 322mOsm/kg water as determined by vapor pressure osmometry, an osmotic pressure of about 273mOsm/L, an absolute viscosity of about 2.3cp at 20 ℃ and about 1.5cp at 37 ℃, and a specific gravity of about 1.164 at 37 ℃. Exemplary compositions include from about 20 to 40% of a non-ionic, low-permeability compound or from about 25% to about 35% of a non-ionic, low-permeability compound. An exemplary composition includes Tris (pH 8.0) formulated at 20mM, MgCl formulated at 1mM₂A scAAV or rAAV viral particle of 200mM NaCl, 0.001% poloxamer 188, and from about 25% to about 35% of a non-ionic low permeability compound. Another exemplary composition includes scAAV formulated in 1X PBS and 0.001% pluronic F68.

The dosage of rAAV to be administered in the methods of the present disclosure will vary depending on, for example, the particular rAAV, the mode of administration, the time of administration, the therapeutic target, the individual, and the cell type targeted, and can be determined by methods standard in the art. The dose may be expressed in units of viral genome (vg). Dosages contemplated herein include about 1x 10¹¹About 1X 10¹²About 1X 10¹³About 1.1X 10¹³About 1.2X 10¹³About 1.3X 10¹³About 1.5X 10¹³About 2X 10¹³About 2.5X 10¹³About 3X 10¹³About 3.4X 10¹³About 3.5X 10¹³About 4X 10¹³About 4.5X 10¹³About 5X 10¹³About 6X 10¹³About 1X 10¹⁴About 1.2X 10¹⁴About 2X 10¹⁴About 3X 10¹⁴About 4X 10¹⁴About 5X 10¹⁴About 1X 10¹⁵To about 1X 10¹⁶Or more total viral genomes. About 1X 10¹¹To about 1X 10¹⁵vg, about 1X 10¹²To about 1X 10¹⁵vg, about 1X 10¹²To about 1X 10¹⁴vg, about 1X 10¹³To about 6X 10¹⁴vg and about 6X 10¹³To about 1.2X 10¹⁴Dosages of vg are also envisaged. One dose exemplified herein is 6 x 10¹³vg. Another dose exemplified herein is 1.2X 10¹⁴。

Methods of transducing target cells (including but not limited to cells of the nervous system, nerves, or glial cells) with rAAV are provided. The cells of the nervous system comprise neurons, lower motor neurons, microglia, oligodendrocytes, astrocytes, schwann cells, or a combination thereof.

The term "transduction" is used to refer to the administration/delivery of a CLN3 polynucleotide to a target cell in vivo or in vitro by a replication-deficient rAAV of the present disclosure, resulting in the expression of a functional polypeptide by the recipient cell. Transduction of a cell with a rAAV of the present disclosure results in sustained expression of the polypeptide or RNA encoded by the rAAV. Accordingly, the present disclosure provides methods of administering/delivering a rAAV encoding a CLN3 polypeptide to a subject by an intrathecal, intracerebroventricular, intraparenchymal, or intravenous route, or any combination thereof. Intrathecal delivery refers to delivery to the subarachnoid space of the brain or spinal cord. In some embodiments, intrathecal administration is by intracisternal administration.

Intrathecal administration is exemplified herein. These methods comprise transducing target cells (including but not limited to neural and/or glial cells) with one or more raavs described herein. In some embodiments, a rAAV viral particle comprising a polynucleotide encoding a CLN3 polypeptide is administered or delivered to the brain and/or spinal cord of a patient. In some embodiments, the polynucleotide is delivered to the brain. Brain regions contemplated for delivery include, but are not limited to, the motor cortex, visual cortex, cerebellum, and brainstem. In some embodiments, the polynucleotide is delivered to the spinal cord. In some embodiments, the polynucleotide is delivered to a neuron or lower motor neuron. The polynucleotides can be delivered to nerves and glial cells. The glial cell is a microglia, oligodendrocyte, or astrocyte. In some embodiments, the polynucleotide is delivered to schwann cells.

In some embodiments of the methods provided herein, the patient is maintained in a trendelenberg position (head down position) after administration of the rAAV (e.g., about 5 minutes, about 10 minutes, about 15 minutes, or about 20 minutes). For example, the patient may be tilted about 1 degree to about 30 degrees, about 15 degrees to about 30 degrees, about 30 degrees to about 60 degrees, about 60 degrees to about 90 degrees, or about 90 degrees to about 180 degrees in a head-down position.

The methods provided herein include the step of administering an effective dose or effective multiple doses of a composition including a rAAV provided herein to a subject in need thereof (e.g., an animal including, but not limited to, a human patient). Administration is prophylactic if the dose is administered before the development of CLN 3-barnacle disease. Administration is therapeutic if the dose is administered after the development of CLN 3-barnacle disease. An effective amount is an amount that alleviates (eliminates or reduces) at least one symptom associated with the disease, slows or arrests the progression of the disease, reduces the extent of the disease, causes remission (partial or total) of the disease, and/or prolongs survival. The methods provided herein result in stabilization, reduction in progression, or improvement of one or more scales, such as the unified barnacle disease assessment system (UBDRS) or the hamburger movement and language scale, for assessing progression and/or improvement of CLN3 barnacle disease compared to a subject prior to treatment or compared to an untreated subject. UBDRS assessment scale (as described in Marshall et al, Neurology 200565 (2): 275-; pediatric quality of life scale (PEDSQOL) scale, motor function, language function, cognitive function, and survival. The methods provided herein can result in one or more of the following, as compared to a subject prior to treatment or as compared to an untreated subject: reduced or slowed lysosomal accumulation of autofluorescent storage material, reduced or slowed lysosomal accumulation of ATP synthase subunit C, reduced or slowed activation of glial cells (astrocytes and/or microglia); astrocytosis was reduced or slowed, and a reduction or delay in brain loss as measured by MRI was shown.

Combination therapies are also provided. Combinations as used herein include simultaneous or sequential treatments. Combinations of the methods described herein with standard medical treatments are particularly contemplated. Further, combinations of compositions (e.g., combinations of scaav9.p546.cln3 and the contrast agents disclosed herein) for use according to the present invention are specifically contemplated (simultaneous or sequential treatment).

Although delivery to a subject in need thereof after birth is contemplated, intrauterine delivery of the fetus is also contemplated.

Examples of the invention

Although the following examples describe specific embodiments, it is to be understood that variations and modifications will occur to those skilled in the art. Therefore, only such limitations as appear in the claims should be applicable to the present invention.

In the examples, a self-complementary AAV (designated scaav9.p546.CLN3) carrying CLN3 cDNA under the control of the P546 promoter was generated. The P546 promoter is a truncated form of the MeCP2 promoter, allowing for moderate level expression of the transgene in both neurons and astrocytes. At CLN3^Δex7/8The efficacy of this gene therapy vector was tested in a knock-in mouse model, which carries the most frequent mutations found in human patients. Evaluation of scaav9.P546.CLN3 at CLN3^Δex7/8Safety and efficacy in knock-in mouse models, wild type mice, and non-human primates. Data from mice and non-human primates clearly indicate that astrocytes and neurons are present throughout the brain and spinal cordEfficient transduction, including deep brain structures such as thalamus, hippocampus, striatum, amygdala, medulla and cerebellum.

Example 1

Production of scaav9.P546.CLN3

DNA comprising the open reading frame of human CLN3(SEQ ID NO: 2) located between two Not1 restriction sites was synthesized by European Genomics, USA, and then inserted into a double-stranded AAV 2-ITR-based production plasmid. Figure 1 shows a schematic diagram showing a plasmid construct of CLN3 DNA inserted between AAV2 ITRs [ 5' ITRs as previously described in McCarty et al, gene therapy "8: 1248-1254(2001) to generate scAAV ]. The plasmid construct also contained the P546 promoter, SV40 chimeric intron, and Bovine Growth Hormone (BGH) polyadenylation signal.

scaav9.p546.cln3 was generated under cGMP by a transient triple plasmid transfection procedure using a production plasmid based on double stranded AAV2-ITR, which encodes a plasmid with the sequence Rep2Cap9 as described previously [ Gao et al, journal of virology, 78: 6381-6388(2004) ], together with an adenovirus helper plasmid pHelper (Stratagene, Santa Clara, Calif.) in HEK293 cells. The virus was purified by two cesium chloride density gradient purification steps, dialyzed against PBS and formulated with 0.001% pluronic-F68 to prevent virus accumulation and stored at 4 ℃. All scAAV preparations were titrated by quantitative PCR using Taq-Man technique. The purity of scAAV was assessed, for example, by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA).

Example 2

CLN3^Δex7/8Long-term efficacy studies of CSF-delivered scAAV9.P546.CLN3 in mice

Cell targeting and expression

To confirm the expression and biodistribution of virus-introduced human CLN3 in mice, scaav9.p546.CLN3 was formulated in 1x PBS and 0.001% pluronic F68 or in 20mM Tris (pH 8.0), 1mM MgCl2200mM NaCl, 0.001% poloxamer 188, and is administered to CLN3 by Intracerebroventricular (ICV) injection within 36 hours of birth^Δex7/8Mice, and expression was monitored at different time points. Wild type and CLN3 injected with equal volumes of PBS^Δex7/8Mice served as controls. The effective dose of the NCH viral vector was 2.2X 10 using the core titer¹⁰vg/mouse.

To obtain detailed brain biodistribution curves, the RNAscope in situ hybridization technique was used to specifically identify human CLN3 mRNA in the brain, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord. This technique involves the use of RNA hybridized in situ with specific probes to detect only the human transgene encoded by scAAV9. Compared to no signal in PBS injected controls, strong signals were observed at 4 and 6 months post-injection, particularly CLN3 at scaav9.p546.CLN3 injection^Aex7/8In the cortex of the mice (regions A-C). The analysis indicated that the CLN3 transgene delivered by AAV9 was expressed at sufficient levels in various regions of the brain, including the cortex, thalamus, hindbrain, cerebellum, and spinal cord. In the cerebellum, the signal in Purkinje neurons (Purkinje neuron) is particularly strong. Transgene expression was also detected in all regions of brain and spinal cord by reverse transcription PCR at 4 and 6 months (fig. 2).

In summary, for the data from CLN3^Δex7/8Reverse transcription PCR data and RNAscope analysis of mouse tissues confirmed that a single ICV injection of scaav9.p546.CLN3 resulted in successful targeting and expression of human CLN3 throughout the brain and spinal cord for up to 6 months after injection. This confirms the effectiveness of ICV-mediated delivery of scAAV9 on specific target cells that are disproportionately involved in the pathogenesis of CLN3-batten disease. CLN3^Δex7/8Expression data in the mouse model was further confirmed in wild type mouse studies using the same primers for detection of human transgenes by quantitative RT-PCR.

Improvement of pathology following delivery of scaav9.p546.cln3

Accumulation of Autofluorescent Storage Materials (ASM)

Accumulation of Autofluorescent Storage Material (ASM) is a histological marker of progression of batten diseaseAnnals (Mole et al, Biochem Biophys Acta-Mol Basis Dis 2015, 1852(10) 2237-. The accumulation of ASM is a powerful indicator of disease progression in many forms of batten disease (Bosch et al, journal of neuroscience (J Neurosci) 2016; 36 (37): 9669-). 9682; Morgan et al, public science library integration (PLoS One.). 2013; 8 (11): e 78694). Reduction of ASM is contemplated herein as an indicator of successful treatment. As one of the earliest detectable disease manifestations of CLN3-batten disease, ASM CLN3 at 2 months of age^Δex7/8Many brain regions of the mice were already visible (fig. 3).

Automated quantification of fluorescent pixel regions confirmed the injection of CLN3 for scaav9.p546.CLN3 at 2 months of age^Δex7/8A significant reduction in ASM accumulation in the somatosensory cortex and thalamus of the mice. Since at this early time point, CLN3 was treated with PBS^Δex7/8Higher variability in ASM accumulation in the motor cortex and visual cortex was observed in mice, with lower statistical power for analysis of these two regions. 4 months and 6 months after injection, with CLN3 treated with PBS^Δex7/8All four brain regions showed a highly significant reduction in ASM accumulation compared to mice (fig. 4). When injecting CLN3 of scAAV9.P546.CLN3^Δex7/8CLN3 injected with scaaV9.P546.CLN3 at 4 months after injection when mice were compared to wild type animals^Δex7/8Slightly higher ASM levels were found in the somatosensory and visual cortex of mice, while CLN3 was found in the motor cortex and thalamus in wild type versus scaav9.p546.CLN3 treated^Δex7/8No significant differences were found between mice. At 6 months post-injection, all regions were in wild type and CLN3 treated with scaav9.p546.CLN3^Δex7/8Showed considerably lower ASM levels in mice treated with PBS CLN3^Δex7/8The mice were much lower, confirming a long duration of ASM accumulation and a highly efficient reduction (p.ltoreq.0.0001). (10N per group) except for the injections between PBS and scaav9.p546.cln3 treated animalsP is 0.0001 or less for all animals except the visual cortex (p is 0.001 or less) at 4 months and the motor cortex (p is 0.001 or less) at 6 months after the irradiation.

Accumulation of the mitochondrial protein ATP synthase subunit C

Analysis of wild type and injection of CLN3^Δex7/8Accumulation of ATP synthase subunit C in PBS or brain tissue of mice injected with scaav9.p546.cln 3. In healthy individuals, this protein is part of the respiratory chain in the mitochondrial membrane, but in patients with batten disease, the protein accumulates abnormally in lysosomes (Palmer et al, Am J Med Genet 1992; 42 (4): 561-. At CLN3^Δex7/8In mice, subunit C accumulation was evident at 4 months in the ventral posterior medial nucleus and ventral posterior lateral nucleus of the thalamus (VPM/VPL region) compared to wild-type animals, and the brain region was often affected in the NCL mouse model (Morgan et al, public science library complex 2013; 8 (11): e 78694; Pontikis et al, Neurobiol of disease (Neurobiol Dis.) (2005; 20 (3): 823) 836). Although untreated animals showed strong signals for the accumulated ATP synthase sub C in the VPM/VPL region of the somatosensory cortex and thalamus, animals treated with scaav9.p546.cln3 showed minimal signals comparable to wild type animals at 4 and 6 months post-injection (figure 5) (p ≦ 0.0001 between PBS and scaav9.p546.cln3 treated animals).

Glial and astrocyte activation

In addition to the abnormal accumulation of storage materials and accumulation of ATP synthase sub C, other histological markers of disease progression in human patients and animal models include activation of astrocytes and microglia (Cotman et al, human molecular genetics 2002; 11 (22): 2709-2721; Morgan et al, public science library integration 2013; 8 (11): e 78694; Pontikis et al, neurobiology of disease 2005; 20 (3): 823-836; Palmer et al, J. USA. Genet. 1992; 42 (4): 561-567). Specifically, reactive microglia are triggered to release pro-inflammatory mediators such as IL1- β 26, which may be a key cause of neuronal cell death in the late stage of CLN3-batten disease. Activated astrocytes were identified in VPM/VPL thalamus and somatosensory cortex sections by staining for Glial Fibrillary Acidic Protein (GFAP) at 4 and 6 month time points. For the somatosensory cortex, quantification was performed in the tubbiness cortex within cortex IV of the somatosensory cortex. Representative images at 6 months post-injection are shown in fig. 6.

Quantification of GFAP-positive regions at 4 and 6 months after treatment, and CLN3 injected with PBS^Δex7/8CLN3 injected with scaav9.p546.CLN3 in mice^Δex7/8Astrocyte activation was significantly reduced in both brain regions of the mice (fig. 6). Despite the CLN3 treated with PBS^Δex7/8In contrast to mice, CLN3 injected with scaav9.p546.CLN3 in these brain regions^Δex7/8The level of GFAP staining in mice was much lower, but for most of the regions analyzed it remained at higher than wild type levels at both 4 and 6 months post-injection.

Glial activation was also determined in VPM/VPL and somatosensory cortex sections using anti-CD 68 staining as a marker for activated microglial cells. CD68 is a lysosomal protein that is upregulated in cells that elicit proinflammatory functions such as phagocytosis (Seehafer et al, J neuroimmunology 2011; 230: 169-. Similar to that observed with astrocytes, 4 months later, CLN3 injected with PBS^Δex7/8Mice injected with AAV9 CLN3 compared to mice^Δex7/8The activation of the gums in VPM/VPL and somatic sensory cortex regions was significantly reduced in mice (FIG. 7). In the somatosensory cortex, treatment with scaav9.p546.cln3 reduced CD68 staining to a level comparable to wild-type mice. At the 6 month time point, in the VPM/VPL zone, with PBS-treated CLN3^Δex7/8The level of CD68 staining was not significantly improved in mice treated with scaav9.p546.cln3 compared to mice, however, there was still a significant reduction in reactive colloids in the somatosensory cortex of mice treated with scaav9.p546.cln3 (figure 7).

Behavioral improvement following delivery of scaav9.p546.cln3

Neurological deficits (e.g. motor and cognitive dysfunction) and early onset disease in human CLN3-batten disease patientsVariants, such as CLN3-batten disease (late infantile batten disease) become significantly later, probably due to the residual function of the truncated CLN3 protein (Kitzmuller et al, human molecular genetics, 2008, 1/15 days; 17 (2): 303-12). This delay in phenotype is also present in CLN3^Δex7/8In a mouse model. In a study of the efficacy of scaav9.p546.cln3, starting from 2 months of age and continuing at 2-month intervals, mice were subjected to a series of behavioral testing paradigms comprising: spin bar measurements and pole climbing were accelerated to test motor function and coordination, and the Morris water maze to assess learning and memory. Currently, animals are tracked for 10 months after injection and are under study. Previous publications characterizing this mouse model indicated an initial delay in neurologic developmental behavior, followed by normalization, and then began to decline at approximately 10-12 months of age (Os Lo rio et al, 2009 for cerebrum sum of Genes behaviour (Genes Brain Behav.); 8 (3): 337-345).

Rotarod analysis showed that wild type and PBS or treated CLN3 until 18 months post-injection^Δex7/8There were no statistically significant differences between mice.

Rotarod assays were performed every 2 months. The mouse was placed on the accelerating wheel and the time until the mouse fell was measured. At each time point, mice were trained in the morning and tested 4 hours later in the afternoon. Unlike previously published data, no wild type mice and PBS CLN3 were observed up to 18 months post-injection^Δex7/8Significant differences in mouse performance (Bosch et al, J. Neuro. Sci 2016; 36 (37): 9669-9682). However, CLN3 treated with PBS in female WT mice^Δex7/8In mice, a significant difference in drop latency was observed at 2 months post-injection. This difference from previous data is most likely due to environmental factors in the design and/or housing of the test protocol. The current protocol used in this study was to test animals at each time point for only one day, while previously published data was repeated over a 4 day time span. Furthermore, the protocol used in this study was performed at a slightly lower starting speed (36rpm versus 40rpm) and in the morning compared to the previously published data (4 hour rest versus 2 hour rest)Training is performed with a longer time interval between afternoon testing sessions. In addition, the training setup is also somewhat unused: whereas in previous studies mice were trained on wheel spin for 5 minutes only in the morning at a constant 5rpm, animals in the current study were trained using the very same settings as then applied in the afternoon test, which resulted in a wheel acceleration of 0.3rpm every 2 seconds. In summary, CLN3 in untreated mice or treated with scaav9.p546.CLN3, compared to wild-type animals with the described settings (figure 8, upper panel) until 18 months post-injection^Δex7/8No defect in the mice was observed in maintaining the ability to accelerate the rotarod.

Morris water maze analysis showed that wild type was associated with CLN3 at 2, 4, 16 and 18 months post-injection^Δex7/8Statistically significant differences between mice.

In the Morris water maze test, animals were placed in a water-filled tank containing a hidden platform. After training, the time to measure the animal's use of environmental cues to locate the hidden platform is measured as a sign of learning and memory ability. At 2 and 4 months post-injection, in wild-type animals CLN3 treated with PBS or with scaav9.p546.cln3^Δex7/8Statistical differences were observed between mice, indicating that at this time point of disease, measurable learning and memory was impaired by this test, resulting in the latency of the animals to find the hidden platform. Furthermore, at 16 months and 18 months, CLN3 was compared between wild type and treatment with PBS or scaav9.p546.cln3^Δex7/8A more significant statistical difference in latency was observed between mice (figure 9, top left). The increased latency at 16 months was also compared to CLN3 treated with PBS^Δex7/8Increased swimming speed in mice was correlated (figure 9, upper right panel). In addition, CLN3 was treated with scaav9.p546.CLN3 in male wild type animals at 16 months and 18 months when divided by gender^Δex7/8Statistical differences in latency were observed between mice (figure 9, middle left panel), while CLN3 treated with scaav9.p546.CLN3^Δex7/8Male mouse swimming speed decreased significantly at 16 months (fig. 9, right middle panel). CLN3 treated with wild type or PBS^Δex7/8Animal comparison, by scaav9.P5CLN3 treated female CLN3^Δex7/8Mice showed significantly increased latency at 18 months (fig. 9, bottom left panel), while CLN3 treated with PBS^Δex7/8Male mouse swimming speed increased significantly at 16 months (fig. 9, lower right panel).

The pole climbing assay showed CLN3 treated with scaav9.p546.CLN3 compared to PBS injected animals^Δex7/8The performance of (2) is improved.

The pole climbing test measures the time it takes to turn around when a mouse is placed face up on a vertical pole and the time it takes to lower the pole when it is placed face down on a vertical pole. In addition, the number of falls from the pole in an attempt to turn or descend is also sometimes measured. This test assesses coordination and balancing capabilities.

At 10 and 12 months post-injection, scaav9.p546.cln3 animals were significantly faster in the lower rods compared to PBS treated animals (figure 10, upper left panel). CLN3 treated with PBS at 10 and 12 months after injection^Δex7/8Statistically significant differences were seen in the time spent when animals were dropped, whereas the wild type and CLN3 treated with scaav9.p546.CLN3^Δex7/8Are indistinguishable (fig. 10, top left). Two statistically significant differences were found with respect to the time it took for the animal to turn from a face-up position to a face-down position. At 2 and 16 months of age, wild-type animals became significantly faster compared to both scaav9.p546.CLN3 and PBS treated CLN3 Δ ex7/8 mice. This difference was more pronounced in male mice (fig. 10, left middle panel) compared to female mice (fig. 10, bottom left panel), where no difference was observed compared to wild type. Time points of 2 and 16 months were the only time points at which this parameter difference was observed between the study groups (figure 10, top left panel).

An additional statistically significant difference was seen in the average number of drops from the rod, where CLN3 was treated with PBS compared to wild type and scaav9.p546.CLN3 treated animals^Δex7/8Males and females fell more frequently (fig. 11). The upper diagram: a significant difference in the number of drops was found at month 2 between the scaav9.p546.cln3 treated animals and the PBS treated animals. 16 months after injection, in wild type andCLN3 treated with PBS^Δex7/8Statistically significant differences were also observed between mice. The middle graph is as follows: only males. CLN3 treated with PBS^Δex7/8Mice fell from the pole more often than the other treatment groups with the greatest statistical significance at 16 months post-injection. The following figures: for females, the drop difference was significant at 8 months post injection, but the trend was visible throughout the study. For each treatment group, N-5 (5M/5F). Interestingly, differences in drop from the pole were seen throughout the 18 month period and were statistically significant at the early time point (4 months) and at 8 months and 16 months. At 8 months, the difference was statistically significant only in females, but there was also a clear trend in males, and was statistically significant in males at 16 months post-injection. Typically, CLN3 treated with PBS^Δex7/8Males fell off the rod more frequently than the other treatment groups.

In summary, there is strong evidence to suggest treatment of CLN3 with scaav9.p546.CLN3^Δex7/8Mice prevented the accumulation of ASM material as well as ATP synthase subunit C, both of which are the major hallmarks of progression of CLN 3-barnacle disease. These data correlate with a strong reduction in glial activation (astrocytes and microglia). Although progressing at an early stage of the disease, the first trend towards an improvement in the behavioral phenotype becomes evident: CLN3 treated with scAAV9.P546.CLN3 compared to animals treated with PBS^Δex7/8The mouse is more able to lower the vertical pole because it moves faster and falls less often. Taken together, these data support scaav9.p546.cln3 gene therapy as a therapeutic strategy for this disease.

Example 3

Expression studies in mice with scaav9.P546.GFP

The P546 promoter allows for expression of transgenes throughout the CNS in a manner similar to the chicken- β -actin (CBA) promoter. For a side-by-side comparison between the two promoters, at postnatal day 1, at 5X 10 per animal¹⁰Mice were injected with the viral genomes scaaV9.CB. GFP or poloxamer 188 formulated in 1 XPBS and 0.001% Pluronic F68 or 20mM Tris (pH 8.0), 1mM MgCl2, 200mM NaCl, 0.001% Poloxamer 188scaav9.p546. gfp. After 3 weeks, animals were sacrificed and brains were placed directly under a fluorescence dissecting microscope. From the fluorescence images, it is evident that the GFP distribution is similar, but the fluorescence levels are lower in animals receiving scaav9.P546.GFP compared to those receiving scaav9.cb. GFP, confirming that the P546 promoter leads to a more moderate expression level of the transgene compared to the CBA promoter.

Another mouse was injected with scaav9.p546.gfp and kept alive for 200 days. After 200 days, animals were sacrificed and whole brain sagittal sections were stained for GFP expression. Even 200 days after injection, extensive expression of the GFP transgene was observed throughout the brain, including cortex, hippocampus, mesencephalon, medulla, amygdala and cerebellum, further suggesting that the P546 promoter is a good candidate for CNS gene therapy.

Western blot data from various tissues and brain regions further support data from GFP fluorescence and GFP immunofluorescence staining. GFP expression could be readily detected three weeks after injection by fluorescent western blot technique using a liquid system in mice treated with scaav9.p546.GFP (n-3), whereas no band was detected in animals injected with PBS used as control (n-1). Transgene expression was evident in whole brain lysates as well as in regiospecific lysates containing cortex, medulla, midbrain, hippocampus, cerebellum and spinal cord.

Furthermore, GFP expression was also confirmed in heart and liver, while lung and spleen showed little to no transcript expression (figure 12). Western blot data with scaav9.p546.gfp are consistent with expression data from mouse and non-human primate safety studies, where very similar expression profiles were found. Furthermore, this expression pattern in brain and peripheral organs is comparable to that found for scaav9.cb. gfp.

In summary, extensive expression analysis in mice using immunostaining and western blot techniques showed that the P546 promoter leads to a very similar and persistent expression profile throughout the nervous system, while allowing for a more moderate expression level compared to the strong CBA promoter.

Example 4

Expression studies in non-human primates with scaav9.P546.CLN3

Single dose of 3.4X 10¹³vg scaav9.p546.cln3 is present in 1x PBS and 0.001% pluronic F68 and is administered to three cynomolgus monkeys of 3-4 years old.

In targeting assays in brain tissue of cynomolgus monkeys injected with scaav9.p546.CLN3, targeting was assayed at the RNA level using primers specific for the human CLN3 transgene and which do not cross-react with endogenous non-human primate CLN3 RNA. Quantitative PCR of reverse transcription in tissues from various brain regions of one of the cynomolgus monkeys sacrificed at 12 weeks post-injection revealed expression of human CLN3 at all levels in spinal cord, cortex, thalamus, striatum, cerebellum, and retina, further emphasizing the broad reach of scAAV9 and expression of transcripts with the P546 promoter throughout the brain and spinal cord (fig. 13). Notably, the primers used to detect vector-derived human CLN3 did not cross-react with the endogenous NHP CLN3 transcript. Thus, normalization was performed against the vector-derived CLN3 RNA levels found in the lumbar spinal cord, which was set to 1 instead of saline-injected or non-saline-injected animals, since normalization to zero was not possible. Actin was used as a normalization gene.

In summary, data from non-human primates demonstrate the high potential of scAAV9 to cross the nervous system and reach large areas of the CNS after a single intrathecal lumbar injection. Notably, all non-human primates treated by intrathecal injection of scaav9.p546.cln3 were well tolerated by treatment and no side effects were observed in any animal at any time point up to 6 months after injection.

Example 5

Clinical trials of gene therapy for scaav9.P546.CLN3

scaav9.p546.CLN3 will be delivered intrathecally to a human patient suffering from CLN3-batten disease.

scAAV for Clinical trials was generated by national Children Hospital Clinical Manufacturing Facility (national world child's Hospital Clinical Manufacturing Facility) using triple transfection method of HEK293 cells under cGMP conditions as described in example 1.

Selecting ginsengPatients with age will be 3-10 years of age, diagnosed with CLN3 disease as determined by genotype. The first cohort (n-3) will receive a single gene transfer dose of 6 × 10 per patient¹³vg total scAAV. The scAAV9.P546.CLN3 was formulated at 20mM 1mM MgCl₂200mM NaCl, 0.001% Poloxamer 188Tris (pH 8.0), and will be delivered in one shot into the subarachnoid space between the spinous processes into the lumbar lacuna by means of an intrathecal catheter inserted by lumbar puncture. Safety will be evaluated according to clinical situation and by checking safety tags. There were at least four weeks between enrollment of each subject to allow review of safety data at day 30 post-gene transfer. If there were no safety issues, a second cohort with four additional subjects would be enrolled after a third subject was evaluated one month post injection. Each subject in cohort 2 (n-4) will receive an increasing dose of 1.2 × 10¹⁴vg total scAAV. There was a time window of at least six weeks between completion of cohort 1 and initiation of cohort 2 to allow review from five time points (day 1, day 2, day 7, day 14 and day 21) and DSMB review safety analysis before giving the next subject.

Disease progression will be measured using the UBDRS scale (referenced in the detailed description above) and the effect on quality of life and the potential for prolonged survival of treatment using the pediatric quality of life (PEDSQOL) scale.

When all patients completed the three year old study, a major analysis of efficacy was evaluated. The basis for determining efficacy is disease stabilization or reduction of disease progression based on a well-established Unified Barnacle Disease Rating Scale (UBDRS) developed specifically for CLN 3-barnacle disease. After the three year study period, patients will be monitored annually for 5 years under FDA guidance.

Example 6

Cln3^Δ7/8Additional study of mouse model

As described in the examples, PBS, scaav9.p546.Cln3 or scaav9.cb. Cln3 gene therapy was administered to 2 Wild Type (WT) and Cln3 Δ 7/8 mice by Intracerebroventricular (ICV) injection on postnatal day 1. In this study, mice were administered 5X 1010 vg/animal (4. mu.L volume).

The injection method and timing were selected to target specific neuronal populations relevant in CLN3-batten disease patients. Animals were sedated by hypothermia during surgery, monitored until complete recovery, and genotyped as previously described (see Morgan et al, public science library complex 8; and laboratory, TJ protocol 18257: standard PCR assay).

Statistical analysis was performed using GraphPad Prism, and details are noted in the legend. Typically, two-way anova was used in the appropriate post-test method and outliers were removed by the ROUT method, Q ═ 0.1-1%. Unpaired t-tests were used, if appropriate.

Expression and distribution of hCLN3 transcript in brain

Quantitative PCR was performed to measure the hCLN3 transcript in the brain of treated mice. Total RNA and cDNA were generated as previously described (see, Cain et al, molecular therapy, 2019). The 2^ -Delta-Delta Ct method was used to calculate the relative gene expression of human CLN3 transcript normalized to Gapdh as housekeeping control. hCLN3 forward primer sequence: CGCTAGCATCTCATCAGGCCTTG (SEQ ID NO: 11); hCLN3 reverse primer sequence: AGCATGGACAGCAGGGTCTG (SEQ ID NO: 12).

As shown in figure 16, scaav9.p546.Cln3 treatment resulted in Cln3^Δ7/8The expression level of hCLN3 transcript in the cerebral cortex and spinal cord of mice increased as measured by qPCR until 24 months of age. Thus, a single neonatal ICV administration of scaav9.p546.cln3 resulted in sustained and targeted good expression of hCLN 3.

In addition, RNAscope was performed to detect CLN3 transcript in the brain of treated mice. Subjecting mice to CO₂Euthanized and heart perfused with PBS. Brains were collected and placed on 1mm sagittal brain blocks. The brain was cut 3mm to the right of the midline and midline. 3mm sagittal sections were snap frozen with-50 ℃ isopentane and then sectioned on a 16 μm cryostat and placed on a glass slide. The slides were then processed according to the manufacturer's suggested protocol (ACDBio manuals 320293 and 320513). Human specific CLN3 Probe (ACDB) for sectioningio catalog No. 470241), consisting of 20 double z pairs in the region of the CLN3 gene, which CLN3 gene has little homology between mouse and human CLN3 (region 631-1711). The slides were fluorescently labeled with an RNAscope fluorescent multiplex kit (ACDBIO Cat. No. 320850) using its 4-FL-AltC, which was labeled with a 550nm fluorophore for hLN 3 probe, and counterstained with DAPI to label the nuclei. Tissue sections were mounted on slides under coverslips using a fade resistant mounting medium (Dako faramount, Agilent technologies). Sections were stored in the dark prior to imaging. Sections were imaged and analyzed using a Nikon NiE microscope with NIS-Elements Advanced Research software (v 4.20).

As shown in figure 17, scaav9.p546.Cln3 treatment was at Cln3^Δ7/8Stable hCLN3 transcripts were produced throughout the brain of mice, as measured by RNAscope (red fluorescence), up to 24 months of age. Quantitative PCT and RNAscope assays confirmed that a single neonatal ICV administration of scaav9.p546 resulted in sustained and targeted good expression of hCLN 3. scaav9.p546.cln3 gene therapy increased hCLN3 gene expression throughout the brain and spinal cord until 24 months of age.

Classic barnyard disease pathology

To determine whether administration of scaav9.p546.Cln3 prevents Cln3^Δ7/8Classical batten disease pathology in mouse brain, examined for depot material Accumulation (ASM) and glial reactivity after ICV administration. For wild type and Cln3^Δ7/8Mice on CO₂Euthanized, perfused with PBS, and the tissues fixed with 4% PFA. The fixed brain was sectioned on a 50 μm vibrating microtome (Leica VT 10008). Sections were treated with standard immunofluorescence and DAB staining protocols. Primary antibodies include anti-CD 68(AbD Serotec, MCA 1957; 1: 2000), anti-GFAP (Dako, Z0334; 1: 8000), and anti-ATP synthase subunit C (Ebos, Abcam, ab181243, 1: 1000). Secondary antibodies include anti-rat and anti-rabbit biotinylated (VectorLabs, BA-9400; 1: 2000). Sections were imaged and analyzed at 20X using an Aperio slide scanning microscope. Images were extracted from the VPM/VPL of the thalamus and 2/3 layers of the somatosensory cortex, where from each oneThe animal acquires a plurality of images of a plurality of tissues. The total area of immunoreactivity was quantified using a threshold analysis in ImageJ.

Figure 18 shows treatment of scaav9.p546.Cln3 with Cln3 up to 24 months of age^Δ7/8ASM accumulation was prevented and reduced in two regions of the mouse brain. Figure 19 shows that scaav9.p546.Cln3 treatment is typically at Cln3 up to 24 months of age^Δ7/8Large subunit C accumulation (component of ASM) was prevented in two regions of the mouse brain. Figure 20 shows that scaav9.p546.Cln3 treatment typically prevents astrocyte activation (GFAP +) in two regions of Cln3 Δ 7/8 brain up to 24 months of age. Figure 21 shows that scaav9.p546.Cln3 treatment prevented some microglial activation (CD68+) in two regions of Cln3 Δ 7/8 brain up to 24 months of age, depending on time point. Thus, scaav9.p546.Cln3 prevents Cln3^Δ7/8Classical batten disease pathology in mouse brain, including depot material accumulation and glial reactivity. Figure 22 shows that scaav9.cb. Cln3 treatment prevented Cln3 at 6 and 12 months of age^Δ7/8The mice were similarly effective in various barnacle pathology.

In addition, treatment with scaav9.p546.cln3 did not cause any red blood cell (CBC) or White Blood Cell (WBC) abnormalities, as measured up to 24 months after ICV administration. Fig. 23 provides data for the following CBC parameters: RBC count, hemoglobin, hematocrit, mean red blood cell volume, mean red blood cell hemoglobin concentration, RBC distribution, platelet count, and mean platelet volume. Fig. 24 provides data for the following WBC parameters: WBC count, lymphocyte count percentage, monocyte percentage, granulocyte percentage.

scaav9.p546.Cln3 gene therapy prevented Cln3 Δ 7/8 mice from developing many of the cellular features of Cln 3-barnyard disease up to 24 months of age, including ASM, subunit C, GFAP, and CD68 expression. In addition, scaav9.cb. Cln3 gene therapy prevented Cln3^Δ7/8Mice develop many cellular features of CLN 3-barnyard disease up to 24 months of age, including ASM, subunit C, GFAP, and CD68 expression.

Example 7

At Cln3^Δ7/8In mouse modelGender-based histopathological analysis

As described in the examples, PBS, scaav9.p546.Cln3 or scaav9.cb. Cln3 gene therapy was administered to 2 Wild Type (WT) and Cln3 Δ 7/8 mice by Intracerebroventricular (ICV) injection on postnatal day 1. In this study, mice were administered 5X 10¹⁰vg/animal (4. mu.L volume).

For wild type and Cln3^Δ7/8Mice on CO₂Euthanized, perfused with PBS, and the tissues fixed with 4% PFA. The fixed brain was sectioned on a 50 μm vibrating microtome (Leica VT 10008). Sections were treated with standard immunofluorescence and DAB staining protocols. Primary antibodies include anti-CD 68(AbD Serotec, MCA 1957; 1: 2000) and anti-ATP synthase subunit C (Ebos, ab181243, 1: 1000). Secondary antibodies include anti-rat and anti-rabbit biotinylated (Vector Labs, BA-9400; 1: 2000). Sections were imaged and analyzed at 20X using an Aperio slide scanning microscope. The images were extracted from the following regions: hippocampus CA2/CA3 region, hippocampal dentate gyrus layer, basolateral amygdala, reins, thalamic reticular nucleus, thalamic ventral posterolateral/ventral posteromedial nucleus, dorsal and medial regions thalamus, piriform cortex, postero-pressal cortex and 2/3 layers of somatosensory cortex, wherein multiple images of multiple tissues were taken from each animal. The total area of immunoreactivity was quantified using a threshold analysis in ImageJ.

Figure 25 shows that mice treated with scaav9.p546.cln3 showed different levels of accumulation of SubC in the hippocampus CA3 region based on gender at 12 months of age. Treated female Cln3 at 12 months of age^Δ7/8Mice accumulated significantly more of the SubC than wild type, while treated males did not differ in their accumulation from wild type. However, no such difference was seen at any other time point analyzed.

Figure 26 shows that mice treated with scaav9.p546.cln3 showed subtle, varying levels of SubC accumulation in piriform cortex (PIRC) at various time points based on gender. At 12 months of age, treated female mutant CLN3 mice accumulated significantly more SubC than wild type, with AAV treatment not preventing accumulation below the PBS mutation level, while treated males did not differ from wild type in their accumulation of SubC. However, this correlation was not seen at any other time point analyzed, and was not consistent with findings at 18 months of age, where the treated females had no significant differences in the accumulation of subcc from wild-type, and were significantly lower than untreated mutant mice. At 18 months of age, the accumulation of subcoc was significantly higher than WT levels in treated males.

Figure 27 shows that mice treated with scaav9.p546.cln3 showed different levels of subcoc accumulation in the Reticulo Thalamic Nucleus (RTN) at various time points based on gender. At 6 months of age, treated female mutant CLN3 mice accumulated significantly more subcoc than wild type, while treated males did not differ in their accumulation of subcoc from wild type. At 12 months of age, treated males remained at wild-type levels, while treated females had significantly higher subcc than both wild-type and untreated mutant mice. This difference between female treated and untreated mutants was absent at 18 months, with subcoc significantly higher than WT, but significantly lower than untreated mutants of both males and females.

Figure 28 shows that mice treated with scaav9.p546.cln3 showed different levels of accumulation of SubC in the somatosensory cortex based on gender at 12 months. At 12 months of age, treatment with AAV did not reduce the accumulation of subcc, while preventing the accumulation of subcc in treated males, compared to untreated mutant females, and did not differ from wild type. However, no such difference was seen at any other time point analyzed.

Figure 29 shows that mice treated with scaav9.p546.cln3 showed different levels of accumulation of SubC in the VPM/VPL of the thalamus at 12 months based on gender. At 6 months of age, treated females accumulated significantly less subcc than untreated mutant females, but significantly more wild-type females. This difference lasted 12 months and 18 months, with no difference between wild type and treated males at any time point analyzed.

Figure 30 shows that mice treated with scaav9.p546.cln3 showed different levels of accumulation of SubC in basolateral amygdala (BLA) at 12 months based on gender. At 12 months of age, AAV did not significantly prevent the accumulation of subcc in treated females. At 18 months, the accumulation of SubC in treated females was still significantly higher than wild-type, but lower than in untreated females. By 18 months, treated males also began to have significantly more SubC than their wild-type counterparts, mimicking what was seen in the female group.

Figure 31 shows that scaav9.p546.cln3 treated mice showed different levels of subcoc accumulation in the Dentate Gyrus (DG) polymorphous layer at 12 months and 18 months based on gender. At 12 months of age, treated females appeared to accumulate significantly more SubC than both wild-type and untreated mutant females. The original image (not shown) shows a layer of darkened granular cells surrounding a toothed-back multi-layer that may affect the threshold results. This darkening occurred only in this group and only at the 12 month time point. This increase also did not occur at 18 months in females, however at 18 months treated males began to have significantly more subcoc accumulation than wild type males.

Figure 32 shows that mice treated with scaav9.p546.cln3 showed different levels of accumulation of subcoc in reins at 12 and 18 months, based on gender. At 12 months of age, treated females accumulated significantly less subcc than untreated mutant females, but significantly more wild-type females. This difference also occurred at 18 months, with no difference between wild type and treated males at any time point analyzed.

Figure 33 shows that mice treated with scaav9.p546.cln3 showed different levels of subcoc accumulation in the dorsal inner nucleus based on gender at 12 months and 18 months. At 12 months of age, treated females accumulated significantly less subcc than untreated mutant females, but significantly more wild-type females. This difference also occurred at 18 months, with no difference between wild type and treated males at any time point analyzed.

Figure 34 shows that mice treated with scaav9.p546.cln3 did not differ in levels of subcc accumulation in posterior cortex (RSC) based on gender. There was no difference between wild type and treated males at any time point analyzed.

Figure 35 shows that mice treated with scaav9.p546.cln3 showed different levels of activated microglia in the somatosensory cortex (S1BF) at 6 months based on gender (CD 68)⁺). At 6 months of age, the microglial activation of treated females increased compared to wild-type and untreated females, with treated males higher than wild-type but lower than untreated males. No sex difference was found at 12 months of age and 18 months of age.

Figure 36 shows that mice treated with scaav9.p546.cln3 showed different levels of microglial activation in VPM-VPL (thalamus) based on gender. At 6 months of age, the microglial activation of treated females increased compared to wild-type and untreated females, with treated males higher than wild-type but lower than untreated males. This difference also appeared at 12 months. The same was observed in the female group at 18 months, however, at this time point, the treated males did not differ significantly from wild type.

Figure 37 shows that scaav9.p546.cln3 mice show different levels of activated microglia in the dorsal inner nucleus (MD) based on gender (CD 68)⁺). At 6 months of age, the microglial activation was increased in treated females compared to wild-type and untreated females, with treated males being higher than wild-type but indistinguishable from untreated males. At both 12 and 18 months of age, treated males have higher microglial activation than wild type and lower activation than untreated males, while treatment appears to have no effect on females.

Figure 38 shows that mice treated with scaav9.p546.cln3 showed different levels of activated microglia in the inner nucleus (SM) based on gender. At 6 months of age, microglial activation was increased in treated females compared to wild-type and untreated females, whereas treated males were not significantly different from untreated males, both of which were more activated than wild-type. By 12 months, treatment appeared to have no effect on the degree of microglial activation in either sex. By 18 months, microglial activation was reduced to wild-type levels in treated males, while activation was the same in treated females as in untreated females.

The above data indicate that animals treated with scaav9.p546.Cln3 are Cln3^Δ7/8Mouse brain with accumulation of ATP-synthase subunit C and CD68 in several regions⁺Different pathologies based on sex associated with microglial activation. Different pathological differences based on gender appear to be more female specific. The 12 month time point is where most of the differences are most consistent, with many differences only appearing at 12 months and no longer appearing by 18 months.

While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments described herein may be employed. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

All documents mentioned in this application are incorporated herein by reference in their entirety.