阅读说明：本技术 双特异性抗体 (Bispecific antibodies ) 是由 P·S·甘地 J·布莱恩霍尔特 H·奥斯特加德 于 2020-04-15 设计创作，主要内容包括：本发明涉及包含能够结合因子VII(a)的第一抗原结合位点和能够结合TLT-1的第二抗原结合位点的双特异性抗体、包含此类双特异性抗体的药物制剂及其用途。(The present invention relates to bispecific antibodies comprising a first antigen-binding site capable of binding to factor vii (a) and a second antigen-binding site capable of binding to TLT-1, pharmaceutical preparations comprising such bispecific antibodies and uses thereof.)

1. A bispecific antibody comprising

(i) A first antigen-binding site capable of binding factor VII (a), and

(ii) a second antigen binding site capable of binding to TREM-like transcript 1 (TLT-1).

2. The bispecific antibody of claim 1, wherein the antibody comprises an Fc region.

3. The bispecific antibody according to claim 1 or 2, wherein the first antigen-binding site competes for binding to fvii (a) with any one of the anti-fvii (a) antibodies comprising a light chain variable domain (VL) and a heavy chain variable domain (VH) as shown below:

mAb0522 (VL: SEQ ID NO:846 and VH: SEQ ID NO:850),

fab0883 (VL: SEQ ID NO:814 and VH: SEQ ID NO:818),

mAb0005 (VL: SEQ ID NO:750 and VH: SEQ ID NO:754),

mAb0004 (VL: SEQ ID NO:14 and VH: SEQ ID NO:18),

mAb0013 (VL: SEQ ID NO:46 and VH: SEQ ID NO:50),

mAb0018 (VL: SEQ ID NO:62 and VH: SEQ ID NO:66),

mAb0544 (VL: SEQ ID NO:694 and VH: SEQ ID NO:698),

mAb0552 (VL: SEQ ID NO:702 and VH: SEQ ID NO:706),

mAb0001 (VL: SEQ ID NO:710 and VH: SEQ ID NO:714),

mAb0007 (VL: SEQ ID NO:718 and VH: SEQ ID NO:722),

mAb0578 (VL: SEQ ID NO:726 and VH: SEQ ID NO:730),

mAb0701 (VL: SEQ ID NO:734 and VH: SEQ ID NO:738), and

mAb0587 (VL: SEQ ID NO:742 and VH: SEQ ID NO: 746).

4. The bispecific antibody of claim 1 or 2, wherein the first antigen-binding site is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of fvii (a) (SEQ ID NO: 1).

5. The bispecific antibody of claim 1 or 2, wherein the first antigen-binding site is capable of binding to an epitope comprising the following amino acid residues of fvii (a) (SEQ ID NO: 1): r113, C114, H115, E116, G117, Y118, S119, L120, T130, V131, N184, T185, P251, V252, V253, Q388, M391 and R392.

6. The bispecific antibody of claim 1 or 2, wherein the first antigen-binding site comprises:

CDRL1 represented by amino acid residue RASQGISDYLH (SEQ ID NO:847) having 0, 1, 2 or 3 amino acid substitutions

CDRL2 represented by amino acid residue YTSQPAT (SEQ ID NO:848) having 0, 1, 2 or 3 amino acid substitutions

CDRL3 represented by amino acid residue QNGHSFPLT (SEQ ID NO:849) having 0, 1 or 2 amino acid substitutions

CDRH1 represented by the amino acid residue SDSAWS (SEQ ID NO:851),

CDRH2 represented by amino acid residue YIQYSGST NYNPSLKS (SEQ ID NO:852) having 0 or 1 amino acid substitution

CDRH3, represented by amino acid residue SVNYYGNSFAVGY (SEQ ID NO:853), having 0, 1, 2 and 3 amino acid substitutions.

7. The bispecific antibody of claim 1 or 2, wherein the first antigen-binding site comprises a light chain variable domain represented by SEQ ID NO 846 and a heavy chain variable domain represented by SEQ ID NO 850.

8. The bispecific antibody of claim 1 or 2, wherein the second antigen-binding site competes for binding to TLT-1 with any one of the anti-TLT-1 antibodies comprising a light chain variable domain (VL) and a heavy chain variable domain (VH) as shown below:

mAb0524 (VL: SEQ ID NO:854 and VH: SEQ ID NO:858),

mAb0012 (VL: SEQ ID NO:862 and VH: SEQ ID NO:866),

mAb0023 (VL: SEQ ID NO:870 and VH: SEQ ID NO:874),

mAb0051 (VL: SEQ ID NO:878 and VH: SEQ ID NO:882), and

mAb0062 (VL: SEQ ID NO:894 and VH: SEQ ID NO: 898).

9. The bispecific antibody of claim 1 or 2, wherein the second antigen-binding site is capable of binding to an epitope comprising the following amino acid residues of TLT-1(SEQ ID NO: 13): k8, I9, G10, S11, L12, A13, N15, A16, F17, S18, D19, P20 and A21.

10. The bispecific antibody of claim 1 or 2, wherein the second antigen-binding site comprises:

CDRL1 represented by SEQ ID NO:855,

CDRL2 represented by SEQ ID NO:856,

CDRL3 represented by SEQ ID NO:857,

CDRH1 represented by SEQ ID NO:859,

CDRH2 represented by SEQ ID NO:860,

CDRH3 as represented by SEQ ID NO: 861.

11. The bispecific antibody of claim 1 or 2, wherein the second antigen-binding site is comprised in a light chain variable domain represented by SEQ ID NO 854 and a heavy chain variable domain represented by SEQ ID NO 858.

12. The bispecific antibody of claim 1, wherein the first antigen-binding site comprises a light chain variable domain represented by SEQ ID NO 846 and a heavy chain variable domain represented by SEQ ID NO 850, and wherein the second antigen-binding site is comprised in a light chain variable domain represented by SEQ ID NO 854 and a heavy chain variable domain represented by SEQ ID NO 858.

13. The bispecific antibody of claim 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NO:943 and 942, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are each represented by SEQ ID NO: 12.

14. A pharmaceutical formulation comprising the bispecific antibody of any one of the preceding claims and a pharmaceutically acceptable carrier.

15. The bispecific antibody according to any one of claims 1-13 or the pharmaceutical formulation according to claim 14 for use in the treatment of coagulopathy, wherein said coagulopathy is selected from hemophilia a with or without inhibitor, or hemophilia B with or without inhibitor, fvii (a) deficiency and Glanzmann platelet insufficiency.

Field of the invention

The present invention relates to bispecific antibodies exhibiting improved pharmaceutical properties, compositions comprising such antibodies, and uses, such as pharmaceutical and therapeutic uses, of such antibodies and compositions.

Sequence listing

This application is filed with a sequence listing in electronic form. The entire contents of this sequence listing are incorporated herein by reference.

Background

The blood clotting process involves several proteins that act together after vascular injury to produce a blood clot that prevents a severe loss of body fluid and/or pathogen invasion. The cascade of events leading to clot formation can be initiated by two pathways called the intrinsic (contact) and extrinsic (tissue factor) pathways. Each pathway consists of a series of zymogen activation steps, where the newly activated enzyme catalyzes the activation of the next zymogen in the series until the prothrombin is converted to thrombin. Thrombin converts fibrinogen to a fibrin network and activates platelets to form a platelet plug, collectively resulting in the formation of a stable blood clot. Initiation of the extrinsic coagulation pathway is mediated by the formation of a complex between membrane-bound Tissue Factor (TF), which is exposed by injury to the vessel wall, and low levels of circulating factor viia (fviia). The FVIIa TF complex initiates the coagulation cascade by activating small amounts of coagulation Factors IX (FIX) and Factor X (FX). In the initial phase, low concentrations of FXa produce traces of thrombin, which can activate factor XI as well as cofactors VIII and V. In the amplification stage, they assemble into procoagulant complexes which are passed by tenase (FIXa, FVIIIa, Ca) respectively²⁺Phospholipids) and prothrombinase (FXa, FVa, Ca)^{2 +}Phospholipid) complex significantly enhances the production of FXa and thrombin.

In hemophilia a and B (HA and HB, respectively) patients, dysfunction of the various steps of the coagulation cascade occurs due to the loss or deficiency of functional FVIII and FIX, respectively. This results in impaired and inadequate coagulation function, as well as potentially life-threatening bleeding, or damage to internal organs such as joints.

Recombinant FVIIa (rFVIIa) has been widely used as a bypass agent for On Demand (OD) therapyBleeding in hemophilia (a and B) patients with inhibitor (HwI). rFVIIa has a short systemic half-life of 2-3 hours when administered Intravenously (IV) and low bioavailability when administered Subcutaneously (SC). The short systemic half-life of rFVIIa is thought to be due to the involvement of several mechanisms, including the plasma inhibitor antithrombin III (AT) ((II)) (II)H et al (2010) J.Thromb.Haemost.9:333-8) and alpha-2-macroglobulin (. alpha.2M) and renal clearance. The short systemic half-life and low SC bioavailability of rFVIIa make prophylactic treatment with rFVIIa challenging. In addition, the low intrinsic activity of rFVIIa requires the administration of higher rFVIIa doses.

Thus, there is a need for improved compounds that can support prophylactic treatment with less frequent dosing and subcutaneous administration.

Roche recently introduced a bispecific antibody, emilizumab, suitable for routine prophylaxis of HA and HA with inhibitor (hawi) patients once a week by subcutaneous administration. Nevertheless, the development of safe, effective molecules with alternative mechanisms of action remains an area of particular interest in order to improve and complement the standard of care for hemophiliacs.

Disclosure of Invention

The present invention relates to bispecific antibodies exhibiting improved pharmaceutical properties, in particular to bispecific antibodies useful for treating subjects suffering from congenital and/or acquired coagulopathy, e.g. for treating patients suffering from hemophilia a or B with or without inhibitor. Furthermore, the invention relates in particular to bispecific antibodies capable of binding to factor VII (FVII (a)) and to TREM-like transcript 1 (TLT-1).

In one aspect, the bispecific antibody of the invention comprises (i) a first antigen-binding site that binds to fvii (a), and (ii) a second antigen-binding site that binds to TLT-1.

In one aspect of the invention, the bispecific antibody extends the circulating half-life of endogenous FVIIa activity without loss of endogenous FVIIa activity, and stimulates endogenous FVIIa activity by selectively localizing it to activated platelets.

In an embodiment of the invention, the bispecific antibody comprises an Fc region. The Fc region mediates the circulation of the bispecific antibody, thereby extending its half-life in circulation.

In an embodiment of the invention, said first antigen binding site competes for binding to fvii (a) with any one of the anti-fvii (a) antibodies comprising a light chain variable domain (VL) and a heavy chain variable domain (VH) as shown below in a competitive ELISA assay:

mAb0522 (VL: SEQ ID NO:846 and VH: SEQ ID NO:850),

fab0883 (VL: SEQ ID NO:814 and VH: SEQ ID NO:818),

mAb0005 (VL: SEQ ID NO:750 and VH: SEQ ID NO:754),

mAb0004 (VL: SEQ ID NO:14 and VH: SEQ ID NO:18),

mAb0013 (VL: SEQ ID NO:46 and VH: SEQ ID NO:50),

mAb0018 (VL: SEQ ID NO:62 and VH: SEQ ID NO:66),

mAb0544 (VL: SEQ ID NO:694 and VH: SEQ ID NO:698),

mAb0552 (VL: SEQ ID NO:702 and VH: SEQ ID NO:706),

mAb0001 (VL: SEQ ID NO:710 and VH: SEQ ID NO:714),

mAb0007 (VL: SEQ ID NO:718 and VH: SEQ ID NO:722),

mAb0578 (VL: SEQ ID NO:726 and VH: SEQ ID NO:730),

mAb0701 (VL: SEQ ID NO:734 and VH: SEQ ID NO:738), and

mAb0587 (VL: SEQ ID NO:742 and VH: SEQ ID NO: 746).

In a further embodiment of the invention, the first antigen binding site of the bispecific antibody is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of FVII (A) (SEQ ID NO: 1).

In one aspect of the invention, the bispecific antibody is formulated into a pharmaceutical formulation comprising the bispecific antibody of the invention and a pharmaceutically acceptable carrier.

In one aspect of the invention, the bispecific antibody is administered parenterally, e.g., intravenously, intramuscularly, or subcutaneously. In one aspect of the invention, the bispecific antibody allows prophylactic treatment of a subject suffering from congenital and/or acquired coagulopathies such as hemophilia a, hemophilia B, hemophilia a with inhibitors or hemophilia B with inhibitors. Thus, the bispecific antibody is designed to provide hemostatic coverage against bleeding. In one aspect of the invention, the bispecific antibody is designed, for example, to be suitable for once weekly, once monthly or less frequent administration.

Medical treatment with bispecific antibodies of the invention may provide a number of advantages, such as longer duration between injections, more convenient administration and possibly improved hemostatic protection between injections. Thus, bispecific antibodies described herein may have a significant impact on the quality of life of individuals with hemophilia a or B with or without inhibitors.

Brief description of the sequence listing

Table 1 is an overview of the corresponding SEQ ID NOs of the antibodies and their respective VL and VL domain sequences. The types of heavy chain constant domains are defined in table 2a ("M" denotes the murine IgG1 constant domain).

Table 2a is an overview of the different formats used for recombinant expression of bivalent antibodies, monovalent (OA) antibodies and bispecific antibodies. The SEQ ID NOs corresponding to the first heavy chain (HC-1) and the second heavy chain (HC-2, or truncated heavy chain (trHC) for OA antibodies) are listed. The light chain constant domain corresponds in each case to the human kappa of SEQ ID NO 12.

Table 2b is an overview of the murine anti-fvii (a) antibodies of the present invention. Clone name, correspondence between the abbreviations of fully murine (hybridoma-derived, except recombinantly expressed mAb 0765) antibodies and the corresponding murine/human chimeric variants (murine variable domain, human IgG 4S 228P constant domain).

Table 2c is an overview of the antibodies in the murine and humanized 11F2 lineages.

Table 2d is an overview of the antibodies against the lineage of TLT-1mAb 0012.

Table 1:

table 2 a:

table 2 b:

table 2 c:

antibodies	Variable fields	Constant domains
			mAb0005	Murine VL/VH	M
mAb0048	Murine VL/VH	A
			Fab0076	Murine VL/VH	G
mAb0077(OA)	Murine VL/VH	E
			mAb0705(OA)	Humanized VL/VH	F
Fab0883	Humanized VL/VH	G
			mAb0865	Humanized VL/VH	B
mAb0522	Humanized VL/VH	K

Table 2 d:

antibodies	Variable fields	Constant domains
			mAb0012	Murine VL/VH	M
mAb0082	Murine VL C41A/VH T61A	A
			mAb1076	Humanized VL/VH	A
mAb0524	Humanized VL/VH	J

In the present invention, the recombinantly produced antibodies were all expressed in a human IgG4 background and all contained the standard hinge stabilizing substitution S228P (EU numbering). In some variants, the C-terminal lysine of the heavy chain (K447, rapidly cleaved in vivo; see Cai et al, Biotechnol. Bioeng.2011vol.108, pp 404-412) was omitted (referred to as delta-lys). Additional substitutions were introduced into the heavy chain constant domain according to table 2a to ensure the desired chain pairing in bispecific and monovalent antibodies (Duobody mutation F405L R409K (Labrijn et al PNAS 2013, vol.110, pp.5145-5150) and knob-hole mutation (see Carter et al j.imm.methods 2001, vol.248, pp.7-15) T366W (knob) and T366S L368A Y407V (knob)), or to prolong the in vivo half-life (YTE mutation, M252Y S254T T256E (Dall' acra et al j.biol.chem.2006, vol.18, pp.23514-24)). All recombinantly produced antibodies of the invention have a human kappa light chain constant domain (SEQ ID NO: 12).

Detailed Description

The present invention relates to the design and use of antibody compositions that exhibit improved pharmaceutical properties. In particular, it relates to bispecific antibodies capable of binding to coagulation FVII (a) and TLT-1.

Antibodies

The term "antibody" herein refers to a protein derived from an immunoglobulin sequence, which is capable of binding to an antigen or a portion thereof. The term antibody includes, but is not limited to, full length antibodies of any class (or isotype), i.e., IgA, IgD, IgE, IgG, IgM, and/or IgY.

Of particular interest to therapeutic antibodies is the IgG subclass, which is divided into 4 subclasses in humans according to the sequence of its heavy chain constant region: IgG1, IgG2, IgG3, and IgG 4. Light chains can be classified into two types according to their difference in sequence composition: kappa and lambda chains. An IgG molecule consists of two heavy chains interconnected by two or more disulfide bonds and two light chains each linked to a heavy chain by a disulfide bond. The IgG heavy chain may comprise a heavy chain variable domain (V)_H) And a maximum of three heavy chain constant (C)_H) Domain: c_H1、C_H2 and C_H3. The light chain may comprise a light chain variable domain (V)_L) And a light chain constant domain (C)_L)。V_HAnd V_LThe regions may be further subdivided into hypervariable regions, known as Complementarity Determining Regions (CDRs), interspersed with more conserved regions, known as Framework Regions (FRs). The VH and VL domains are typically composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR 4. The heavy and light chain variable domains comprising hypervariable regions (CDRs) constitute structures capable of interacting with an antigen, while the constant regions of an antibody mediate the interaction of the antibody with an Fc receptorBinding of the body to the first component C1q of the C1 complex of the classical complement system.

The term "antigen binding site" or "binding portion" refers to the portion of an antibody that allows antigen binding.

The term "antigen-binding fragment" of an antibody refers to a fragment of an antibody that retains the ability to bind its cognate antigen, e.g., fvii (a), TLT-1, or another target molecule, as described herein. Examples of antigen binding fragments include, but are not limited to, Fab', Fab₂、Fab'₂Fv, single-chain Fv (scFv) or single V_HOr V_LA domain.

The term "single-armed antibody" as used herein refers to a specific type of monovalent antibody fragment consisting of an antibody heavy chain, a truncated heavy chain lacking a Fab region, and a single light chain.

The term "monospecific" antibody as used herein refers to an antibody (including but not limited to a bivalent antibody) capable of binding to one specific epitope.

The terms "bispecific antibody" and "biAb" herein refer to an antibody capable of binding to two different antigens, such as fvii (a) and TLT-1, or two different epitopes on the same antigen.

The bispecific antibodies of the invention are derived from antibodies or antigen-binding fragments thereof. The bispecific antibodies of the invention may be fusions or conjugates of antibodies and antigen-binding fragments of antibodies, such as Fab, Fab ', Fab2, Fab'2, or scFv. The bispecific antibodies of the invention may also be fusions or conjugates of antibody fragments. Numerous Molecular forms of bispecific antibodies derived from antibodies and antibody fragments are known in the art, see, e.g., (Spiess et al: Molecular Immunology 67, (2015), pp.95-106) and (Brinkmann and Kontermann: MABS,9(2017), pp 182-212).

Bispecific antibodies can be prepared by a variety of means described in the art, see, e.g., (Spiess et al: Molecular Immunology 67, (2015), pp.95-106) and (Brinkmann and Kontermann: MABS,9(2017), pp 182-. For example, the required heavy chain pairing can be achieved by engineering the dimerization interface of the Fc region to promote heterodimerization. One example is the so-called knob-in-hole mutation, in which sterically bulky side chains (knobs) are introduced into an Fc that is matched by sterically smaller side chains (knobs) on the opposite Fc, thereby creating steric complementarity that promotes heterodimerization. Other methods for engineering heterodimeric Fc interfaces are electrostatic complementation, fusion with a non-IgG heterodimerization domain, or heterodimerization in vitro using the natural Fab-arm exchange phenomenon of human IgG 4. Examples of heterodimeric bispecific antibodies are well described in the literature, e.g. (Klein C et al; MAbs.20124, pp 653-. Special attention must be paid to the light chain in heterodimeric antibodies. Correct pairing of LC and HC can be achieved by using a common light chain. Engineering of the LC/HC interface can be used to facilitate heterodimerization or light chain cross-engineering, such as CrossMabs. Reassembly of antibodies from two separate IgGs containing appropriate mutations in vitro under mild reducing conditions can also be used to generate bispecific antibodies (e.g., Labrijn et al, PNAS,110(2013), pp 5145-. Natural Fab-arm exchange methods have also been reported to ensure correct light chain pairing.

The term "multispecific" antibody as used herein refers to an antibody capable of binding to two or more different antigens or two or more different epitopes on the same antigen. Thus, multispecific antibodies include bispecific antibodies.

The antibodies of the invention can be combined with other antibodies and antibody fragments known in the art to produce bispecific, trispecific, or multispecific antibody molecules.

In one aspect, the antibody of the invention is a chimeric, human or humanized antibody. Such antibodies can be produced by using, for example, a suitable antibody display or immunization platform or other suitable platforms or methods known in the art.

Furthermore, if the antibody contains a constant region, the constant region or portion thereof is also derived from a human germline immunoglobulin sequence. The human antibodies of the invention may comprise amino acid residues that are not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

Human antibodies can be isolated from libraries of sequences, created based on selection of human germline sequences, that are further diversified with natural and synthetic sequence diversity. Human antibodies can be prepared by in vitro immunization of human lymphocytes and subsequent transformation of the lymphocytes with the EB virus. Human antibodies can be produced by recombinant methods known in the art.

As used herein, the term "humanized antibody" refers to a human/non-human antibody that contains sequences (CDR regions or portions thereof) derived from a non-human immunoglobulin. Thus, a humanized antibody is a human immunoglobulin (recipient antibody) in which at least residues from a hypervariable region of the recipient have been replaced by residues from a hypervariable region of an antibody (donor antibody) from a non-human species, such as mouse, rat, rabbit or nonhuman primate, which has the desired specificity, affinity, sequence composition and functionality. In some cases, Framework (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. An example of such a modification is the introduction of one or more so-called back mutations, which are typically amino acid residues derived from the donor antibody. Humanization of antibodies can be performed using recombinant techniques known to those skilled in the art (see, e.g., Antibody Engineering, Methods in Molecular Biology, vol.248, by Benny k.lo). Human acceptor frameworks that are suitable for both light and heavy chain variable domains can be identified by, for example, sequence or structural homology. Alternatively, for example, a fixed acceptor framework may be used based on knowledge of structural, biophysical, and biochemical properties. The acceptor framework may be germline-derived or derived from mature antibody sequences. The CDR regions from the donor antibody can be transferred by CDR grafting. CDR-grafted humanized antibodies can be further optimized in terms of, for example, affinity, functional and biophysical properties by determining key framework positions at which amino acid residues from the donor antibody are reintroduced (back-mutated) to have a favorable effect on the properties of the humanized antibody. In addition to back-mutations derived from donor antibodies, humanized antibodies can be engineered by introducing germline residues in the CDRs or framework regions, eliminating immunogenic epitopes, site-directed mutagenesis, affinity maturation, and the like. In addition, humanized antibodies may comprise residues not found in the recipient antibody or the donor antibody. These modifications were made to further improve antibody performance. The humanized antibody may also optionally comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.

As used herein, the term "chimeric antibody" refers to an antibody comprising portions of an antibody derived from two or more species. For example, genes encoding such antibodies include genes encoding variable domains derived from two different species and genes encoding constant domains derived from two different species. For example, a gene encoding a mouse monoclonal antibody variable domain may be linked to a gene encoding a human antibody constant domain.

An antibody or fragment thereof may be defined in terms of its Complementarity Determining Regions (CDRs). The term "complementarity determining region" as used herein refers to a region of an antibody in which amino acid residues involved in antigen binding are typically located. CDRs can be identified as the regions with the highest variability between antibody variable domains. Databases such as the Kabat database can be used for CDR identification, e.g., CDRs are defined comprising amino acid residues 24-34(L1), 50-56(L2), and 89-97(L3) of the light chain variable domain and 31-35(H1), 50-65(H2), and 95-102(H3) of the heavy chain variable domain; (Kabat et al 1991; Sequences of Proteins of Immunological Interest, fifth edition, U.S. department of Health and Human Services, NIH publication No. 91-3242). Typically, the numbering of the amino acid residues in this region is by the method described by Kabat et al (supra). Phrases such as "Kabat position", "Kabat residue", and "according to Kabat" herein refer to this numbering system for the heavy chain variable domain or the light chain variable domain. By using the Kabat numbering system, the actual linear amino acid sequence of a peptide may contain fewer or additional amino acids, which correspond to a shortening of or insertion into the Framework (FR) or CDR of the variable domain. For example, the heavy chain variable domain may comprise amino acid insertions after residue 52 of CDR H2 (residues 52a, 52b, and 52c according to Kabat) and residues inserted after heavy chain FR residue 82 (e.g., residues 82a, 82b, and 82c, etc. according to Kabat). The Kabat numbering of residues for a given antibody can be determined by aligning regions of homology of the antibody sequences with "standard" Kabat numbered sequences. Numbering according to Kabat is only when specified, otherwise the numbering is consecutive according to the designated SEQ ID NO.

The term "framework region" or "FR" residues refers to those V residues that are not within a CDR as defined herein_HOr V_LAmino acid residues.

The antibodies of the invention may comprise CDR regions from one or more specific antibodies disclosed herein.

The term "antigen" (Ag) refers to a molecular entity used to immunize an immunocompetent vertebrate to produce an antibody (Ab) that recognizes the Ag. Ag is referred to herein more broadly and is generally intended to include target molecules recognized by abs.

The invention includes variants of the antibodies of the invention, or antigen binding fragments thereof, which may comprise 1, 2, 3, 4, or 5 amino acid substitutions and/or deletions and/or insertions in each of the sequences disclosed herein.

"substitution" variants preferably involve the replacement of one or more amino acids with the same number of amino acids.

The term "epitope" as used herein is defined in the context of a molecular interaction between an "antigen-binding polypeptide", such as an antibody (Ab), and its corresponding antigen (Ag). Generally, an "epitope" refers to a region or region on Ag that binds to the Ab, i.e., a region or region in physical contact with the Ab. In the present invention, epitopes are defined using X-ray derived crystal structures, defining the spatial coordinates of the complex between an Ab, such as a Fab fragment, and its Ag. Unless otherwise stated or contradicted by context, the term epitope is defined herein as a residue of Ag (here FVII (a) or TLT-1) characterized by having a distance from the heavy atom in the FabHeavy atoms (i.e., non-hydrogen atoms) within a distance of (c).

Epitopes described at the amino acid level, e.g.as determined by X-ray structure, are said to be identical if they contain the same set of amino acid residues. Epitopes are said to be overlapping if they share at least one amino acid residue. Epitopes are said to be distinct (unique) if they do not have consensus amino acid residues.

The definition of the term "paratope" derives from the above definition of "epitope" by reversing the viewing angle. Thus, the term "paratope" refers to a region or region on an antibody or fragment thereof that binds to an antigen, i.e., a region or region that is in physical contact with an antigen. Unless otherwise stated or contradicted by context, the term paratope is defined herein as an Ab residue characterized as having a distance from a heavy atom in FVII (a) or TLT-1Heavy atoms (i.e., non-hydrogen atoms) within a distance of (c).

Epitopes on antigens may contain one or more hotspot residues, i.e. residues that are particularly important for interaction with homologous antibodies, and where the interaction mediated by the side chain of the hotspot residue contributes significantly to the binding energy for antibody/antigen interactions (Peng et al, PNAS 111(2014), E2656-E2665). Hotspot residues can be identified by testing binding of antigen variants in which a single epitope residue has been replaced with, for example, alanine, to a cognate antibody. If the substitution of an epitope residue with alanine has a strong effect on the binding to an antibody, said epitope residue is considered to be a hotspot residue and is therefore particularly important for the binding of an antibody to an antigen.

Antibodies that bind to the same antigen can be characterized for their ability to bind to their common antigen simultaneously, and can be subjected to "competitive binding"/"binning". In this context, the term "binning" refers to a method of grouping antibodies that bind to the same antigen. Antibody "binning" can be based on the competitive binding of two antibodies to their common antigen in standard technology based assays. Reference antibodies are used to define "bins" of antibodies. A second antibody is said to belong to the same "bin" as a reference antibody if it cannot bind to the antigen simultaneously with the reference antibody. In this case, the reference antibody and the second antibody competitively bind to the same part of the antigen and are therefore classified as "competing antibodies". A second antibody is said to belong to a different "bin" if it is capable of binding to the antigen simultaneously with the reference antibody. In this case, the reference antibody and the second antibody do not competitively bind to the same part of the antigen and are therefore classified as "non-competing antibodies".

Competition assays for determining whether an antibody competes for binding with an anti-fvii (a) or anti-TLT-1 antibody disclosed herein are known in the art. Exemplary competition assays include immunoassays (e.g., ELISA assays, RIA assays), surface plasmon resonance analysis (e.g., using BIAcore)^TMInstrumentation), bio-layer interferometryAnd flow cytometry.

In general, competition assays involve the use of antigens bound to a solid surface or expressed on the surface of a cell, test FVII-or FVIIa-binding antibodies, and reference antibodies. The reference antibody is labeled and the test antibody is unlabeled. Competitive inhibition is measured by determining the amount of labeled reference antibody that binds to a solid surface or cells in the presence of the test antibody. Typically, the test antibody is present in excess (e.g., 1, 5, 10, 20, 100, 1000, 10000, or 100000 fold). Antibodies identified as competitive in competition assays (i.e., competing antibodies) include antibodies that bind the same epitope or an overlapping epitope as the reference antibody, as well as antibodies that bind an adjacent epitope that is close enough to the epitope bound by the reference antibody to be sterically hindered.

In an exemplary competition assay, a reference anti-FVII or anti-FVIIa antibody is biotinylated using commercially available reagents. The biotinylated reference antibody is mixed with serial dilutions of the test antibody or unlabeled reference antibody (self-competitive control) to give mixtures of test antibody (or unlabeled reference antibody) and labeled reference antibody in various molar ratios (e.g., 1, 5, 10, 20, 100, 1000, 10000, or 100000 fold). The antibody mixture was added to an ELISA plate coated with FVII or FVIIa polypeptides. The plate is then washed and horseradish peroxidase (HRP) -streptavidin is added to the plate as a detection reagent. The amount of labeled reference antibody bound to the target antigen is detected after addition of a chromogenic substrate known in the art (e.g., TMB (3,3',5,5' -tetramethylbenzidine) or ABTS (2,2 "-azino-bis- (3-ethylbenzothiazoline-6-sulfonate)), optical density readings (OD units) are taken using a spectrometer (e.g.,m2 spectrometer (Molecular Devices)). The response (OD units) corresponding to 0% inhibition was determined from wells without any competing antibody. The response (OD units) corresponding to 100% inhibition, i.e. assay background, was determined from wells without any labeled reference or test antibody. The percent inhibition of the test antibody (or unlabeled reference antibody) against the labeled reference antibody to FVII or FVIIa at each concentration was calculated as follows: % inhibition-100 (1- (OD units-100% inhibition)/(0% inhibition-100% inhibition)).

One skilled in the art will appreciate that similar assays can be performed to determine whether two or more anti-TLT-1 antibodies share a binding region, a bin, and/or competitively bind to an antigen. One skilled in the art will also appreciate that competition assays can be performed using various detection systems known in the art.

A test antibody competes for binding to antigen with a reference antibody if an excess of one antibody (e.g., 1, 5, 10, 20, 100, 1000, 10000, or 100000-fold) inhibits the binding of another antibody, e.g., by at least 50%, 75%, 90%, 95%, or 99%, as measured in a competitive binding assay.

Competition was determined using the competitive ELISA assay described above and provided in example 7 and example 32, unless otherwise indicated.

The term "binding affinity" is used herein as a measure of the strength of a non-covalent interaction between two molecules (e.g., an antibody or fragment thereof and an antigen). The term "binding affinity" is used to describe a monovalent interaction. By determining the equilibrium dissociation constant (K)_D) The binding affinity between two molecules (e.g., an antibody or fragment thereof and an antigen) through a monovalent interaction can be quantified. Can be measured by compoundingKinetics of formation and dissociation, e.g. determination of K by Surface Plasmon Resonance (SPR) as performed in examples 6 and 16 or other methods known in the art_D. The rate constants corresponding to the binding and dissociation of the monovalent complex are respectively referred to as the binding rate constant k_a(or k)_{Bonding of}) And dissociation rate constant k_d(or k)_Dissociation). By equation K_D＝k_d/k_aIs a reaction of K_DAnd k is_aAnd k_dAnd (4) associating.

By comparing the K of individual antibody/antigen complexes, as defined above_DValues, binding affinities associated with different molecular interactions can be compared, for example, the binding affinities of different antibodies to a given antigen.

K of the antibodies of the invention to their targets_DMay be less than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM, such as less than 400nM, such as less than 600nM, such as less than 800 nM.

In one such embodiment, the antibody is a bispecific antibody comprising an anti-FVII (a) arm and a second anti-TLT-1 arm, said anti-FVII (a) arm being K for FVIIa_DLess than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM, such as less than 400nM, such as less than 600nM, such as less than 800nM, and the second anti-TLT-1 arm is opposite to the K of TLT-1_DLess than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM, such as less than 400nM, such as less than 600nM, such as less than 800 nM.

The term "identity" as known in the art refers to the relationship between the sequences of two or more polypeptides as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptides, as determined by the number of matches between strings of residues of two or more amino acid residues. "identity" measures the percentage of identical matches between two or more sequences with null alignments (if any) to the smaller, as derived by a particular mathematical model or computer program (i.e., an "algorithm"). The identity of the related polypeptides can be readily calculated by known methods. In the present invention, Needleman (Needleman et al, J.Mol.biol.1970; 48: 443-.

Fragment crystallizable regions of antibodies ("Fc region"/"Fc domain") are those comprising a hinge and a constant C_H2 and C_H3 domain.

An antibody of the invention may comprise an Fc region which may have a wild-type amino acid sequence, or it may comprise amino acid substitutions which modulate the effector function of the antibody, see, for example (Wang et al: Protein cell.9(2018), pp.63-73). A specific example of an Fc variant with modified effector function is one that has reduced binding to fey receptors. A specific example of such a variant is IgG1 comprising the substitutions L234A, L235E, G237A, a330S and P331S (numbering of residues according to the EU index), which has reduced affinity for certain Fc γ receptors and Clq.

Bispecific molecules

The term "bispecific molecule" herein refers to a molecule capable of binding to different targets, such as FVII (a) and TLT-1. The binding moiety of the bispecific molecule may be derived from an antibody or may be of non-antibody origin. One particular example of a bispecific molecule is a bispecific antibody.

In one aspect of the invention, the bispecific molecule comprises a first antigen-binding site capable of binding to factor vii (a) and a second antigen-binding site capable of binding to TREM-like transcript 1 (TLT-1).

The bispecific molecules of the invention may comprise a non-antibody derived binding moiety, also referred to as a surrogate scaffold. The bispecific molecules of the invention may be fusions or conjugates that replace a scaffold. The bispecific molecules of the invention may be fusions or conjugates of antibodies and alternative scaffolds. The bispecific molecules of the invention may also be fusions or conjugates of antibody fragments and alternative scaffolds.

A large number and variety of alternative scaffolds are known in the art, see, e.g., (Simeon and Chen: Protein Cell 9(2018), pp.3-14), (C), (D) and (D)And Kolmar: microbiological Cell Factories (2018), pp.17-32) and (Nygren and Skerra: Journal of Immunological Methods 290(2004), pp 3-28).

Specific examples of alternative scaffolds are Adnectins, Affilins, Anticalins, Avimers, atrers, FN3 scaffolds, fynomes, OBodies, Kringle domains, Kunitz domains, Knottins, Affibodies, DARPins, bicyclic peptides and Cys-knots.

Factor VII (a)

The terms "factor VII" and "FVII" herein refer to the zymogen of factor VII. The terms "factor VIIa" and "FVIIa" as used herein refer to activated factor VII, which is a serine protease. The terms "factor vii (a)" and "fvii (a)" herein include the uncleaved zymogen, factor vii (fvii), and the cleaved and thus activated protease, factor viia (fviia). The terms "factor vii (a)" and "fvii (a)" herein include naturally occurring allelic variants of fvii (a) that may be present. A wild-type human factor VII (a) sequence is provided in SEQ ID NO 1.

Wild-type human factor VII (a) (SEQ ID NO. 1):

wild-type fvii (a) consists of 406 amino acid residues and consists of four domains. There is an N-terminal gamma-carboxyglutamic acid (Gla) -rich domain in which 10 glutamic acid residues (highlighted in bold in the above sequence) can be gamma-carboxylated. The gla domain is followed by two Epidermal Growth Factor (EGF) -like domains and a C-terminal serine protease domain. FVII and FVIIa are present in the circulation, but FVIIa is present only in low abundance (about 1% of the total FVII (a) pool; Morrissey JH, size Jr GJ. tissue factor and the initiation and regulation (TFPI) of synergy. in: Marder VJ, Aird WC, Bennett JS, Schulman S, White II GC, hemostatis and thombosis: basic principles and clinical practice 6 th edition; Wolters Kluwer & Lippincott Williams & Wilkins: Philadelphia; 2013. p.163-78). FVII can be activated to FVIIa by proteolytic cleavage between residues Arg152 and Ile153, resulting in a double-chain FVIIa molecule consisting of a light chain and a heavy chain. The two chains in FVIIa are tethered by disulfide bonds. The light chain comprises Gla and EGF-like domains, while the heavy chain comprises a protease domain. FVIIa requires binding to its cell surface cofactor Tissue Factor (TF) to achieve its full biological activity.

The predicted full-length cynomolgus monkey (Macaca fascicularis) FVII isoform X1 consists of 406 amino acids with the NCBI reference sequence ID XP — 015295043.1. The term "cFVIIa-chimera" as used herein refers to a chimeric cynomolgus monkey FVIIa construct. The amino acid sequence of the cFVIIa-chimera is such that Gla and the first EGF-like domain (amino acids 1-88 when aligned with the human FVIIa sequence) consist of the human FVII sequence (Uniprot ID P08709); while the second EGF-like and protease domain (amino acids 89-406 when aligned to the human FVIIa sequence) consists of the cynomolgus monkey FVII isoform X1 sequence (NCBI reference sequence ID XP — 015295043.1).

When administered intravenously, recombinant FVIIa (and endogenous FVIIa) has an active half-life in humans of about 2 to 3 hours. Factor vii (a) may be endogenous, plasma-derived or recombinantly produced, obtained using well-known production and purification methods. The degree and location of glycosylation, gamma-carboxylation and other post-translational modifications may vary depending on the host cell chosen and its growth conditions.

Factor VIIa may exist in different conformations. Factor VIIa circulates in the blood in an inactive conformation or inactive form. Such asThe conformation has no catalytic activity. FVIIa may also exist in the active conformation or active form, also referred to herein as fully active or fully activated FVIIa. The term FVIIa encompasses FVIIa in inactive form or conformation and FVIIa in active form or conformation. For example, the active conformation of FVIIa may comprise the complex between FVIIa and tissue factor (FVIIa/TF), e.g. in the form of FVIIa/sTF (1-219), where sTF (1-219) is a truncated and soluble form of tissue factor, or the active conformation of FVIIa may comprise active site-inhibited FVIIa (FVIIa). FVIIai is a catalytically inert form of FVIIa which can be produced by treating FVIIa with dansyl-Glu-Gly-Arg-chloromone or Phe-Phe-Arg-chloromone (FFR-chloromone) (Wildgoose et al (1990) Biochemistry 29: 3413) -3420 andet al (1997) J Biol Chem 272: 11863-11868). FVIIa retains its affinity for TF and is believed to adopt the same conformation as that induced by TF binding in FVIIa. FVIIa therefore has an activated conformation, and binding of the test compound to FVIIa indicates that the test compound will also bind to the activated form of wild-type FVIIa.

The target molecule for the anti-fvii (a) antibody may be any fvii (a) molecule described herein.

TREM-like transcript 1(TLT-1)

The Trigger Receptors (TREMs) expressed on bone marrow cells have a defined role in the biology of various myeloid lineages, playing an important role in the regulation of innate and adaptive immunity. The TREM-like transcript (TLT) -1 belongs to this family of proteins, although the TLT-1 gene is expressed only in a single lineage, i.e., megakaryocytes and thrombocytes (platelets), and is present only in the alpha granule of megakaryocytes and platelets. TLT-1 is a transmembrane protein exposed on the surface of activated platelets upon release of the alpha granule. To date, TLT-1 has not been found on the surface of resting platelets or on the surface of any other cell type.

TLT-1 comprises an extracellular spherical head, stem region, transmembrane domain and intracellular domain containing an immunoreceptor tyrosine-based inhibitory motif (Washington et al Blood, 2002; 100: 3822-3824). The extracellular globular head of human TLT-1(hTLT-1) is a single immunoglobulin-like (Ig-like) domain. It is attached to the platelet membrane via a 37 amino acid linker region called the stem (Gattis et al, Jour Biol Chem,2006,281,19, 13396-13403).

The putative transmembrane segment of hTLT-1 is 20 amino acids long. TLT-1 also possesses a cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM), which can serve as an intracellular signaling motif.

After platelet activation, a portion of TLT-1 is shed to form the soluble form (sTLT-1) (Gattis et al, Jour Biol Chem,2006,281,19, 13396-13403). The cleavage site is immediately adjacent to the platelet membrane. The shorter TLT-1 isoform, which has a truncated endodomain, is also present in platelets.

TLT-1 is involved in the regulation of coagulation and may also be involved in the regulation of inflammation at the site of injury. TLT-1 functions in platelet aggregation in response to non-optimal concentrations of certain platelet agonists (Giomarelli et al, Thromb Haemost 2007; 97: 955-. The best described ligand for TLT-1 is fibrinogen (Washington et al J Clin Invest 2009; 119: 1489-one 3824). Recently, TLT-1 was shown to also bind von Willebrand factor (Doerr A et al, Abstract PB359 of International Society of Thrombosins and Haemostasines 2019). sTLT-1 was suggested to play a role in sepsis-associated hemorrhage by inhibiting leukocyte activation and modulating platelet-neutrophil crosstalk (Derive, J Immunol 2012,188: 5585-.

For the purposes of the present invention, TLT-1 may be derived from any vertebrate, such as any mammal, such as a rodent (e.g., mouse, rat, or guinea pig), lagomorph (e.g., rabbit), artiodactyl (e.g., pig, cow, sheep, or camel), or primate (e.g., monkey or human). TLT-1 is preferably human TLT-1. TLT-1 can be translated from any naturally occurring genotype or allele that produces a functional TLT-1 protein. A non-limiting example of a human TLT-1 is the polypeptide sequence of SEQ ID NO. 2.

The target molecule of the TLT-1 antibody may be any of the TLT-1 molecules described herein.

anti-FVII (a) antibodies

The term "anti-fvii (a) antibody" herein refers to an antibody having fvii (a) as its target. An anti-fvii (a) antibody is capable of binding to a fvii (a) molecule as described herein; including, but not limited to, endogenous FVII (a) found in human plasma, exogenous FVII (a), such as recombinant wild-type human FVII (a), and endogenous FVII (a) found in animal plasma, e.g., in rabbits, mice, rats, dogs, or monkeys.

An "anti-fvii (a) antibody" may be a monoclonal, monospecific antibody targeting fvii (a). Monospecific anti-fvii (a) antibodies typically comprise two identical antigen binding sites for binding to fvii (a); a non-limiting example is the monoclonal IgG4 anti-FVII (a) antibody.

Suitable anti-fvii (a) antibodies include, but are not limited to, any of the anti-fvii (a) antibodies shown in table 3.

Table 3:

anti-fvii (a) antibodies may be capable of competing with any one of the antibodies shown in table 3 for binding to fvii (a). Whether an anti-fvii (a) antibody competes for binding to fvii (a) with any one of the antibodies shown in table 3 can be determined using well known methods (i.e., competitive binding assays), such as Surface Plasmon Resonance (SPR), ELISA or flow cytometry. Example 7 describes how competitive binding to fvii (a) can be determined using a competitive ELISA.

In one embodiment, the anti-fvii (a) antibody binds fvii (a) with high affinity. K of anti-FVII (a) antibody against its target_DMay be less than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM, such as less than 400nM, such as less than 600nM, such as less than 800 nM. In vivo, high affinity anti-fvii (a) antibodies reduce fvii (a) clearance by forming a complex with fvii (a). Thus, it extends the half-life of FVII (a) and allows it to circulateAnd (4) accumulating. In this way, the antibody can provide an elevated steady-state fvii (a) concentration.

In one embodiment, the anti-fvii (a) antibody does not interfere with the biological function of fvii (a). In one embodiment, the anti-FVII (a) antibody does not prevent endogenous FVII from being activated to FVIIa. For example, anti-FVII (a) antibodies do not interfere with the ability of FVII to convert to FVIIa (i.e. to activate automatically) upon binding to TF (as described in example 12). It is also preferred that anti-fvii (a) antibodies do not prevent fvii (a) from forming so-called initiation complexes with Tissue Factor (TF) and activate factor x (fx) in a TF-dependent or TF-independent manner (as described in example 10). In one embodiment, the anti-fvii (a) antibody does not compete with fvii (a) substrate or cofactor. However, anti-FVII (a) antibodies may compete with inhibitors of FVIIa such as Antithrombin (AT) and alpha-2-macroglobulin (as described in example 11).

anti-TLT-1 antibodies

The term "anti-TLT-1 antibody" herein refers to an antibody that has TLT-1 as its target. The anti-TLT-1 antibody is capable of binding to the TLT-1 molecule described herein. The "TLT-1 antibody" may be a monoclonal, monospecific antibody.

Suitable anti-TLT-1 antibodies include, but are not limited to, the anti-TLT-1 antibodies shown in Table 4.

Table 4:

the anti-TLT-1 antibody may be capable of competing for binding to TLT-1 with any of the antibodies shown in Table 4. Whether an anti-TLT-1 antibody competes for binding to TLT-1 with any of the antibodies shown in Table 4 can be determined using well-known methods (i.e., competitive binding assays), such as Surface Plasmon Resonance (SPR), ELISA, or flow cytometry. Competitive binding to TLT-1 can be determined using a competitive ELISA. Example 32 describes how competitive binding to TLT-1 can be determined using a competitive ELISA.

K of anti-TLT-1 antibody against its target_DMay be less than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM, such as less than 400nM, such as less than 600nM, such as less than 800 nM.

Preferably, the anti-TLT-1 antibody does not interfere with the function of TLT-1, in particular does not inhibit platelet aggregation.

In a preferred embodiment, the anti-TLT-1 antibody is capable of binding TLT-1 without interfering with platelet aggregation.

In another preferred embodiment, the anti-TLT-1 antibody is capable of binding to TLT-1 without competing with fibrinogen for binding to TLT-1.

In another preferred embodiment, the TLT-1 antibody does not interfere with the shedding of TLT-1.

Preferably, the anti-TLT-1 antibody does not bind to or exhibits low affinity for any other Trigger Receptor (TREM) expressed on myeloid cells or any other receptor on resting or activated platelets other than TLT-1.

In one embodiment, the anti-TLT-1 antibody binds to the stem of TLT-1.

Bispecific anti-FVII (a)/anti-TLT-1 antibodies

The bispecific antibodies of the invention comprise a first antigen-binding site capable of binding to fvii (a) and a second antigen-binding site capable of binding to TLT-1.

anti-FVII (a) antigen binding site

In one aspect, the bispecific antibody of the invention comprises a first antigen binding site capable of binding fvii (a).

In some embodiments of the invention, the first antigen binding site of the bispecific antibody competes for binding to fvii (a) with any one of the anti-fvii (a) antibodies identified in table 3; has the same epitope as any one of the antibodies identified in table 3; (ii) has the same CDR regions as any one of the antibodies identified in table 3; and has the same VL and VH regions as any one of the antibodies identified in table 3.

anti-TLT-1 antigen binding site

In one aspect, a bispecific antibody of the invention comprises a second antigen-binding site capable of binding TLT-1.

In some embodiments of the invention, the second antigen-binding site of the bispecific antibody competes for binding to TLT-1 with any one of the anti-TLT-1 antibodies identified in table 4; has the same epitope as any one of the antibodies identified in table 4; (ii) has the same CDR regions as any one of the antibodies identified in table 4; and has the same VL and VH regions as any one of the antibodies identified in table 4.

Modified effector function

The bispecific antibody of the invention may comprise an Fc region which may have a wild-type amino acid sequence, or it may comprise amino acid substitutions which modulate the effector function of the antibody, see, e.g., Wang et al Protein cell.9(2018), pp.63-73. A specific example of an Fc variant with modified effector function is one that has reduced binding to fey receptors. A specific example of such a variant is IgG1 comprising the substitutions L234A, L235E, G237A, a330S and P331S (numbering of residues according to the EU index), which has reduced affinity for certain Fc γ receptors and Clq.

A desirable property of the bispecific antibodies of the invention is a long in vivo half-life. Bispecific antibodies comprising an Fc region can be recycled and rescued through the FcRn receptor, which in turn can result in the desired long half-life. For bispecific antibodies of the invention lacking an Fc region, the half-life can be extended by other means. Different methods and principles for obtaining extended polypeptide and antibody half-lives are known in the art, see, e.g., Kontermann: Expert Opinion on Biological Therapy,16(2016), pp.903-915 and references therein.

In addition to Fc-based half-life extension of polypeptides and antibodies, fusion or conjugation to albumin or albumin variants has also been shown to be effective in extending half-life. Another approach is to attach polymers such as XTEN or PEG (insert reference). Furthermore, an extended half-life in vivo can be obtained by attaching an albumin binding moiety, see e.g. Tan et al Current Pharmaceutical Design 24(2018), pp.4932-4946; kontermann: Expert Opinion on Biological Therapy,16(2016), pp.903-915 and Kontermann: Current Opinion in Biotechnology 22(2011), pp 868-876.

Functional features

By binding to fvii (a), the bispecific antibodies of the invention can prolong the active circulating half-life of FVIIa present in the circulation; the bispecific antibody and bound fvii (a) are directed to the surface of activated platelets by binding to TLT-1. This in turn leads to an increased accumulation of FVIIa on activated platelets, thereby enhancing the FVIIa procoagulant activity at the site of vascular injury. Thus, the bispecific antibodies described herein are capable of conferring improved Pharmacokinetic (PK) and Pharmacodynamic (PD) properties to the endogenous fvii (a) pool.

In humans, it is known that the half-life of activity of administered recombinant FVIIa is about 2-3 hours. The short half-life of recombinant FVIIa is thought to be due to the involvement of several mechanisms, including inhibition by antithrombin iii (at), inhibition by α -2-macroglobulin (α 2M), and renal clearance. It is believed that a similar mechanism applies to endogenous FVIIa, giving it a similarly short half-life.

In order to prolong the active half-life of FVIIa, including the half-life of endogenous FVIIa, the bispecific antibodies described herein are intended to block one or more of these clearance mechanisms by means of their anti-FVII arm or so-called "first antigen-binding site" without losing endogenous FVIIa activity. The Fc portion of the FVIIa complex will mediate the recycling of the complex in endosomes by binding to FcRn and protect it from degradation. In addition, the high affinity anti-FVII arm of the bispecific antibody protects endogenous FVIIa from α 2M inhibition and renal clearance by virtue of the increased molecular size of the biAb-FVIIa complex compared to the size of free endogenous FVIIa. The anti-TLT-1 arm of the bispecific antibody selectively localizes prolonged acting endogenous FVIIa to activated platelets. This localization of FVIIa to activated platelets potentiates FVIIa activity without increasing its sensitivity to AT inhibition.

The bispecific antibodies of the invention can increase the Mean Residence Time (MRT) of endogenous or exogenous FVII (a). Preferably, the bispecific antibody is capable of enhancing the activity of fvii (a) in vivo.

Mean residence time

Mean Residence Time (MRT) is the average time a molecule remains in the body that is available for therapeutic activity. MRT is calculated as a function of the steady state distribution volume (Vss) divided by the total body Clearance (CL) according to equation 1.

MRT-Vss/CL equation 1

The results are expressed in time. MRT and effective plasma half-life (t) according to equation 2_1/2) And (4) correlating.

MRT＝ln(2)*t_1/2Equation 2

The ability of an antibody to increase the MRT of FVII (a) can be determined by well-known methods, such as those described in Pharmacokinetic and Pharmacodynamic Data Analysis: Concepts & Applications (Gabrielsson and Weiner). For example, plasma concentrations or activity profiles of FVII (a) are analyzed after intravenous or subcutaneous administration to experimental animals, such as mice, rats or monkeys. The ability of an antibody to increase the functional MRT of fvii (a) can be determined by analysis of the plasma activity profile of fvii (a), as measured using assays such as, but not limited to, the FVIIa activity assay described in example 8.

For example, the ability of an antibody to increase the MRT and functional MRT of fvii (a) can be determined as described in examples 9 and 18.

In some embodiments, the bispecific antibody of the invention is capable of increasing the MRT of fvii (a) by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold or at least 40-fold compared to administration of fvii (a) (fvii (a) polypeptide alone) in the absence of the antibody of the invention.

In some embodiments, the bispecific antibody of the invention is capable of increasing the functional MRT of fvii (a) by at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold or at least 40-fold as measured using the FVIIa activity assay described in example 8, compared to administering fvii (a) in the absence of the bispecific antibody of the invention.

Accumulation of endogenous FVIIa

For example, the ability of a bispecific antibody of the invention to increase circulating endogenous functionally active FVIIa levels can be determined by measuring endogenous FVIIa levels before and after administration of the antibody to a test animal, e.g. a mouse, rat or monkey, using assays such as, but not limited to, the FVIIa activity assay described in example 8.

For example, the ability of an antibody to increase circulating endogenous functionally active FVIIa levels can be determined as described in examples 27 and 28.

In some embodiments, the bispecific antibody of the invention is capable of increasing the level of circulating endogenous FVIIa at least 2 fold, at least 4 fold, at least 10 fold, at least 20 fold, at least 40 fold, at least 80 fold, at least 160 fold, at least 320 fold, at least 640 fold compared to the level of circulating endogenous FVIIa in the absence of the administered bispecific antibody.

TLT-1 and TF-independent thrombin generation

In one aspect, the bispecific antibodies of the invention are capable of maintaining or increasing the TLT-1 and TF-independent ability of factor VIIa to generate thrombin.

The ability of an antibody to increase thrombin generation by a fvii (a) polypeptide can be determined by methods well known in the art, e.g., the thrombin generation assay as described in example 5. In this assay thrombin generation is measured in haemophilia a induced human plasma in the presence of phospholipids, 25nM FVIIa and antibodies at a concentration close to saturation with added FVIIa. The dissociation constant determined for FVIIa-antibody interactions, e.g. as measured by SPR as exemplified in example 6, approaches saturation when > 90% of FVIIa is bound by antibody. Antibodies were classified as either stimulatory (> 120%), inhibitory (< 90%), or neutral (90-120%) based on the ratio of peak thrombin formation in the presence and absence of antibody.

In some embodiments, the bispecific antibodies of the invention are capable of maintaining (neutral)/increasing (stimulatory) the ability of the factor vii (a) polypeptide to generate thrombin as measured in a thrombin generation assay compared to fvii (a) in the absence of the antibody.

In some embodiments, the bispecific antibody of the invention is capable of increasing the ability of factor vii (a) to generate thrombin by at least 20% as measured in a thrombin generation assay compared to fvii (a) in the absence of the antibody.

Inhibition by antithrombin and/or alpha-2-macroglobulin

In one aspect, the bispecific antibodies of the invention are capable of reducing the sensitivity of FVIIa to inhibition by Antithrombin (AT) and/or alpha-2-macroglobulin.

The ability of an antibody to reduce inhibition of FVIIa by Antithrombin (AT) and/or alpha-2-macroglobulin can be determined by methods well known in the art, for example, as described in examples 5 and 11.

In some embodiments, the bispecific antibodies of the invention are capable of reducing inhibition of FVIIa by Antithrombin (AT) and/or alpha-2-macroglobulin, as compared to inhibition of FVIIa in the absence of the antibody.

TLT-1 dependent FXa production (measurement of stimulatory Activity)

In one aspect, the bispecific antibodies of the invention are capable of maintaining or increasing the ability of a FVIIa polypeptide to promote FX activation in the presence of a TLT-1 containing procoagulant blood membrane surface.

The ability of a bispecific antibody of the invention to increase the ability of a FVIIa polypeptide to promote FX activation can be determined by methods well known in the art, e.g., the TLT-1-dependent stimulatory activity assay as described in example 21. In this assay, FX activation is measured in the presence of FX (150nM), FVIIa (2.5nM), phospholipid membrane containing TLT-1 (4nM) and an anti-FVII (a)/anti-TLT-1 bispecific antibody. The so-called stimulatory activity (expressed as fold increase) of a bispecific antibody is the amount of FXa produced in the presence of a 100nM bispecific antibody relative to the amount produced by FVIIa in the absence of a bispecific antibody.

In some embodiments, the stimulatory activity of a bispecific antibody of the invention is at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 60-fold, at least 80-fold, at least 100-fold, or at least 150-fold.

TLT-1 dependent Whole blood clot formation

In one aspect, the bispecific antibodies of the invention are capable of promoting clot formation in hemophilia a conditions similar to or better than therapeutically effective concentrations of recombinant FVIIa.

The ability of a bispecific antibody to improve clot formation in whole blood can be determined by methods well known in the art, e.g., thromboelastography as described in example 29. In this assay, clot formation is measured in hemophilia a induced whole blood after repeated administration of bispecific antibody as described in examples 27, 28 and 29, to which bispecific antibody is added as well as FVII, FVIIa and FVIIa: AT, concentrations which mimic the homeostatic plasma levels of the respective endogenous factors. Coagulation was induced by the addition of the PAR1 agonist peptides SFLLRN and calcium. The clotting times under these conditions were compared with the clotting times achieved by the addition of 25nM FVIIa in the absence of antibody.

In some embodiments, the bispecific antibodies of the invention are capable of shortening clotting time in human hemophilia a-induced whole blood to a level similar to or lower than that achieved by the addition of 25nM FVIIa. In some embodiments, bispecific antibodies of the invention are capable of shortening the clotting time in human hemophilia a-induced whole blood to a level similar to or lower than that achieved by the addition of 2nM FVIIa, 4nM FVIIa, 6nM FVIIa, 8nM FVIIa, 10nM FVIIa, 12nM FVIIa, 16nM FVIIa or 20nM FVIIa.

Pharmaceutical preparation

In one aspect, the invention provides compositions and formulations comprising the bispecific antibodies described herein. For example, the invention provides pharmaceutical compositions comprising a bispecific antibody formulated with a pharmaceutically acceptable carrier.

In an embodiment of the invention, the pharmaceutical formulation comprises the bispecific antibody present in a concentration of 80mg/ml to 200mg/ml, such as 100mg/ml and 180mg/ml, and wherein the pH of the formulation is 2.0 to 10.0. The formulation may further comprise one or more of a buffer system, a preservative, a tonicity agent, a chelating agent, a stabilizer or surfactant, and various combinations thereof. The use of preservatives, isotonicity agents, chelating agents, stabilizers and surfactants in pharmaceutical compositions is well known to those skilled in the art. Reference may be made to Remington, The Science and Practice of Pharmacy, 19 th edition, 1995.

In one embodiment, the pharmaceutical formulation is an aqueous formulation. Such formulations are typically solutions or suspensions, but may also include colloids, dispersions, emulsions, and multiphase materials. The term "aqueous formulation" is defined as a formulation comprising at least 50% w/w water. Similarly, the term "aqueous solution" is defined as a solution comprising at least 50% w/w water, whereas the term "aqueous suspension" is defined as a suspension comprising at least 50% w/w water.

In another embodiment, the pharmaceutical formulation is a lyophilized formulation to which a physician or patient adds solvents and/or diluents prior to use.

In a further aspect, the pharmaceutical formulation comprises an aqueous solution of a fvii (a) polypeptide bispecific antibody as described herein and a buffer, wherein the antibody is present at a concentration of 1mg/ml or more, and wherein the pH of the formulation is from about 2.0 to about 10.0.

The compositions of the invention may be administered parenterally, such as intravenously, such as intramuscularly, such as subcutaneously; subcutaneous administration is preferred. The compositions of the present invention may be administered prophylactically.

The pharmaceutical composition of the invention may be used to treat a subject suffering from coagulopathy. As used herein, the term "subject" includes any human patient, or non-human vertebrate, having a coagulopathy.

Medical application

As used herein, the term "treatment" refers to the medical treatment of any human or other animal subject in need thereof. The subject is expected to have undergone a physical examination by a medical practitioner who has given a preliminary or definitive diagnosis indicating that the use of the particular treatment is beneficial to the health of the human or other animal subject. The timing and purpose of the treatment may vary from individual to individual, depending on the current state of the subject's health. Also contemplated is prophylactic or preventative administration of the procoagulant compounds of the present invention, wherein prophylaxis is defined as delaying or circumventing the manifestation or exacerbation of one or more symptoms of the disease or disorder. Thus, the treatment may be prophylactic, palliative, symptomatic ("on-demand"), and/or curative.

For the purposes of the present invention, prophylactic, palliative and/or symptomatic treatment may represent a separate aspect of the invention.

Coagulopathies leading to an increased bleeding tendency may result from any qualitative or quantitative absence of any procoagulant component of the normal coagulation cascade or any up-regulation of fibrinolysis. Such coagulopathies may be congenital and/or acquired and/or iatrogenic and are determined by those skilled in the art.

Non-limiting examples of congenital hypocoagulases (hypocoagulopathies) are hemophilia a, hemophilia B, factor VII deficiency, factor X deficiency, factor XI deficiency, von Willebrand disease and thrombocytopenia, such as Glanzmann's platelet insufficiency and Bernard-Soulier syndrome.

Non-limiting examples of acquired coagulopathies are serine protease deficiency caused by vitamin K deficiency; such vitamin K deficiency may result from administration of a vitamin K antagonist such as warfarin. Acquired coagulopathy may also occur after extensive trauma. Also referred to as "hematologic vicious cycle" in this context, characterized by haemodilution (dilutional thrombocytopenia and dilution of coagulation factors), hypothermia, consumption of coagulation factors and metabolic disturbances (acidosis). Fluid replacement therapy and increased fibrinolysis may exacerbate this situation. The bleeding may come from any part of the body.

Hemophilia a with "inhibitor" (i.e., alloantibody against factor VIII) and hemophilia B with "inhibitor" (i.e., alloantibody against factor IX) are non-limiting examples of partially congenital and partially acquired coagulopathies.

Non-limiting examples of iatrogenic coagulopathies are coagulopathies induced by excessive and/or inappropriate fluid replacement therapy, such as those that can be induced by blood transfusions.

In a preferred embodiment of the invention, the bleeding is associated with hemophilia a. In another preferred embodiment of the invention, the bleeding is associated with hemophilia B. In another preferred embodiment, the bleeding is associated with hemophilia a or B with acquired inhibitors. In another preferred embodiment, the bleeding is associated with a FVII deficiency. In another preferred embodiment, the bleeding is associated with Glanzmann platelet insufficiency. In another embodiment, the bleeding is associated with von Willebrand disease. In another embodiment, the bleeding is associated with severe tissue damage. In another embodiment, the bleeding is associated with severe trauma. In another embodiment, the bleeding is associated with surgery. In another embodiment, the bleeding is associated with hemorrhagic gastritis and/or enteritis. In another embodiment, the bleeding is metrorrhagia, such as in placental premapse. In another embodiment, bleeding occurs in organs with limited potential for mechanical hemostasis, such as intracranial, intra-aural, or intra-ocular. In another embodiment, the bleeding is associated with anticoagulation therapy.

In further embodiments, the bleeding may be associated with thrombocytopenia. In individuals with thrombocytopenia, the bispecific antibodies described herein may be co-administered with platelets.

Route of administration

The bispecific antibodies described herein may be suitable for parenteral administration, preferably intravenous and/or subcutaneous administration. Subcutaneous administration is the preferred route of administration.

Dosing regimens

The bioavailability and half-life of the bispecific antibodies described herein make them particularly attractive drugs for prophylactic subcutaneous treatment of subjects with acquired and/or congenital coagulopathies. The bispecific antibodies described herein may be administered to a subject suffering from acquired and/or congenital coagulopathy, but not bleeding, once a week, such as once every two weeks, preferably once a month. The bispecific antibodies described herein can be administered to a subject having a coagulopathy prior to surgery and who should undergo invasive procedures such as surgery. The bispecific antibodies described herein can be administered to a subject who has a coagulopathy and is undergoing an invasive procedure such as surgery.

The bispecific antibodies described herein can also be co-administered with exogenous FVIIa, such as plasma-derived or recombinantly produced FVIIa, for on-demand or prophylactic treatment of subjects with coagulopathy or experiencing bleeding events.

The dose administered to a subject with coagulopathy will depend on the route of administration, whether prophylactic or on-demand, and on individual variations. Subcutaneous administration requires a larger dose than intravenous administration.

In an embodiment of the invention, the bispecific antibody is administered subcutaneously at a dose of 1.0 to 30.0 nmol/kg.

Unless otherwise stated in this specification, terms presented in the singular also include the plural.

List of embodiments

The invention is further described by the following non-limiting list of embodiments of the invention:

1. a bispecific antibody comprising

(i) A first antigen-binding site capable of binding factor VII (a), and

(ii) a second antigen binding site capable of binding to TREM-like transcript 1 (TLT-1).

2. The bispecific antibody according to embodiment 1, wherein the first antigen-binding site competes for binding to fvii (a) with any one of the anti-fvii (a) antibodies of table 3:

3. the bispecific antibody of embodiment 1, wherein the antibody competes in a competitive ELISA assay as described in example 7.

4. The bispecific antibody of embodiment 1, wherein the first antigen-binding site is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of FVII (a) (SEQ ID NO: 1).

5. The bispecific antibody of embodiment 1, wherein the first antigen-binding site is capable of binding to an epitope comprising one or more of amino acid residues H115, T130, V131 and R392 of FVII (a) (SEQ ID NO: 1).

6. The bispecific antibody of embodiment 1, wherein the first antigen-binding site is capable of binding to an epitope comprising the following amino acid residues of FVII (a) (SEQ ID NO: 1): r113, C114, H115, E116, G117, Y118, S119, L120, T130, V131, N184, T185, P251, V252, V253, Q388, M391 and R392.

7. The bispecific antibody of embodiment 1, wherein the first antigen-binding site is capable of binding to an epitope comprising one or more of the following amino acid residues of FVII (a) (SEQ ID NO: 1): r113, C114, H115, E116, G117, Y118, S119, L120, T130, V131, N184, T185, P251, V252, V253, Q388, M391 and R392.

8. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises:

CDRL1, represented by SEQ ID NO:847, having 0, 1, 2 or 3 amino acid substitutions

CDRL2, represented by SEQ ID NO:848, having 0, 1, 2 or 3 amino acid substitutions

CDRL3, represented by SEQ ID NO:849, having 0, 1 or 2 amino acid substitutions

CDRH1 represented by SEQ ID NO:851, having 0 or 1 amino acid substitution

CDRH2 represented by SEQ ID NO:852, having 0 or 1 amino acid substitution

CDRL3, represented by SEQ ID NO:853, having 0, 1, 2 and 3 amino acid substitutions.

9. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises:

CDRL1 represented by SEQ ID NO:847,

CDRL2 as represented by SEQ ID NO:848,

CDRL3 represented by SEQ ID NO:849,

CDRH1 represented by SEQ ID NO:851,

CDRH2 represented by SEQ ID NO:852, and

CDRH3 represented by SEQ ID NO: 853.

10. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises heavy chain variable domain and light chain variable domain sequences according to an antibody listed in table 13 or table 14, wherein affinity (K)_D) Is 1nM or less.

11. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises heavy chain variable domain and light chain variable domain sequences according to an antibody listed in table 13 or table 14, wherein affinity (K)_D) Is 5nM or less.

12. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises heavy chain variable domain and light chain variable domain sequences according to an antibody listed in table 13 or table 14, wherein affinity (K)_D) 10nM or less.

13. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises heavy chain variable domain and light chain variable domain sequences according to an antibody listed in table 13 or table 14, wherein affinity (K)_D) 25nM or less.

14. The bispecific antibody of any one of the preceding embodiments, wherein the antibody has an affinity (K) for FVII (a)_D) Less than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM,e.g., less than 400nM, e.g., less than 600nM, e.g., less than 800 nM.

15. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a light chain variable domain represented by SEQ ID NO 846 and a heavy chain variable domain represented by SEQ ID NO 850.

16. The bispecific antibody of embodiment 15, wherein the light chain variable domain and/or heavy chain variable domain sequences have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid substitutions.

17. The bispecific antibody of embodiment 1, wherein the second antigen-binding site competes for binding to TLT-1 with any one of the anti-TLT-1 antibodies of table 4:

18. the bispecific antibody of embodiment 17, wherein the antibody competes in a competitive ELISA assay as described in example 32.

19. The bispecific antibody of embodiment 1, wherein the second antigen-binding site is capable of binding to an epitope comprising the following amino acid residues of TLT-1(SEQ ID NO: 13): k8, I9, G10, S11, L12, A13, N15, A16, F17, S18, D19, P20 and A21.

20. The bispecific antibody of embodiment 1, wherein the second antigen-binding site comprises:

CDRL1, represented by SEQ ID NO:855, having 0, 1, 2 or 3 amino acid substitutions

CDRL2 represented by SEQ ID NO:856, having 0, 1 or 2 amino acid substitutions

CDRL3 represented by SEQ ID NO:857, having 0, 1 or 2 amino acid substitutions

CDRH1 represented by SEQ ID NO:859 with 0 or 1 amino acid substitution

CDRH2 represented by SEQ ID NO:860 with 0, 1, 2 or 3 amino acid substitutions

CDRH3, represented by SEQ ID NO:861, having 0 or 1 amino acid substitutions

21. The bispecific antibody of embodiment 1, wherein the second antigen-binding site comprises:

CDRL1 represented by SEQ ID NO:855,

CDRL2 represented by SEQ ID NO:856,

CDRL3 represented by SEQ ID NO:857,

CDRH1 represented by SEQ ID NO:859,

CDRH2 represented by SEQ ID NO:860,

CDRH3 as represented by SEQ ID NO: 861.

22. The bispecific antibody of embodiment 1, wherein the second antigen-binding site comprises:

CDRL1 represented by SEQ ID NO:871,

CDRL2 represented by SEQ ID NO:872,

CDRL3 represented by SEQ ID NO:873,

CDRH1 represented by SEQ ID NO:875,

CDRH2 represented by SEQ ID NO:876, and

CDRH3 represented by SEQ ID NO: 877.

23. The bispecific antibody of embodiment 1, wherein the second antigen-binding site comprises:

CDRL1 represented by SEQ ID NO:879,

CDRL2 as represented by SEQ ID NO:880,

CDRL3 as represented by SEQ ID NO:881,

CDRH1 represented by SEQ ID NO:883,

CDRH2 represented by SEQ ID NO:884, and

CDRH3 represented by SEQ ID NO: 885.

24. The bispecific antibody of embodiment 1, wherein the second antigen-binding site comprises:

CDRL1 represented by SEQ ID NO:895,

CDRL2 represented by SEQ ID NO:896,

CDRL3 represented by SEQ ID NO:897,

CDRH1 represented by SEQ ID NO:899,

CDRH2 represented by SEQ ID NO:900, and

CDRH3 represented by SEQ ID NO: 901.

25. The bispecific antibody of embodiment 1, wherein the second antigen-binding site is comprised in the light chain variable domain represented by SEQ ID NO 854 and the heavy chain variable domain represented by SEQ ID NO 858.

26. The bispecific antibody of embodiment 25, wherein the light chain variable domain and/or heavy chain variable domain sequences have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid substitutions.

27. The bispecific antibody of any one of the preceding embodiments, wherein the antibody has affinity (K) for TLT-1_D) Less than 1pM, such as less than 10pM, such as less than 100pM, such as less than 200pM, such as less than 400pM, such as less than 600pM, such as less than 1nM, such as less than 5nM, such as less than 10nM, such as less than 20nM, such as less than 50nM, such as less than 100nM, such as less than 200nM, such as less than 400nM, such as less than 600nM, such as less than 800 nM.

28. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises the light chain variable domain represented by SEQ ID NO:846 and the heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in the light chain variable domain represented by SEQ ID NO:854 and the heavy chain variable domain represented by SEQ ID NO: 858.

29. The bispecific antibody of any one of the preceding embodiments, wherein the antibody comprises an Fc region.

30. The bispecific antibody of embodiment 29, wherein the Fc region is an Fc variant of the Fc region of IgG1 comprising the substitutions L234A, L235E, G237A, a330S and P331S.

31. The bispecific antibody of any one of the preceding embodiments, wherein the antibody is a fusion or conjugate of an antigen-binding fragment of an antibody.

32. The bispecific antibody of embodiment 31, wherein one or more of the binding fragments is selected from the group consisting of Fab, Fab ', Fab2, Fab'2, and scFv.

33. The bispecific antibody of any one of the preceding embodiments, wherein the antibody is a multispecific antibody.

34. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NO:5 and 4, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

35. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NOS: 943 and 942, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are each represented by SEQ ID NO: 12.

36. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NO:7 and 6, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

37. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NO:4 and 5, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

38. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NO:942 and 943, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

39. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises a first light chain variable domain represented by SEQ ID NO:846 and a first heavy chain variable domain represented by SEQ ID NO:850, and wherein the second antigen-binding site is comprised in a second light chain variable domain represented by SEQ ID NO:854 and a second heavy chain variable domain represented by SEQ ID NO:858, and wherein the heavy chain constant domains linked to the first and second heavy chain variable domains are represented by SEQ ID NO:6 and 7, respectively, and wherein the light chain constant domains linked to the first and second light chain variable domains are both represented by SEQ ID NO: 12.

40. The bispecific antibody according to embodiment 1, wherein the antibody competes for binding to fvii (a) and for binding to TLT-1:

table 5:

41. the bispecific antibody of embodiment 38, wherein the antibody competes for binding to fvii (a) and for binding to TLT-1 in a competitive ELISA with one or more bispecific antibodies listed in table 5.

42. The bispecific antibody of embodiment 38, wherein the antibody competes in a competitive ELISA assay as described in example 7 and example 32.

43. The bispecific antibody of embodiment 1, wherein the first antigen-binding site is capable of binding to an epitope comprising amino acid residues H115, T130, V131 and R392 of fvii (a) (SEQ ID NO:1), and wherein the second antigen-binding site is capable of binding to an epitope comprising amino acid residues TLT-1(SEQ ID NO:13) of: k8, I9, G10, S11, L12, A13, N15, A16, F17, S18, D19, P20 and A21.

44. The bispecific antibody of embodiment 1, wherein the first antigen-binding site comprises:

CDRL1 represented by amino acid residue (SEQ ID NO:847) having 0, 1, 2 or 3 amino acid substitutions

CDRL2 represented by amino acid residue (SEQ ID NO:848) having 0, 1, 2 or 3 amino acid substitutions

CDRL3 represented by amino acid residue (SEQ ID NO:849) having 0, 1 or 2 amino acid substitutions

CDRH1 represented by amino acid residues (SEQ ID NO:851),

CDRH2 represented by amino acid residue (SEQ ID NO:852), having 0 or 1 amino acid substitution

CDRH3 represented by amino acid residue (SEQ ID NO:853) having 0, 1, 2 and 3 amino acid substitutions, and

wherein the second antigen binding site comprises:

CDRL1, represented by SEQ ID NO:855, having 0, 1, 2 or 3 amino acid substitutions

CDRL2 represented by SEQ ID NO:856, having 0, 1 or 2 amino acid substitutions

CDRL3 represented by SEQ ID NO:857, having 0, 1 or 2 amino acid substitutions

CDRH1 represented by SEQ ID NO:859 with 0 or 1 amino acid substitution

CDRH2 represented by SEQ ID NO:860 with 0, 1, 2 or 3 amino acid substitutions

CDRH3, represented by SEQ ID NO:861, having 0 or 1 amino acid substitutions.

45. The bispecific antibody according to any one of the preceding embodiments, wherein the antibody increases the functional MRT of fvii (a) as measured using the FVIIa activity assay described in example 8.

46. The bispecific antibody of embodiment 41, wherein the antibody increases the functional MRT of FVII (a) by at least 2 fold, at least 3 fold, at least 5 fold, at least 10 fold, at least 20 fold, at least 30 fold or at least 40 fold compared to FVII (a) administered in the absence of the bispecific antibody of the invention.

47. The bispecific antibody according to any one of the preceding embodiments, wherein the antibody is capable of increasing the level of circulating endogenous functionally active FVIIa as determined according to examples 27 and 28 compared to the level of circulating endogenous FVIIa in the absence of the bispecific antibody administered.

48. The bispecific antibody of embodiment 45, wherein the antibody increases the level of circulating endogenous functionally active FVIIa at least 2 fold, at least 4 fold, at least 10 fold, at least 20 fold, at least 40 fold, at least 80 fold, at least 160 fold, at least 320 fold, at least 640 fold.

49. The bispecific antibody according to any one of the preceding embodiments, wherein the antibody is capable of increasing the ability of a FVIIa polypeptide to promote FX activation as determined by the stimulatory activity assay described in example 21.

50. The bispecific antibody of embodiment 43, wherein the stimulatory activity is at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 60-fold, at least 80-fold, at least 100-fold, or at least 150-fold.

51. A pharmaceutical formulation comprising a bispecific antibody according to any one of the preceding embodiments and a pharmaceutically acceptable carrier.

52. The bispecific antibody of embodiments 1-48, wherein the pharmaceutical formulation according to embodiment 49 is administered by subcutaneous administration.

53. The bispecific antibody according to embodiments 1-48 or the pharmaceutical formulation according to embodiment 49 for use as a medicament.

54. The bispecific antibody according to any one of embodiments 1-48 and 50-51 or the pharmaceutical formulation according to embodiment 49 for use in the treatment of coagulopathy, wherein the coagulopathy is congenital and/or acquired.

55. The bispecific antibody of embodiment 52, wherein the coagulopathy is selected from hemophilia A with or without inhibitor, or hemophilia B with or without inhibitor, FVII (a) deficiency and Glanzmann platelet insufficiency.

56. The bispecific antibody for use in treating bleeding according to embodiments 1-48 and 50-51, wherein the bleeding is associated with congenital or acquired hemophilia A, congenital or acquired hemophilia B, hemophilia A with inhibitors, hemophilia B with inhibitors or factor VII (a) deficiency.

57. The use according to any one of embodiments 1-48, wherein the bispecific antibody or pharmaceutical formulation according to embodiment 49 is administered parenterally, such as intravenously, intramuscularly or subcutaneously.

Examples

Example 1: generation of anti-FVII (a) mouse monoclonal antibodies using hybridoma technology

Monoclonal antibody by using the monoclonal antibody with the publication number WO07/115953, FVIIa Q64C-sTF (1-219) G109C disulfide linked complex was prepared by immunization of NMRCF1 mice (Charles River). Mice were initially injected subcutaneously with 20 μ g in FCA (freund's complete adjuvant) and then boosted intraperitoneally with 20 μ g antigen in IFA (freund's incomplete adjuvant). Spleens were removed aseptically and dispersed into single cell suspensions. Splenocytes were fused with x63ag8.653 myeloma cells using electrofusion. Cells were seeded in microtiter plates and incubated at 37 ℃ with 5% CO₂And (5) culturing. Tissue culture medium (RPMI 1640+ 10% fetal bovine serum) containing hat (sigma) for selection was replaced twice. After 10 days of growth, hybridoma clones producing specific antibodies were identified by ELISA screening using the following protocol. NUNC Maxisorb plates were coated with FVIIa Q64C-sTF (1-219) G109C disulfide linked complexes or FVIIa (expressed and purified as described by Thim et al (1988) Biochemistry 27:7785-₂HEPES buffer) and incubated at 4 ℃ overnight. Plates were washed 5 times and in wash buffer (HEPES buffer, 5mM CaCl)₂0.05% tween 20) for 15 minutes. 50 μ L of supernatant was transferred to each well and incubated for 1 hour. The plate was washed 5 times and 50. mu.l of HRP-labeled goat anti-mouse (Fc. gamma. fragment specific; Jackson, working dilution 1/10000) was added. The plates were incubated for 1 hour, washed 5 times, and developed with 50. mu.l TMB (Ready-to-use TMB ONE; Kem-En-Tec) for 10 minutes. By adding 50. mu.l of 4M H₃PO₄The reaction was stopped and read in a FLUOStar Optima microplate reader at 450 and 620 nm.

Hybridoma cells producing positive results were subcloned at least twice by limiting dilution to ensure monoclonality. Antibody purification was performed using standard protein a purification.

Hybridoma cells producing antibodies for PK studies were expanded into T-flasks or shake flasks in RPMI1640+ 10% FBS medium. Conditioned media was harvested by centrifugation and antibodies were purified by protein a affinity chromatography, followed by desalting.

Example 2: cloning and sequencing of mouse anti-FVII (a) antibodies

This example describes the cloning and sequencing of murine Heavy (HC) and Light (LC) chain cDNA sequences encoding anti-fvii (a) antibody variable domains. Total RNA was extracted from hybridoma cells using the RNeasy-Mini kit from Qiagen and used as a template for cDNA synthesis. cDNA was synthesized in a 5' -RACE reaction using SMARTer RACE cDNA amplification kit from Clontech. The use of Phusion Hot Start polymerase (Finnzymes) and inclusion as a forward primer in SMARTer^TMThe subsequent target amplification of the variable domain of HC (called VH) and variable domain of LC (called VL) sequences was performed by PCR using Universal Primer Mix (UPM) in RACE kit. The sequence of the reverse primer used for VH amplification was 5 'agctgggaaggtgtgcacac 3'. The sequence of the reverse primer for VL amplification was 5 'gctctagactaacactcattcctgttgaagctcttg 3'.

The PCR products were separated by Gel electrophoresis, extracted using GFX PCR DNA & Gel Band Purification kit from GE Healthcare Bio-Sciences, and cloned for sequencing using Zero Blunt TOPO PCR Cloning kit and chemically competent TOP10 E.coli (Invitrogen). Sequencing was performed at MWG Biotech, Martinrered, Germany, using M13uni (-21)/M13rev (-29) sequencing primers. All kits and reagents were used according to the manufacturer's instructions.

Example 3: recombinant expression of bivalent antibodies, monovalent antibodies (OA antibodies) and antibody Fab fragments

Transient transfection of HEK293 suspension cells (293Expi, Invitrogen) was used to express bivalent antibodies, monovalent antibodies (single arm known as OA antibodies) and antibody Fab fragments essentially according to the manufacturer's instructions. 293Expi cells were subcultured every 3-4 days in Expi293F expression medium (Invitrogen, Cat. No. A1435104) supplemented with 1% P/S (GIBCO Cat. No. 15140-122). Expi293F cells were transfected using Expifactamine at a cell density of 250-300 ten thousand/mL. For each liter of Expi293F cells, transfection was performed by diluting a total of 1mg plasmid DNA into 50ml Optimem (GIBCO, Cat. No. 51985-026, dilution A) and 2.7ml Expifeacylamine into 50ml Optimem (dilution B). Bivalent antibodies were generated by co-transfection of VH-CH1-CH2-CH3(HC) and VL-CL (LC) plasmids (1:1 ratio), whereas for Fab fragments the plasmids were VH-CH1 and LC (1:1 ratio). To generate OA antibodies, cells were transfected with three plasmids: HC plasmid, LC plasmid and a third plasmid encoding truncated HC (trhc). The HC of the OA-antibody contains a hole mutation (T366S, L368A, Y407V) and trHC contains a knob (T366W) mutation, but knobs and holes may also be reversed. Pestle/hole mutations are described in international patent EP0979281B1 and are introduced to optimize the formation of the desired heterodimer, i.e. the pairing of HC with trHC, and to suppress the formation of the undesired homodimer, i.e. the pairing of trHC with trHC and HC with HC. Dilutions a and B were mixed and incubated at room temperature for 10-20 minutes. The transfection mixture was then added to Expi293F cells and the cells were incubated at 37 ℃ in a humidified incubator under orbital rotation (85-125 rpm). One day after Transfection, transfected cells were supplemented with 5ml expifctamine 293 Transfection Enhancer (Transfection Enhancer)1 and 50ml expifctamine 293 Transfection Enhancer 2. Cell culture supernatants were harvested by centrifugation and then filtration 4-5 days after transfection.

Bivalent and monovalent antibodies are purified by standard protein a affinity chromatography known to those skilled in the art, and, if necessary, additional purification steps, such as gel filtration or ion exchange chromatography. Fab fragments were purified by affinity chromatography using an affinity resin that recognizes the kappa chain of the Fab.

Example 4: preparation of bispecific and OA antibodies by in vitro Assembly

Bispecific antibodies prepared by in vitro assembly

Bispecific antibodies are generated by the in vitro assembly of two parent antibodies in a manner similar to that described by Labrijn et al, PNAS 2013, vol.110, pp.5145-5150, referred to asTechnique (Genmab). Rather than the lgG1 subtype used by Labrijn et al. IgG4 was used in the present invention. The exchange reaction was carried out in the presence of 75mM 2-mercaptoethylamine (2-MEA) at 30 ℃ for 4 hours. The resulting bispecific antibody is purified by ion exchange chromatography to separate the remaining parent antibody from the bispecific antibody. In this embodiment, the firstThe heavy chain constant region of one parent antibody (anti-fvii (a)) was IgG 4S 228P F405L R409K, while the heavy chain constant region of the second parent antibody (anti-TLT-1) was IgG 4S 228P (both using EU numbering). The light chain constant domain is human kappa. These two parent antibodies were generated as described in example 3. Bispecific anti-FVII (a)/anti-TLT-1 antibodies can also be assembled from a set of parent antibodies, wherein the constant domain of the anti-FVII (a) antibody is IgG 4S 228P, and the constant domain of the anti-TLT-1 antibody is IgG 4S 228P F405L R409K.

Monovalent antibodies prepared by in vitro assembly

Monovalent antibodies are generated by in vitro assembly as described above for bispecific antibodies, except that (1) instead of combining two antibodies to form a bispecific antibody, an antibody and a trHC dimer are combined to form a monovalent antibody. In this example, trHC was IgG 4S 228P F405L R409K, and HC was IgG 4S 228P (both using EU numbering). The light chain constant domain is human kappa. Typically, the arm exchange reaction is performed with a 20-50% molar excess of trHC dimer to minimize the amount of bivalent antibody in the reaction mixture. The monovalent antibodies are purified by size exclusion chromatography, optionally supplemented with additional purification steps, such as ion exchange chromatography.

Example 5: in vitro characterization of anti-FVIIa (a) in functional assays

In order to promote the accumulation of endogenous FVIIa and allow it to exert its procoagulant activity, the anti-FVII (a) antibodies of the invention should preferably not impair the activity of FVIIa, and similarly preferably not promote the inactivation of FVIIa by its primary plasma inhibitor antithrombin (A) ((A))H et al (2011) J Thromb Haemost 9: 333-338). To explore these aspects, the effect of anti-fvii (a) antibodies on the procoagulant activity of FVIIa and the inactivation of FVIIa by antithrombin was determined in vitro using the assays described below.

Effect of anti-FVII (a) antibodies on thrombin Generation in human plasma induced by hemophilia A

The effect of bivalent or monovalent anti-fvii (a) antibodies on thrombin generation was measured in a kaolin-triggered thrombin generation assay (TGT) at a 96-well setting. Briefly, hemophilia a-induced plasma was prepared by adding anti-hFVIII antibody 4F30 (described in international patent application publication No. WO 2012/035050) to a final concentration of 37.5 μ g/ml. Phospholipid (Rossix) was added to hemophilia A plasma at a final concentration of 10. mu.M and incubated for 15 minutes at 37 ℃. Purified antibody (100nM) and FVIIa (25nM) were added to the mixture and incubated for 10 min at room temperature. Anti-fvii (a) antibodies were generated as described in examples 1, 2 and 3. Triggering was performed by adding 10. mu.l of kaolin (Haemonetics) followed by 10. mu.l of FIIa FluCa-kit (Thrombinoscope BV) and fluorescence (excitation at 390nm and emission at 460 nm) was measured on an EnVision multiple label reader for two hours.

The thrombin generation assay (Thrombogram) was calculated as the first derivative of the measured fluorescence. The peak thrombin height was calculated as the maximum value in the thrombin generation experiment. The observed peak heights were then normalized and expressed as a percentage by dividing them by the peak heights corresponding to the values observed for 25nM FVIIa in the absence of antibody. Based on this, antibodies were classified as either stimulatory (> 120%), inhibitory (< 90%) or neutral (90% -120%). As shown in table 6, all classes of antibodies were identified. Preferred antibodies are stimulatory or neutral in the TGT assay.

Effect of anti-FVII (a) antibodies on FVIIa inactivation by plasma-derived antithrombin

FVIIa (200nM) was purified by mixing with low molecular weight heparin (enoxaparin, 12. mu.M) and antibody (200- "1000 nM) in 50mM HEPES, 100mM NaCl, 10mM CaCl₂FVIIa inhibition by plasma-derived Antithrombin (AT) in the presence of bivalent or monovalent anti-FVII (a) antibodies was measured by incubation in 0.1% PEG8000, 1mg/ml BSA (pH7.3) for 10 minutes. AT (5. mu.M) was then added and samples were transferred to new microtiter plates AT time points of 10, 20, 30, 40, 60 and 80 minutes in the presence of 1mM S-2288 chromogenic substrate (Chromogenix), 200nM soluble tissue factor (sTF; produced as described by Freskgard et al (1996) Protein Sci 5:1531-residual activity was measured in a ramax instrument (Molecular Devices) at 405nm for 5 minutes. Samples with buffer instead of AT provided uninhibited FVIIa activity.

Residual amidolytic (amidolytic) activity was determined as a function of time relative to activity in the absence of inhibitor. The inhibition constant (kinh) was estimated by fitting the data to a single-phase decay model. The percentage of the value of kin in the presence of fvii (a) -antibody compared to the value determined in the absence of antibody is called kin% and is reported in table 6 for each antibody.

An estimated% of kinh < 60% of antibodies were classified as protecting FVIIa from AT inhibition. An estimated antibody of 60% ≦ kinh% ≦ 150% is classified as neutral, while an estimated antibody of > kinh% > 150% is classified as accelerating AT inhibition of FVIIa. As reported in table 6, antibodies from all three classes were identified. Preferred antibodies are neutral or protect FVIIa from AT inhibition.

Among the antibodies tested, a portion of the antibodies including 11F2(mAb005 and mAb0048, corresponding to fully murine and murine/human chimeras, respectively) were found to have the desired in vitro properties as described above.

TABLE 6Functional characterization of anti-fvii (a) antibodies in Thrombin Generation (TGT) and anti-thrombin (AT) inhibition assays as described in example 2.

Example 6: SPR analysis of antibody binding to FVIIa and Effect of pH and calcium

Binding of the antibody from example 5 to FVIIa was probed by surface plasmon resonance (Biacore T200). Anti-mouse IgG (supplied by GE Healthcare) was immobilized on CM4 sensor chips (both supplied by GE Healthcare) using standard amine coupled chemistry kits. Purified anti-FVII (a) antibodies according to Table 7 (0.25nM) were injected at a flow rate of 10. mu.l/min for 1 min. Subsequently, 5, 15, 45 and 135nM FVIIa were injected at a flow rate of 30. mu.l/min for 7 minutes to allow binding to the anti-FVII (a) antibody, followed by a 9 minute buffer injection to allow binding to the anti-FVII (a) antibodyAllowing dissociation from anti-FVII (a) antibodies. By diluting 10XHBS-P buffer (supplied by GE Healthcare) 10-fold and supplementing with 1mg/ml BSA and 5mM CaCl₂To give 10mM HEPES, 150mM NaCl, 0.05% v/v polysorbate 20(P20), pH7.4, 5mM CaCl₂Running buffer was prepared with 1mg/ml Bovine Serum Albumin (BSA). The running buffer was also used to dilute anti-FVII (a) antibodies and FVII samples. Regeneration of the chip was achieved using a regeneration buffer consisting of 10mM Gly-HCl pH 1.7 (supplied by GE Healthcare). Binding data were analyzed according to the 1:1 model using BiaEvaluation 4.1 supplied by the manufacturer (Biacore AB, Uppsala, Sweden). The analysis led to the binding constants reported in table 7, demonstrating high affinity binding of several antibodies to FVIIa, including 11F2(mAb005 and mAb0048, corresponding to a fully murine and murine/human chimera, respectively).

TABLE 7Estimated binding constants for the interaction of anti-fvii (a) antibodies with FVIIa, as determined by Surface Plasmon Resonance (SPR) analysis according to example 6.

pH and CaCl₂The effect of binding of the selected antibodies from example 5 to FVIIa and cFVIIa-chimeras was probed by surface plasmon resonance (Biacore T200) at 37 ℃. The cFVIIa-chimera sequence is indicated in the section titled detailed description of the invention and is expressed as outlined in examples 16 and 26. Anti-mouse IgG (supplied by GE Healthcare) was immobilized on CM4 sensor chips (both supplied by GE Healthcare) using standard amine coupled chemistry kits. A pre-equilibrated mixture of 1.2nM FVIIa and 0.5nM 4F9 (NN internal anti-FVII murine Ab binding to the FVIIa EGF1 domain) was injected at a flow rate of 10. mu.l/min for 1 min. Subsequently, an anti-FVII (a) antibody of 540, 180, 60, 20, 6.66, 2.22, 0.74, 0.25nM was injected at a flow rate of 30. mu.l/min for 7min to allow binding to FVIIa, followed by a 9min buffer injection to allow dissociation from FVIIa. Two running buffers were prepared. Buffer 1 was prepared by diluting 10XHBS-P + (supplied by GE Healthcare) 10 fold and supplementing 1mg `ml BSA and 5mM CaCl₂To give 10mM HEPES, 150mM NaCl, 0.05% v/v polysorbate 20, pH7.4, 5mM CaCl₂1mg/ml Bovine Serum Albumin (BSA). Buffer 2 was prepared by 10-fold dilution of 10 XSS-P + (supplied by GE Healthcare) and supplementation with 1mg/ml BSA, 5. mu.M CaCl₂And the pH was adjusted to 6.0 (using 4M HCl) to give 10mM HEPES, 150mM NaCl, 0.05% v/v polysorbate 20, pH6.0, 5. mu.M CaCl₂1mg/ml Bovine Serum Albumin (BSA). FVIIa, anti-FVII antibody 4F9 and anti-FVII (a) antibody were diluted in these two running buffers, respectively. Regeneration of the chip was achieved using a regeneration buffer consisting of 10mM Gly-HCl pH 1.7 (supplied by GE Healthcare). Binding data were analyzed according to the 1:1 model using BiaEvaluation 4.1 supplied by the manufacturer (Biacore AB, Uppsala, Sweden). The analysis led to the binding constants reported in table 7b, demonstrating the high affinity binding retained between FVIIa and anti-fvii (a) antibodies.

TABLE 7bEstimated binding constants and fold difference of interaction of FVIIa and anti-fvii (a) antibodies in two different buffers, as determined by Surface Plasmon Resonance (SPR) analysis according to example 6.

Example 7: identification of antibodies competing with mAb0005(11F2) for binding to FVII (a) in a competitive ELISA

To determine whether the anti-fvii (a) antibody with the desired in vitro properties from example 5 competed for binding to fviia (a) with mAb0005(11F2) and its derived antibodies, competition studies were performed using the corresponding Fab fragment Fab 0076. FVIIa, H-D-Phe-Phe-Arg-Chloromethane (FFR-cmk; Bachem, Switzerland) active site inhibited FVIIa (FVIIai; see example 9) in dilution buffer (20mM HEPES, 5mM CaCl)₂150mM NaCl, pH7.2) at a concentration of 125ng/ml were fixed on NUNC maxisorp plates overnight at 4 ℃. Plates were washed and washed in wash buffer (20mM HEPES, 5mM CaCl)₂150mM NaCl, 0.5mL/L Tween 20, pH7.2) for 15 minutes. Biotinylation Using StandardThe kit (EZ-Link, Thermo) biotinylates 11F2-Fab0076 according to the manufacturer's instructions. For competition studies, a final fixed concentration of 10ng/ml of biotinylated Fab0076 was combined with a series of dilutions of anti-fviia (a) antibody to give a final concentration in the dilution buffer in the range of 100mg/ml to 9.5 ng/ml. The mixture was added to the wells of the plate and allowed to incubate for 1 hour. The plates were then washed and HRP-labeled streptavidin-HRPO (1: 2000 in dilution buffer; Kirkegaard)&Perry Labs) and incubated for 1 hour. Finally, the plates were washed and developed with TMB ONE (KEMENTEC) for 10 min. By addition of H₃PO₄(4M) the reaction was stopped and the plate was read in a FLUOStar Optima microplate reader at 450nm, minus the background signal measured at 620 nm. All incubations were performed at room temperature unless otherwise stated, and the plates were washed 5 times with wash buffer.

From the measured signal (OD units), the competition at any given antibody concentration was calculated as follows

% inhibition ═ 100 (1- (OD unit-100% inhibition)/(0% inhibition-100% inhibition) — where 0% inhibition is determined from the signal in wells without any competing anti-fvii (a) antibody and 100% inhibition is determined as the signal from wells without biotinylated Fab0076 (i.e. corresponding to assay background). An antibody is considered to compete with 11F2(mAb0005) for binding to fvii (a) if at least 50% inhibition (% inhibition) is observed at antibody concentrations measured up to 10000-fold excess of biotinylated Fab 0076. The results are summarized in table 8.

TABLE 8Competes with 11F2-Fab0076(mAb0005) for binding to FVII (a). Antibodies were classified as competitors or non-competitors using a 50% cut-off as described in example 7.

Example 8: FVIIa Activity assay

Essentially as described in Morisey JH et al, Blood, 1993; 81:734-44, using a catalyst fromThe FVIIa activity was measured with the reagent of the VIIa-rTF kit (diagnostic Stago). The assay was performed on an ACLTOP500 automated coagulometer from Instrumentation Laboratory. In the assay were 40 μ l of diluted animal plasma samples, calibrators (recombinant fviia (rfviia) reference material calibrated against international WHO reference) or Quality Control (QC) samples, mixed with 40 μ l of plasma deficient in FVII and 40 μ l of soluble tissue factor (sTF) and phospholipids. 25mM CaCl in a volume of 40. mu.l was added₂To initiate the reaction and to measure the clotting time by the instrument. The samples and QC clotting times were compared to rFVIIa calibration curves, and plasma concentrations were the same as the diluted samples to mitigate plasma interference. The calibration curve ranges from 5-1000mIU/mL and is fitted using a cubic polynomial equation. QC and sample results were calculated by software on the ACLTOP500 instrument. Results in IU/mL were converted to nM using the specific activity of the administered compound (IU/pmol).

Example 9: pharmacokinetics in rats of recombinant FVIIa co-formulated with anti-FVII (a) antibodies

Monoclonal anti-fvii (a) antibodies with the desired in vitro properties from example 5 were administered intravenously to male Sprague Dawley rats with 20nmol/kg human FVIIa in a co-formulation. The molar ratio of FVIIa to antibody was 1:1 or 1:5, as shown in table 9. During the experiment, the animals were allowed free access to food and water. FVIIa plasma activity was measured using the FVIIa activity assay as described in example 8.

Pharmacokinetic analysis was performed by a non-compartmental method using WinNonlin. Mean Residence Time (MRT) was calculated from the data. The results are given in table 9.

Of the antibodies with the desired properties from example 5, mAb0005(11F2) and mAb0001(11F26) gave the longest mean residence time of human FVIIa, 7.9 and 7.5 hours, respectively, compared to 1.1 hours for free human FVIIa (see table 9). mAb0005 and mAb0001(mAb0759) are high affinity antibodies (example 6) that show competition for binding to FVIIa (example 7).

TABLE 9Mean Residence Time (MRT) of FVIIa plasma activity in sprague dawley rats after intravenous administration of 20nmol/kg FVIIa in a molar ratio of 1:1 or 1:5 with the indicated antibodies. Vehicle means FVIIa administered in combination with buffer but not with antibody.

anti-FVII (a) antibodies	Molar ratio of FVIIa to antibody	MRT(h)
			Media	n.a.	1.1
mAb0005	1:5	7.9
			mAb0007	1:1	3.9
mAb0018	1:5	1.1
			mAb0004	1:5	3.6
mAb0001	1:1	7.5
			mAb0587	1:1	4.0
mAb0578	1:1	4.2

Example 10: 11F2 Effect of anti-FVII (a) antibodies on FX activation by free or TF-complexed FVIIa

Preferably, the anti-fvii (a) antibodies of the invention should not interfere with the pharmacological action of FVIIa on the membrane surface or the initiation of coagulation, i.e. the activation of FX by the FVIIa-TF complex. To explore these aspects, the effect of 11F2 on TF-independent and TF-dependent proteolytic activity of FVIIa was determined in the absence or presence of lipidated TF, respectively. The one-armed monovalent antibody format was used to avoid avidity effects due to simultaneous binding of two FVIIa molecules to a normal bivalent antibody.

Effect of the 11F2 antibody on FX activation by FVIIa in the Presence of phospholipid membranes

In assay buffer (50mM HEPES, 100mM NaCl, 10mM CaCl) containing 10nM FVIIa, 0 or 200nM antibody (see Table 10) and 25. mu.M 25:75 phosphatidylserine phosphatidylcholine Inc₂pH7.3, 0.1% PEG8000, and 1mg/ml BSA). The reaction was initiated by addition of 0-300nM human plasma-derived factor x (fx) and incubated in 96-well plates for 20 min at room temperature with a total reaction volume of 100 μ Ι (n ═ 2). After incubation, by adding 50. mu.l of quenching buffer (50mM HEPES, 100mM NaCl, 10mM CaCl)₂80mM EDTA, pH7.3) was added followed by 50. mu.l of 1mM S-2765 aqueous chromogenic substrate (Chromogenix). Spectramax microplate spectrophotometer was used as a line at 405nm for 10 minutesThe slope of the increase in the sexual absorbance was measured for the conversion of the chromogenic substrate by the FXa produced. By correlating the measured slope with the slope generated with a known amount of plasma-derived human FXa under similar conditions, the initial rate of FXa generation on a molar basis can be estimated. Data were matched to the Michaelis-Menten equation (v ═ kcat [ FX [) using GraphPad Prism]*[FVIIa-TF]/(Km+[FX]) ) to estimate enzyme kinetic parameters.

As shown in table 10, in the presence of phospholipid vesicles, the monovalent 11F2 did not affect the rate at which free FVIIa activated FX.

Effect of the 11F2 antibody on FX activation by FVIIa in the Presence of TF

In assay buffer (50mM HEPES, 100mM NaCl, 10mM CaCl) containing 100pM FVIIa, 0 or 200nM antibody (see Table 10) and 2pM E.coli-derived TF fragment 1-244 incorporated into 25:75 phosphatidylserine phosphatidylcholine (PS: PC) vesicles as described by Smith and Morrissey (2005) J.Thromb.Haemost.,2:1155-1162₂pH7.3, 0.1% PEG8000, and 1mg/ml BSA). The reaction was initiated by addition of 0-30nM human plasma-derived factor x (fx) and incubated in 96-well plates for 20 min at room temperature with a total reaction volume of 100 μ Ι (n ═ 2). After incubation, the reaction was quenched and FXa was quantified as described above.

As shown in Table 10, monovalent 11F2(mAb0077(OA)) did not affect the rate at which FX is activated by the FVIIa/TF complex.

Watch 10Effect of the monovalent form of 11F2 at 200nM on the kinetic parameters of FX activation of the FVIIa-TF complex according to embodiment 10. The parameters shown as mean ± SD (n-3) were estimated by fitting the Michaelis-Menten equation. k is a radical of_cat/K_MRelative to the value determined in the absence of antibody.

Example 11: effect of the 11F2 antibody on inhibition of FVIIa by plasma inhibitors

FVIIa exhibits a relatively short half-life in circulation, in part because it is inactivated by the abundant plasma inhibitor Antithrombin (AT). Similarly, animal studies have shown that α -2-macroglobulin, another plasma inhibitor, is associated with inactivation of FVIIa. Using purified plasma-derived inhibitors, the effect of monovalent 11F2 antibody on the inactivation of FVIIa by these inhibitors was investigated.

The effect of the 11F2 antibody on the inhibition of FVIIa by antithrombin

Inhibition of FVIIa with human plasma-derived AT in the presence of a monovalent 11F2 antibody (mAb0048, mAb0077(OA)) was performed under pseudo-first order conditions. The assay was performed at room temperature in assay buffer (50mM HEPES, 100mM NaCl, 10mM CaCl) containing 200nM FVIIa, 12. mu.M low molecular weight heparin (enoxaparin, European pharmacopoeia reference, code E0180000, batch 5.0, Id 00CK18) and 0 or 1000nM antibody₂0.1% PEG8000, 1mg/ml BSA, pH7.3) in a volume of 200. mu.l. After a pre-incubation time of 10 min, the reaction was initiated by the addition of 5 μ M AT (antithrombin III, Baxter, Lot VNB1M 007; repurification on a heparin-Sepharose column to remove serum albumin from the preparation). At selected time points, 10 μ l aliquots were transferred to a total volume of 200 μ l containing 0.5mg/ml polybrene (hydrabamine, Sigma, cat # H9268, batch SLBC8683V), 200nM sTF and 1mM S-2288(Chromogenix) to quench the reaction and saturate FVIIa with sTF, which allowed measurement of residual FVIIa activity from monitoring 5 min of chromogenic substrate hydrolysis at 405 nM. Residual amidolytic activity was determined as the slope of the linear course curve after subtraction of the blanks, and these curves were then fitted to a first order exponential decay function using GraphPad Prism software to obtain the pseudo first order rate constant (kapp) for the reaction. The apparent second order rate constant (kinh) is estimated by dividing kapp by the AT concentration.

From this analysis, it was found that the FVIIa inhibition rate in the presence of monovalent 11F2(mAb0077(OA)) was 133. + -. 10M^-1s^-1In contrast, inhibition of free FVIIa was 124. + -.7M^-1s^-1。

Effect of the 11F2 antibody on alpha-2-macroglobulin inhibition of FVIIa

Under the pseudo-first-order conditions,FVIIa is inhibited by human plasma-derived alpha-2-macroglobulin in the presence of 0 or 1000nM of a monovalent 11F2 antibody (mAb0077 (OA)). The assay was performed at room temperature in assay buffer (50mM HEPES, 100mM NaCl, 5mM CaCl) containing 200nM FVIIa and 0 or 1000nM antibody₂0.1% PEG8000, 0.01% Tween 80, pH7.3) in a volume of 100. mu.l. The reaction was initiated by the addition of 0 or 1000nM of alpha-2-macroglobulin purified from human plasma as described in Banbunla et al (2005) J. biochem.,138: 527-. At selected time points, 10. mu.l aliquots were transferred to 190. mu.l buffer (50mM HEPES, 100mM NaCl, 5mM CaCl) containing 200nM sTF and 1mM S-2288(Chromogenix)₂0.1% PEG8000, 1mg/ml BSA, pH7.3), which allows measuring the residual FVIIa activity from the hydrolysis of the chromogenic substrate, monitored at 405nM for 5 minutes. Residual amidolytic activity was determined as the slope of the linear course curve after subtraction of the blanks, and these curves were then fitted to a first order exponential decay function using GraphPad Prism software to obtain the pseudo first order rate constant (kapp) for the reaction. The apparent second order rate constant (kinh) was estimated by dividing kapp by alpha-2-macroglobulin concentration.

In the absence of antibody, alpha-2-macroglobulin was found to inhibit FVIIa with an apparent secondary rate constant of 475. + -.21M^-1s^-1. However, no significant inhibition of FVIIa was observed in the presence of the monovalent 11F2 antibody (mAb0077(OA)) until 125 minutes at the last time point. From these studies the following conclusions can be drawn: 11F2 does not affect the inhibition of FVIIa by antithrombin, but rather protects FVIIa from inhibition by alpha-2-macroglobulin.

Example 12: effect of the 11F2 antibody on FVII Autoactivation

Following vascular injury, endogenous FVII binds with high affinity to its cofactor Tissue Factor (TF), which is exposed on cells surrounding the vascular endothelium. In this process, FVII is converted to FVIIa by limited proteolysis. Activation is thought to occur as a result of TF-mediated transactivation of FVIIa-FVII (also known as auto-activation). To determine the effect of the 11F2 antibody on FVII auto-activation, FVII activation was measured in the presence of lipidated TF, FVII, a limiting concentration of FVIIa and a monovalent 11F2 antibody.

In assay buffer (50mM HEPES, 100mM NaCl, 5mM CaCl) containing 2nM FVIIa, 145nM FVII, 0 or 200nM monovalent 11F2 antibody (mAb0077(OA))₂pH7.3, containing 0.1% PEG8000 and 1mg/ml BSA). The reaction was initiated by the addition of 2nM lipidated E.coli-derived TF fragment 1-244 incorporated into 25:75PS: PC vesicles as described by Smith and Morrissey (2005) J.Thromb.Haemost.,2: 1155-1162. The total reaction volume was 100. mu.l. At selected time points (typically 5, 10, 15, 20, 30, 40, 50 and 60 minutes), the quantity of FVIIa produced was quantified according to the subsampling procedure described below.

FVIIa quantification by subsampling-at selected time points, 10. mu.l samples were quenched by transferring them into 140. mu.l 50mM HEPES, 100mM NaCl, 5mM EDTA containing 0.1% PEG8000, 1mg/ml BSA and 215nM soluble tissue factor (sTF). After all samples were collected by adding 60mM CaCl₂50 μ l S-2288(4mM) in (C) was measured for FVIIa chromogenic activity. The conversion of the chromogenic substrate by the FVIIa formed was measured using a Spectramax microplate reader with a slope of the linear absorbance increase at 405nM over 10 minutes. By correlating the measured slope with the slope generated under similar conditions using a known quantity of FVIIa, the molar concentration of FVIIa can be estimated.

FVIIa autoactivation was found to be TF dependent, and FVIIa activity measured from table 11 indicates that it was not impaired by the presence of the monovalent 11F2 antibody.

TABLE 11: TF-mediated automatic activation of FVIIa according to embodiment 12 in the absence or presence of the 200nM monovalent 11F2 antibody mAb0077(OA)

Example 13: crystal structure of 11F2-Fab0076 complexed with active site-inhibited FVIIa and soluble tissue factor

To determine the epitope on FVII (a) recognized by the murine antibody 11F2, the corresponding Fab fragment (Fab0076) was crystallized in complex with H-D-Phe-Phe-Arg-chloromone (FFR-cmk; Bachem, Switzerland) active site-inhibited FVIIa (FVIIai) and soluble tissue factor fragment 1-219(sTF) using the pendant drop method according to Kirchhofer.D. et al, Proteins Structure Function and Genetics (1995),22, 419-425.

Crystallization of

Crystals of Fab0076 mixed with the FVIIai/sTF complex at a 1:1 molar ratio were grown at 18 ℃ using the hanging drop vapor diffusion technique. Mu.l of 4.6mg/ml protein complex in 10mM HEPES, 50mM NaCl, 5mM CaCl₂(pH7.0) with 0.5. mu.l 100mM sodium citrate (pH 6.2) and 20% PEG6000 as a precipitant, and incubated at a temperature of 18 ℃ on 1ml of the precipitant solution to obtain crystals of the complex.

Diffraction data acquisition

Prior to rapid cooling in liquid nitrogen, the crystals were cryoprotected in a solution consisting of 75mM sodium citrate (pH 6.2), 15% PEG6000, 4% glycerol, 4% ethylene glycol, 4.5% sucrose and 1% glucose. Diffraction data was collected at 100K at MAX-lab (Lund, Sweden) beam line I911-3 using a marCCD225 detector from MAR Research. Automatic indexing, integration and scaling of the data was performed using the program from the XDS package (diffraction data statistics are summarized in table 12).

Structure determination and refinement

The structure was determined by molecular replacement with the a and B chains of protein database entry 1YY8 and protein database entry 3ELA using Phaser as implemented in the program suite Phenix. The asymmetric unit contains two Fab, the FVIIai/sTF complex. The model was refined using a Phenix refinement and manual reconstruction step in COOT. The refinement statistics are shown in table 12.

TABLE 12: data acquisition and refinement statistics from X-ray crystallographic structure measurements of the complex between active site-inhibited FVIIa, soluble tissue factor (sTF) and Fab 0076. The statistics of the highest resolution shell are shown in parentheses.

Epitopes (defined as having in FVIIai a distances less than or equal to the non-hydrogen atoms in Fab0076Residues other than hydrogen atoms within the distance of (a) include the following residues according to SEQ ID NO: 1:

R113

C114

H115

E116

G117

Y118

S119

L120

T130

V131

N184

T185

I186

P251

V252

E265

M391

R392

E394

paratope (defined as Fab0076 with a distance of less than or equal to the non-hydrogen atom in FVIIai) was foundResidues other than hydrogen atoms within the distance of) include the following light chain residues according to seq id No. 64:

Q27

G28

S30

D31

Y32

K49

Y50

Q53

H92

S93

F94

and heavy chain residue according to SEQ ID NO: 63:

D32

Y54

N59

N101

Y102

Y103

G104

N105。

example 14: humanized mouse 11F2

In order to humanize the murine antibody 11F2(mAb0005) having sequences corresponding to the VH and VL domains of SEQ ID No.754 and SEQ ID No.750, respectively, while retaining its high binding affinity for fvii (a), we combined information from sequence identity relative to the human germline, the crystal structure of the complex between Fab0076 (example 12) and active site-inhibited FVIIa (example 9), and in vitro binding data. At the outset, we used the blast algorithm to search human germline databases for human VH, VL and VJ sequences (for both Heavy Chain (HC) and Light Chain (LC)) with high sequence identity to the murine variable domain sequence of 11F 2. For the VH of HC, the sequences with the highest sequence identity are: IGHV4-30-4 x 01, IGHV4-28 x 01, IGHV4-28 x 06 and IGHV459 x 01, whereas for the VJ segment of HC the top ranked species are: IGHJ5 × 01, IGHJ4 × 01. For LC, the ranked prostate sequence of VL is: IGKV6D-41 x 01 and IGKV3-11 x 01, for VJ segments: IGKJ2 × 01 and IGKJ2 × 02 (table 12). Next, the differences between the human germline and murine VH and VL sequences were mapped onto the crystal structure of the Fab0076/FVIIa complex. Is expected to be greater than or equal to the residue in the epitopeResidues in the murine variable domain of distance (d) have little or no effect on binding affinity and are exchanged for the corresponding human germline amino acid entity. In addition, the residues that make up the paratope are thought to be more problematic to replace without affecting affinity, thus preserving the murine amino acid entity. IdentificationA subset of residues near the binding interface that may affect binding affinity are identified. Humanized variants are generated by mutating residues distal to the epitope to human amino acid entities from the germline alignment. In addition, residues near the paratope are mutated in a subset to human entities, so that the variants are as close as possible to the human germline. This group includes variants with murine CDRs grafted onto a fully human germline of HC and LC. From the initial analysis, 12 LCs and 13 HCs were generated and paired into 23 variants according to table 13.

The binding affinity of the humanized antibody to FVIIa (listed in table 13) was measured using Bio-Layer interferometry (Fortebio). All steps were performed in running buffer (20mM HEPES buffer (pH7.4), 150mM NaCl, 5mM CaCl)₂0.03% Tween 20, 1mg/ml BSA without IgG) at 30 ℃. The antibody was captured on an anti-human tip (AHC, Fortebio) for 3 minutes at a concentration of 10 ug/ml. An incubation of 3 minutes was then performed to establish a baseline. After this, the association was monitored for 3 minutes using four different concentrations of FVIIa (25nM, 50nM, 100nM and 200nM), followed by 3 minutes of dissociation. Sensorgrams were analyzed using Fortebio data analysis software. Fortebio data was used for ranking, while absolute affinity values may deviate from the values determined by SPR (example 6, table 7).

TABLE 12: human germline sequences for humanization of murine 11F 2. The numbers in parentheses reflect the identity between the murine variable domain of Fab0076 and the designated human germline sequence ((n/m) denotes n identical positions out of a total of m positions)

Watch 13: pairing of VH and VL in the first round of humanization of murine 11F2-mAb0048, and measured affinity of the corresponding antibody for FVIIa (determined as described herein). For some variants, no binding (nb) was measured.

Variants from the first round of humanization with equal or higher affinity to the parent murine antibody were identified and those mutations found to retain or improve binding affinity were used to design the second round variants. From this set of mutations, a second round of variants was generated by inserting as many of these mutations as possible on top of the humanized HC and LC already having the desired affinity. From this analysis, 19 VH sequences (corresponding to SEQ ID NOs: 314, 514, 522, 530, 538, 546, 554, 562, 570, 578, 586, 594, 602, 610, 618, 626, 634, 642, and 650) and 25 VL sequences (corresponding to SEQ ID NOs: 310, 318, 326, 334, 342, 350, 358, 366, 374, 382, 390, 398, 406, 414, 422, 430, 438, 446, 454, 462, 470, 478, 486, 494, and 502) were designed and experimentally tested by combining all VLs with VL to yield a total of 475 combinations. Dissociation constant (KD) values for binding of the resulting 475 humanized antibodies to FVIIa were measured using Bio-Layer interferometry (Fortebio) as described above. The measured KD values are listed in table 14.

TABLE 14Dissociation constant values for humanized variants of murine 11F2 anti-fvii (a) antibody (M, nb denotes no binding). Antibodies are defined by their respective VH and VL SEQ ID NOs.

TABLE 14(continuation)

TABLE 14(continuation)

SPR analysis of humanized 11F2 variants

The affinity of the selected humanized 11F2 variants was determined by SPR analysis as detailed in example 6. The measured dissociation constants are listed in table 15 and show that the variants bind with retained high affinity to human FVIIa.

Watch 15Monovalent forms of humanized 11F2 antibody and estimated binding constant (K) for biAb interaction with FVIIa_D) As determined by Surface Plasmon Resonance (SPR) analysis according to example 6.

anti-FVII (a) antibodies	KD(M)
		mAb0077(OA)	4.1E-11
mAb0099(OA)	1.2E-10
		mAb0138(OA)	1.3E-10
mAb0140(OA)	8.3E-11
		mAb0141(OA)	7.8E-11
mAb0142(OA)	1.0E-09
		mAb0143(OA)	7.9E-11
mAb0705(OA)	5.05E-11
		mAb0706(OA)	5.42E-11
mAb0707(OA)	1.06E-10
		mAb0709(OA)	1.04E-10
mAb0710(OA)	1.28E-10
		biAb0001	0.06E-09
biAb0245	600E-09

Functional characterization of humanized 11F2 variants

The effect of the selected humanized 11F2 variants on FVIIa activity and sensitivity to antithrombin inhibition was determined as detailed in example 5. The results are listed in table 16 and show that the humanized variants retain the desired properties with respect to these parameters.

TABLE 16Functional characterization of anti-fvii (a) antibodies in Thrombin Generation (TGT) and anti-thrombin (AT) -inhibition assays as described in example 5.

Pharmacokinetics of FVIIa in rats Co-formulated with humanized 11F2 variant

As detailed in example 9, a family of humanized 11F2 variants was administered intravenously to male Sprague Dawley rats in a co-formulation with 20nmol/kg FVIIa.

The results are given in table 17 and show that several humanized 11F2 variants confer the same long half-life to FVIIa as the parent antibody.

TABLE 17: mean residence time of FVIIa plasma activity (MRT) in Sprague Dawley rats after intravenous administration of 20nmol/kg FVIIa in different molar ratios to the antibody. The values are mean ± SD, n is 3. n.a.: not applicable to

anti-FVII (a) antibodies	Molar ratio of FVIIa to antibody	MRT(h)
			Media	n.a.	1.1
mAb0005	1:5	7.9
			mAb0077(OA)	1:1	11±0.2
mAb0099(OA)	1:1	7.7±0.4
			mAb0137(OA)	1:1	7.0
mAb0139(OA)	1:1	2.7
			mAb0140(OA)	1:1	7.7
mAb0141(OA)	1:1	7.7
			mAb0705(OA)	1:1	7.7±0.4
mAb0706(OA)	1:1	7.3±0.3
			mAb0707(OA)	1:1	6.4±1.0
mAb0709(OA)	1:1	5.9±0.4
			mAb0710(OA)	1:1	5.7±0.3

Example 15: crystallization and epitope mapping of 11F2Fab0883 complexed with active site-inhibited FVIIa and soluble tissue factor

To determine the epitope on FVII (a) recognized by humanised 11F2, i.e.mAb 0705(OA) and mAb0842(OA), the corresponding Fab fragment Fab0883 was co-crystallized using the hanging drop method with H-D-Phe-Phe-Arg-chloromone (FFR-cmk; Bachem, Switzerland) active site inhibited FVIIa (FVIIai) and soluble tissue factor fragment 1-219(sTF), as described by Kirchhofer.D. et al, protein Structure Function and Genetics (1995),22, 419-425.

Crystallization of

Crystals of the Fab-FVIIai/sTF-complexed SEC-purified complex were grown at 18 ℃ using the sitting-drop vapor diffusion technique. 360nl of the protein complex (4.5mg/ml) were placed in 20mM HEPES, 150mM NaCl, 0.1mM CaCl₂(pH7.4) the protein solution was mixed with 360nl of a precipitant solution containing 0.15M CsCl and 15% (w/v) polyethylene glycol 3350 and 360nl of water, and equilibrated with 80. mu.l of the precipitant solution. The crystals grew within 6 weeks.

Diffraction data acquisition

The crystals were cryoprotected in a solution consisting of 0.15M CsCl, 15% (w/v) ethylene glycol 3350 and 20% (v/v) glycerol before rapid cooling in liquid nitrogen. Diffraction data were collected at 100K on a Rigaku FRX rotating anode generator equipped with a decris Pilatus1M detector. Data reduction was performed using the program from the XDS package (diffraction data statistics are summarized in table 18).

Structure determination and refinement

All crystallographic calculations were performed using the Phenix crystallographic procedure suite. The structure was determined by molecular replacement using the Phaser program with the coordinates of the complex structure obtained as described in example 13 as a search model. The asymmetric unit contains four Fab, the FVIIai/sTF complex. An iterative loop of manual reconstruction using COOT and Phenix refinement yielded the final model (table 18).

Table 18:data acquisition and refinement statistics from X-ray structural measurements of the complex between active site-inhibited FVIIa, soluble tissue factor (sTF) and Fab 0883. The statistics of the highest resolution shell are shown in parentheses.

Epitope mapping

If all four independently defined FVIIa molecules in the crystal have a position less than or equal to the non-hydrogen atom in the FabIs not a hydrogen atom of the residue, the residue is considered to be part of the epitope. Thus, the epitope was found to comprise the following residues according to SEQ ID NO: 1:

R113

C114

H115

E116

G117

Y118

S119

L120

T130

V131

N184

T185

P251

V252

V253

Q388

M391

R392

complementary bit determination

If all four independently defined Fab molecules in the crystal have a position less than or equal to the non-hydrogen atom in FVIIaIs considered to be part of the paratope. The paratope was found to comprise the following light chain residues (according to SEQ ID NO: 814):

Q27

G28

Y32

Y50

H92

S93

F94

and heavy chain residues (according to SEQ ID NO: 818):

D32

Y54

Y103

N105

example 16: hot spot analysis of 11F2 mAb0842(OA) using SPRExpression of alanine variants of FVIIa

hFVII alanine variants were generated using QMCF technology, a stable free expression system (Icelain). In CO₂CHOEBNALT85 cells were cultured in Qmix1 medium (1L ═ 1:1CD-CHO and SFM II (NVO11514701) +10ml Pen/Strep (Gibco, 15140-. On the day of transfection, 1 × 10e7 CHOEBNALT85 cells were transfected with 2. mu.g of hFVII variant-encoding plasmid and 50. mu.g of salmon sperm DNA using electroporation (Bio-Rad Gene Pulser Xcell electroporation System, 300V, 900. mu.F, 4mm cuvette). One day after transfection, G418 selection was initiated by transferring cells to Qmix2 medium (1L ═ 1:1CD-CHO and SFM II (NVO11514701) +10ml Pen/Strep (Gibco, 15140-. 10-14 days after G418 selection, cells reached>95% viability (Vi-Cell XR Cell counter). The cells were split in 2 × E1000 flasks from 0.4 × 10E6 cells/ml to 2 × 250ml Qmix 2. After 3-4 days, the cells reached a density of about 4-5 × 10e6 cells/ml. Expression was initiated by addition of 20% CHO CD Efficient Feed B (Gibco A10240) +6mM GlutaMax (Gibco, 35050). After 4 days, 10% CHO CD Efficient Feed B +6mM GlutaMAX was added. On day 6 after start, cultures were harvested and centrifuged (200g, 5 min). The supernatant was collected and 15mM HEPES (Gibco, 15630) and 5mM CaCl were added₂(Sigma, 21115). The supernatant was filter sterilized using a 0.22 μm bottle top filter (Corning, CLS 430049).

Expression and purification of cFVIIa-chimera (22017-

Similar expression systems as outlined above were used to generate cFVIIa-chimeras. The zymogen cFVII-chimera was purified from the culture medium using an affinity column prepared by coupling an internal anti-FVII (a) antibody (F1A2) to agarose beads as described in example 26. Anti-fvii (a) antibody F1a2 binds to the Gla domain of fvii (a) in a Ca + + dependent manner. The zymogen cFVII-chimera was activated using human FIXa and re-purified using F1a2 affinity purification to obtain the final cFVI chimera.

Hotspot analysis

Hotspot analysis using monovalent humanized antibody mAb0842(OA) was performed by binding studies using surface plasmon resonance (Biacore T200) at 25 ℃ with a panel of 19 fvii (a) variants. 25 μ g/ml of anti-FVII (a) antibody targeting the gla domain (NN internal Ab 4F6(Nielsen AL et AL, PNAS 114(47)12454-12459,2017)) was immobilized on a sensor chip on CM4 (both provided by GE Healthcare) using a standard amine coupling chemistry kit. FVII (a) variants according to Table 19 in cell culture supernatant (as described above) were diluted in running buffer and injected at a flow rate of 10. mu.l/min for 1 min to reach 5-55RUThe capture level of (c). Each fvii (a) variant is captured by an immobilized anti-fvii (a) gla Ab. Subsequently, 540nM (3-fold dilution) of mAb0842(OA) was injected at a flow rate of 30. mu.l/min for 7min to allow binding to the captured FVII (a) variant, followed by 9min buffer injection to dissociate the one-armed anti-FVII (a) antibody. By diluting 10XHBS-P buffer (supplied by GE Healthcare) 10-fold and supplementing with 1mg/ml BSA and 5mM CaCl₂To obtain 10mM HEPES, 150mM NaCl, 0.05% v/v polysorbate 20(pH7.4), 5mM CaCl₂Running buffer was prepared with 1mg/ml Bovine Serum Albumin (BSA). The running buffer was also used to dilute the anti-FVII (a) antibody and FVII (a) sample. Regeneration of the chip was achieved using 10mM HEPES, 150mM NaCl, 20mM EDTA, 0.05v/v polysorbate 20(pH 7.4). Binding data were analyzed according to a 1:1 kinetic model and steady state analysis using BiaEvaluation 4.1 supplied by the manufacturer (Biacore AB, Uppsala, sweden). Whenever possible, ka, KD, and KD values from the 1:1 kinetic fit model are reported. KD values using a steady-state fitting model are reported for 4 fvii (a) variants. In addition, capture signals for all fvii (a) variants were reported. An amino acid residue is considered a hotspot residue if substitution of the amino acid residue with alanine results in a ten (10) fold or greater decrease in affinity relative to wild-type. Based on the data provided in table 19, the following conclusions are drawn: amino acid residues H115, T130, V131 and R392 are hot spots.

Table 19.Binding interaction of fvii (a) variants with monovalent humanized antibody mAb0842(OA) as determined by Surface Plasmon Resonance (SPR) analysis according to embodiment 16.

Example 18: pharmacokinetics of recombinant FVIIa in cynomolgus monkeys co-formulated with humanized 11F2 antibody

In cynomolgus studies, FVIIa plasma activity-time curves were estimated after intravenous or subcutaneous administration of recombinant FVIIa (rfviia) alone or co-formulated with a 1:3 molar ratio of monovalent monobrachial 11F2 mAb0705 (OA). The formulation was administered as a single dose of 5.4nmol/kg FVIIa, including 16.2nmol/kg mAb0705(OA) for the co-formulation, and blood samples were drawn over a three week period.

During the experiment, animals were housed and treated according to standard procedures of local health authorities, and were allowed free access to feed and water. FVIIa plasma activity was measured using the FVIIa activity assay as described in example 8. Endogenous cynomolgus FVIIa was below LLOQ (0.1nM) prior to administration and therefore was negligible.

Pharmacokinetic analysis of FVIIa plasma activity-time curves was performed by a non-compartmental method using Phoenix WinNonlin 6.4. The following parameters were estimated from the data: clearance (CL), Mean Residence Time (MRT) and SC bioavailability (F). The parameters are listed in table 20 and show that FVIIa activity is significantly prolonged after intravenous and subcutaneous administration by co-formulation with mAb0705(OA) compared to FVIIa in the absence of antibody.

Watch 20: in cynomolgus monkey studies, Clearance (CL), Mean Residence Time (MRT) and SC bioavailability (F) of FVIIa plasma activity after intravenous or subcutaneous administration of 5.4nmol/kg FVIIa alone or co-formulation with mAb0705(OA) at a 1:3 molar ratio. The value is the average (SD) and n is 3.

Example 19: humanization and optimization of the murine anti-TLT-1 antibody mAb0012

Humanization

The murine anti-human TLT-1 antibody mAb0082 disclosed in WO2012/117091 was used as the starting point for the humanization process. mAb0082 was derived from mAb0012 by: two point mutations, C41A in VL and T61A in VH, were incorporated to remove unpaired cysteines in FR1 of VL and N-glycosylation sites in CDR2 of VH, respectively. The humanization process is based on standard molecular biology methods known to those skilled in the art.

Briefly, mAb0082 CDRH1, CDRH2 and CDRH3 sequences were grafted onto human germline sequences based on VH3_74/JH1 sequences defined in the IMGT database. In addition, three VH3_74/JH1 human amino acid substitutions were introduced into the grafted CDRH2 sequence to further humanize the CDR sequence: P62D, L64V and D66G. To obtain comparable binding affinity to mAb0082, three back mutations were introduced at positions S49G, D62P and R98S of the VL sequence. For humanization of VL, mAb0082 CDRL1, CDRL2 and CDRL3 sequences were grafted onto human germline sequences based on VKII _ a23/JK2 sequences as defined in the IMGT database. The VL sequence contains a potential deamidation hot spot (NG motif) in CDR 1. Using saturation mutagenesis at this position, it was found that the NG motif could be eliminated by N33Q substitution without compromising affinity for TLT-1.

The final humanized and optimized variant of mAb0082, designated mAb1076, corresponds to SEQ ID NOS: 934(VL) and 938 (VH).

SPR analysis of humanized TLT1 variants

Binding of sTLT1 (corresponding to SEQ ID NO:3 with the addition of six histidine residues at the C-terminus) to the biAb from (example 4) was probed by surface plasmon resonance (BiacoreT200) at 25 ℃. Anti-human IgG was immobilized on CM5 sensor chips (all supplied by GE Healthcare) using standard amine coupling chemistry. Purified biAb (1nM) according to table 21 was injected at a flow rate of 10 μ l/min for 1 min. Subsequently, 0 to 60 μ M of sTLT1 was injected at a flow rate of 30 μ l/min for 3 minutes to allow binding to the biAb, followed by a3 minute buffer injection to allow dissociation from the biAb. By diluting 10XHBS-P buffer (supplied by GE Healthcare) 10-fold and supplementing with 1mg/ml BSA and 5mM CaCl₂To obtain 10mM HEPES, 150mM NaCl, 0.05% v/v polysorbate 20(pH7.4), 5mM CaCl₂Running buffer was prepared with 1mg/ml Bovine Serum Albumin (BSA). The running buffer was also used to dilute the biAb and sTLT1 samples. Use of MgCl prepared from 3M₂The recommended regeneration buffer (supplied by GE Healthcare) of the composition effects regeneration of the chip. BiaEvaluation 4.1, supplied by the manufacturer (Biacore AB, Uppsala, Sweden), was used, and scored according to the 1:1 modelThe binding data was analyzed. The analysis resulted in the binding constants reported in table 21, demonstrating that the affinity of the biAb for sllt 1 binding ranged from 2.9nM to 320 nM.

TABLE 21Estimated binding constants for the interaction of stttl with biAb as determined by Surface Plasmon Resonance (SPR) analysis according to embodiment X.

Example 20: crystal structure of Hz-TLT1 and TLT-1 peptide complex preparations

The Fab fragment used for the complex crystallization with the TLT-1 stem peptide contained sequences corresponding to the VL and VH domains of mAb1076 (SEQ ID NOS: 854 and 858, respectively), the human IgG4 CH1 domain and human kappa CL with a single point mutation (G157C). The G to C substitution is in the constant domain of the Fab fragment, i.e.away from the antigen binding site, and has no effect on binding to TLT-1. 37-mer stem peptide EEEEETHKIGSLAENAFSDPAGSANPLEPSQDEKSIP (SEQ ID NO:13) was prepared by standard peptide synthesis methods known to those skilled in the art, which corresponds to residue 111-147 of SEQ ID NO: 2. Fab and stem peptides were mixed in HEPES buffer (20mM HEPES (pH7.3), 150mM NaCl) at a 1:2 molar ratio. The 1:1Fab: peptide complex was isolated using gel filtration on a superdex 200 column eluted with hepes buffer, then concentrated to about 11mg/ml and used for crystallization.

Crystallization of

Crystals of gel filtered 1:1 molar Fab/peptide complexes were grown at 18 ℃ using the sitting drop vapor diffusion technique. 150nl of a 10.8mg/ml protein solution of Fab peptide complex in 20mM HEPES (pH7.3) and 150mM NaCl was mixed with 50nl of 1M LiCl, 0.1M sodium citrate-citric acid (pH 4) and 20% (w/v) PEG6000 as a precipitant, and incubated on 60. mu.l of the precipitant.

Diffraction data acquisition

Before rapid cooling in liquid nitrogen, the crystals were cryoprotected by adding 1 μ l of precipitant plus 20% ethylene glycol to the crystallization drops. Diffraction data were acquired at 100K at the BioMAX beam line of a MAX IV synchrotron (Lund, sweden) using an Eiger 16M mixed pixel detector from Dectris. Automatic indexing, integration and scaling of the data was performed using the program from the XDS package (diffraction data statistics are summarized in table 22).

Structure determination and refinement

The asymmetric unit contains two Fab: peptide complexes as judged by Matthews coefficient analysis. The structure is determined by molecular replacement. The H and L chains of 5KMV from the protein database entry were used as search models to locate two fabs using Phaser implemented in the program suite Phenix. These are models constructed with the correct amino acid sequence using COOT followed by refinement using Phenix refinement. Amino acids 7 to 21 from the peptide are clearly seen in the differential electron density map and can be manually modeled using COOT. The model was further refined using the steps of Phenix refinement and manual reconstruction in COOT. The refinement statistics are shown in table 22.

TABLE 22Data acquisition and refinement statistics

The statistics of the highest resolution shell are shown in parentheses.

Epitope and paratope of Fab/peptide complex

Epitopes are defined as residues in the TLT-1 stem-peptide with the following characteristics: in both complexes in asymmetric units, with a distance from the heavy atom in the FabHeavy atoms (i.e., non-hydrogen atoms) within a distance of (c). Similarly, the paratope is defined as a residue in a Fab fragment with the following characteristics: two complexes in an asymmetric cellIn the compound, having a distance between the heavy atoms in the TLT-1 stem-peptideThe epitope was found to comprise the following residues from the 37aa TLT-1 peptide according to SEQ ID NO: 13:

K8

I9

G10

S11

L12

A13

N15

A16

F17

S18

D19

P20

A21

k118, I119, G120, S121, L122, A123, N125, A126, F127, S128, D129, P130 and A131 corresponding to SEQ ID Nos 2 and 3).

The paratope comprises the following residues from the heavy chain variable domain (SEQ ID NO: 938):

V2

F27

R31

Y32

W33

E50

T57

N59

S98

G99

V100

T102

S103

and the following residues from the light chain variable domain (SEQ ID NO: 934):

H31

Y37

H39

Y54

F60

S61

S96

T97

V99

Y101

example 21: effect of affinity on the stimulatory Activity of an anti-FVII (a)/anti-TLT-1 bispecific antibody

To determine the effect of affinity on bispecific antibody activity, a number of anti-fvii (a) and anti-TLT-1 mabs humanized from 11F2 mAb0005 (see example 14) and mAb0012 (see example 19) and having different affinities for FVIIa and TLT-1, respectively, were tested in a bispecific format in FXa generation assays using lipidated TLT-1 as described in WO 2011/023785.

In a first step, FX activation was measured in the presence of 4nM recombinant TLT-1(WO2011023785), 2.5nM FVIIa and a series of bispecific antibodies (biAb) at concentrations from 0 to 300nM incorporated into 10:90 phosphatidylserine phosphatidylcholine vesicles. Assay buffer (50mM HEPES, 100mM NaCl, 10mM CaCl) at room temperature₂pH7.3 +1mg/ml BSA and 0.1% PEG8000) for 10 minutes, 150nM plasma-derived fx (haematologic technologies) was added to give a total volume of 50 μ l and allowed to activate for 20 minutes. Activation was then stopped by adding 25. mu.l of quenching buffer (50mM HEPES, 100mM NaCl, 80mM EDTA, pH7.3) and the resultant FXa quantified by its ability to hydrolyze 0.5mM S-2765(Chromogenix) chromogenic substrate (added in a volume of 25. mu.l as a 2mM stock solution) was followed for 5 minutes at 405nM in a SPECTRAmax Plus384 microplate reader. The normalized activity of each biAb at a concentration of 100nM was calculated from the slope of the linear absorbance increase by subtracting the background activity in the absence of the biAb and dividing by the FVIIa concentration in the assay (a)_biAb)。

In the second step, the same assay is performed with assay buffer and a series of FVIIa concentrations ranging from 0 to 80nM instead of the biAb. The slope of the linear relationship between FXa production and FVIIa concentration minus the background in this assay provides a measure of the specific activity of free FVIIa under the assay conditions used (A)_FVIIa)。

Based on the activity measured, the stimulatory activity of each biAb at 100nM was calculated as a_biAb/A_FVIIaThe ratio of (a) to (b). The stimulatory activity provides a measure of the fold increase in FXa production elicited by FVIIa following addition of 100nM biAb.

Stimulatory activity is provided in table 23, and shows the dependence of biAb stimulation on the intensity of binding to FVIIa and TLT-1, respectively, expressed as dissociation constant (KD) values. Among the biabs tested, biAb0001 showed the highest stimulatory activity.

TABLE 23: the stimulatory activity of bispecific antibodies in the presence of FX, FVIIa and lipidated TLT-1 is described in example 21. For each bispecific antibody, the measured stimulatory activity (mean ± SD, n ═ 2) and dissociation constants for interaction with FVIIa and TLT-1, respectively, are listed.

Example 22: effect of epitope mapping on anti-FVII (a)/anti-TLT-1 bispecific antibody stimulatory activity

To determine the effect of epitope mapping on bispecific antibody activity, a number of anti-TLT-1 and anti-FVIIa mabs that bind to different epitopes on TLT-1 and FVIIa, respectively, were tested in a bispecific format in an FXa generation assay as performed in example 21.

The results are provided in table 24 and show the dependence of biAb stimulatory activity on epitope localization. In particular, anti-TLT-1 mAb mAb1076, mAb0023, mAb0051 and mAb0062 in combination with anti-FVIIa mAb0865 showed comparable stimulatory activity.

Watch 24The stimulatory activity of bispecific antibodies in the presence of FX, FVIIa and lipidated TLT-1 is described in example 22. For each bispecific antibody, the measured stimulatory activity (mean ± SD, n ═ 2) and dissociation constants for interaction with FVIIa and TLT-1, respectively, are listed.

Example 23: antigen assay of human IgG (LOCI)

The presence of human igg (higg) in cynomolgus monkey plasma was measured by Luminescent Oxygen Channel Immunoassay (LOCI). Briefly, LOCI reagents included two latex bead reagents (donor and acceptor beads) and a biotinylated monoclonal antibody against hIgG (Biosite, catalog No. AFC 4249). The donor bead reagent containing the photosensitizing dye was coated with streptavidin. The second bead reagent, the acceptor bead, is conjugated to an internal monoclonal antibody against hIgG (0421), which constitutes a sandwich structure. During the assay, the three reactants combined with the hIgG in plasma to form bead-aggregate immune complexes. Excitation of the complex releases a singlet oxygen molecule from the donor bead, which is directed into the acceptor bead and triggers a chemiluminescent reaction. And then measured in an Envision microplate reader. The amount of light produced (reported in counts per second (cps)) is proportional to the concentration of hIgG. Samples were diluted at least 100-fold in assay buffer and calibration curves were prepared based on hIgG added to 1% cynomolgus monkey plasma.

Example 24: antigen assay (LOCI) of FVII (a)

FVII (a) antigens, including FVII zymogen, FVIIa and FVIIa antithrombin (FVIIa: AT) complex, were measured by the LOCI assay as described in example 23, except that the FVII (a) assay consisted of acceptor beads coated with an internal anti-FVII (a) antibody (4F9) and an internal biotinylated anti-FVII (a) monoclonal antibody (4F 7). The samples were diluted at least 100-fold in assay buffer and a calibration curve was prepared by adding a known amount of human rFVIIa to the assay buffer.

Example 25: antigenic assay (EIA) of FVIIa: AT (antithrombin)

FVIIa AT (antithrombin) complexes by use of e.g.H et al, J Thromb Haemost 2011; 9:333-8 by Enzyme Immunoassay (EIA). Monoclonal anti-FVIIa antibodies (Dako Denmark A/S, Glostrup, Denmark, product code O9572) that bind to the N-terminal EGF domain and do not block the anti-thrombin binding were used to capture the FVIIa: AT complex. Preformed human FVIIa andthe cynomolgus monkey antithrombin complex (FVIIa: AT) is prepared by incubating FVIIa with a 2-fold molar excess of antithrombin in the presence of 10. mu.M low molecular weight heparin (enoxaparin). The residual amidolytic activity of FVIIa after overnight incubation at room temperature (see example 11) proved to be less than 10% of the initial FVIIa activity. This complex was used to construct an EIA calibration curve. Polyclonal anti-human antithrombin antibody peroxidase conjugate was used for detection (Siemens Healthcare Diagnostics ApS, Ballerup, Denmark, product code OWMG 15). Adding TMB, developing until color development is sufficient, by adding H₂SO₄The termination was performed by measuring the absorbance at 450nM on an absorbance microplate reader (BioTek), with 650nM as reference. The colour intensity is proportional to the FVIIa: AT concentration.

Example 26: preparation of human FVIIa, FVII (zymogen) and FVIIa: AT (antithrombin) complexes

Preparation of human FVIIa (activated FVII)

Unless otherwise stated, recombinant human activated FVII (FVIIa) was prepared as described by Thim et al (1988) Biochemistry 27:7785-7793 and Persson et al (1996) FEBS Lett 385: 241-243.

Preparation of human FVII (zymogen FVII)

Recombinant human FVII produced in CHO cells was purified by single step calcium dependent affinity chromatography as described by Thim et al (1988) Biochemistry 27: 7785-7793. After purification, the zymogen FVII was dialyzed against 10mM MES, 100mM NaCl, 10mM CaCl₂(pH6.0) in a buffer. The level of activated FVII (FVIIa) in the preparation was determined by measuring the amidolytic activity in the presence of 1mM chromogenic substrate S-2288 and 200nM sTF (see example 11). The measured activity can be converted into molar concentrations of FVIIa in the zymogen FVII preparation by correlating it with a standard curve prepared with known concentrations of FVIIa.

Preparation of the human FVIIa: AT (antithrombin) Complex

The FVIIa AT (antithrombin) complex was prepared by incubating equimolar concentrations of human recombinant FVIIa, human plasma-derived AT (Baxter) and low molecular weight heparin (enoxaparin sodium) for 16 hours AT 4 ℃. To remove contaminating excipients, AT was re-purified on a heparin sepharose 6fast flow (GE Healthcare) column by applying a sodium chloride gradient prior to use. The eluted AT was concentrated upwards by ultrafiltration to give the final preparation in 10mM HEPES, 25mM NaCl (pH7.3) containing 50% glycerol. AT Complex was purified by SEC chromatography in 20mM MES, 100mM NaCl, 1mM EDTA (pH5.5) AT 4 ℃ to maximize the stability of the complex. Residual levels of FVIIa in the preparation were determined as described above. To minimize complex decomposition, the preparations were stored in aliquots at-80 ℃ and thawed and stored on ice immediately prior to use.

Example 27: single dose pharmacokinetics of anti-fvii (a)/anti-TLT-1 biAb in cynomolgus monkeys biAb0001 and the corresponding YTE variant biAb0352 (in which additional three half-life extending substitutions (M252Y, S254T and T256E) were introduced into the heavy chain constant domain) were administered intravenously at 3.0, 9.49 or 30nmol/kg or subcutaneously (sc) at 9.49 nmol/kg. Each group consisted of two monkeys (one male and one female). 1mL of sodium citrate stable blood samples were taken before dosing and for group iv at 0.5h, 2.5h, 6h, 12h, 24h, 48h, 72h and on days 8, 10 and 15 post-dosing. For the sc group, blood samples were taken before and at 0.5h, 3h, 6h, 12h, 16h, 24h, 30h, 38h, 48h, 54h, 72h, 78h, 96h, 120h, and at days 8, 10, and 15 post-dose. Blood samples were centrifuged AT 2000g for 10 min, plasma was removed, aliquoted and stored AT-80 ℃ until hIgG (see example 23), total FVII (a) antigen (see example 24), FVIIa activity (see example 8) and FVIIa: AT complex (example 25) were analyzed. Pharmacokinetic (PK) analysis of the concentration versus time profile of hIgG was performed by a non-compartmental method using Phoenix WinNonlin 6.4. The following PK parameters are shown in table 24: half-life (t1/2), clearance (Cl), volume of distribution (Vz), Mean Residence Time (MRT) and SC bioavailability (F).

Watch 24PK parameters of biAb with and without YTE mutation based on plasma sample analysis from cynomolgus monkey. *

Each line represents data from one cynomolgus monkey,. Cl was used for group iv and Cl/F was used for group sc. F corresponds to sc bioavailability.

Accumulation of endogenous fvii (a) was observed in monkeys dosed with BiAb0001 or the corresponding YTE-variant BiAb 0352. Table 25 shows FVII (a) antigen, FVIIa activity and FVII: AT pre-dose levels and the mean cumulative levels measured between 72 and 240 hours post-dose. Dose-dependent accumulation of fvii (a) antigen, FVIIa activity and antibodies to FVIIa AT was observed. Fvii (a) antigen increased up to 3-fold relative to pre-dose levels, while FVIIa and FVIIa AT increased up to 5-fold. The data indicate that single dose intravenous or subcutaneous administration of biAb0001 or biAb0352 with YTE mutations results in accumulation of endogenous fvii (a) antigen, FVIIa activity and FVIIa: AT complexes in vivo.

TABLE 25: accumulation of fvii (a) antigen, FVIIa and FVIIa: AT after a single intravenous or subcutaneous administration of the biAb with or without a YTE mutation to cynomolgus monkeys.

Data are mean and SD of measurements from 2 animals per group and 3 time points from group iv and 6 time points from group sc. For all 16 animals, the pre-dose values were based on one time point (pre-dose).

Example 28: single and multiple dose pharmacokinetics of monovalent 11F2 anti-FVII (a) antibody mAb0705(OA) in cynomolgus monkeys

In vivo accumulation of FVII, FVIIa and FVIIa: AT was assayed by administering monovalent 11F2 anti-FVII (a) antibody mAb0705(OA) to cynomolgus monkeys, followed by measurement of FVII antigen, FVIIa activity and FVIIa: AT in the plasma samples. Two male cynomolgus monkeys, approximately 2.5kg, were given 40nmol/kg mAb0705(OA) intravenously in the saphenous vein, the cephalic vein or the lateral caudal vein of the tail, while 3 male cynomolgus monkeys were given 20nmol/kg of a one-armed anti-FVIIa antibody every other day subcutaneously (sc) in the thighs (left and right thighs alternated) (i.e. the antibody was administered on days 1, 3, 5, 7, 9, 11, 13 and 15). Blood was collected from the cephalic or femoral vein and added to 3.8% trisodium citrate at time points up to 21 days post-dose.

Blood was centrifuged AT 2300g for 10 min, plasma was aliquoted and stored AT-80 ℃ until hIgG (see example 23), total FVII (a) antigen (see example 24), FVIIa activity (see example 8) and FVIIa: AT complex (see example 25) were analyzed. PK analysis of concentration versus time profiles was performed by a non-compartmental method using Phoenix WinNonlin 6.4. PK parameters for intravenous administration are shown in table 26. The half-life of the one-armed antibody (t1/2) after a single intravenous administration averaged 116 hours (4.8 days). The estimated half-life of the subcutaneously administered antibody was 181 ± 20 hours (n ═ 3 mean and SD). The antibody accumulated during the two week dosing period, resulting in a maximum level of 1179 ± 140nM at time points between 336 and 366 hours after the initial dosing (mean and SD of data from n-3 animals and 3 time points).

Watch 26PK parameters of mAb0705(OA) administered intravenously at 40nmol/kg in cynomolgus monkeys.

Single intravenous or repeated subcutaneous administrations of mAb0705(OA) resulted in the accumulation of endogenous fvii (a). Total FVII (a) antigen, FVIIa: AT and FVIIa after a single intravenous dose of 40nmol/kg are shown in Table 27. On days 7-14, total FVII antigen increased from 7.0nM to 35.0 + -4.7 nM prior to dosing. Likewise, FVIIa increased from below the limit of detection (0.009nM) to 2.3. + -. 0.7nM, FVIIa: AT increased from 1.0 to 6.3. + -. 0.8nM on days 7-14. The zymogen FVII level after administration of 40nmol/kh one-armed antibody was 26.4nM, as calculated by subtracting FVIIa and FVIIa: AT from total FVII (a) antigen.

Watch 27Fvii (a) levels after a single intravenous dose of 40nmol/kg mAb0705(OA) measured on days 7-14 post-dose.

FVII(a)	Predose level (nM)	Steady state concentration (nM)
			Total FVII (a) antigen	7.0	35.0±4.7
FVIIa:AT	1.0	6.3±0.8
			FVIIa	<0.009	2.3±0.7

Steady-state levels of total FVII (a), FVIIa and FVIIa: AT after multiple subcutaneous administrations are shown in Table 28. On days 12-21, total FVII (a) antigen increased from 6.5. + -. 1.5nM to 36.9. + -. 9.8nM prior to administration. Likewise, FVIIa increased from below the limit of detection (0.009nM) to 3.9. + -. 1.6nM on days 12-21, while FVIIa: AT increased from 1.0. + -. 0.3 to 9.1. + -. 0.6nM on days 12-21. The steady state zymogen FVII level calculated by subtracting FVIIa and FVIIa: AT from total FVII (a) antigen is 24 nM.

The data indicate that administration of the one-armed anti-FVII (a) antibody mAb0705(OA) results in the accumulation of endogenous FVII (a), FVIIa and FVIIa: AT in vivo. The clearance of the one-armed anti-FVII (a) antibody (0.42-0.49mL/kg x kg, Table 26) was comparable to that of biAb0001 after intravenous administration (0.33-0.64 mL/kg x kg, example 27, Table 24). Thus, the steady-state levels of FVII (a) antigen, FVIIa and FVIIa: AT measured after repeated administration of a one-armed anti-FVII (a) antibody are expected to represent the levels that will be reached AT steady state after repeated administration of a biAb with the same FVII (a) binding arm.

Watch 28Steady state levels of fvii (a) after repeated subcutaneous administrations of 20nmol/kg mAb0705(OA), measured on days 12-21 after initial administration.

FVII(a)	Predose level (nM)	Steady state concentration (nM)
			Total FVII (a) antigen	6.5±1.5	36.9±9.8
FVIIa:AT	1.0±0.3	9.1±0.6
			FVIIa	<0.009	3.9±1.6

Example 29: thromboelastography in hemophilia A-like conditions in human whole blood supplemented with anti-FVII (a)/anti-TLT-1 biAb0001 and steady-state levels of the zymogens FVII, FVIIa and FVIIa: AT

The effect of the bispecific anti-FVII (a)/anti-TLT-1 antibody biAb0001 (where the parent anti-FVII (a) is mAb0865 and the parent anti-TLT-1 antibody is mAb1076) and the cumulative levels of the zymogens FVII, FVIIa and FVIIa: AT from example 28 were evaluated by thromboelastography in human whole blood in hemophilia-like conditions and compared to the effect of rFVIIa added to the blood. In principle as described by Viuff D et al, Thromb Res 2010; 126: 144-9, usingThromboelastography analysis was performed with the instrument (thromboelastogram) coagulometer, Haemoscope Corp. Citrate-stabilized whole blood from healthy donors was incubated with 0.1mg/mL of neutralizing anti-FVIII sheep polyclonal antibody (Haematologic Technologies Inc, Cat. PAHFVIII-S-C) and 5. mu.g/mL of neutralizing anti-TF mouse monoclonal antibody (1F44, prepared internally) for 30 minutes. BiAb0001 and rFVIIa (Novo) at a final plasma concentration of 100nM in HBS/BSA buffer (20mM HEPES, 140mM NaCl, pH7.4, 2% BSA)Novo Nordisk, final plasma concentration 3.9nM), zymogen FVII (prepared as in example 26, final plasma concentration 24nM), and FVIIa: AT complex (prepared as in example 26, final plasma concentration 9nM) were mixed and added to blood samples. Pre-dilutions of FVIIa AT were prepared in cold 20mM MES, 100mM NaCl, 1mM EDTA (pH5.5) + 2% BSA and added to the remaining protein immediately before the start of the assay. FVII zymogen and FVIIa: AT preparations contain traces of FVIIa, so correspondingly lower amounts of FVIIa are added to compensate for this and the expected plasma concentration of FVIIa in the donor Blood (0.1nM, Morissey JH et al Blood, 1993; 81: 734-44). Also, the amount of zymogen FVII added compensates for the expected plasma concentration of 10nM zymogen FVIIa in the donor blood. The individual samples contained 25nM rFVIIa, corresponding to the administration of 90. mu.g/kg rFVIIa to human subjects with hemophilia AThe latter theoretical maximum plasma concentration (Lindley CM et al Clin Pharmacol Ther 1994; 55: 638-48). Controls included biAb alone and FVII/FVIIa: AT cocktail without biAb. Platelets were maximally activated by addition of the PAR1 agonist peptide SFLLRN (Tocrisis Biosciences Cat. No. 3497) to a final concentration of 30. mu.M and the GPVI agonist convulsant protein (convulxin) (5-Diagnostics, Cat. No. 5D-1192-50UG) to a final concentration of 10 ng/mL. A volume of 20. mu.L of 0.2M CaCl in 20mM Hepes (pH7.4)₂Add to TEG cup, then add 340 μ L blood sample and start analysis immediately. By software (Analytical software, version 4.1.73) calculated the clotting time (R-time) defined as the time to reach 2mm amplitude of the TEG trace. Data from 4 donors are shown in table 29. After induction of hemophilia a-like condition by neutralizing FVIII, clotting time was delayed from 290 ± 12s to 3506 ± 1561s in normal blood. Addition of 25nM rFVIIa results in a reduction of the clotting time to 694. + -.158 s in hemophilia A-mimicking blood. Addition of 100nM biAb to blood resulted in a modest reduction in clotting time to 2198 + -712 s, most likely due to an enhanced effect of endogenous FVIIa in the blood. Addition of steady-state levels of FVII/FVIIa/FVIIa AT reduced the clotting time to 1440. + -.275 s. AT shortens the clotting time to 495. + -.39 s, i.e.to a level comparable to or slightly lower than the clotting time after addition of 25nM FVIIa, in combination with 100nM BIAb and steady state levels of FVII/FVIIa/FVIIa. The data indicate that the biAb enhances the effect of cumulative levels of FVII/FVIIa: AT, resulting in a clotting time reduction similar to or slightly better than that achieved with therapeutically effective concentrations of rFVIIa.

Watch 29Thromboelastography analysis of the effect of biAb0001(100nM) in human whole blood with or without steady-state levels of FVII/FVIIa: AT.

Example 30: thromboelastography in hemophilia A-like conditions in human whole blood supplemented with bispecific anti-FVII (a)/anti-TLT-1 antibodies with different TLT-1 affinities and steady state levels of the zymogens FVII, FVIIa and FVIIa: AT

In this example, the following bispecific anti-FVII (a)/anti-TLT-1 antibodies with different affinities for TLT-1 were tested:

bispecific antibody was evaluated by thromboelastography at a concentration of 100nM as described in example 29. Clotting times (R-times) are listed in Table 30. After induction of hemophilia a (ha) by addition of anti-FVIII antibodies, clotting time was delayed from 340 seconds to 5433 seconds. The presence of the biAb with the highest affinity for TLT-1 (biAb0001) reduced clotting time to 2465 seconds, i.e. over that observed for the other three individual biabs: biAb0015 reduced clotting time to 3645 seconds; biAb0090 was reduced to 4335 seconds, biAb0095 was reduced to 4110 seconds. Likewise, the combination of biAb with steady-state levels of FVII, FVIIa and FVII: AT resulted in a more significant reduction in clotting time for biAb0001 (reduced to 540 seconds) than the other three biabs; that is, shortened to 1100 seconds for biAb0015, shortened to 1040 seconds for biAb0090, and shortened to 815 seconds for biAb 0095. The data indicate that biAb0001, which has the highest affinity for TLT-1 (i.e., lowest KD), is most effective in shortening clotting time.

Watch 30: thromboelastography analysis of the effect of biAb0001, biAb0015 or biAb0090 (100nM each) in human whole blood with or without steady-state levels of FVII/FVIIa: AT.

Example 31: in vivo Effect of anti-FVII (a)/anti-TLT-1 bispecific antibody BIAb001 in Tail vein transection model of FVIII deficient transgenic human TLT-1 mice

The in vivo efficacy of anti-fvii (a)/anti-TLT-1 bispecific antibody biAb0001 was determined using transgenic FVIII knockout (i.e. hemophilia a), murine TLT-1 knockout, Tail Vein Transection (TVT) models in human knock-in mice. Since anti-FVII (a) does not recognize murine FVII (a), the biAb was co-administered with human FVIIa, FVII: AT to provide target plasma levels of these components in mice (3.8, 26.2 and 9.0nM, respectively) to mimic their expected clinical steady-state plasma levels according to example 28. The concentration of the biAb was 40 or 100 nM. Briefly, mice were anesthetized with isoflurane and placed on a heating pad set to maintain the body temperature of the animals at 37 ℃ and their tails immersed in saline (37 ℃). Dosing was performed 5 minutes prior to injury in the right caudal vein. In this TVT model (Johansen et al, Haemophilia,2016,625-31), the lateral veins are transected. If bleeding stops at 10, 20 or 30 minutes, the tail is removed from the saline and the wound is gently wiped with a saline-wetted gauze swab. The total blood loss was determined after 40 minutes by quantifying the amount of hemoglobin in the saline. Blood samples were collected from the orbital plexus and added to 3.8% trisodium citrate 40 minutes after administration. Blood was centrifuged at 4000g for 5 min, plasma was aliquoted and stored at-80 ℃ until hIgG (see example 23), total FVII (a) antigen (see example 24) and FVIIa activity (see example 8) were assayed.

As shown in table 31, all combinations of FVIIa and biAb resulted in a significant reduction in blood loss compared to fvii (a) administered with or without the biAb alone. Platelet counts measured 45 minutes after treatment were comparable to those observed in the vehicle group for all combinations.

Taken together, these data demonstrate significant in vivo hemostatic effects of biAb0001 in the presence of expected steady-state levels of FVIIa, FVII, and FVII: AT.

Watch 31In FVIII knockout/mouse TLT-1 knockout/human TLT-1 knock-in mice administered with the indicated combination of biAb0001, FVIIa, FVII and FVIIa: AT, blood loss after Tail Vein Transection (TVT). The administered dose, the expected and measured plasma concentrations and the determined blood loss are shown as mean ± SEM (n-10). The blood loss was found to be significantly different in groups 3-5 from groups 1 and 2 using one-way ANOVA followed by Dunnett's multiple comparison test. Total FVII (a) antigen concentration (measured according to embodiment 23) is listed in the row labeled "FVII" with values marked with an asterisk.

While certain features of the invention have been illustrated and described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true scope of the invention.

Example 32: identification of antibodies that compete for binding to TLT-1 with anti-TLT-1 mAb1076 in a competitive ELISA

The Fab fragment used for competition experiments (anti-TLT-1 Fab) contained sequences corresponding to the VH and VL domains of mAb1076 (SEQ ID NOS: 938 and 934, respectively), the human IgG4 CH1 domain and human kappa CL with a single point mutation (G157C). The G to C substitution is in the constant domain of the Fab fragment, i.e.away from the antigen binding site, and has no effect on binding to TLT-1 (see example 20). Recombinants were produced as TLT-1 as described in WO 2011/023785. The anti-TLT-1 Fab was biotinylated using standard methods, including the use of biotinylation kits (EZ-link, Thermo) according to the manufacturer's instructions.

To determine whether the anti-TLT-1 antibody competes for binding to TLT-1 with the anti-TLT-1 Fab and its derivatives, competition studies were performed. Recombinant TLT-1 in dilution buffer (20mM HEPES, 5mM CaCl)₂150mM NaCl, pH7.2) were fixed overnight at 4 ℃ in NUNC maxisorp plates. Plates were washed and washed in wash buffer (20mM HEPES, 5mM CaCl)₂，150mM NaCl, 0.5ml/L Tween 20, pH7.2) for 15 minutes. For competition studies, final fixed concentrations of biotinylated anti-TLT-1 Fab were combined with a series of dilutions of anti-TLT-1 antibody to give final concentrations in the dilution buffer ranging from 0 up to 100 mg/ml. The mixture was added to the wells of the plate and incubated for 1 hour. The plates were then washed and HRP-labeled streptavidin-HRPO (1: 2000 in dilution buffer; Kirkegaard) was added&Perry Labs) and incubated for 1 hour. Finally, the plates were washed and developed with TMB ONE (KEMENTEC) for 10 min. By addition of H₃PO₄(4M) the reaction was stopped and the plate was read in the FLUOStar Optima at 450nm, minus the background signal measured at 620 nm. All incubations were performed at room temperature unless otherwise stated, and the plates were washed 5 times with wash buffer.

The concentration of recombinant TLT-1 to be immobilized on NUNC maxisorp plates and the immobilized concentration of biotinylated anti-TLT-1 Fab mixed with competitor antibody for competition studies were determined by titration of the two components separately in order to provide sufficient signal to allow detection of competition (i.e., reduced signal) by the competitor antibody. The concentration of TLT-1 used for immobilization is usually in the range of 0-1mg/ml, such as 125 ng/ml. The concentration of biotinylated anti-TLT-1 Fab is usually in the range of 0-1mg/ml, such as 10 ng/ml.

From the measured signal (OD units), the competition at any given antibody concentration was calculated as follows

% inhibition ═ 100 (1- (OD units-100% inhibition)/(0% inhibition-100% inhibition) — 100 where 0% inhibition is determined from the signal in wells without any competing anti-TLT-1 antibody and 100% inhibition is determined as the signal from wells without biotinylated anti-TLT-1 Fab (i.e. corresponding to assay background). An antibody is considered to compete with the anti-TLT-1 Fab for binding to TLT-1 if at least 50% inhibition (% inhibition) is observed at antibody concentrations measured up to 10000-fold excess of biotinylated anti-TLT-1 Fab.