阅读说明：本技术 一种Circ-COL6A3-6401抑制剂在制备抗肿瘤药物中的应用 (Application of Circ-COL6A3-6401 inhibitor in preparation of antitumor drugs ) 是由 潘文胜 张晨静 周晓露 耿晓歌 王婧雅 于 2021-04-25 设计创作，主要内容包括：本发明属于基因工程抗体药物研制领域,涉及一种Circ-COL6A3-6401抑制剂在制备抗肿瘤药物中的应用,具体涉及了一种环状RNA Circ-COL6A3-6401核酸分子及其表达的蛋白Circ-COL6A3-20KD的抑制剂在制备抗肿瘤药物中的应用。尤其是针对Circ-COL6A3-20KD设计了多克隆抗体Anti-Circ-COL6A3,其能够特异性的检测细胞内源性环状RNA Circ-COL6A3编码的蛋白质的含量,同时可以显著抑制大肠癌细胞的侵袭迁移,该多克隆抗体在肿瘤的临床检测及侵袭迁移治疗中具有广阔的应用前景。(The invention belongs to the field of development of genetic engineering antibody drugs, relates to application of a Circ-COL6A3-6401 inhibitor in preparation of antitumor drugs, and particularly relates to application of a circular RNA Circ-COL6A3-6401 nucleic acid molecule and an expressed protein Circ-COL6A3-20KD inhibitor in preparation of antitumor drugs. Particularly, a polyclonal antibody Anti-Circ-COL6A3 is designed aiming at Circ-COL6A3-20KD, the content of protein coded by cell endogenous circular RNA Circ-COL6A3 can be specifically detected, meanwhile, invasion and migration of colorectal cancer cells can be remarkably inhibited, and the polyclonal antibody has wide application prospects in clinical detection and invasion and migration treatment of tumors.)

1. An application of a Circ-COL6A3-6401 inhibitor in preparing antitumor drugs is characterized in that the Circ-COL6A3-6401 inhibitor is a Circ-COL6A3-6401 nucleic acid fragment inhibitor or a Circ-COL6A3-20KD peptide fragment inhibitor, wherein the sequence of the Circ-COL6A3-6401 nucleic acid fragment is shown as SEQ ID NO: 1; the sequence of the Circ-COL6A3-20KD peptide segment is shown in SEQ ID NO. 2.

2. The use of an inhibitor of Circ-COL6A3-6401 according to claim 1 in the preparation of an anti-tumor medicament, wherein the inhibitor of the fragment of Circ-COL6A3-6401 nucleic acid is a nucleic acid effector molecule; the nucleic acid effector molecule is DNA, RNA, PNA or DNA-RNA-hybrid; the nucleic acid effector molecule inhibits expression of Circ-COL6a3-6401 in whole or in part; the nucleic acid effector molecule is selected from one of siRNA, dsRNA, miRNA, ribozyme and shRNA;

the inhibitor of the Circ-COL6A3-6401 nucleic acid fragment is designed and obtained aiming at a nucleic acid sequence SEQ ID NO. 9; the inhibitor of the Circ-COL6A3-6401 nucleic acid fragment is siRNA; the inhibitor is designed aiming at a Circ-COL6A3-6401 annular interface; more preferably, the sequence fragment spanning the interface is designed for any sequence fragment from 713 th to 20 th positions of the Circ-COL6A 3-6401; the sequence segment is preferably more than 18 bases in length and is complementary with at least the sequence from 744 to 17 of the Circ-COL6A 3-6401; the inhibitor is designed aiming at one of the following key fragments of the Circ-COL6A3-6401, and the siRNA is selected from any one of SEQ ID NO 6-8; the Circ-COL6A3-20KD peptide fragment inhibitor is an antibody and a functional fragment thereof, or a small molecular compound.

3. The use of a inhibitor of Circ-COL6A3-6401 according to claim 1 in the preparation of an anti-tumor medicament, wherein said inhibitor of the peptide fragment of Circ-COL6A3-20KD is an antibody; the antibody is directed against the amino acid sequence SEQ ID NO. 3; the antibody is obtained by preparing a monoclonal antibody by using SEQ ID NO. 3 as an immunogen.

4. The use of the inhibitor of Circ-COL6A3-6401 according to claim 1 in the preparation of an anti-tumor medicament, wherein the tumor is a COL6A3 mutated tumor; the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein is colon cancer.

5. An antitumor drug, which is characterized in that the antitumor drug is a Circ-COL6A3-6401 inhibitor, and the Circ-COL6A3-6401 inhibitor comprises a Circ-COL6A3-6401 nucleic acid fragment inhibitor in the claim 2, a Circ-COL6A3-20KD peptide fragment inhibitor in the claim 3 and a pharmaceutically acceptable carrier.

6. Antitumor drug according to claim 5, characterized in that said tumor is a COL6A3 mutated tumor; the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein is colon cancer.

7. A kit for tumor diagnosis and/or prognosis judgment is characterized in that the kit contains a detection reagent of Circ-COL6A3-6401, and the detection reagent is used for amplifying a primer of the Circ-COL6A3-6401 in the claim 2 or an antibody against the Circ-COL6A3-20KD protein in the claim 3.

8. The kit for tumor diagnosis and/or prognosis according to claim 7, wherein the kit is used for determining whether the tumor is a COL6A3 mutant tumor; the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein is colon cancer.

Technical Field

The invention belongs to the field of development of genetic engineering antibody drugs, and relates to application of a Circ-COL6A3-6401 inhibitor in preparation of an anti-tumor drug.

Background

With the improvement and innovation of gene detection technology in recent years, non-coding RNA (ncRNA) is widely concerned at home and abroad as a novel gene expression regulation and control mode. Circular RNA (circular RNA) is a non-coding RNA molecule (ncRNA) which is abundantly present in eukaryotic cells and forms a circular structure by a special variable splicing mechanism. Unlike traditional linear RNA, circRNA is not affected by exornases and is highly conserved across species. Although circRNA is usually expressed at low levels, it plays an important role in a variety of pathophysiological processes in the body. Recent studies found that abnormal circRNA expression is closely related to the development and development of tumors, for example, circRNA _102171 promotes the progression of thyroid cancer by activating Wnt/β -catenin pathway through interaction with CTNNBIP 1; circ-Foxo3, which is highly expressed in non-tumor cells, impedes cell cycle progression through the mitogenic effects of CDK 2; the circRNA cSMARCA5 promotes the expression of a tumor suppressor TIMP3 by serving as a sponge of miR-17-3p and miR-181b-5p, thereby inhibiting the proliferation and migration of liver cancer cells. As it does not contain the 5' cap structure necessary for translation of most mRNAs, circRNA has long been considered a non-coding RNA. In recent years, circRNA is found to be used as a protein synthesis template to code and translate protein under some special conditions such as stress. An increasing number of studies have also demonstrated that circRNA-derived proteins play important biological functions during cellular stress, myogenesis and tumor proliferation. COL6A3(Collagen type VI alpha 3chain) is a tumor suppressor gene located in chromosome 16q22.1, and is one of the coding genes of the three alpha chains of type VI Collagen. It has been shown that COL6A3 is associated with dystonia, colorectal cancer, pancreatic cancer, etc.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, and produces a drug capable of inhibiting tumor, namely an application of a Circ-COL6A3-6401 inhibitor in preparing anti-tumor drugs, which is characterized in that the Circ-COL6A3-6401 inhibitor is a Circ-COL6A3-6401 nucleic acid fragment inhibitor or a Circ-COL6A3-20KD peptide fragment inhibitor, wherein the sequence of the Circ-COL6A3-6401 nucleic acid fragment is shown as SEQ ID NO. 1; the sequence of the Circ-COL6A3-20KD peptide segment is shown in SEQ ID NO. 2.

Preferably, the method comprises the following steps: the inhibitor of the Circ-COL6A3-6401 nucleic acid fragment is a nucleic acid effector molecule; the nucleic acid effector molecule is DNA, RNA, PNA or DNA-RNA-hybrid; the nucleic acid effector molecule inhibits expression of Circ-COL6a3-6401 in whole or in part; the nucleic acid effector molecule is selected from one of siRNA, dsRNA, miRNA, ribozyme and shRNA; the inhibitor of the Circ-COL6A3-6401 nucleic acid fragment is designed and obtained aiming at a nucleic acid sequence SEQ ID NO. 9; the inhibitor of the Circ-COL6A3-6401 nucleic acid fragment is siRNA; the inhibitor is designed aiming at a Circ-COL6A3-6401 annular interface; more preferably, the sequence fragment spanning the interface is designed for any sequence fragment from 713 th to 20 th positions of the Circ-COL6A 3-6401; the sequence segment is preferably more than 18 bases in length and is complementary with at least the sequence from 744 to 17 of the Circ-COL6A 3-6401; the inhibitor is designed aiming at one of the following key fragments of the Circ-COL6A3-6401, and the siRNA is selected from any one of SEQ ID NO 6-8; the Circ-COL6A3-20KD peptide fragment inhibitor is an antibody and a functional fragment thereof, or a small molecular compound.

Preferably, the method comprises the following steps: the Circ-COL6A3-20KD peptide fragment inhibitor is an antibody; the antibody is directed against the amino acid sequence SEQ ID NO. 3; the antibody is obtained by preparing a monoclonal antibody by using SEQ ID NO. 3 as an immunogen.

Preferably, the method comprises the following steps: the tumor is a COL6A3 mutant tumor; the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein is colon cancer.

An antineoplastic medicine is a Circ-COL6A3-6401 inhibitor, which comprises a Circ-COL6A3-6401 nucleic acid fragment inhibitor in claim 2, a Circ-COL6A3-20KD peptide fragment inhibitor in claim 3 and a pharmaceutically acceptable carrier.

Preferably, the method comprises the following steps: the tumor is a COL6A3 mutant tumor; the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein is colon cancer.

A kit for tumor diagnosis and/or prognosis judgment, which contains a detection reagent of Circ-COL6A3-6401, wherein the detection reagent is used for amplifying a primer of Circ-COL6A3-6401 in the right 2 or an antibody against a protein of Circ-COL6A3-20KD in the right 3;

preferably, the method comprises the following steps: the kit can be used for judging the tumor to be COL6A3 mutant tumor; the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein is colon cancer.

The invention has the beneficial effects that:

1. the invention discovers a variant of a cyclization mode of COL6A3, namely, Circ-COL6A3-6401 and protein Circ-COL6A3-20KD expressed by the variant in a tumor cell for the first time, and discovers that the inhibition of the Circ-COL6A3-6401 or the Circ-COL6A3-20KD can realize the inhibition of the tumor. Provides a new marker for the diagnosis of the tumor and simultaneously provides a new target for the treatment of the tumor.

2. The invention designs and synthesizes an anti-Circ-CDH 1-28KD antibody which can effectively inhibit the growth of tumor cells.

Drawings

FIG. 1 is a schematic diagram of the formation of circular RNA by COL6A 3;

FIG. 2COL6A3 circular RNA sequencing identification;

FIG. 3 expression of Circ-COL6A3-6401 in colon cancer as well as in normal tissues;

FIG. 4 is a schematic diagram of the small molecule protein translated from COL6A3 circular RNA;

FIG. 5Western blot to detect the presence of cell Circ-COL6A3-20KD protein;

FIG. 6 clonogenic assay to detect the anti-tumor effect of the polyclonal antibody anti-COL6A 3-28;

FIG. 7 cell scratch test for detecting the anti-tumor effect of polyclonal antibody anti-COL6A 3-28;

FIG. 8 expression of Circ-COL6A3-20KD in colon cancer as well as in normal tissues.

Detailed Description

Application of a Circ-COL6A3-6401 inhibitor in preparing an antitumor drug.

Furthermore, the inhibitor of the Circ-COL6A3-6401 is an inhibitor of a Circ-COL6A3-6401 nucleic acid fragment or an inhibitor of a Circ-COL6A3-20KD peptide fragment.

It was not obvious that the inventors identified and found a cyclization pattern of COL6A3 variants in colon cancer tissues and cell lines SW480 and SW620, wherein the cyclization pattern of variants is formed by head-to-tail cyclization of exons 2, 3 and 4 of COL6A3 gene and consists of 761 nucleotides. We have the designation Circ-COL6A3-6401 (see FIG. 1), and specifically, the sequence of the nucleic acid fragment of Circ-COL6A3-6401 is shown in SEQ ID NO:1, with the name of CircBase ID: hsa _ Circ _ 0006401. The exact circularization interface for circular RNA was identified by sanger DNA sequencing (see FIG. 2). After the COL6A3 forms a circular RNA molecule, a complete open reading frame is formed, 198 amino acids are coded, the molecular weight of the protein is about 20KD, the protein is named as Circ-COL6A3-20KD (see figure 3), and particularly, the sequence of the peptide segment of the Circ-COL6A3-20KD is shown as SEQ ID NO. 2.

Although many tumors have been reported to be associated with mutations in the COL6A3 gene, the presence of the circular RNA, Circ-COL6A3-6401, and the proteins expressed thereby, has never been previously discovered. Furthermore, the association of the gene of Circ-COL6A3 with colon cancer has not been reported. Surprisingly, the inventors prepared a specific anti-Circ-COL6A 3-20KD polyclonal antibody anti-Circ-COL6A 3-28 or siRNA interference Circ-COL6A3-6401, and found that the antibody or siRNA can significantly inhibit the growth of tumor cells, indicating that the inhibition of the cyclic RNA or its expressed protein can inhibit the growth of tumor.

The Circ-COL6A3-6401 is formed by head-to-tail cyclization of exons 2, 3 and 4 of COL6A3 gene and consists of 761 nucleotides. The COL6A3 gene is transcribed in many tumors. In these tumors that transcribe the COL6A3 gene, it is possible to generate both Circ-COL6A 3-6401.

Wherein the inhibitor of the nucleic acid fragment of the Circ-COL6A3-6401 is a substance which inhibits the overall or local expression of the nucleic acid fragment of the Circ-COL6A 3-6401.

As an alternative embodiment, the nucleic acid effector molecule is DNA, RNA, PNA or DNA-RNA-hybrid. The nucleic acid effector molecule may be single-stranded or double-stranded. Expression vectors derived from retroviruses, adenoviruses, herpesviruses or vaccinia viruses, or from various bacterial plasmids, can be used to deliver nucleotide sequences to targeted organs, tissues or cell populations. Such constructs can be used to introduce nontranslatable sense or antisense sequences into cells. Such vectors can continue to transcribe RNA molecules until they are disabled by endogenous nucleases, even in the absence of integration into DNA.

The nucleic acid effector molecule may be selected from small inhibitory nucleic acid molecules capable of inhibiting the expression of Circ-COL6A3-6401, such as short interfering RNAs (siRNAs), double-stranded RNAs (dsRNA), microRNAs (miRNAs), ribozymes, and small hairpin RNAs (shRNAs), which reduce or eliminate the expression of the peptide fragments of Circ-COL6A3-6401 and/or Circ-COL6A3-20 KD.

These small inhibitory nucleic acid molecules may include first and second strands that hybridize to each other to form one or more double-stranded regions, each strand being about 18-28 nucleotides in length, about 18-23 nucleotides in length, or 18, 19, 20, 21, 22 nucleotides in length. In addition, single strands may also include regions that are capable of hybridizing to each other to form a duplex, such as in shRNA molecules.

These small inhibitory nucleic acid molecules may include modified nucleotides while maintaining the ability to reduce or eliminate the expression of the peptide segment of Circ-COL6A3-6401 and/or Circ-COL6A3-20 KD. Modified nucleotides can be used to improve in vitro or in vivo properties, such as stability, activity and/or bioavailability. For example, the modified nucleotides may include deoxynucleotides, 2 ' -methyl nucleotides, 2 ' -deoxy-2 ' -fluoro nucleotides, 4 ' -trinucleotides, Locked Nucleic Acid (LNA) nucleotides, and/or 2 ' -O-methoxyethyl nucleotides. Small inhibitory nucleic acid molecules, such as short interfering RNA (siRNA), may also contain 5 '-and/or 3' -cap structures to prevent degradation by exonucleases.

In some embodiments, the double-stranded nucleic acid of the small inhibitory nucleic acid molecule contains blunt-ended, or pendent, nucleotides. Other nucleotides may include nucleotides that result in misplacement, bulge, cycling, or wobble base pairs. The small inhibitory nucleic acid molecules may be formulated for administration, for example, by liposome encapsulation, or incorporated into other carriers (e.g., biodegradable polymer hydrogels, or cyclodextrins).

The inhibitor of the Circ-COL6A3-6401 nucleic acid fragment is designed and obtained aiming at a nucleic acid sequence SEQ ID NO. 9.

In some embodiments, the inhibitor of the Circ-COL6a3-6401 nucleic acid fragment is siRNA. In a preferred embodiment, the inhibitor is designed for the Circ-COL6a3-6401 ring interface; preferably, the sequence is designed for any sequence fragment spanning the interface from 741 th to 20 th positions of Circ-COL6A3-6401, preferably more than 18 bases in length, complementary to at least the sequence from 741 th to 17 th positions of Circ-COL6A 3-6401; more preferably, the inhibitor is designed against one of the following key fragments of Circ-COL6A3-6401, or alternatively complementary to a fragment of Circ-COL6A3-6401 from position 749 to position 8 of Circ-COL6A3-6401, or from position 756 to position 16 of Circ-COL6A 3-73; preferably complementary to a fragment of Circ-COL6A3-6401 from position 755 to position 15. In some preferred embodiments, it is selected from any one of SEQ ID NOs 6-8.

Wherein the Circ-COL6A3-20KD peptide fragment inhibitor is an antibody and a functional fragment thereof, or a small molecular compound. In a preferred embodiment, the inhibitor of the peptide fragment of Circ-COL6A3-20KD is an antibody. The antibody can be a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a humanized antibody, a human antibody, a chimeric antibody, a multispecific antibody or antibody fragment thereof (e.g., a Fab fragment, a Fab 'fragment, a F (ab')2 fragment, an Fv fragment, a diabody, or a single chain antibody molecule). The antibody may be of the IgG1, IgG2, IgG3 or IgG4 type. The antibodies may be used with or without modification, and may be labeled covalently or non-covalently, with, for example, a reporter group or an effector group.

An "antibody fragment" according to the invention exhibits substantially the same epitope binding site as a corresponding antibody and/or has substantially the same inhibitory activity of the Circ-COL6a3-20KD peptide fragment as a corresponding antibody.

Methods for producing the antibodies of the invention are known to those skilled in the art.

In some embodiments, the antibody is designed against the amino acid sequence of TEMFRITLLQVLHPTQC (SEQ ID NO: 3); is obtained by preparing monoclonal antibody with polypeptide TEMFRITLLQVLHPTQC (SEQ ID NO:3) as immunogen. The tumor cell scratch test and the cell invasion analysis show that the antibody anti-COL6A3-20KD of the invention can well inhibit the proliferation and migration of colon cancer cells, and the results are shown in fig. 6 and fig. 7.

On the other hand, the invention also provides application of a detection reagent of the nucleic acid fragment of the Circ-COL6A3-6401 and/or the peptide fragment of the Circ-COL6A3-20KD in preparing a cancer screening/diagnosis/prediction/prognosis diagnostic agent or a diagnostic system.

In another aspect, the invention provides a colon cancer treatment system comprising 1) a Circ-COL6A3-6401 and/or Circ-COL6A3-20KD detection system; 2) a medication system; wherein, the detection system is a detection system which can detect the circular RNA and the expressed peptide segment thereof in the prior art, such as fluorescent quantitative PCR and/or immunohistochemistry. The detection system is used for detecting whether the Circ-COL6A3-6401 and/or Circ-COL6A3-28KD exists or not, and if the Circ-COL6A3-6401 and/or the Circ-COL6A3-28KD exists, then a medicine application system can be implemented. Wherein the medicine system contains a Circ-COL6A3-6401 nucleic acid fragment and/or a Circ-COL6A3-20KD peptide fragment inhibitor.

Preferably, the fragment of the Circ-COL6A3-6401 nucleic acid and/or the inhibitor of the peptide fragment of Circ-COL6A3-20KD is as described above.

On the other hand, the invention also provides a research and development method of a medicine for treating colon cancer. Aiming at a nucleic acid fragment of the Circ-COL6A3-6401, designing a corresponding inhibitor or a gene therapy tool; as a preferred embodiment, this is achieved by means of gene interference, gene editing, antisense nucleic acid sequences or Locked Nucleic Acids (LNA).

In another aspect, the invention provides another method for developing a drug for treating colon cancer. The method aims at the Circ-COL6A3-20KD and designs a corresponding activity inhibitor of the Circ-COL6A3-20 KD. Further, the Circ-COL6A3-20KD activity inhibitor is an antibody and a functional fragment thereof, or a small molecule compound; preferably, the inhibitor of the activity of Circ-COL6A3-20KD is an antibody.

In another aspect, the invention also provides an siRNA specific to Circ-COL6A 3-6401.

The siRNA is designed aiming at a Circ-COL6A3-6401 ring interface. Preferably, the sequence fragment spanning the interface is designed for any of 741 th to 20 th positions of Circ-CHD 1-6401; the sequence fragment is preferably 18 bases or more in length and is complementary to at least the sequence from position 716 to 17 of Circ-COL6A 3-6401.

More preferably, the siRNA is designed against one of the following key fragments of Circ-COL6A3-6401, and as a more preferred embodiment, the siRNA is selected from any one of SEQ ID NO 6-8.

In another aspect, the invention also provides a polypeptide characterized by a sequence as shown in SEQ ID NO. 3.

In another aspect, the invention also provides a Circ-COL6A3-6401 nucleic acid fragment or a Circ-COL6A3-20KD peptide fragment, wherein the sequence of the nucleic acid fragment is shown as SEQ ID NO. 1; the sequence of the peptide segment is shown as SEQ ID NO. 2.

In another aspect, the invention provides an antibody against Circ-COL6A3-20 KD. It is prepared by adopting an amino acid sequence shown as SEQ ID NO. 3 as immunogen. The antibody is a polyclonal antibody. In one embodiment of the present invention, the antibody is a monoclonal antibody raised against TEMFRITLLQVLHPTQC (SEQ ID NO:3) as an immunogen and designated anti-COL6A3-20 KD.

In another aspect, the invention also provides a kit for tumor diagnosis and/or prognosis judgment, which comprises a primer for amplifying the Circ-COL6A3-6401 or an antibody against the Circ-COL6A3-28KD protein.

In another aspect, the present invention also provides a system for tumor diagnosis and/or prognosis, comprising the following components:

a detection member of circ-COL6a 3-6401;

b. a result judgment means; the result judging component is used for judging the risk of the colon cancer or the prognosis risk according to the expression quantity of the Circ-COL6A3-6401 detected by the detecting component;

if the expression quantity of the Circ-COL6A3-6401 is high, judging high risk; otherwise, the risk is low.

As a practical way, the expression level of the Circ-COL6A3-6401 can be divided according to the grouping score.

As a specific grouping and scoring method, at least two pathologists independently judge the immunohistochemical result under double-blind condition (without knowing any relevant clinical and pathological data).

And judging the result, namely evaluating the dyeing result by using a Bresalier semi-quantitative scoring formula. Ten views were randomly selected from each section and the intensity of cell staining was scored as follows: negative cells (-) no color (0); weakly positive cells (+) (1) in yellow; moderately positive cells (++) are light brown (2); positive cells (+++) were identified as dark brown (3). In each field, the cell counts with each staining intensity were counted and the average staining intensity for each section was calculated according to the following formula: the intensity score ∑[ (0 × F0) + (1 × F1) + (2 × F2) + (3 × F3) ], where F ═ x 10 fields of view. Differences between groups were analyzed using Student t-test, P <0.05 was considered statistically significant.

The detection member of the Circ-COL6A3-6401 contains a Circ-COL6A3-6401 detection reagent; preferably, the detection reagent of the Circ-COL6A3-6401 is a primer for amplifying the Circ-COL6A3-6401 or an antibody against the Circ-COL6A3-20KD protein.

The expression quantity of the Circ-COL6A3-6401 is the quantity of circular RNA or the quantity of protein Circ-COL6A3-20KD expressed by the circular RNA;

the Circ-COL6A3-6401 has a nucleic acid sequence shown in SEQ ID NO. 1; preferably, the Circ-COL6A3-20KD has the amino acid sequence shown in SEQ ID NO. 2.

In the invention, the tumor is a tumor type with COL6A3 mutation; specifically, the COL6A3 mutant tumor is a tumor which expresses circular Circ-COL6A3-6401 and translates corresponding protein; more specifically, the tumor which expresses the circular Circ-COL6A3-6401 and translates the corresponding protein comprises one or more of colon cancer, liver cancer, breast cancer, pancreatic cancer, colon cancer, gastric cancer and the like; particularly preferably, the tumor is colon cancer.

The method comprises the following specific implementation steps: detailed description of the preferred embodiments

The technical solutions of the present invention are further illustrated by the following specific examples, which do not represent limitations to the scope of the present invention. Insubstantial modifications and adaptations of the present invention by others of the concepts fall within the scope of the invention.

In the invention, the Circ-COL6A3-6401 refers to a circular RNA Circ-COL6A3-6401 nucleic acid fragment and also refers to a peptide fragment translated by the circular RNA, namely, the Circ-COL6A3-20 KD.

At present, a nucleic acid fragment of Circ-CDH-6401 is disclosed and reported as a closed circular RNA molecule formed by head-to-tail connection of exons 2 to 4 of COL6A3 gene, and the length of the RNA molecule is 761 nt. The expression product of the nucleic acid fragment of the Circ-COL6A3-6401 is a peptide fragment of the Circ-COL6A3-20 KD. Of course, it is not excluded that other variant forms of Circ-CDH-6401 will be subsequently found, performing a similar mechanism. The use of these variant forms for targeted inhibition, modulation, detection, etc. in accordance with the concepts of the present invention is also within the scope of the present invention.

The inhibitor of Circ-COL6A3-6401 is a substance or a tool that causes at least partial blockage of the genetic information pathway of circular RNA Circ-COL6A3-6401, and can inhibit at the protein level (a fragment of the peptide of Circ-COL6A3-20 KD) or at the nucleic acid level (a fragment of the nucleic acid of Circ-COL6A 3-6401). Inhibitors acting at the protein level may be selected from antibodies and/or small molecule compounds, etc. Inhibitors acting at the nucleic acid level such as antisense molecules, RNAi molecules and/or ribozymes.

Example 1COL6A3 circular RNA formation and DNA sequencing identification

The COL6A3 gene was found to be located in the region of the human chromosome 2 long arm chr2(q37.3) through the analysis of UCSC (http:// genome. UCSC. edu /) online database software, and the genome spans 3083 bp; according to COL6A3 circular RNA information recorded by circular RNA authority database circBase (http:// circrna. org /), exons 2 to 4 of COL6A3 gene are found to form closed circular RNA molecules through head-to-tail connection, the length of which is 761nt, and the name of the circular-COL 6A3-6401 (see figure 1) contains a sequence shown as SEQ ID NO. 1; PCR amplification primers are designed on two sides of the circular RNA connecting site, sequences at two wings of the circular RNA connecting site are amplified, and the accurate circular site of the Circ-COL6A3-6401 circular RNA is obtained by a sanger DNA sequencing method. The PCR primer sequence for specific PCR amplification of Circ-COL6A3-6401 is designed as follows:

SEQ ID NO:4

F1:5'TGGCTCTCACTGAAACAGAAATG 3'，

SEQ ID NO:5

R1:5'GTCGTCACTGGGTTGGATGTAG3'

total RNA was isolated from SGC7901 and BGC823 cell lysates using the RNeasy mini kit according to the manufacturer's instructions. The total RNA was then treated with DNase I in the presence of an anti-RNase enzyme to remove DNA contamination prior to complementary DNA synthesis. Complementary DNA was synthesized using random primers and avian fibroblast disease virus reverse transcriptase (Promega). Real-time PCR (Power SYBR-Green, ABI, wolington, england) analysis was performed using an ABI Prism 7500 sequence detector according to the manufacturer's protocol. The PCR product was purified and subjected to sanger DNA sequencing. The exact circularization interface for circular RNA was identified by sanger DNA sequencing (see FIG. 2). PCR detected the expression of Circ-COL6A3-6401 in colon cancer and paracarcinoma tissues (see FIG. 3).

Example 2

Predictive identification of COL6A3 circular RNA translated small molecule protein and mouse monoclonal antibody preparation through nucleotide sequence analysis of Circ-COL6A3-6401 circular RNA molecule, the RNA can form an open reading frame consisting of ATG-TGA after cyclization, a novel COL6A3 small protein consisting of 254 amino acids is generated through translation, and the protein molecular weight prediction software http:// www.bio-soft

The predicted protein has a molecular weight of about 20KD, and is named as Circ-COL6A3-20KD (see FIG. 4), and contains a sequence shown as SEQ ID NO. 2. According to the composition of a Circ-COL6A3-20KD amino acid sequence, a mouse monoclonal antibody which can be used for detection by an Elisa and western blot method and cell function test is designed, wherein the method comprises the following steps of synthesizing a polypeptide TEMFRITLLQVLHPTQC (SEQ ID NO:3) amino acid sequence which is specifically generated aiming at circular RNA COL6A3 as an immunogen by a method for chemically synthesizing the polypeptide; polyclonal antibody preparation a standardized preparation protocol was used as follows:

first, polypeptide coupling to carrier protein BSA, followed by rabbit immunization protocol 2.1 animal selection: the rabbit is New Zealand white rabbit, and has body weight of 2.5Kg for young and strong. The animals are selected from healthy animals with bright fur and free movement. Animals were selected and pre-housed for about 2 weeks. Aims to eliminate some unqualified animals and ensure that later experiments can be smoothly carried out. 2.2 preparation before experiment: the rabbit was marked. 2.3 antigen preparation: 2.3.1 the antigen is taken out of a refrigerator with the temperature of-20 ℃, dissolved at normal temperature and prevented from being repeatedly frozen and thawed. And mark the syringe, write item number and animal number. 2.3.2 extracting antigen (completely mixing antigen), the concentration of the first immunity antigen is 1mg/ml, the concentration of the second immunity-fourth immunity antigen is 0.5 ml/rabbit, the concentration of the second immunity-fourth immunity antigen is halved, and the dosage is not changed. 2.3.3 draw out adjuvant, adjuvant and antigen at a 1:1 volume ratio. The first-time immunization adopts a complete adjuvant, and the second-time immunization adopts an incomplete adjuvant. When the adjuvant is pumped, the adjuvant is pumped into the injector after being fully and uniformly mixed. 2.3.4 two injectors are butted by a syringe connecting pipe and then completely emulsified, and the emulsification standard is as follows: the emulsified immunogen is dropped into water with the temperature of 37 ℃ and is not dispersed to be qualified. 2.4 immunization: the rabbits were injected subcutaneously in multiple spots of 0.2ml each. The immunization time is as follows: the second immunization is carried out 14 days after the first immunization, and the interval between the second immunization and the third immunization is 7 days. And (3) collecting small sample serum from the middle ear artery on the 7 th day after the rabbit three-immunization, detecting the small sample serum to be qualified, adding the rabbit three-immunization after 7 days, and collecting the whole blood after 7 days of adding the rabbit three-immunization.

Antibody purification

The affinity column was washed thoroughly with 20mL of pure water and 1 XPBS (pH7.4) in this order at a flow rate of 70 mL/h. 10mL of serum to be purified was taken in a 50mL centrifuge tube and filtered with a microfiltration membrane having a pore size of 0.45 μm and a diameter of 25 mm. The suction-filtered serum sample was loaded at a flow rate of 40mL/h and repeated once. The column was washed with 20mL of 1 XPBS (pH7.4) at a flow rate of 70mL/h, and after 10min, a protein detector was attached, and the light transmittance (T-range) of the instrument was adjusted to 100 during the washing. Adjusting the light absorption rate (1A grade) of the protein detector to be 0, opening an HD-A computer collector on a computer desk at the moment, adjusting the full-screen range to be 5, eluting the antibody at the speed of 40mL/h by using glycine solution (pH 2.7, 0.2M), pressing a green elution record button to start elution at the moment, and starting to collect the antibody when the light absorption rate of the protein detector starts to rise. The pH value of the antibody is timely adjusted to about 7 by 1M sodium bicarbonate in the antibody collection process, and the highest peak value of an elution peak is recorded. After antibody collection, the pH was adjusted to about 7 and the volume of antibody eluted was recorded, after which the rubber tube connected to the collector was rinsed with purified water. The affinity column was washed with 20mL of 1 XPBS and purified water at a rate of 70mL/h, followed by addition of 20% ethanol, sealing, and storage in a refrigerator at 4 ℃.

ELISA detection

Wrapping a plate: known antigens were diluted to 1. mu.g/ml with coating buffer (Na 2CO3 and NaHCO3 buffer), 50. mu.l was added to each reaction well of the polystyrene plate, overnight at 4 ℃ the next day, the well solutions were discarded, and the wells were washed 1 time with 180. mu.l/well of 1 XTSST washing buffer.

And (3) sealing: blocking was performed by adding 60. mu.l of 1% BSA (in TBST) to each well, and incubating at 37 ℃ for 1 hour. The blocking solution was then discarded.

Sample adding: adding a diluted sample to be tested (diluting the sample to be tested according to a certain proportion), and placing 50 mu l of the diluted sample in the sealed reaction hole. Positive control wells (positive serum) and negative control wells (BSA) were also set. Incubate at 37 ℃ for 1 hour, then discard the blocking solution, wash 2 times with 180. mu.l per well of 1XTBST wash buffer.

Adding an enzyme-labeled antibody: freshly diluted secondary antibody-HRP (1:5K, diluted with 1% BSA) was added to the wells of the ELISA plate at 50. mu.l/well and incubated at 37 ℃ for 45min, after which the blocking solution was discarded and washed 3 times with 180. mu.l/well of 1 XTSST wash buffer.

Adding a substrate solution for color development: 100. mu.l of a TMB substrate solution prepared temporarily was added to each reaction well, and the mixture was allowed to react at 37 ℃ for 5 min.

And (3) terminating the reaction: to each reaction well was added 90. mu.l of 2M sulfuric acid.

Reading a plate: and (3) placing the ELISA plate in a preheated ELISA reader (450nm) for reading, storing data and analyzing.

TABLE 1 Elisa test for polyclonal antibodies prepared

Example 3

Western blot protein detection

Cells were scraped from the plates and the final protein concentration of the cell lysates was determined by BCA method using bovine serum albumin as standard. Equivalent cell extracts (20-40. mu.g protein) were boiled in 5 Xdodecyl sodium sulfate (SDS) at 95 ℃ for 5 minutes, cooled on ice, and then the total protein extracts were separated by 10-12% SDS-PAGE, followed by electrotransfer to polyvinylidene fluoride membranes. Primary anti-HAPM 0617 (1: 1,000) and anti-GAPDH (1: 1,000, Abcam) antibodies were diluted in TBST and incubated with the membrane overnight at 4 ℃. Appropriate secondary antibodies (1: 1,000, anti-rabbit antibody) were applied for 1h at room temperature. Immunoreactive proteins were visualized by enhanced chemiluminescence.

The results of the experiment are shown in FIG. 5, where western examined the expression of the protein Circ-COL6A3-20KD in SW620 cells (NC control group, P-Circ Circ-COL6A3-6401 overexpression group).

EXAMPLE 4 plate clone formation assay

500 cells were plated in RPMI-1640/10% FBS in 6-well plates per well and cultured in a 37 degree incubator for 2 weeks. Clones were stained with 1ml 0.1% crystal violet for 20 min. The number of clones in 10 randomly selected fields was evaluated by microscopy.

The experimental results are shown in FIG. 6, the number of SW480 cell clones formed after adding the Circ-COL6A3-20KD polyclonal antibody is reduced, and the inhibition effect of the polyclonal antibody on the SW480 cell proliferation capacity is suggested.

Example 5 cell scratch test

Scribing: a marker pen is firstly used at the back of the 6-hole plate, and then the 6-hole plate is touched by a ruler, and transverse lines are uniformly drawn approximately every 0.5-1 cm and transversely penetrate through the holes. Each hole passes through at least 5 lines of planking: cells in logarithmic growth phase are digested into single cell suspension by trypsin and inoculated in a 6-hole culture plate; the cells were plated at 6 × 105 cells/well to ensure that the cells were confluent the next day, with a final total amount of 2mL of medium per well; the cells were cultured at 37 ℃ for 24h in a 5% CO2 incubator. Scratching: the gun head is used on the next day, the ruler is compared, the scratch is perpendicular to the transverse line at the back as much as possible, and the gun head is perpendicular and cannot be inclined. Cleaning: the cells were washed 3 times with PBS, the scraped cells were removed, and serum-free medium was added. And (3) photographing: take a picture under the 4 times mirror, guarantee that the mar is placed in the middle and perpendicular, notice the background unanimous, can be according to 0, 6, 12, 24h time point sample, take a picture (specific time is decided according to the experiment needs).

The experimental results are shown in FIG. 7, the scratch distance of SW480 cells is reduced after adding the Circ-COL6A3-20KD polyclonal antibody, which indicates the inhibition effect of the polyclonal antibody on the migration capability of SW480 cells.

Example 6 immunohistochemistry

The slices were dewaxed conventionally to water. If antigen retrieval is required, this can be followed; washing with buffer solution for 3min/2 times; in order to reduce non-specific background staining caused by endogenous peroxidase, the sections were incubated in a Hydrogen Peroxide Block for 10-15 minutes; washing with buffer solution for 5min/2 times; ultra V Block was added dropwise and incubated at room temperature for 5min to Block non-specific background staining. (Note: incubate not longer than 10 minutes, otherwise it will lead to specific staining reduction. if the primary antibody dilution contains 5-10% normal sheep serum, this step can be omitted.); washing with buffer solution for 5min/2 times; adding primary antibody working solution dropwise and incubating for 1-2 hours at 37 ℃. (the specific incubation time and temperature are ultimately determined by the experimenter); the buffer was washed 5min/2 times. Primary Antibody Enhancer (Enhancer) was added dropwise and incubated at room temperature for 20 min. The buffer was washed 5min/2 times. HRP Polymer (enzyme-labeled secondary antibody) was added dropwise and incubated at room temperature for 30 minutes. Immunohistochemistry detected the expression of Circ-COL6A3-20KD in colon cancer tissues and tissues adjacent to the cancer (FIG. 8).

Sequence listing

<110> Zhejiang province people hospital

<120> application of Circ-COL6A3-6401 inhibitor in preparation of antitumor drugs

<160> 0

<170> SIPOSeqienceListing 1.0

SEQ ID NO:1

DNA

Homo sapiens

AAATGTTCCG AATAACGTTA CTTCAAGTCC TACATCCAAC CCAGTGACGA CAACGAAGCC GGTGACTACG ACGAAGCCGG TGACCACCAC AACAAAGCCT GTAACCACCA CAACAAAGCC TGTGACTATT ATAAATCAGC CATCTGTGAA GCCAGCCGCT GCAAAGCCGG CCCCTGCGAA ACCTGTGGCT GCCAAGCCTG TGGCCACAAA GATGGCCACT GTTAGACCCC CAGTGGCGGT GAAGCCAGCA ACGGCAGCGA AGCCTGTAGC AGCAAAGCCA GCAGCTGTAA GACCCCCCGC TGCTGCTGCT GCAAAACCAG TGGCGACCAA GCCTGAGGTC CCTAGGCCAC AGGCAGCCAA ACCAGCTGCC ACCAAGCCAG CCACCACTAA GCCCATGGTT AAGATGTCCC GTGAAGTCCA GGTGTTTGAG ATAACAGAGA ACAGCGCCAA ACTCCACTGG GAGAGGGCTG AGCCCCCCGG TCCTTATTTT TATGACCTCA CCGTCACCTC AGCCCATGAT CAGTCCCTGG TTCTGAAGCA GAACCTCACG GTCACGGACC GCGTCATTGG AGGCCTGCTC GCTGGGCAGA CATACCATGT GGCTGTGGTC TGCTACCTGA GGTCTCAGGT CAGAGCCACC TACCACGGAA GTTTCAGTAC AAAGAAATCT CAGCCCCCAC CTCCACAGCC AGCAAGGTCA GCTTCTAGTT CAACCATCAA TCTAATGGTG AGCACAGAAC CATTGGCTCT CACTGAAACA G

SEQ ID NO:2

Homo sapiens

MATVRPPVAV KPATAAKPVA AKPAAVRPPA AAAAKPVATK PEVPRPQAAK PAATKPATTK PMVKMSREVQ VFEITENSAK LHWERAEPPG PYFYDLTVTS AHDQSLVLKQ NLTVTDRVIG GLLAGQTYHV AVVCYLRSQV RATYHGSFST KKSQPPPPQP ARSASSSTIN LMVSTEPLAL TETEMFRITL LQVLHPTQ

SEQ ID NO:3

TEMFRITLLQVLHPTQC

SEQ ID NO:4

F1:5'TGGCTCTCACTGAAACAGAAATG 3'，

SEQ ID NO:5

R1:5'GTCGTCACTGGGTTGGATGTAG3'

SEQ ID NO:6

Forward: 5’-3’ CUCUCACUGAAACAGAAAU

Reverse: 5’-3’ GAGAGUGACUUUGUCUUUA

SEQ ID 7

Forward: 5’-3’ UCACUGAAACAGAAAUGUU

Reverse: 5’-3’ AGUGACUUUGUCUUUACAA

SEQ ID 8

Forward: 5’-3’ ACAGAAAUGUUCCGAAUAA

Reverse: 5’-3’UGUCUUUACAAGGCUUAUU