Transformation method of corynebacterium plasmid replicon and product thereof
阅读说明：本技术 一种棒状杆菌质粒复制子的改造方法及其产品 (Transformation method of corynebacterium plasmid replicon and product thereof ) 是由 刘秀霞 黄丹妮 余心宇 杨艳坤 白仲虎 于 2021-08-27 设计创作，主要内容包括：本发明基于pEC-XK99E中的pGA1棒杆菌复制子这一在谷氨酸棒杆菌中拷贝数约为30的低拷贝质粒复制子,将复制蛋白Rep的325位异亮氨酸突变为苏氨酸、398位编码丝氨酸的氨基酸变为同义密码子,成功获得了一种可以提高棒杆菌质粒拷贝数的复制子pGA1-Rep-I325T/S398。将该复制子用于高拷贝质粒的构建,携带有pGA1-Rep-I325T/S398复制子的质粒pEC-XK99E-Rep-T/S在谷氨酸棒杆菌中复制后,通过质粒体外抽提证实增加了菌体中质粒的数量。构建pEC-XK99E-EGFP-Rep-T/S质粒,通过测定不同菌体量下的荧光值,与为突变质粒相比荧光量增加三倍即改造后的质粒提高了蛋白的表达量。同时通过荧光定量PCR手段,测定突变后拷贝数为野生型复制子的质粒的8倍约为245。(The invention is based on pGA1 corynebacterium replicon in pEC-XK99E, namely a low copy plasmid replicon with copy number of about 30 in Corynebacterium glutamicum, and successfully obtains a replicon pGA1-Rep-I325T/S398 capable of improving the copy number of corynebacterium plasmid by mutating isoleucine at position 325 of replication protein Rep into threonine and changing amino acid coding serine at position 398 into synonymous codon. The replicon is used for constructing high-copy plasmids, and after the plasmid pEC-XK99E-Rep-T/S carrying pGA1-Rep-I325T/S398 replicon replicates in Corynebacterium glutamicum, plasmid in-vitro extraction proves that the number of plasmids in thalli is increased. pEC-XK99E-EGFP-Rep-T/S plasmids are constructed, and the fluorescence quantity is increased by three times compared with that of mutant plasmids by measuring the fluorescence values under different bacterial quantities, namely the modified plasmids improve the expression quantity of proteins. Meanwhile, the copy number after mutation is determined to be about 8 times of that of the wild replicon plasmid by a fluorescent quantitative PCR method, and the copy number is about 245.)
1. A modified corynebacterium plasmid replicon, wherein: the Corynebacterium plasmid replicon takes a minimum replicon amino acid sequence, namely a fragment 1, of a wild-type Corynebacterium plasmid pGA1 in Corynebacterium glutamicum LP-6 (Corynebacterium glutamicum LP-6) shown in SEQ ID No.1 as a starting sequence, 325-bit isoleucine of a replication protein Rep is mutated into threonine, 398-bit serine is changed into a synonymous codon, and the modified Corynebacterium plasmid replicon pGA1-Rep-I325T/S398 is obtained by constructing a recombinant bacterium, expressing and purifying.
2. A modified corynebacterium plasmid replicon according to claim 1 wherein: said coryneform plasmid replicon comprising,
taking the amino acid sequence shown in SEQ ID No.1 as a starting sequence, isoleucine at position 325 of a replication protein Rep is mutated into threonine ACC, and serine at position 398 is changed into serine CAU which is a synonymous codon.
3. A modified corynebacterium plasmid replicon according to claim 1 or 2 wherein: the amino acid sequence of the corynebacterium plasmid replicon pGA1-Rep-I325T/S398 is shown as SEQ ID No. 2.
4. A method of modifying a coryneform plasmid replicon according to any one of claims 1 to 3, wherein: the transformation method comprises the steps of,
the plasmid pEC-XK99E is used as a template, a primer Replicon _ F, Replicon _ R is designed, and a minimal replication region (1696bp) of corynebacterium pGA1 in the pEC-XK99E plasmid is obtained through PCR, namely a fragment 1; carrying out agarose gel electrophoresis on the fragment 1, recovering an agarose gel band with correct molecular weight, and determining the concentration for later use;
designing primers Replicon _ F, 355_ R, 355_ F, 575_ R and 575_ F, Replicon _ R for the fragment 1, carrying out mutation, mutating G of the 355 site to A to obtain a fragment 2, mutating G of the 355 site to A and T of the 575 site to C to obtain a fragment 3, mutating G of the 355 site to A to obtain a fragment 4, and setting the sequences of the fragments 2-4 as SEQ ID NO. 9-11;
performing overlapping PCR on the fragments 2 and 3, wherein the primers are Replicon _ F and 575_ R to obtain a fragment 5 with a sequence of SEQ ID NO. 12;
overlapping PCR is carried out on the fragments 4 and 5, the primer is Replicon _ F, Replicon _ R, and a fragment 6 with the sequence of SEQ ID NO.13 is obtained;
taking pEC-XK99E plasmid as a template, obtaining a linear vector except pGA1 replicon by PCR, and obtaining a homologous sequence of 25bp or more with the replicon; primers are designed into Plasmid _ F and Plasmid _ R, and the nucleotide sequences are shown as SEQ ID NO.15 and SEQ ID NO. 16. The obtained linear vector fragment 19(5322bp) has a sequence shown in SEQ ID NO. 19;
homologous recombination is carried out on the fragment 19 and the fragment 6, the Escherichia coli JM109 is transformed by a ligation product, and a composition plasmid with a target mutant replicon is obtained after the transfer culture: the corynebacterium plasmid replicon pEC-XK99E-Rep-T/S was modified.
5. The method of modifying a coryneform plasmid replicon according to claim 4, wherein: the design primer Replicon _ F, Replicon _ R is shown in the specification, wherein the nucleotide sequence of the primer Replicon _ F, Replicon _ R is shown in SEQ ID NO.3 and SEQ ID NO. 4.
6. The method of modifying a coryneform plasmid replicon according to claim 4, wherein: the agarose gel electrophoresis condition is 170v, and the electrophoresis time is 10-15 min.
7. The method of modifying a coryneform plasmid replicon according to claim 4, wherein: the correct molecular weight, i.e. the molecular weight of the minimal replicon, 1696bp, was recovered.
8. The method of modifying a coryneform plasmid replicon according to claim 4, wherein: the design primers are Replicon _ F, 355_ R, 355_ F, 575_ R and 575_ F, Replicon _ R, wherein the nucleotide sequences of the primers 355_ R, 355_ F, 575_ R and 575_ F are shown in SEQ ID NO. 9-SEQ ID NO. 11; the primers of Plasmid _ F and Plasmid _ R are designed, wherein the nucleotide sequences of the primers of Plasmid _ F and Plasmid _ R are shown as SEQ ID NO.15 and SEQ ID NO. 16.
9. The method of modifying a coryneform plasmid replicon according to claim 4, wherein: the homologous recombination is carried out under the condition that the concentration ratio of the fragment 19 to the fragment 6 is 1:3, and the reaction is carried out for 30min at 50 ℃.
10. The modified coryneform plasmid replicon pEC-XK99E-Rep-T/S obtained by the method for modifying a coryneform plasmid replicon according to claim 4, wherein: the modified corynebacterium plasmid replicon pEC-XK99E-Rep-T/S has a map shown in figure 3, and the copy number of the modified corynebacterium plasmid replicon is 8 times that of a wild-type replicon plasmid.
Technical Field
The invention belongs to the field of bioengineering, and particularly relates to a modified corynebacterium plasmid replicon and a product thereof.
Background
Corynebacterium glutamicum the plasmids which are frequently used today are all shuttle plasmids of Corynebacterium/Escherichia coli which have a plasmid copy number in Escherichia coli which is 5-6 times that in Corynebacterium glutamicum. Therefore, the expression of the foreign protein in the corynebacterium glutamicum through the shuttle plasmid still has great space for improvement, and the construction of a high-copy shuttle plasmid which can be used in the corynebacterium glutamicum is significant.
Endogenous plasmids which have been isolated from C.glutamicum have been classified into several Corynebacterium plasmid families, based on the similarity of replication pattern and replication proteins, the pBL1, pCG1, pSR1 and pGA1 families all replicating with rolling circles. The patent reports that the pBL1 replicon of the pXMJ19 plasmid can be modified to improve the copy number of the plasmid in Corynebacterium glutamicum, but the plasmid has the condition of unstable replication and segregation. The pEC-XK99E plasmid possesses a pGA1 replicon for replication in C.glutamicum with a rolling circle copy number of about 30. In most cases, stable maintenance of small, rolling circle replicated plasmids in gram-positive bacteria is achieved by their high copy number and no specific partitioning mechanism is required. However, when the copy number of the plasmid is small, the separation is unstable, which proves that the copy number of the plasmid is in positive correlation with the separation stability. Per (positive effect of replication) protein in pEC-XK99E can regulate cells to obtain an optimal number of plasmid copies, and research shows that the positive effect of per on pGA1 copy number is probably due to the interaction with ctRNA, so that the negative effect of ctRNA on pGA1 gene expression is reduced. Experiments show that the copy number of pXMJ19 can be increased when pEC-XK99E and pXMJ19 are expressed in the same bacterium. Therefore, the improvement of the copy number of the pEC-XK99E plasmid has positive significance for improving the expression of foreign proteins of the corynebacterium glutamicum and stabilizing shuttle plasmids.
In the invention, the replication protein (Rep) in the corynebacterium replicon pGA1 is subjected to site-directed mutagenesis on the basis of the shuttle plasmid pEC-XK99E of corynebacterium/escherichia coli, and the improvement of the expression of heterologous proteins in the replication and transcription levels of the modified plasmid is verified by using a reporter gene.
Disclosure of Invention
This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.
The present invention has been made keeping in mind the above and/or other problems occurring in the prior art.
Accordingly, it is an object of the present invention to overcome the disadvantages of the prior art and to provide a modified coryneform replicon and a product thereof.
In order to solve the technical problems, the invention provides the following technical scheme: a modified coryneform replicon comprising: comprises the steps of (a) preparing a mixture of a plurality of raw materials,
the Corynebacterium plasmid replicon takes a minimum replicon amino acid sequence, namely a fragment 1, of a wild-type Corynebacterium plasmid pGA1 in Corynebacterium glutamicum LP-6 (Corynebacterium glutamicum LP-6) shown in SEQ ID No.1 as a starting sequence, 325-bit isoleucine of a replication protein Rep is mutated into threonine, 398-bit serine is changed into a synonymous codon, and the modified Corynebacterium plasmid replicon pGA1-Rep-I325T/S398 is obtained by constructing a recombinant bacterium, expressing and purifying.
As a preferred embodiment of the modified coryneform plasmid replicon of the present invention, there is provided: said coryneform plasmid replicon comprising,
taking the amino acid sequence shown in SEQ ID No.1 as a starting sequence, isoleucine at position 325 of a replication protein Rep is mutated into threonine ACC, and serine at position 398 is changed into serine CAU which is a synonymous codon.
As a preferred embodiment of the modified coryneform plasmid replicon of the present invention, there is provided: the amino acid sequence of the corynebacterium plasmid replicon pGA1-Rep-I325T/S398 is shown as SEQ ID No. 2.
As a preferable embodiment of the method for modifying a coryneform plasmid replicon of the present invention, wherein: the transformation method comprises the steps of,
the plasmid pEC-XK99E is used as a template, a primer Replicon _ F, Replicon _ R is designed, and a minimal replication region (1696bp) of corynebacterium pGA1 in the pEC-XK99E plasmid is obtained through PCR, namely a fragment 1; carrying out agarose gel electrophoresis on the fragment 1, recovering an agarose gel band with correct molecular weight, and determining the concentration for later use;
designing primers Replicon _ F, 355_ R, 355_ F, 575_ R and 575_ F, Replicon _ R for the fragment 1, carrying out mutation, mutating G of the 355 site to A to obtain a fragment 2, mutating G of the 355 site to A and T of the 575 site to C to obtain a fragment 3, mutating G of the 355 site to A to obtain a fragment 4, and setting the sequences of the fragments 2-4 as SEQ ID NO. 9-11;
performing overlapping PCR on the fragments 2 and 3, wherein the primers are Replicon _ F and 575_ R to obtain a fragment 5 with a sequence of SEQ ID NO. 12;
overlapping PCR is carried out on the fragments 4 and 5, the primer is Replicon _ F, Replicon _ R, and a fragment 6 with the sequence of SEQ ID NO.13 is obtained;
a linear vector except the pGA1 replicon was obtained by PCR using the pEC-XK99E plasmid as a template and having a homologous sequence of 25bp or more with the replicon. Designing primers into plasma _ F and plasma _ R, wherein the nucleotide sequences are shown as SEQ ID NO.15 and SEQ ID NO. 16; the obtained linear vector fragment 19(5322bp) has a sequence shown in SEQ ID NO. 19;
homologous recombination is carried out on the fragment 19 and the fragment 6, the Escherichia coli JM109 is transformed by a ligation product, and a composition plasmid with a target mutant replicon is obtained after the transfer culture: the corynebacterium plasmid replicon pEC-XK99E-Rep-T/S was modified.
As a preferable embodiment of the method for modifying a coryneform plasmid replicon of the present invention, wherein: the design primer Replicon _ F, Replicon _ R is shown in the specification, wherein the nucleotide sequence of the primer Replicon _ F, Replicon _ R is shown in SEQ ID NO.3 and SEQ ID NO. 4.
As a preferable embodiment of the method for modifying a coryneform plasmid replicon of the present invention, wherein: the agarose gel electrophoresis condition is 170v, and the electrophoresis time is 10-15 min.
As a preferable embodiment of the method for modifying a coryneform plasmid replicon of the present invention, wherein: the correct molecular weight, i.e. the molecular weight of the minimal replicon, 1696bp, was recovered.
As a preferable embodiment of the method for modifying a coryneform plasmid replicon of the present invention, wherein: the design primers are Replicon _ F, 355_ R, 355_ F, 575_ R and 575_ F, Replicon _ R, wherein the nucleotide sequences of the primers 355_ R, 355_ F, 575_ R and 575_ F are shown in SEQ ID NO. 9-SEQ ID NO. 11; the primers of Plasmid _ F and Plasmid _ R are designed, wherein the nucleotide sequences of the primers of Plasmid _ F and Plasmid _ R are shown as SEQ ID NO.15 and SEQ ID NO. 16.
As a preferable embodiment of the method for modifying a coryneform plasmid replicon of the present invention, wherein: the homologous recombination is carried out under the condition that the concentration ratio of the fragment 19 to the fragment 6 is 1:3, and the reaction is carried out for 30min at 50 ℃.
As a product prepared by the method for modifying the corynebacterium plasmid replicon, the modified corynebacterium plasmid replicon pEC-XK99E-Rep-T/S is characterized in that: the modified corynebacterium plasmid replicon pEC-XK99E-Rep-T/S has a map shown in figure 3, and the copy number of the modified corynebacterium plasmid replicon is 8 times that of a wild-type replicon plasmid.
The invention has the beneficial effects that:
the invention discloses a modified corynebacterium replicon and application thereof. The plasmid replicon provided by the invention is that the isoleucine at position 325 of the Rep protein of the minimum replicon of the Corynebacterium plasmid pGA1 in Corynebacterium glutamicum (Corynebacterium glutamicum LP-6) is mutated into threonine, and the serine at position 398 is mutated into synonymous codon. The plasmid pEC-XK99E-Rep-T/S carrying the artificially modified plasmid replicon pGA1-Rep-I325T/S398 of the present invention has a plasmid copy number 8 times that of the plasmid carrying the original non-mutated replicon (pEC-XK99E) after replication in C.glutamicum. The copy number of pEC-XK99E in Corynebacterium glutamicum was approximately 30, and the copy number of pEC-XK99E-Rep-T/S was 245.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:
FIG. 1 is a schematic structural diagram of the artificially modified plasmid replicon pGA1-Rep-I325T/S398 obtained in the present invention.
FIG. 2 is a map of plasmid pEC-XK99E-EGFP carrying a wild-type pGA1 replicon.
FIG. 3 is a map of plasmid pEC-XK99E-EGFP-Rep-T/S carrying pGA1-Rep-I325T/S398 replicon.
FIG. 4 is an electrophoretogram of the PCR-amplified product in example 1, and L1, 2 and 3 are biological parallel samples.
FIG. 5 is a diagram showing the results of sequencing verification of fragment 6 prepared in example 1.
FIG. 6 is a bar graph of unit fluorescence values plotted against Prism 9 in performance tests, CONTROL representing fluorescence/OD values of plasmid before non-engineering. Wherein 2-4, 2-6, 3-1, 3-2 and 3-3 are parallel samples of plasmids possessing site-directed mutagenesis replicons.
FIG. 7 shows the results of RT-PCR testing of copy number in performance testing, CONTROL represents the copy number of plasmid before non-modification. Wherein 2-4, 2-6, 3-1, 3-2 and 3-3 are parallel samples of plasmids possessing site-directed mutagenesis replicons.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in detail below.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described herein, and it will be readily apparent to those of ordinary skill in the art that the present invention may be practiced without departing from the spirit and scope of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.
Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.
The object of the present invention is to design a replicon capable of increasing the copy number of a coryneform plasmid and construct a coryneform plasmid with high copy number.
The invention uses a product column which is purchased from Jiangsukang, a century Biotechnology GmbH, and the model is DNA Clean-up Kit; the primers used in the present invention were synthesized by Suzhou Jinweizhi Biotechnology, Inc.
The other raw materials used are commercially available unless otherwise specified.
Example 1
In vitro engineering of pGA1 Corynebacterium replicons:
the objective of this experiment was to obtain a high copy number of pGA1-Rep-I325S/T398 mutant. The method comprises the following steps:
(1) the plasmid pEC-XK99E is used as a template, a primer is designed, a fragment 1 which is the minimum replication region (1696bp) of corynebacterium pGA1 in the pEC-XK99E plasmid is obtained through PCR, the primer is Replicon _ F, Replicon _ R, and the nucleotide sequence of the primer is sequentially shown as SEQ ID No.3 and SEQ ID No. 4. Synthesized by Suzhou Jinzhi Biotechnology, Inc. The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; performing denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 2min for 34 cycles; finally, the temperature is kept at 72 ℃ for 5 min. The PCR reaction system is shown in Table 1.
TABLE 1 PCR reaction System
Performing agarose gel electrophoresis on the product after PCR amplification, recovering an agarose gel strip with the molecular weight of 1696bp of the minimum replicon, and determining the concentration for later use; the electrophoresis chart of the PCR amplified product is shown in figure 4.
(2) And (3) designing a primer for mutation of the fragment 1, wherein the site 575 is mutated from T to C, and the site 355 is mutated from G to A. The primers are Replicon _ F, 355_ R, 355_ F, 555_ R and 555_ F, Replicon _ R, and the nucleotide sequences are as follows: SEQ ID NO.3, SEQ ID NO. 5-8, and SEQ ID NO. 4. Fragments 2, 3, 4 were obtained with the sequences: SEQ ID NO. 9-11.
(3) Fragments 2 and 3 were subjected to overlap PCR. Adding the fragments 2 and 3 into the system in equal proportion by taking the templates as templates, and obtaining a fragment 5 with the sequence shown as SEQ ID NO.12 by taking the primers as the replion _ F and 575_ R.
(4) Adding the fragments 4 and 5 as templates in equal proportion into a system for overlapping PCR, and obtaining a fragment 6 with a primer of Replicon _ F, Replicon _ R, wherein the sequence is shown as SEQ ID NO. 13.
The PrimeSTAR polymerase is used in the overlapping PCR of the steps (3) and (4), and the reaction conditions are as follows: performing pre-denaturation at 98 ℃ for 3min, denaturation at 98 ℃ for 15s, annealing at 55 ℃ for 15s, extension at 72 ℃ and extension speed of 6-10 kb/min for 30 cycles; finally, the temperature is kept at 72 ℃ for 5 min.
(5) Fragment 6 prepared in example 1 was sequenced by Kinzyo Biotech, Suzhou, as shown in FIG. 5, and was confirmed to be the desired pGA1-Rep-I325S/T398 replicon.
Example 2
Construction of a plasmid carrying a mutated Rep Gene:
in order to better detect the product performance, the embodiment provides a method for constructing a plasmid of pEC-XK99E-Rep-T/S for constitutive expression of EGFP protein, which comprises the following steps:
(1) based on pEC-XK99E plasmid, gene elements of lacIq promoter, lacI, lac operator and the like are cut off, and pEC-XK99E-Ptac containing constitutive tac promoter is constructed.
(2) EGFP, fragment 7, was amplified using primers EcoRI-EGFP _ F and BamHI-EGFP _ R. The amplification method is PCR using PrimeSTAR polymerase reaction, and the reaction conditions are as follows: pre-denaturation at 98 deg.C for 3 min; performing denaturation at 98 ℃ for 15s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 1min for 30 cycles; finally, the temperature is kept at 72 ℃ for 5 min.
(3) Carrying out double enzyme digestion on the fragment 7 through enzyme digestion sites EcoRI and BamHI, and adding enzyme 1Quickcut into the systemTMBamHI, reacting at 30 ℃ for 30min, and adding enzyme 2QuickcutTMEcoRI, reacted at 37 ℃ for 30 min. The enzyme digestion product is subjected to column recovery to obtain a fragment 8, and the product column is purchased fromJiangsukang is a century biotech GmbH with the model of DNA Clean-up Kit. The double cleavage system is shown in Table 2.
TABLE 2 enzyme digestion System
(4) And (3) carrying out double enzyme digestion on pEC-XK99E-Ptac through enzyme digestion sites EcoRI and BamHI, wherein the reaction conditions are the same as those in the step (3), and the nucleic acid electrophoresis separation gel is used for recovering a large fragment (5494bp), namely the fragment 9.
(5) Fragments 9 and 8 were ligated in a molar ratio of 1:3 using a Ligation mix at 16 ℃ overnight. The enzyme linked system is shown in table 3. Ligation product was transformed into Escherichia coli JM109 and coated with LBB (Kan)+) The plate was incubated overnight at 37 ℃ to obtain transformants. Selecting a single colony of the transformant, culturing the single colony in a Kan-resistant LBB liquid culture medium at 37 ℃ overnight, and extracting plasmids to obtain pEC-XK99E-EGFP plasmids with the sequence shown in SEQ ID NO. 14.
TABLE 3 enzyme Linked systems
(6) Taking pEC-XK99E-EGFP plasmid as a template, obtaining a linear vector except pGA1 replicon by PCR, and obtaining a homologous sequence of 25bp or more with the replicon. Primers are designed into Plasmid _ F and Plasmid _ R, and the nucleotide sequences are shown as SEQ ID NO.15 and SEQ ID NO. 16. The obtained linear vector fragment 10(5494bp) has the sequence shown in SEQ ID NO. 17. The PCR reaction uses PFX polymerase, and the reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; performing denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 34 cycles; finally, the temperature is kept at 72 ℃ for 5 min.
(7) Homologous recombination is carried out on the fragment 10 and the fragment 6, the concentration ratio is required to be 1:3, and the reaction is carried out for 30min at 56 ℃. The homologous recombination system is shown in Table 4. The ligation product was transformed into Escherichia coli JM109, and plasmid pEC-XK99E-EGFP-Rep-T/S for constitutive expression of EGFP with the desired mutant replicon was obtained after the transfer culture, and the map was shown in FIG. 3.
TABLE 4 homologous recombination System
Example 3
Plasmid pEC-XK99E-EGFP-Rep-T/S copy ability test in C.glutamicum:
respectively transferring pEC-XK99E-EGFP and pEC-XK99E-EGFP-Rep-T/S plasmids into a corynebacterium glutamicum BZH001 wild strain, and the steps are as follows: (1) adding 5 mul of pEC-XK99E-EGFP and pEC-XK99E-EGFP-Rep-T/S plasmids into 100 mul of Corynebacterium glutamicum BZH001 competent cells, carrying out ice bath for 10min, and transferring into a frozen electric rotary cup; (2) twice 1800Kv electric shocks; (3) immediately adding into preheated LBHIS recovery medium at 46 deg.C, water bathing at 46 deg.C for 6min, and transferring into 30 deg.C shaking table for recovery culture for 2 hr; (4) spread on 30. mu.g/ml kanamycin-resistant LBHIS solid medium and cultured in an incubator at 30 ℃ for 24 hours.
Detecting the fluorescence value of the strain to reflect copy number, and the steps are as follows:
(1) initial OD of 0.2 was determined for 10mL LBB (Kan) of Corynebacterium glutamicum BZH001 containing pEC-XK99E-EGFP and pEC-XK99E-EGFP-Rep-T/S plasmids+) Fermentation is carried out in the culture medium. (2) Shaking culture at 30 deg.C for 12h and 24h, sampling at fixed point, and measuring fluorescence/OD600The results are shown in FIG. 6. FIG. 6 is a histogram of unit fluorescence values in performance tests plotted against Prism 9, CONTROL represents fluorescence/OD values of the plasmid before transformation, and 2-4, 2-6, 3-1, 3-2, 3-3 are parallel samples of the plasmid harboring the site-directed mutant replicon. The plasmid containing pEC-XK99E-EGFP-Rep-T/S can be read from the mapThe unit fluorescence intensity of the strain is 3-3.5 times of that of a strain containing pEC-XK99E-EGFP, and the result shows that the copy number of the plasmid is increased in a protein level and in a side face, and the plasmid can be used for producing protein.
The in vitro extraction of the plasmid of Corynebacterium glutamicum comprises the following steps:
(1) taking 1OD BZH001 bacterial solution with pEC-XK99E-EGFP and pEC-XK99E-EGFP-Rep-T/S plasmids, centrifuging at 12000rpm/min for 1min, discarding the supernatant, resuspending with PBS, and washing for three times. (2) mu.L of lysozyme (10mg/mL) was added and pretreated for one hour at 37 ℃. (3) Plasmid extraction was performed according to the plasmid extraction instruction of Jiangsukang, a century Biotechnology Ltd. (4) Plasmid yields were compared and the comparative data are shown in table 5.
TABLE 5 comparison data sheet of plasmid yields
The plasmid obtained by in vitro extraction of the strain containing pEC-XK99E-EGFP-Rep-T/S under the condition of fixed OD600 is 3.9 times that of the strain containing pEC-XK99E-EGFP, and the mutant plasmid is proved to be increased in plasmid level and copy number.
The total DNA of Corynebacterium glutamicum BZH001 was extracted according to the instructions of Jiangsukang, a century Biotechnology Co., Ltd.
The relative replication capacity of the plasmid is determined by a fluorescent quantitative PCR method, and the steps are as follows:
(1) the following primers were selected for fluorescent quantitative PCR to determine the increase in plasmid copy number for pEC-XK99E-EGFP-Rep-T/S relative to pEC-XK 99E-EGFP. The selected primers were:
primers for determination of endogenous DNA of C.glutamicum:
DNA_F:GGTCGATGACATCCAGTTCC
DNA_R:GCTTATCTGCCTGGTGCAAT
primers for determination of plasmid DNA:
Rep_F:TGGCATCTTTTAGGCGCTCA
Rep_R:TGCGAGTGCTCTGGACAAAT
(2) the reaction solution was prepared, and the contents of the reaction solution are shown in Table 6. Three replicates were set up for each sample and the DNA addition volume calculated to be not more than 1/10 of the total reaction volume, and the system was configured to avoid strong light exposure as much as possible. The PCR reaction conditions are as follows: pre-denaturation, reaction at 95 ℃ for 20 s; denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 20s, for 40 cycles. Dissolution curve measurement: 2min at 72 ℃; 15s at 95 ℃; 30s at 60 ℃; 95 ℃ for 15 s.
TABLE 6 reaction solution content
(3) The RT-PCR results are shown in FIG. 7, CONTROL represents the copy number of the plasmid before modification, and 2-4, 2-6, 3-1, 3-2 and 3-3 are parallel samples of the plasmid with site-directed mutant replicon. StepOneTMThe Real-Time PCR System software calculates the difference multiple among the groups, and the relative copy plasmid number of pEC-XK99E-EGFP-Rep-T/S is 8 times by comparing the difference multiple with the copy number of pEC-XK99E-EGFP, which shows that the mutated plasmid shows the difference of copy number at the transcription level. The copy number of the plasmid pEC-XK99E in Corynebacterium glutamicum is 30-35, and the copy number of pEC-XK99E-EGFP-Rep-T/S is calculated to be about 245.
The invention is based on pGA1 corynebacterium replicon in pEC-XK99E, namely a low copy plasmid replicon with copy number of about 30 in Corynebacterium glutamicum, and successfully obtains a replicon pGA1-Rep-I325T/S398 capable of improving the copy number of corynebacterium plasmid by mutating isoleucine at position 325 of replication protein Rep into threonine and changing amino acid coding serine at position 398 into synonymous codon. The replicon is used for constructing high-copy plasmids, and after the plasmid pEC-XK99E-Rep-T/S carrying pGA1-Rep-I325T/S398 replicon replicates in Corynebacterium glutamicum, plasmid in-vitro extraction proves that the number of plasmids in thalli is increased. pEC-XK99E-EGFP-Rep-T/S plasmids are constructed, and the fluorescence quantity is increased by three times compared with that of mutant plasmids by measuring the fluorescence values under different bacterial quantities, namely the modified plasmids improve the expression quantity of proteins. Meanwhile, the copy number after mutation is determined to be about 8 times of that of the wild replicon plasmid by a fluorescent quantitative PCR method, and the copy number is about 245.
It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.
Sequence listing
<110> university of south of the Yangtze river
<120> method for modifying corynebacterium replicon and product thereof
<141> 2021-08-22
<160> 19
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1696
<212> DNA
<213> Artificial Sequence
<400> 1
ccatcaatcc tgcctatttg ccacgtttaa caaggtagtt aagcgttcat ttacgaagaa 60
aacacgataa gctgcacaaa tacctgaaaa agttgaacgc cccgtgagcg ggaactcaca 120
gggcgtcggc taacccccag tcatcagctg ggagaaagca ctcaagacat gactctagcc 180
gatccgcagg acacagtcac agctagcgcg tggaaatttt ccgccgatct gttcgacacc 240
caccccgaac tagcgctgcg ctcacgcggc tggacggcag aagatcgccg cgaactgctc 300
gctcacctgg gacgcgaaag cttccagggc agcaagacaa gagatttcgc gagcgcctgg 360
attaaaaacc cggataccgg cgaaacccaa ccaaagctct accgggctgg ctcaaaagcg 420
ctgacgcggt gccagtacgt tgcgctgacg cacgcgcaac atgccgcggt gatcgtgctt 480
gacatcgatg tgcccagcca ccaggccggc gggaagattg agcacgtaaa cccgcaggtc 540
tacgcgattt tagagaaatg ggcacgccta gaaaaagcgc cggcttggat cggcgtgaat 600
ccgctgagcg ggaaatgcca gctcatctgg ctcattgacc cggtgtatgc cgcagcaggt 660
aaaaccagcc caaatatgcg cctgctggct gcaacgacgg aagaaatgac tcgtgttttc 720
ggcgctgacc aggctttttc gcataggctg agccggtggc cgctgcacgt ctcagacgat 780
ccgacagcct ataaatggca ctgccagcat gatcgtgtgg atcggctggc cgacctaatg 840
gagattgctc gaacgatgac cggatcacag aagccgaaaa agtacattga gcaggacttt 900
tccagcggac gcgcccgcat tgaagcggca caacgcgcca ccgcagaagc caaggcgcta 960
gcgattttgg acgcgagcct gccgagcgcc ctggacgcgt ccggcgacct gatcgacggc 1020
gtgcgagtgc tctggacaaa tccagagcgc gcagcgcgcg acgagaccgc gtttcgccac 1080
gcgttgaccg tgggatacca gctcaaagct gctggtgagc gcctaaaaga tgccaagatc 1140
atcgacgcgt atgaagtggc gtacaacgtt gcccaggcgg tcggtgcaga cggccgggag 1200
ccggatcttc ccgccatgcg tgatcgcctg acgatggcgc gtcgtgtgcg cggctacgtg 1260
gctaaaggcc agccagtcgt ccctgctcgt cgggtggaaa cgcagagcag ccgagggcgg 1320
aaagctctag cgacgatggg gcgacggggc gcagctacat cgaatgcacg cagatgggct 1380
gacccagaaa gtaagtatgc gcaggagacg cgacagcgat tagcggaagc aaacaaacgc 1440
cgagaaatga caggcgagtt gctcgaactt cgcgtcaaaa ctgcgatcct ggatgcccgt 1500
tctcaatcgg ttgctgatcc ctcgactcgt gagcttgcag gcgaactagg tgtcagtgaa 1560
aggcgcatcc aacaagtcag aaaggcactt ggaatggaag ctaaacgcgg ccgtccacgg 1620
gctgaaaact aataaacgaa acaccgtcag cagaaaacgg ttcccccctt taggggtccc 1680
gtccttgctc tggctc 1696
<210> 2
<211> 1696
<212> DNA
<213> Artificial Sequence
<400> 2
ccatcaatcc tgcctatttg ccacgtttaa caaggtagtt aagcgttcat ttacgaagaa 60
aacacgataa gctgcacaaa tacctgaaaa agttgaacgc cccgtgagcg ggaactcaca 120
gggcgtcggc taacccccag tcatcagctg ggagaaagca ctcaagacat gactctagcc 180
gatccgcagg acacagtcac agctagcgcg tggaaattgt ccgccgatct gttcgacacc 240
caccccgaag ctatgcgctg cggctcacgc ggctggacgg cagaagatcg ccgcgaactg 300
ctcgctcacc tgggacgcga aagcttccag ggcagcaaga caagagattt cgcgagcgcc 360
tggattaaaa acccggatac cggcgaaacc caaccaaagc tctaccgggc tggctcaaaa 420
gcgctgacgc ggtgccagta cgttgcgctg acgcacgcgc aacatgccgc ggtgatcgtg 480
cttgacatcg atgtgcccag ccaccaggcc ggcgggaaga ttgagcacgt aaacccgcag 540
gtctacgcga ttttagagaa atgggcacgc ctagaaaaag cgccggcttg gatcggcgtg 600
aatccgctga gcgggaaatg ccagctcatc tggctcattg acccggtgta tgccgcagca 660
ggtaaaacca gcccaaatat gcgcctgctg gctgcaacga cggaagaaat gactcgtgtt 720
ttcggcgctg accaggcttt ttcgcatagg ctgagccggt ggccgctgca cgtctcagac 780
gatccgacag cctataaatg gcactgccag catgatcgtg tggatcggct ggccgaccta 840
atggagattg ctcgaacgat gaccggatca cagaagccga aaaagtacat tgagcaggac 900
ttttccagcg gacgcgcccg cattgaagcg gcacaacgcg ccaccgcaga agccaaggcg 960
ctagcgattt tggacgcgag cctgccgagc gccctggacg cgtccggcga cctgatcgac 1020
ggcgtgcgag tgctctggac aaatccagag cgagcgcgcg acgagaccgc gtttcgccac 1080
gcgttgaccg tgggatacca gctcaaagct gctggtgagc gcctaaaaga tgccaagatc 1140
accgacgcgt atgaagtggc gtacaacgtt gcccaggcgg tcggtgcaga cggccgggag 1200
ccggatcttc ccgccatgcg tgatcgcctg acgatggcgc gtcgtgtgcg cggctacgtg 1260
gctaaaggcc agccagtcgt ccctgctcgt cgggtggaaa cgcagagcag ccgagggcgg 1320
aaagctctag cgacgatggg gcgacggggc gcagctacat caaatgcacg cagatgggct 1380
gacccagaaa gtaagtatgc gcaggagacg cgacagcgat tagcggaagc aaacaaacgc 1440
cgagaaatga caggcgagtt gctcgaactt cgcgtcaaaa ctgcgatcct ggatgcccgt 1500
tctcaatcgg ttgctgatcc ctcgactcgt gagcttgcag gcgaactagg tgtcagtgaa 1560
aggcgcatcc aacaagtcag aaaggcactt ggaatggaag ctaaacgcgg ccgtccacgg 1620
gctgaaaact aataaacgaa acaccgtcag cagaaaacgg ttcccccctt taggggtccc 1680
gtccttgctc tggctc 1696
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 3
cggagggtga gggcaagtga 20
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 4
cggcagcgtg aagctagatc c 21
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 5
cgcagctaca tcaaatgcac gcagat 26
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 6
atctgcgtgc atttgatgta gctgc 25
<210> 7
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 7
atgccaagat caccgacgcg tatgaa 26
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 8
tcatacgcgt cggtgatctt ggcat 25
<210> 9
<211> 367
<212> DNA
<213> Artificial Sequence
<400> 9
cggagggtga gggcaagtga gagccagagc aaggacggga cccctaaagg ggggaaccgt 60
tttctgctga cggtgtttcg tttattagtt ttcagcccgt ggacggccgc gtttagcttc 120
cattccaagt gcctttctga cttgttggat gcgcctttca ctgacaccta gttcgcctgc 180
aagctcacga gtcgagggat cagcaaccga ttgagaacgg gcatccagga tcgcagtttt 240
gacgcgaagt tcgagcaact cgcctgtcat ttctcggcgt ttgtttgctt ccgctaatcg 300
ctgtcgcgtc tcctgcgcat acttactttc tgggtcagcc catctgcgtg catttgatgt 360
agctgcg 367
<210> 10
<211> 246
<212> DNA
<213> Artificial Sequence
<400> 10
atctgcgtgc atttgatgta gctgcgcccc gtcgccccat cgtcgctaga gctttccgcc 60
ctcggctgct ctgcgtttcc acccgacgag cagggacgac tggctggcct ttagccacgt 120
agccgcgcac acgacgcgcc atcgtcaggc gatcacgcat ggcgggaaga tccggctccc 180
ggccgtctgc accgaccgcc tgggcaacgt tgtacgccac ttcatacgcg tcggtgatct 240
tggcat 246
<210> 11
<211> 1175
<212> DNA
<213> Artificial Sequence
<400> 11
tcatacgcgt cggtgatctt ggcatctttt aggcgctcac cagcagcttt gagctggtat 60
cccacggtca acgcgtggcg aaacgcggtc tcgtcgcgcg ctcgctctgg atttgtccag 120
agcactcgca cgccgtcgat caggtcgccg gacgcgtcca gggcgctcgg caggctcgcg 180
tccaaaatcg ctagcgcctt ggcttctgcg gtggcgcgtt gtgccgcttc aatgcgggcg 240
cgtccgctgg aaaagtcctg ctcaatgtac tttttcggct tctgtgatcc ggtcatcgtt 300
cgagcaatct ccattaggtc ggccagccga tccacacgat catgctggca gtgccattta 360
taggctgtcg gatcgtctga gacgtgcagc ggccaccggc tcagcctatg cgaaaaagcc 420
tggtcagcgc cgaaaacacg agtcatttct tccgtcgttg cagccagcag gcgcatattt 480
gggctggttt tacctgctgc ggcatacacc gggtcaatga gccagatgag ctggcatttc 540
ccgctcagcg gattcacgcc gatccaagcc ggcgcttttt ctaggcgtgc ccatttctct 600
aaaatcgcgt agacctgcgg gtttacgtgc tcaatcttcc cgccggcctg gtggctgggc 660
acatcgatgt caagcacgat caccgcggca tgttgcgcgt gcgtcagcgc aacgtactgg 720
caccgcgtca gcgcttttga gccagcccgg tagagctttg gttgggtttc gccggtatcc 780
gggtttttaa tccaggcgct cgcgaaatct cttgtcttgc tgccctggaa gctttcgcgt 840
cccaggtgag cgagcagttc gcggcgatct tctgccgtcc agccgcgtga gccgcagcgc 900
atagcttcgg ggtgggtgtc gaacagatcg gcggacaatt tccacgcgct agctgtgact 960
gtgtcctgcg gatcggctag agtcatgtct tgagtgcttt ctcccagctg atgactgggg 1020
gttagccgac gccctgtgag ttcccgctca cggggcgttc aactttttca ggtatttgtg 1080
cagcttatcg tgttttcttc gtaaatgaac gcttaactac cttgttaaac gtggcaaata 1140
ggcaggattg atggggatct agcttcacgc tgccg 1175
<210> 12
<211> 587
<212> DNA
<213> Artificial Sequence
<400> 12
cggagggtga gggcaagtga gagccagagc aaggacggga cccctaaagg ggggaaccgt 60
tttctgctga cggtgtttcg tttattagtt ttcagcccgt ggacggccgc gtttagcttc 120
cattccaagt gcctttctga cttgttggat gcgcctttca ctgacaccta gttcgcctgc 180
aagctcacga gtcgagggat cagcaaccga ttgagaacgg gcatccagga tcgcagtttt 240
gacgcgaagt tcgagcaact cgcctgtcat ttctcggcgt ttgtttgctt ccgctaatcg 300
ctgtcgcgtc tcctgcgcat acttactttc tgggtcagcc catctgcgtg catttgatgt 360
agctgcgccc cgtcgcccca tcgtcgctag agctttccgc cctcggctgc tctgcgtttc 420
cacccgacga gcagggacga ctggctggcc tttagccacg tagccgcgca cacgacgcgc 480
catcgtcagg cgatcacgca tggcgggaag atccggctcc cggccgtctg caccgaccgc 540
ctgggcaacg ttgtacgcca cttcatacgc gtcggtgatc ttggcat 587
<210> 13
<211> 1737
<212> DNA
<213> Artificial Sequence
<400> 13
cggagggtga gggcaagtga gagccagagc aaggacggga cccctaaagg ggggaaccgt 60
tttctgctga cggtgtttcg tttattagtt ttcagcccgt ggacggccgc gtttagcttc 120
cattccaagt gcctttctga cttgttggat gcgcctttca ctgacaccta gttcgcctgc 180
aagctcacga gtcgagggat cagcaaccga ttgagaacgg gcatccagga tcgcagtttt 240
gacgcgaagt tcgagcaact cgcctgtcat ttctcggcgt ttgtttgctt ccgctaatcg 300
ctgtcgcgtc tcctgcgcat acttactttc tgggtcagcc catctgcgtg catttgatgt 360
agctgcgccc cgtcgcccca tcgtcgctag agctttccgc cctcggctgc tctgcgtttc 420
cacccgacga gcagggacga ctggctggcc tttagccacg tagccgcgca cacgacgcgc 480
catcgtcagg cgatcacgca tggcgggaag atccggctcc cggccgtctg caccgaccgc 540
ctgggcaacg ttgtacgcca cttcatacgc gtcggtgatc ttggcatctt ttaggcgctc 600
accagcagct ttgagctggt atcccacggt caacgcgtgg cgaaacgcgg tctcgtcgcg 660
cgctcgctct ggatttgtcc agagcactcg cacgccgtcg atcaggtcgc cggacgcgtc 720
cagggcgctc ggcaggctcg cgtccaaaat cgctagcgcc ttggcttctg cggtggcgcg 780
ttgtgccgct tcaatgcggg cgcgtccgct ggaaaagtcc tgctcaatgt actttttcgg 840
cttctgtgat ccggtcatcg ttcgagcaat ctccattagg tcggccagcc gatccacacg 900
atcatgctgg cagtgccatt tataggctgt cggatcgtct gagacgtgca gcggccaccg 960
gctcagccta tgcgaaaaag cctggtcagc gccgaaaaca cgagtcattt cttccgtcgt 1020
tgcagccagc aggcgcatat ttgggctggt tttacctgct gcggcataca ccgggtcaat 1080
gagccagatg agctggcatt tcccgctcag cggattcacg ccgatccaag ccggcgcttt 1140
ttctaggcgt gcccatttct ctaaaatcgc gtagacctgc gggtttacgt gctcaatctt 1200
cccgccggcc tggtggctgg gcacatcgat gtcaagcacg atcaccgcgg catgttgcgc 1260
gtgcgtcagc gcaacgtact ggcaccgcgt cagcgctttt gagccagccc ggtagagctt 1320
tggttgggtt tcgccggtat ccgggttttt aatccaggcg ctcgcgaaat ctcttgtctt 1380
gctgccctgg aagctttcgc gtcccaggtg agcgagcagt tcgcggcgat cttctgccgt 1440
ccagccgcgt gagccgcagc gcatagcttc ggggtgggtg tcgaacagat cggcggacaa 1500
tttccacgcg ctagctgtga ctgtgtcctg cggatcggct agagtcatgt cttgagtgct 1560
ttctcccagc tgatgactgg gggttagccg acgccctgtg agttcccgct cacggggcgt 1620
tcaacttttt caggtatttg tgcagcttat cgtgttttct tcgtaaatga acgcttaact 1680
accttgttaa acgtggcaaa taggcaggat tgatggggat ctagcttcac gctgccg 1737
<210> 14
<211> 6214
<212> DNA
<213> Artificial Sequence
<400> 14
tgactctagc cgatccgcag gacacagtca cagctagcgc gtggaaattt tccgccgatc 60
tgttcgacac ccaccccgaa ctagcgctgc gctcacgcgg ctggacggca gaagatcgcc 120
gcgaactgct cgctcacctg ggacgcgaaa gcttccaggg cagcaagaca agagatttcg 180
cgagcgcctg gattaaaaac ccggataccg gcgaaaccca accaaagctc taccgggctg 240
gctcaaaagc gctgacgcgg tgccagtacg ttgcgctgac gcacgcgcaa catgccgcgg 300
tgatcgtgct tgacatcgat gtgcccagcc accaggccgg cgggaagatt gagcacgtaa 360
acccgcaggt ctacgcgatt ttagagaaat gggcacgcct agaaaaagcg ccggcttgga 420
tcggcgtgaa tccgctgagc gggaaatgcc agctcatctg gctcattgac ccggtgtatg 480
ccgcagcagg taaaaccagc ccaaatatgc gcctgctggc tgcaacgacg gaagaaatga 540
ctcgtgtttt cggcgctgac caggcttttt cgcataggct gagccggtgg ccgctgcacg 600
tctcagacga tccgacagcc tataaatggc actgccagca tgatcgtgtg gatcggctgg 660
ccgacctaat ggagattgct cgaacgatga ccggatcaca gaagccgaaa aagtacattg 720
agcaggactt ttccagcgga cgcgcccgca ttgaagcggc acaacgcgcc accgcagaag 780
ccaaggcgct agcgattttg gacgcgagcc tgccgagcgc cctggacgcg tccggcgacc 840
tgatcgacgg cgtgcgagtg ctctggacaa atccagagcg cgcagcgcgc gacgagaccg 900
cgtttcgcca cgcgttgacc gtgggatacc agctcaaagc tgctggtgag cgcctaaaag 960
atgccaagat catcgacgcg tatgaagtgg cgtacaacgt tgcccaggcg gtcggtgcag 1020
acggccggga gccggatctt cccgccatgc gtgatcgcct gacgatggcg cgtcgtgtgc 1080
gcggctacgt ggctaaaggc cagccagtcg tccctgctcg tcgggtggaa acgcagagca 1140
gccgagggcg gaaagctcta gcgacgatgg ggcgacgggg cgcagctaca tcgaatgcac 1200
gcagatgggc tgacccagaa agtaagtatg cgcaggagac gcgacagcga ttagcggaag 1260
caaacaaacg ccgagaaatg acaggcgagt tgctcgaact tcgcgtcaaa actgcgatcc 1320
tggatgcccg ttctcaatcg gttgctgatc cctcgactcg tgagcttgca ggcgaactag 1380
gtgtcagtga aaggcgcatc caacaagtca gaaaggcact tggaatggaa gctaaacgcg 1440
gccgtccacg ggctgaaaac taataaacga aacaccgtca gcagaaaacg gttcccccct 1500
ttaggggtcc cgtccttgct ctggctctca cttgccctca ccctccgcta tccacgggct 1560
gaaaactaat aaacgaaaca ccgtcagcag aaaacggttc cccccctcta gggtgtctcg 1620
ctcctagctc tgatccctcc ccggttcctc cccggcctga tttttaaggg ggctcacgct 1680
gtcggcagag aacggttccc ccgccttctg ctctggctct tcctcgactc cctccccctc 1740
aaaaatctcc tcgagatcct ggagagcttt ttggagctag cgcgttgctg cttcgcacca 1800
acttgctcat gatgattttc atttttgctt gtgtgctttt ttgggttgaa ccctccaaag 1860
aggggaaacc aggggcacac ctcatgcact aaagtgccgc ttcgctggtc agggtgaaat 1920
cacctggaaa aaaagtgcgg taaccgctgc gcttggcgtt ttttctgggc aagaagtctc 1980
gcaggttttc gcaggagtgc cggaagaaat tatcagaatt ggggctagaa tttttaacga 2040
acgttcgtta taatggtgtc atgaccttca cgacgaagta ccaaaactgg cctgaagcat 2100
cagcggtgga tctctccgat gtcgcgctgg agtccgacgc actcgatgcc gccgtcgatt 2160
taaaaacggt gatcggattt ttccgcgccc tcgatacgac agacgcgcca gcatcacgcg 2220
actgggcaag tgccgcgagc gacctagaaa cgcttgtggc cgaccttgaa gagctggccg 2280
acgagctgcg tgctcggcag cgccaggagg acgcgcagta gtggaggatc gcatcagctg 2340
cgcctactgc ggtggcctga tcccaccccg gcctgaccca cgaggacggc gcgcaaaata 2400
ctgctcagac gcgtgtcgtg ccgcagccag ccgcgagcgc gccaacaagc gccacgccca 2460
ggaggtcgaa gccgcacgtc atctagcgga attaattcat gagcggatac atatttgaat 2520
gtatttagaa aaataaacaa aagagtttgt agaaacgcaa aaaggccatc cgtcaggatg 2580
gccttctgct taatttgatg cctggcagtt tatggcgggc gtcctgcccg ccaccctccg 2640
ggccgtggct tcgcaacgtt caaatccgct cccggcggat ttgtcctact caggagagcg 2700
ttcaccgaca aacaacagat aaaacgaaag gcccagtctt tcgactgagc ctttcgtttt 2760
atttgatgcc tggcagttcc ctactctcgc atggggagac cccacactac catcggcgct 2820
acggcgtttc acttctgagt tcggcatggg gtcaggtggg accaccgcgc tactgccgcc 2880
aggcaaattc tgttttatca gaccgcttct gcgttctgat ttaatctgta tcaggctgaa 2940
aatcttctct catccgccaa aacagccaag cttgcatgcc tgcaggtcga ctctagagga 3000
tccttacttg tacagctcgt ccatgccgag agtgatcccg gcggcggtca cgaactccag 3060
caggaccatg tgatcgcgct tctcgttggg gtctttgctc agggcggact gggtgctcag 3120
gtagtggttg tcgggcagca gcacggggcc gtcgccgatg ggggtgttct gctggtagtg 3180
gtcggcgagc tgcacgctgc cgtcctcgat gttgtggcgg atcttgaagt tcaccttgat 3240
gccgttcttc tgcttgtcgg ccatgatata gacgttgtgg ctgttgtagt tgtactccag 3300
cttgtgcccc aggatgttgc cgtcctcctt gaagtcgatg cccttcagct cgatgcggtt 3360
caccagggtg tcgccctcga acttcacctc ggcgcgggtc ttgtagttgc cgtcgtcctt 3420
gaagaagatg gtgcgctcct ggacgtagcc ttcgggcatg gcggacttga agaagtcgtg 3480
ctgcttcatg tggtcggggt agcggctgaa gcactgcacg ccgtaggtca gggtggtcac 3540
gagggtgggc cagggcacgg gcagcttgcc ggtggtgcag atgaacttca gggtcagctt 3600
gccgtaggtg gcatcgccct cgccctcgcc ggacacgctg aacttgtggc cgtttacgtc 3660
gccgtccagc tcgaccagga tgggcaccac cccggtgaac agctcctcgc ccttgctcac 3720
cattagttgt cctcctttga attctaatta attctgtttc ctgtgtgaaa ttgttatccg 3780
ctcacaattc cacacattat acgagccgat gattaattgt caacagctca tttcagaata 3840
tttgccagaa ccgttatgat gtcggcgcaa aaaacattat ccagaacggg agtgcgcctt 3900
gagcgacacg aattatgcag tgatttacga cctgcacagc cataccacag cttccgatgg 3960
ctcatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct 4020
cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 4080
cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 4140
acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 4200
ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 4260
ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 4320
gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 4380
gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 4440
ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 4500
actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 4560
gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 4620
ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 4680
ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 4740
gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 4800
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 4860
tcatgattcc gcgaacccca gagtcccgct cagaagaact cgtcaagaag gcgatagaag 4920
gcgatgcgct gcgaatcggg agcggcgata ccgtaaagca cgaggaagcg gtcagcccat 4980
tcgccgccaa gctcttcagc aatatcacgg gtagccaacg ctatgtcctg atagcggtcc 5040
gccacaccca gccggccaca gtcgatgaat ccagaaaagc ggccattttc caccatgata 5100
ttcggcaagc aggcatcgcc atgggtcacg acgagatcct cgccgtcggg catccgcgcc 5160
ttgagcctgg cgaacagttc ggctggcgcg agcccctgat gctcttcgtc cagatcatcc 5220
tgatcgacaa gaccggcttc catccgagta cgtgctcgct cgatgcgatg tttcgcttgg 5280
tggtcgaatg ggcaggtagc cggatcaagc gtatgcagcc gccgcattgc atcagccatg 5340
atggatactt tctcggcagg agcaaggtga gatgacagga gatcctgccc cggcacttcg 5400
cccaatagca gccagtccct tcccgcttca gtgacaacgt cgagcacagc tgcgcaagga 5460
acgcccgtcg tggccagcca cgatagccgc gctgcctcgt cttggagttc attcagggca 5520
ccggacaggt cggtcttgac aaaaagaacc gggcgcccct gcgctgacag ccggaacacg 5580
gcggcatcag agcagccgat tgtctgttgt gcccagtcat agccgaatag cctctccacc 5640
caagcggccg gagaacctgc gtgcaatcca tcttgttcaa tcatgcgaaa cgatcctcat 5700
cctgtctctt gatcagatct tgatcccctg cgccatcaga tccttggcgg caagaaagcc 5760
atccagttta ctttgcaggg cttcccaacc ttaccagagg gcgccccagc tggcaattcc 5820
ggttcgcttg ctgtccataa aaccgcccag tctagctatc gccatgtaag cccactgcaa 5880
gctacctgct ttctctttgc gcttgcgttt tcccttgtcc agatagccca gtagctgaca 5940
ttcatccggg gtcagcaccg tttctgcgga ctggctttct acgtgttccg cttcctttag 6000
cagcccttgc gccctgagtg cttgcggcag cgtgaagcta gatccccatc aatcctgcct 6060
atttgccacg tttaacaagg tagttaagcg ttcatttacg aagaaaacac gataagctgc 6120
acaaatacct gaaaaagttg aacgccccgt gagcgggaac tcacagggcg tcggctaacc 6180
cccagtcatc agctgggaga aagcactcaa gaca 6214
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 15
ggatctagct tcacgctgcc g 21
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 16
tcacttgccc tcaccctccg 20
<210> 17
<211> 4519
<212> DNA
<213> Artificial Sequence
<400> 17
ggatctagct tcacgctgcc gcaagcactc agggcgcaag ggctgctaaa ggaagcggaa 60
cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg atgaatgtca gctactgggc 120
tatctggaca agggaaaacg caagcgcaaa gagaaagcag gtagcttgca gtgggcttac 180
atggcgatag ctagactggg cggttttatg gacagcaagc gaaccggaat tgccagctgg 240
ggcgccctct ggtaaggttg ggaagccctg caaagtaaac tggatggctt tcttgccgcc 300
aaggatctga tggcgcaggg gatcaagatc tgatcaagag acaggatgag gatcgtttcg 360
catgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg agaggctatt 420
cggctatgac tgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtc 480
agcgcagggg cgcccggttc tttttgtcaa gaccgacctg tccggtgccc tgaatgaact 540
ccaagacgag gcagcgcggc tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt 600
gctcgacgtt gtcactgaag cgggaaggga ctggctgcta ttgggcgaag tgccggggca 660
ggatctcctg tcatctcacc ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat 720
gcggcggctg catacgcttg atccggctac ctgcccattc gaccaccaag cgaaacatcg 780
catcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatg atctggacga 840
agagcatcag gggctcgcgc cagccgaact gttcgccagg ctcaaggcgc ggatgcccga 900
cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg ccgaatatca tggtggaaaa 960
tggccgcttt tctggattca tcgactgtgg ccggctgggt gtggcggacc gctatcagga 1020
catagcgttg gctacccgtg atattgctga agagcttggc ggcgaatggg ctgaccgctt 1080
cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc atcgccttct atcgccttct 1140
tgacgagttc ttctgagcgg gactctgggg ttcgcggaat catgaccaaa atcccttaac 1200
gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 1260
atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 1320
tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 1380
gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 1440
actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 1500
gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 1560
agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 1620
ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 1680
aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 1740
cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 1800
gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 1860
cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt cctgcgttat 1920
cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca 1980
gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc ctgatgcggt 2040
attttctcct tacgcatctg tgcggtattt cacaccgcat atgagccatc ggaagctgtg 2100
gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt 2160
tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc 2220
tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca 2280
cacaggaaac agaattaatt agaattcaaa ggaggacaac taatggtgag caagggcgag 2340
gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt aaacggccac 2400
aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct gaccctgaag 2460
ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac caccctgacc 2520
tacggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga cttcttcaag 2580
tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga cgacggcaac 2640
tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg catcgagctg 2700
aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga gtacaactac 2760
aacagccaca acgtctatat catggccgac aagcagaaga acggcatcaa ggtgaacttc 2820
aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta ccagcagaac 2880
acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag cacccagtcc 2940
gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc 3000
gccgccggga tcactctcgg catggacgag ctgtacaagt aaggatcctc tagagtcgac 3060
ctgcaggcat gcaagcttgg ctgttttggc ggatgagaga agattttcag cctgatacag 3120
attaaatcag aacgcagaag cggtctgata aaacagaatt tgcctggcgg cagtagcgcg 3180
gtggtcccac ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt 3240
gtggggtctc cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca 3300
gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc tcctgagtag 3360
gacaaatccg ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc 3420
aggacgcccg ccataaactg ccaggcatca aattaagcag aaggccatcc tgacggatgg 3480
cctttttgcg tttctacaaa ctctttttgt ttatttttct aaatacattc aaatatgtat 3540
ccgctcatga attaattccg ctagatgacg tgcggcttcg acctcctggg cgtggcgctt 3600
gttggcgcgc tcgcggctgg ctgcggcacg acacgcgtct gagcagtatt ttgcgcgccg 3660
tcctcgtggg tcaggccggg gtgggatcag gccaccgcag taggcgcagc tgatgcgatc 3720
ctccactact gcgcgtcctc ctggcgctgc cgagcacgca gctcgtcggc cagctcttca 3780
aggtcggcca caagcgtttc taggtcgctc gcggcacttg cccagtcgcg tgatgctggc 3840
gcgtctgtcg tatcgagggc gcggaaaaat ccgatcaccg tttttaaatc gacggcggca 3900
tcgagtgcgt cggactccag cgcgacatcg gagagatcca ccgctgatgc ttcaggccag 3960
ttttggtact tcgtcgtgaa ggtcatgaca ccattataac gaacgttcgt taaaaattct 4020
agccccaatt ctgataattt cttccggcac tcctgcgaaa acctgcgaga cttcttgccc 4080
agaaaaaacg ccaagcgcag cggttaccgc actttttttc caggtgattt caccctgacc 4140
agcgaagcgg cactttagtg catgaggtgt gcccctggtt tcccctcttt ggagggttca 4200
acccaaaaaa gcacacaagc aaaaatgaaa atcatcatga gcaagttggt gcgaagcagc 4260
aacgcgctag ctccaaaaag gtctccagga tctcgaggag atttttgagg gggagggagt 4320
cgaggaagag ccagagcaga aggcggggaa ccgttctctg ccgacagcgt gagcccccct 4380
taaaaatcag gccggggagg aaccggggag ggatcagagc taggagcgag acaccctaaa 4440
gggggggaac cgttttctgc tgacggtgtt tcgtttatta gttttcagcc cgtggatagc 4500
ggagggtgag ggcaagtga 4519
<210> 18
<211> 5495
<212> DNA
<213> Artificial Sequence
<400> 18
tgactctagc cgatccgcag gacacagtca cagctagcgc gtggaaattt tccgccgatc 60
tgttcgacac ccaccccgaa ctagcgctgc gctcacgcgg ctggacggca gaagatcgcc 120
gcgaactgct cgctcacctg ggacgcgaaa gcttccaggg cagcaagaca agagatttcg 180
cgagcgcctg gattaaaaac ccggataccg gcgaaaccca accaaagctc taccgggctg 240
gctcaaaagc gctgacgcgg tgccagtacg ttgcgctgac gcacgcgcaa catgccgcgg 300
tgatcgtgct tgacatcgat gtgcccagcc accaggccgg cgggaagatt gagcacgtaa 360
acccgcaggt ctacgcgatt ttagagaaat gggcacgcct agaaaaagcg ccggcttgga 420
tcggcgtgaa tccgctgagc gggaaatgcc agctcatctg gctcattgac ccggtgtatg 480
ccgcagcagg taaaaccagc ccaaatatgc gcctgctggc tgcaacgacg gaagaaatga 540
ctcgtgtttt cggcgctgac caggcttttt cgcataggct gagccggtgg ccgctgcacg 600
tctcagacga tccgacagcc tataaatggc actgccagca tgatcgtgtg gatcggctgg 660
ccgacctaat ggagattgct cgaacgatga ccggatcaca gaagccgaaa aagtacattg 720
agcaggactt ttccagcgga cgcgcccgca ttgaagcggc acaacgcgcc accgcagaag 780
ccaaggcgct agcgattttg gacgcgagcc tgccgagcgc cctggacgcg tccggcgacc 840
tgatcgacgg cgtgcgagtg ctctggacaa atccagagcg cgcagcgcgc gacgagaccg 900
cgtttcgcca cgcgttgacc gtgggatacc agctcaaagc tgctggtgag cgcctaaaag 960
atgccaagat catcgacgcg tatgaagtgg cgtacaacgt tgcccaggcg gtcggtgcag 1020
acggccggga gccggatctt cccgccatgc gtgatcgcct gacgatggcg cgtcgtgtgc 1080
gcggctacgt ggctaaaggc cagccagtcg tccctgctcg tcgggtggaa acgcagagca 1140
gccgagggcg gaaagctcta gcgacgatgg ggcgacgggg cgcagctaca tcgaatgcac 1200
gcagatgggc tgacccagaa agtaagtatg cgcaggagac gcgacagcga ttagcggaag 1260
caaacaaacg ccgagaaatg acaggcgagt tgctcgaact tcgcgtcaaa actgcgatcc 1320
tggatgcccg ttctcaatcg gttgctgatc cctcgactcg tgagcttgca ggcgaactag 1380
gtgtcagtga aaggcgcatc caacaagtca gaaaggcact tggaatggaa gctaaacgcg 1440
gccgtccacg ggctgaaaac taataaacga aacaccgtca gcagaaaacg gttcccccct 1500
ttaggggtcc cgtccttgct ctggctctca cttgccctca ccctccgcta tccacgggct 1560
gaaaactaat aaacgaaaca ccgtcagcag aaaacggttc cccccctcta gggtgtctcg 1620
ctcctagctc tgatccctcc ccggttcctc cccggcctga tttttaaggg ggctcacgct 1680
gtcggcagag aacggttccc ccgccttctg ctctggctct tcctcgactc cctccccctc 1740
aaaaatctcc tcgagatcct ggagagcttt ttggagctag cgcgttgctg cttcgcacca 1800
acttgctcat gatgattttc atttttgctt gtgtgctttt ttgggttgaa ccctccaaag 1860
aggggaaacc aggggcacac ctcatgcact aaagtgccgc ttcgctggtc agggtgaaat 1920
cacctggaaa aaaagtgcgg taaccgctgc gcttggcgtt ttttctgggc aagaagtctc 1980
gcaggttttc gcaggagtgc cggaagaaat tatcagaatt ggggctagaa tttttaacga 2040
acgttcgtta taatggtgtc atgaccttca cgacgaagta ccaaaactgg cctgaagcat 2100
cagcggtgga tctctccgat gtcgcgctgg agtccgacgc actcgatgcc gccgtcgatt 2160
taaaaacggt gatcggattt ttccgcgccc tcgatacgac agacgcgcca gcatcacgcg 2220
actgggcaag tgccgcgagc gacctagaaa cgcttgtggc cgaccttgaa gagctggccg 2280
acgagctgcg tgctcggcag cgccaggagg acgcgcagta gtggaggatc gcatcagctg 2340
cgcctactgc ggtggcctga tcccaccccg gcctgaccca cgaggacggc gcgcaaaata 2400
ctgctcagac gcgtgtcgtg ccgcagccag ccgcgagcgc gccaacaagc gccacgccca 2460
ggaggtcgaa gccgcacgtc atctagcgga attaattcat gagcggatac atatttgaat 2520
gtatttagaa aaataaacaa aagagtttgt agaaacgcaa aaaggccatc cgtcaggatg 2580
gccttctgct taatttgatg cctggcagtt tatggcgggc gtcctgcccg ccaccctccg 2640
ggccgtggct tcgcaacgtt caaatccgct cccggcggat ttgtcctact caggagagcg 2700
ttcaccgaca aacaacagat aaaacgaaag gcccagtctt tcgactgagc ctttcgtttt 2760
atttgatgcc tggcagttcc ctactctcgc atggggagac cccacactac catcggcgct 2820
acggcgtttc acttctgagt tcggcatggg gtcaggtggg accaccgcgc tactgccgcc 2880
aggcaaattc tgttttatca gaccgcttct gcgttctgat ttaatctgta tcaggctgaa 2940
aatcttctct catccgccaa aacagccaag cttgcatgcc tgcaggtcga ctctagagga 3000
tccccgggta ccgagctcga attctaatta attctgtttc ctgtgtgaaa ttgttatccg 3060
ctcacaattc cacacattat acgagccgat gattaattgt caacagctca tttcagaata 3120
tttgccagaa ccgttatgat gtcggcgcaa aaaacattat ccagaacggg agtgcgcctt 3180
gagcgacacg aattatgcag tgatttacga cctgcacagc cataccacag cttccgatgg 3240
ctcatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct 3300
cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 3360
cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 3420
acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 3480
ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 3540
ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc 3600
gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 3660
gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 3720
ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 3780
actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 3840
gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 3900
ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 3960
ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 4020
gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 4080
tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 4140
tcatgattcc gcgaacccca gagtcccgct cagaagaact cgtcaagaag gcgatagaag 4200
gcgatgcgct gcgaatcggg agcggcgata ccgtaaagca cgaggaagcg gtcagcccat 4260
tcgccgccaa gctcttcagc aatatcacgg gtagccaacg ctatgtcctg atagcggtcc 4320
gccacaccca gccggccaca gtcgatgaat ccagaaaagc ggccattttc caccatgata 4380
ttcggcaagc aggcatcgcc atgggtcacg acgagatcct cgccgtcggg catccgcgcc 4440
ttgagcctgg cgaacagttc ggctggcgcg agcccctgat gctcttcgtc cagatcatcc 4500
tgatcgacaa gaccggcttc catccgagta cgtgctcgct cgatgcgatg tttcgcttgg 4560
tggtcgaatg ggcaggtagc cggatcaagc gtatgcagcc gccgcattgc atcagccatg 4620
atggatactt tctcggcagg agcaaggtga gatgacagga gatcctgccc cggcacttcg 4680
cccaatagca gccagtccct tcccgcttca gtgacaacgt cgagcacagc tgcgcaagga 4740
acgcccgtcg tggccagcca cgatagccgc gctgcctcgt cttggagttc attcagggca 4800
ccggacaggt cggtcttgac aaaaagaacc gggcgcccct gcgctgacag ccggaacacg 4860
gcggcatcag agcagccgat tgtctgttgt gcccagtcat agccgaatag cctctccacc 4920
caagcggccg gagaacctgc gtgcaatcca tcttgttcaa tcatgcgaaa cgatcctcat 4980
cctgtctctt gatcagatct ttgatcccct gcgccatcag atccttggcg gcaagaaagc 5040
catccagttt actttgcagg gcttcccaac cttaccagag ggcgccccag ctggcaattc 5100
cggttcgctt gctgtccata aaaccgccca gtctagctat cgccatgtaa gcccactgca 5160
agctacctgc tttctctttg cgcttgcgtt ttcccttgtc cagatagccc agtagctgac 5220
attcatccgg ggtcagcacc gtttctgcgg actggctttc tacgtgttcc gcttccttta 5280
gcagcccttg cgccctgagt gcttgcggca gcgtgaagct agatccccat caatcctgcc 5340
tatttgccac gtttaacaag gtagttaagc gttcatttac gaagaaaaca cgataagctg 5400
cacaaatacc tgaaaaagtt gaacgccccg tgagcgggaa ctcacagggc gtcggctaac 5460
ccccagtcat cagctgggag aaagcactca agaca 5495
<210> 19
<211> 5322
<212> DNA
<213> Artificial Sequence
<400> 19
tcacttgccc tcaccctccg ctatccacgg gctgaaaact aataaacgaa acaccgtcag 60
cagaaaacgg ttccccccct ttagggtgtc tcgctcctag ctctgatccc tccccggttc 120
ctccccggcc tgatttttaa ggggggctca cgctgtcggc agagaacggt tccccgcctt 180
ctgctctggc tcttcctcga ctccctcccc ctcaaaaatc tcctcgagat cctggagacc 240
tttttggagc tagcgcgttg ctgcttcgca ccaacttgct catgatgatt ttcatttttg 300
cttgtgtgct tttttgggtt gaaccctcca aagaggggaa accaggggca cacctcatgc 360
actaaagtgc cgcttcgctg gtcagggtga aatcacctgg aaaaaaagtg cggtaaccgc 420
tgcgcttggc gttttttctg ggcaagaagt ctcgcaggtt ttcgcaggag tgccggaaga 480
aattatcaga attggggcta gaatttttaa cgaacgttcg ttataatggt gtcatgacct 540
tcacgacgaa gtaccaaaac tggcctgaag catcagcggt ggatctctcc gatgtcgcgc 600
tggagtccga cgcactcgat gccgccgtcg atttaaaaac ggtgatcgga tttttccgcg 660
ccctcgatac gacagacgcg ccagcatcac gcgactgggc aagtgccgcg agcgacctag 720
aaacgcttgt ggccgacctt gaagagctgg ccgacgagct gcgtgctcgg cagcgccagg 780
aggacgcgca gtagtggagg atcgcatcag ctgcgcctac tgcggtggcc tgatcccacc 840
ccggcctgac ccacgaggac ggcgcgcaaa atactgctca gacgcgtgtc gtgccgcagc 900
cagccgcgag cgcgccaaca agcgccacgc ccaggaggtc gaagccgcac gtcatctagc 960
ggaattaatt catgagcgga tacatatttg aatgtattta gaaaaataaa caaaaagagt 1020
ttgtagaaac gcaaaaaggc catccgtcag gatggccttc tgcttaattt gatgcctggc 1080
agtttatggc gggcgtcctg cccgccaccc tccgggccgt tgcttcgcaa cgttcaaatc 1140
cgctcccggc ggatttgtcc tactcaggag agcgttcacc gacaaacaac agataaaacg 1200
aaaggcccag tctttcgact gagcctttcg ttttatttga tgcctggcag ttccctactc 1260
tcgcatgggg agaccccaca ctaccatcgg cgctacggcg tttcacttct gagttcggca 1320
tggggtcagg tgggaccacc gcgctactgc cgccaggcaa attctgtttt atcagaccgc 1380
ttctgcgttc tgatttaatc tgtatcaggc tgaaaatctt ctctcatccg ccaaaacagc 1440
caagcttgca tgcctgcagg tcgactctag aggatccccg ggtaccgagc tcgaattcca 1500
tggtctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacatta tacgagccgg 1560
atgattaatt gtcaacagct catttcagaa tatttgccag aaccgttatg atgtcggcgc 1620
aaaaaacatt atccagaacg ggagtgcgcc ttgagcgaca cgaattatgc agtgatttac 1680
gacctgcaca gccataccac agcttccgat ggctgcctga cgccagaagc attggtgcac 1740
cgtgcagtcg atgataagct gtcaaaccag atcaattcgc gctaactcac attaattgcg 1800
ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc 1860
ggccaacgcg cggggagagg cggtttgcgt attgggcgcc agggtggttt ttcttttcac 1920
cagtgagacg ggcaacagct gattgccctt caccgcctgg ccctgagaga gttgcagcaa 1980
gcggtccacg ctggtttgcc ccagcaggcg aaaatcctgt ttgatggtgg ttgacggcgg 2040
gatataacat gagctgtctt cggtatcgtc gtatcccact accgagatat ccgcaccaac 2100
gcgcagcccg gactcggtaa tggcgcgcat tgcgcccagc gccatctgat cgttggcaac 2160
cagcatcgca gtgggaacga tgccctcatt cagcatttgc atggtttgtt gaaaaccgga 2220
catggcactc cagtcgcctt cccgttccgc tatcggctga atttgattgc gagtgagata 2280
tttatgccag ccagccagac gcagacgcgc cgagacagaa cttaatgggc ccgctaacag 2340
cgcgatttgc tggtgaccca atgcgaccag atgctccacg cccagtcgcg taccgtcttc 2400
atgggagaaa ataatactgt tgatgggtgt ctggtcagag acatcaagaa ataacgccgg 2460
aacattagtg caggcagctt ccacagcaat ggcatcctgg tcatccagcg gatagttaat 2520
gatcagccca ctgacgcgtt gcgcgagaag attgtgcacc gccgctttac aggcttcgac 2580
gccgcttcgt tctaccatcg acaccaccac gctggcaccc agttgatcgg cgcgagattt 2640
aatcgccgcg acaatttgcg acggcgcgtg cagggccaga ctggaggtgg caacgccaat 2700
cagcaacgac tgtttgcccg ccagttgttg tgccacgcgg ttgggaatgt aattcagctc 2760
cgccatcgcc gcttccactt tttcccgcgt tttcgcagaa acgtggctgg cctggttcac 2820
cacgcgggaa acggtctgat aagagacacc ggcatactct gcgacatcgt ataacgttac 2880
tggtttcaca ttcaccaccc tgaattgact ctcttccggg cgctatcatg ccataccgcg 2940
aaaggttttg caccattcga tggtgtcaac gtaaatgcat gccgcttcgc cttcgcgcgc 3000
gaattgatct gctgcctcgc gcgtttcggt gatgacggtg aaaacctctg acacatgcag 3060
ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag 3120
ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc acgtagcgat 3180
agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg agagtgcacc 3240
atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcgctctt 3300
ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag 3360
ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca 3420
tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 3480
tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 3540
gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 3600
ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 3660
tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 3720
agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 3780
atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 3840
acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta 3900
actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct 3960
tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt 4020
tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga 4080
tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca 4140
tgattccgcg aaccccagag tcccgctcag aagaactcgt caagaaggcg atagaaggcg 4200
atgcgctgcg aatcgggagc ggcgataccg taaagcacga ggaagcggtc agcccattcg 4260
ccgccaagct cttcagcaat atcacgggta gccaacgcta tgtcctgata gcggtccgcc 4320
acacccagcc ggccacagtc gatgaatcca gaaaagcggc cattttccac catgatattc 4380
ggcaagcagg catcgccatg ggtcacgacg agatcctcgc cgtcgggcat ccgcgccttg 4440
agcctggcga acagttcggc tggcgcgagc ccctgatgct cttcgtccag atcatcctga 4500
tcgacaagac cggcttccat ccgagtacgt gctcgctcga tgcgatgttt cgcttggtgg 4560
tcgaatgggc aggtagccgg atcaagcgta tgcagccgcc gcattgcatc agccatgatg 4620
gatactttct cggcaggagc aaggtgagat gacaggagat cctgccccgg cacttcgccc 4680
aatagcagcc agtcccttcc cgcttcagtg acaacgtcga gcacagctgc gcaaggaacg 4740
cccgtcgtgg ccagccacga tagccgcgct gcctcgtctt ggagttcatt cagggcaccg 4800
gacaggtcgg tcttgacaaa aagaaccggg cgcccctgcg ctgacagccg gaacacggcg 4860
gcatcagagc agccgattgt ctgttgtgcc cagtcatagc cgaatagcct ctccacccaa 4920
gcggccggag aacctgcgtg caatccatct tgttcaatca tgcgaaacga tcctcatcct 4980
gtctcttgat cagatcttga tcccctgcgc catcagatcc ttggcggcaa gaaagccatc 5040
cagtttactt tgcagggctt cccaacctta ccagagggcg ccccagctgg caattccggt 5100
tcgcttgctg tccataaaac cgcccagtct agctatcgcc atgtaagccc actgcaagct 5160
acctgctttc tctttgcgct tgcgttttcc cttgtccaga tagcccagta gctgacattc 5220
atccggggtc agcaccgttt ctgcggactg gctttctacg tgttccgctt cctttagcag 5280
cccttgcgcc ctgagtgctt gcggcagcgt gaagctagat cc 5322
- 上一篇：一种医用注射器针头装配设备
- 下一篇：菌株及其发酵生产麦角生物碱的应用