阅读说明：本技术 一种用于检测β淀粉样蛋白的基因序列组、杂交瘤细胞组及胶乳增强免疫比浊法试剂盒 (Gene sequence group for detecting beta amyloid, hybridoma cell group and latex enhanced immunoturbidimetry kit ) 是由 芮双印 符修乐 于 2020-12-08 设计创作，主要内容包括：本发明公开了一种用于检测β淀粉样蛋白的基因序列组和杂交瘤细胞组,以及基于它们的β淀粉样蛋白的胶乳增强免疫比浊法试剂盒。本发明自制了三株单克隆抗体,交联到胶乳微球上,形成胶乳增强免疫比浊法试剂盒,相比酶联免疫法,该方法测定β淀粉样蛋白,可在全自动生化分析仪上使用,成本低廉且自动化高节省检测时间。(The invention discloses a gene sequence group and a hybridoma cell group for detecting beta amyloid, and a latex enhanced immunoturbidimetry kit based on the beta amyloid. The invention self-prepares three monoclonal antibodies, and the three monoclonal antibodies are crosslinked on latex microspheres to form the latex enhanced immunoturbidimetry kit.)

1. A gene sequence set for detecting amyloid beta, characterized by: the gene fragment I, the gene fragment II and the gene fragment III are included, wherein the DNA sequence of the gene fragment I is shown as SEQ ID NO.1, the DNA sequence of the gene fragment II is shown as SEQ ID NO.2, and the DNA sequence of the gene fragment III is shown as SEQ ID NO. 3.

2. A hybridoma cell panel for detecting amyloid-beta, comprising: the hybridoma cell line comprises a first hybridoma cell, a second hybridoma cell and a third hybridoma cell, wherein the first hybridoma cell is formed by fusing a cell immunized by an expression product of a first gene segment and a myeloma cell, the second hybridoma cell is formed by fusing a cell immunized by an expression product of a second gene segment and a myeloma cell, and the third hybridoma cell is formed by fusing a cell immunized by an expression product of a third gene segment and a myeloma cell.

3. A kit for a latex enhanced immunoturbidimetry method for amyloid beta, which is characterized in that: comprises a reagent R1 and a reagent R2;

the reagent R1 comprises the following components:

the reagent R2 comprises the following components:

the Abeta-latexMIX is formed by respectively crosslinking three monoclonal antibodies Abeta 1-mab, Abeta 2-mab and Abeta 3-mab to polystyrene latex microspheres and then mixing.

4. The amyloid-beta latex-enhanced immunoturbidimetry kit of claim 3, wherein: the three monoclonal antibodies Abeta 1-mab, Abeta 2-mab and Abeta 3-mab are respectively selected from the hybridoma cell I, the hybridoma cell II and the antibody secreted by the hybridoma cell III as claimed in claim 2.

5. The latex-enhanced immunoturbidimetry kit for amyloid beta according to claim 3 or 4, wherein: the preparation method of the A beta-latexMIX comprises the following steps:

5.1 suspending the polystyrene latex microspheres by using an activation buffer solution to obtain a microsphere activation solution;

5.2 adding EDC into the microsphere activation solution, incubating at room temperature, then adding EDC again, and continuing incubating at room temperature to obtain a microsphere incubation solution;

5.3 washing the microsphere incubation solution by using a coating buffer solution, and suspending the obtained polystyrene latex microspheres in the coating buffer solution to obtain microsphere suspension;

5.4 dissolving the A beta 1-mab by using a coating buffer solution to obtain an A beta 1-mab antibody solution;

5.5 adding the Abeta 1-mab antibody solution into the microsphere suspension, and continuously stirring for incubation at room temperature to obtain a reaction solution;

5.6 adding ethanolamine into the reaction solution, and continuously stirring for incubation at room temperature to obtain a cross-linked mixed solution;

5.7 suspending the crosslinking mixture with a storage buffer solution, removing unbound antibody and ethanolamine, and obtaining latex microspheres Abeta 1-latex of Abeta 1-mab;

5.8 obtaining latex microspheres Abeta 2-latex and Abeta 3-latex of Abeta 2-mab and Abeta 3-mab according to the operation;

5.9 A.beta.1-latex, A.beta.2-latex and A.beta.3-latex were mixed in the following ratio of 2: 2: 3, mixing to obtain Abeta-latexMIX.

6. The latex-enhanced immunoturbidimetry kit for amyloid beta according to claim 3 or 4, wherein: the kit also comprises a reagent calibration product, wherein the reagent calibration product comprises the following components:

wherein rA beta 1-3 is a mixture of three target proteins rA beta 1, rA beta 2 and rA beta 3 mixed according to the ratio of 1:1: 1.

7. The method of determining amyloid-beta latex-enhanced immunoturbidimetry kit of any one of claims 3 to 6, wherein: the analysis method adopts a two-point end point method, and the conditions are as follows:

the reaction direction is ascending reaction;

the calibration mode is Logit-Log (5P);

the measuring wavelength is 570 nm;

the measuring temperature is 37 ℃;

sample reagent R1 reagent R2 ═ 20:210:70(μ L)

The testing steps are as follows: aspirate 20. mu.L of sample, add 210. mu.L of reagent R1, incubate at 37 ℃ for 5min, add 70. mu.L of reagent R2, read absorbance A1 after 1min, read absorbance A2 after 3min, calculate Δ A.

Technical Field

The invention belongs to the technical field of genetic engineering and the field of immunoassay, and particularly relates to a beta amyloid latex enhanced immunoturbidimetry detection kit (A amyloid beta-protein expressed proteinaceous detected kit on monoclonal antibodies) prepared based on a monoclonal antibody and a preparation method thereof.

Background

An antigen is usually composed of a plurality of antigenic determinants, an organism is stimulated by one antigenic determinant, an antibody generated by a B lymphocyte receiving the antigen is called a monoclonal antibody, and the monoclonal antibody is usually prepared by adopting a hybridoma technology, wherein the hybridoma technology is characterized in that a sensitized B cell with the capacity of secreting a specific antibody and a myeloma cell with the unlimited reproductive capacity are fused into a B cell hybridoma on the basis of a cell fusion technology. By culturing a single hybridoma having such a characteristic into a cell population, a monoclonal antibody, which is a specific antibody against one epitope, can be produced.

Amyloid beta (Amyloid β -protein, a β) has a molecular weight of about 4kDa, is hydrolyzed from Amyloid precursor protein, is secreted by cells, and has a potent neurotoxic effect after accumulation of cell matrix precipitates. It is a polypeptide mainly containing 40 or 42 amino acids and is obtained by performing two times of protease digestion on a precursor protein APP. And is beta-sheet in three-dimensional structure, and is called "beta-amyloid".

Beta-amyloid can be produced by a variety of cells, circulating in the blood, cerebrospinal fluid and cerebral interstitial fluid, mostly bound to chaperone molecules, and a few in free state, resulting from the hydrolysis of amyloid precursor proteins. Amyloid precursor protein may be cleaved by three secretases, and only by both β -secretase and γ -secretase can a β be obtained. The α -secretase plays a role in preventing a β secretion, balancing a β secretion level. A.beta.1-40 containing 40 amino acids is the most common in vivo, while A.beta.1-42 containing 42 amino acids was found to have increased secretion in AD and more prone to amyloid aggregation, probably related to the two hydrophobic amino acids added to the C-terminus of A.beta.1-42. In a healthy person's lifetime, a β is present in both the brain and cerebrospinal fluid, and therefore, the presence of a β does not mean neuropathy. Physiologically secreted soluble a β aggregates into oligomers or larger a β fibers when neuronal damage occurs, are considered to be a determinant of the onset of AD. However, the reason why a β, which is usually present in soluble form in cerebrospinal fluid and plasma, becomes prone to aggregate and form neurotoxic oligomers, fibrils and mature fibers, which in turn accumulate to form plaques, is not particularly clear. Shaked et al suggest that A β may interact directly with APP to promote aggregation of APP, and through a series of cascade reactions, may eventually cause apoptosis; the site of action is the A β region on APP. The content and clinical significance of beta amyloid in the serum of AD patients are also studied by the trefoil et al. They examined the serum Abeta content in 22 AD patients and 30 normal control groups by radioimmunoassay. The result shows that the content of the A beta in the serum of the AD patient is obviously higher than that of the control group, 72.3pg/mL is taken as the upper limit of the A beta of the normal population, the sensitivity for diagnosing the senile dementia is 63.6 percent, and the specificity is 83.3 percent; the final experimental conclusion is that the content of Abeta in the serum of an AD patient is increased, and the kit has higher sensitivity and specificity for diagnosing senile dementia and has certain clinical application value. Pendangtao also studied the production and changes of Abeta 1-40, Abeta 1-42 and P-Tau in the plasma of patients with senile dementia. The kit A beta 1-40 and A beta 1-42 produced by Sigma is adopted to study population of early AD patients, middle AD patients and non-dementia control groups, and finally, the blood plasma concentrations of the A beta 1-40 and the A beta 1-42 of the AD early patients are increased, wherein the A beta 1-42 concentration is obviously increased, and the A beta 1-40 concentration has only rising trend compared with the control group and has no statistical significance. The difference between the concentration of the A beta 1-42 in the middle period and the concentration in the control group is not significant, which is probably because the precipitation of the A beta 1-42 is accelerated to lower the plasma concentration of the A beta 1-42 along with the worsening of the disease condition. Therefore, the increase of the A beta 1-42 plasma concentration can possibly become a good auxiliary index for early diagnosis of AD, but the sample size needs to be further increased for verification.

At present, a commercially available beta amyloid (Abeta) detection kit mainly adopts an enzyme-linked immunosorbent assay technology, and the method has the problems of low sensitivity, narrow linear range, complex operation steps, time consumption and the like, and cannot meet the requirements of clinical application. Therefore, a rapid quantitative detection method for beta-amyloid (a β) with less pollution, high sensitivity, simple operation, high automation degree, good specificity and low cost is still needed.

Disclosure of Invention

Aiming at the problems of poor A beta antigenicity, overlong detection method time, undersize detection amount and high detection cost which cannot be popularized in clinic in the prior art, the invention provides a gene sequence group, a hybridoma cell group and a latex enhanced immunoturbidimetry kit for detecting beta amyloid, which can replace an enzyme-linked immunosorbent assay method, improve the detection efficiency and enlarge the detection sample amount. Meanwhile, the method has good correlation with the enzyme-linked immunosorbent assay, is suitable for analysis of various full-automatic biochemical analyzers, and is convenient for clinical application.

In order to solve the technical problems, the invention adopts the following technical scheme:

the invention provides a gene sequence group for detecting beta amyloid, which comprises a gene segment I, a gene segment II and a gene segment III, wherein the DNA sequence of the gene segment I is shown as SEQ ID NO.1, the DNA sequence of the gene segment II is shown as SEQ ID NO.2, and the DNA sequence of the gene segment III is shown as SEQ ID NO. 3.

The invention provides a hybridoma cell group for detecting beta amyloid, which comprises a first hybridoma cell, a second hybridoma cell and a third hybridoma cell, wherein the first hybridoma cell is formed by fusing a cell immunized by an expression product of a gene segment I and a myeloma cell, the second hybridoma cell is formed by fusing a cell immunized by an expression product of a gene segment II and a myeloma cell, and the third hybridoma cell is formed by fusing a cell immunized by an expression product of a gene segment III and a myeloma cell.

The invention provides a latex enhanced immunoturbidimetry kit for amyloid beta, which comprises a reagent R1 and a reagent R2;

the reagent R1 comprises the following components:

the reagent R2 comprises the following components:

the Abeta-latexMIX is formed by respectively crosslinking three monoclonal antibodies Abeta 1-mab, Abeta 2-mab and Abeta 3-mab to polystyrene latex microspheres and then mixing.

Furthermore, the three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab are respectively selected from antibodies secreted by the hybridoma cell I, the hybridoma cell II and the hybridoma cell III.

Further, the preparation method of the A beta-latexMIX comprises the following steps:

5.1 suspending the polystyrene latex microspheres by using an activation buffer solution to obtain a microsphere activation solution;

5.2 adding EDC into the microsphere activation solution, incubating at room temperature, then adding EDC again, and continuing incubating at room temperature to obtain a microsphere incubation solution;

5.3 washing the microsphere incubation solution by using a coating buffer solution, and suspending the obtained polystyrene latex microspheres in the coating buffer solution to obtain microsphere suspension;

5.4 dissolving the A beta 1-mab by using a coating buffer solution to obtain an A beta 1-mab antibody solution;

5.5 adding the Abeta 1-mab antibody solution into the microsphere suspension, and continuously stirring for incubation at room temperature to obtain a reaction solution;

5.6 adding ethanolamine into the reaction solution, and continuously stirring for incubation at room temperature to obtain a cross-linked mixed solution;

5.7 suspending the crosslinking mixture with a storage buffer solution, removing unbound antibody and ethanolamine, and obtaining latex microspheres Abeta 1-latex of Abeta 1-mab;

5.8 obtaining latex microspheres Abeta 2-latex and Abeta 3-latex of Abeta 2-mab and Abeta 3-mab according to the operation;

5.9 A.beta.1-latex, A.beta.2-latex and A.beta.3-latex were mixed in the following ratio of 2: 2: 3, mixing to obtain Abeta-latexMIX.

Further, the kit also comprises a reagent calibration product, wherein the reagent calibration product comprises the following components:

wherein rA beta 1-3 is a mixture of three target proteins rA beta 1, rA beta 2 and rA beta 3 mixed according to the ratio of 1:1: 1.

The invention also provides a determination method of the beta amyloid latex enhanced immunoturbidimetry kit, wherein the analysis method adopts a two-point end point method, and the conditions are as follows:

the reaction direction is ascending reaction;

the calibration mode is Logit-Log (5P);

the measuring wavelength is 570 nm;

the measuring temperature is 37 ℃;

sample reagent R1 reagent R2 ═ 20:210:70(μ L)

The testing steps are as follows: aspirate 20. mu.L of sample, add 210. mu.L of reagent R1, incubate at 37 ℃ for 5min, add 70. mu.L of reagent R2, read absorbance A1 after 1min, read absorbance A2 after 3min, calculate Δ A.

The latex enhanced turbidimetry is a more stable and accurate homogeneous phase immunoturbidimetry detection method which appears in recent years. The latex enhanced turbidimetry is to crosslink antibodies on the surface of polymer latex microspheres, and after the microspheres crosslinked with the antibodies are combined with antigens, the microspheres can be rapidly aggregated together in a short time, so that the light transmittance (namely, the absorbance) of a reaction solution is changed. Moreover, the change of the light transmittance of the reaction solution has strong correlation with the concentration of the antigen to be detected, and the concentration of the antigen to be detected can be reflected within a certain range. The latex enhanced turbidimetry is a method in which antigen and antibody reactions and results are measured in a homogeneous reaction system. After the antigen and the antibody react, the absorbance value of the reaction liquid is directly measured, the result can be obtained in a few minutes, and the method is low in cost, time-saving and labor-saving. In addition, the method can be used on a large-scale full-automatic biochemical analyzer without adding extra equipment. The simplification of the operation steps of the latex enhanced turbidimetry correspondingly avoids the interference of a plurality of human operation factors and external factors such as reagents, environment and the like, has better stability and repeatability, and can reflect the content of the measured substance more truly.

The method comprises the steps of taking three sections of beta-amyloid protein genes in a partition manner, enabling the beta-amyloid protein genes to be crossed, sending the beta-amyloid protein genes to be synthesized by Huada genes, connecting the beta-amyloid protein genes to an expression vector pET-28a, introducing the beta-amyloid protein genes into expression bacteria BL-21 to form three expression bacteria A beta-1, A beta-2 and A beta-3, purifying and identifying three expression products of the three expression bacteria, immunizing a mouse by using the purified products, aseptically taking spleen after immunization reaches a specified antibody level, preparing hybridoma cells, culturing and screening the hybridoma, and obtaining the three hybridoma cells for later use after identification;

then, three monoclonal antibodies secreted by the three hybridoma cells are respectively crosslinked to polystyrene latex microspheres with the diameter of 100-300 nm to obtain three monoclonal antibody latex microspheres, and then the three monoclonal antibody latex microspheres are mixed together according to a certain proportion to be used as a component of the kit R2. The kit is composed of a reagent R1 and a reagent R2, wherein the reagent R1 is composed of a buffer solution, a surfactant, a stabilizer and a preservative, and the reagent R2 is composed of a buffer solution, a surfactant, a stabilizer, a preservative and latex microspheres of cross-linked and mixed Abeta 1-3 monoclonal antibodies.

The invention has the beneficial effects that:

the invention self-prepares three monoclonal antibodies, and cross-links to latex microspheres to form a latex enhanced immunoturbidimetry kit.

Drawings

FIG. 1 shows the Western Blot identification result of recombinant human A beta protein.

Lane M protein Marker26610, Lane 1 empty bacteria control, Lane 2 purified sample of recombinant human Abeta-1, Lane 3 purified sample of recombinant human Abeta-2, Yongdao 4: and purifying the recombinant human Abeta-3.

FIG. 2 shows the Western Blot identification result of the prepared three anti-Abeta protein monoclonal antibodies.

Lane M, protein Marker26610, Lane 1, BSA control, Lane 2-4, anti-Abeta protein monoclonal antibodies 1-3 prepared, Lane 5, anti-Abeta protein monoclonal antibody control by abcam.

FIG. 3 is a graph showing the correlation between the results of the enzyme-linked immunoassay and the kit of the present invention

FIG. 4 is a graph showing the verification of the linear range of the kit of the present invention

Detailed Description

The present invention will be described in further detail with reference to examples.

The various starting materials used in the following examples are all commercially available products known in the art unless otherwise specified.

Example 1

Preparation of recombinant human Abeta protein

(1) Cleavage of human Abeta protein Gene

The complete gene sequence of human A beta is as follows:

CAGGCCTAGAAAGAAGTTTTGGGTAGGCTTTGTCTTACAGTGTTATTATTTATGAGTAAAACTAATTGGTTGTCCTGCATACTTTAATTATGATGTAATACAGGTTCTGGGTTGACAAATATCAAGACGGAGGAGATCTCTGAAGTGAAGATGGATGCAGAATTCCGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTACGTAAAATAATTTACCTCTTTCCACTACTGTTTGTCCTCATCCAAATGTCCCCGTCATTTAAGAAATGAAATTCTTCTAATTGCGTTTATAAATTGTAAATTATATTGCATTTAGAAATTAAAATTCTTTTTCTTAATTTGTTTTCAAGGTGTTCTTTGCAGAAGATGTGGGTTCAAACAAAGGTGCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGACAGTGATCGTCATCACCTTGGTGATGCTGAAGAAGAAACAGTACACATCCATTCATCATGGTGTGGTGGAGGTAGGTAAACTTGACTGCATGTTTCCAAGTGGGAATTAAGACTATGAGAGAATTAGGC

the artificial cutting first segment sequence is as follows:

CAGGCCTAGAAAGAAGTTTTGGGTAGGCTTTGTCTTACAGTGTTATTATTTATGAGTAAAACTAATTGGTTGTCCTGCATACTTTAATTATGATGTAATACAGGTTCTGGGTTGACAAATATCAAGACGGAGGAGATCTCTGAAGTGAAGATGGATGCAGAATTCCGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTACGTAAAATAATTTACCTCTTTCCACTA the artificial cutting second segment sequence is:

GACTCAGGATATGAAGTTCATCATCAAAAATTGGTACGTAAAATAATTTACCTCTTTCCACTACTGTTTGTCCTCATCCAAATGTCCCCGTCATTTAAGAAATGAAATTCTTCTAATTGCGTTTATAAATTGTAAATTATATTGCATTTAGAAATTAAAATTCTTTTTCTTAATTTGTTTTCAAGGTGTTCTTTGCAGAAGATGTGGGTTCAAACAAAGGTGCAATCATTG

the third sequence of artificial cutting is:

TCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGACAGTGATCGTCATCACCTTGGTGATGCTGAAGAAGAAACAGTACACATCCATTCATCATGGTGTGGTGGAGGTAGGTAAACTTGACTGCATGTTTCCAAGTGGGAATTAAGACTATGAGAGAATTAGGC

(2) expression of recombinant human rA β 1-3 protein:

three genes are sent to Huada genes to be respectively synthesized, are connected to an expression vector pET-28a and are introduced into expression bacteria BL-21 to form three expression engineering bacteria A beta-1, A beta-2 and A beta-3, after the expression engineering bacteria are received, the activity of the engineering bacteria is recovered by shaking the bacteria for 2h at 37 ℃ in an LB culture medium containing 100 mu g/mL of ampicillin respectively, then the engineering bacteria are amplified and cultured for 8h in the LB culture medium containing 100 mu g/mL of ampicillin, when the OD value is measured to reach 1.0, IPTG is added, induction expression (final concentration is 10 mu g/mL) is carried out for 8h at 32 ℃, the bacteria are collected, and after the bacteria are crushed, supernatant and precipitate are obtained, and target proteins rA beta 1, rA beta 2 and rA beta 3 with HIS label fusion proteins are respectively obtained.

(3) Preparation of crude recombinant human rA beta 1-3:

respectively adding PBS (phosphate buffer solution) with the mass volume ratio of 1:2 into target proteins rA beta 1, rA beta 2 and rA beta 3 with HIS (human immunodeficiency virus) label fusion proteins for heavy suspension precipitation, repeatedly freezing and thawing the precipitates for 3 times at 20 ℃ and 4 ℃, ultrasonically cracking the bacterial precipitates at 4 ℃, performing ultrasonic disruption for 10min at the interval of 1s with the power of 40W, performing work for 2s, repeating the steps for 3 times, centrifuging the precipitates at 4 ℃ and 12000r/min for 30min, and respectively taking supernatant and precipitates to obtain crude proteins of rA beta 1, rA beta 2 and rA beta 3;

(4) purifying a crude product of the recombinant human rA beta 1-3:

respectively purifying crude proteins of rA beta 1, rA beta 2 and rA beta 3, wherein the specific method comprises the following steps:

affinity chromatography, filtering the crude protein, passing through GST affinity chromatography column, gradient eluting with Elution buffer (50mM Tris-Cl 30mM reduced glutathione pH 8.6), and collecting rA beta peak;

desalting and buffer solution replacing, namely passing the rA beta purified in the first step through a desalting column, and replacing with a buffer solution (50mM Tris-Cl pH10.0) to prepare for the next step of ion exchange chromatography;

ion exchange chromatography, namely balancing the columns respectively by using Loading buffers (50mM Tris-Cl pH7.0), carrying out gradient Elution by using an Elution buffer (50mM Tris-Cl 1M NaCl pH7.0) after Loading, and collecting rA beta peaks;

molecular sieve chromatography, passing rA β collected by ion exchange chromatography through a molecular sieve chromatographic column, and collecting rA β peak by Elution buffer (50mM Na2HPO 40.15M Na Cl pH7.0);

and (3) taking collected rA beta as Wersten Blot verification, namely using an Abcam A beta antibody (Y188) as a first antibody and using an Abcam goat anti-rabbit IgG (HRP-labeled) as a second antibody as WB, wherein the precipitates and the supernatant sample have positive bands at about 17kD, and the rA beta obtained after purification is beta amyloid protein.

Adding 20% glycerol, packaging under sterile condition, and storing at-80 deg.C.

The following kit was used as a mixture of purified rA β 1, rA β 2 and rA β 3 in a 1:1:1 ratio.

Example 2

Preparation of Abeta 1-mab, Abeta 2-mab and Abeta 3-mab monoclonal antibodies

(1) Immunization of mice

And (3) selecting a healthy and well-developed female BALb/c mouse with the age of 6-10 weeks for immunization. The first intraperitoneal injection of 0.2 mL/mouse, repeated 1 time interval 2 weeks, 3d before the fusion with the same dose of intravenous injection to strengthen immunity. Taking the immunized mouse spleen, preparing spleen cell suspension, suspending cells by using complete culture solution, adding rHulL-2, rHulL-6, PWM and Abeta 1-3 to make the final concentration respectively be 50U/mL, 500U/mL, 1200 and 500ug/mL, placing the mixture in a 5% CO2, culturing in an incubator at 37 ℃ for 5 days, and then harvesting the cells for fusion.

(2) Hybridoma selection

A mouse myeloma cell line SP2/0 was selected. The recovered tumor cells need to be cultured in RPMI-1640 culture solution containing 10% fresh calf serum at the temperature of 237 ℃ by a 5% CO incubator, the culture solution is changed once every 2 days, and the cells are passaged once every 3 days. The round shape is bright, the arrangement is neat, the shape is complete, and the density is proper (0.1 multiplied by 106 to 1 multiplied by 106/ml). When the number of living cells is more than 90%, the cells are fused by trypan blue staining.

(3) Cell culture and fusion

Mouse abdominal cavity macrophage is added as a feeder cell, the cell concentration is adjusted to be 1 × 105/mL, and the immune parental spleen cell and the bone marrow remaining cell are firstly fused into a binuclear cell or a karyon under the action of PEG:

mixing prepared myeloma cells and mouse spleen cells according to a proportion of 1/5, adding 20mL of RPMI-1640 solution, centrifuging at 1500rpm multiplied by 5min, discarding supernatant, lightly beating the bottom of a centrifuge tube with fingers to disperse precipitated cells, placing the centrifuge tube in a 37 ℃ water bath, sucking 1mL of 50% PEG (polyethylene glycol) pre-warmed at 37 ℃ and slowly dripping into the centrifuge tube, and adding within 1 min. Standing at 37 deg.C for 1min, adding 1mL complete culture solution (prewarming at 37 deg.C) dropwise within 1min, and adding RPM1-1640 solution to 50mL to stop PEC action. Centrifuging at 800r/min × 10min, discarding the supernatant, suspending the precipitated cells gently in HAT culture solution of desired volume, inoculating 24-well or 96-well culture plate, and culturing in 5% CO2 incubator at 37 deg.C.

(4) Screening clone culture

And (3) screening out clone culture of the two parent cells after PEC treatment by using culture solution containing hypoxanthine, aminopterin and thymidine nuciferine (HAT), changing HAT culture solution every 3 days after fusion, sucking out old culture hole solution 1/2 and changing into new culture hole solution every time, and continuously culturing for 2 weeks (14 days). After 5 days, cells which are not fused and fused by themselves die gradually, clone can appear in about 1 week, and the cells are continuously proliferated, when the colony is larger than 3mm or is fully distributed at the bottom of a hole 1/2, the supernatant is taken for antibody activity detection, and fresh HAT culture solution is added at the same time.

(5) Cloning of hybridoma positive clones

After the hybridoma cells have grown in HAT medium to form clones, only a few of which are cells secreting McAb against a β 1-3 of a predetermined specificity, are screened and cloned using enzyme-linked immunosorbent assay (ELISA). The method comprises the steps of primarily screening McAb hybridoma cells capable of secreting and reacting with a predetermined antigen, further screening hybridoma cells having a predetermined specificity, and then selecting cell clones which can be practically used and have stable growth and functional characteristics. And (3) screening and separating by a soft agar method, and then putting the selected hybridoma cells into a 96-well plate for culturing.

(6) Preparation of anti-Abeta 1-3McAb

Ascites is prepared by in vivo induction.

Healthy mice of 6-8 weeks are selected, 0.3mL of pristanine is injected into the abdominal cavity of the mice, 1.0 multiplied by 108 hybridoma cells with positive clone are injected into the abdominal cavity of each mouse after 7-10 days, and the mice are normally bred. When the abdomen of the mouse is obviously expanded to a certain degree, the ascites is extracted by a 9-gauge needle or put by a 16-gauge needle, and the ascites can be repeatedly collected for a plurality of times. The ascites fluid is centrifuged at 12000rpm for 10min, and the supernatant fluid is taken and packaged.

(7) Purification of ascites

Performing affinity chromatography after coarse purification by adopting an octanoic acid-ammonium sulfate method: ascites was centrifuged at 12000rpm for 15min at 4 ℃ and the supernatant was filtered through filter paper to remove lipids and large particle precipitates, the filtrate was diluted with 4 volumes of 60mM acetic acid buffer (pH4.0), pH was adjusted to 4.5 with 1M NaOH, octanoic acid (diluted ascites at a final concentration of 25. mu.l/ml) was added dropwise, another drop was added after dissolution, stirred at room temperature for 30min and then allowed to stand at 4 ℃ for 2 hours or more to precipitate sufficiently. 12000r/min, 4 ℃, 30min, and collecting supernatant. The supernatant was filtered 1 time through a common filter paper, added 1/10 volumes of 0.1M 10 × PBS ph7.4 adjusted to 7.4 with 1M NaOH, and ice-cooled to 4 ℃. 0.277g of solid ammonium sulfate was added to each ml of the mixture, and the mixture was stirred for 0min and allowed to stand overnight. 13000r/min, 4 ℃ centrifugal 30min, abandon the supernatant, the precipitation dissolved in the binding buffer. The column was washed with binding buffer at a flow rate of 1ml/min, loaded, and the column was washed with binding buffer until the effluent was free of contaminating material, and eluted with 10 bed volumes of eluent. The purified product can be exchanged with Hi Trap Desainting exchange buffer.

(8) Ass 1-3McAb identification

The number of chromosomes of the clones producing the antibody was checked, and the number was about 80 to 100.

The ascites purified product 1-3 was taken as a first antibody, rA β 1-3 prepared as above was used as an antigen, goat anti-mouse IgG (HRP-labeled, ab7063) from abcam was used as a second antibody as WB, and positive bands were generated at 17kD after incubation respectively corresponding to the antigen and the antibody. See fig. 2. As rA beta 1-3 is verified by a commercialized monoclonal antibody, and the positive strip is also shown by the fact that the rA beta is also verified by the commercialized monoclonal antibody of abcam, the monoclonal antibody is successfully prepared.

From the positive fragments in lanes 2-4 of FIG. 1, it can be determined that the recombinant A.beta.was successfully constructed and successfully expressed. The positive fragments appearing in lanes 2-4 in FIG. 2 are combined with the identification result of the recombinant human Abeta protein in example 1 and the result in lane 5, so that the success of preparing the goat anti-human Abeta protein three-strain monoclonal antibody can be judged.

Example 3

Preparation of beta amyloid latex enhanced immunoturbidimetry kit

The kit comprises a reagent R1, a reagent R2 and a reagent calibrator;

the reagent R1 comprises the following components:

the reagent R2 comprises the following components:

the reagent calibration product comprises the following components:

the A beta-latexMIX is formed by respectively crosslinking three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab to polystyrene latex microspheres and then mixing, wherein the three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab are respectively selected from the hybridoma cell I, the hybridoma cell II and the antibody secreted by the hybridoma cell III as claimed in claim 2, and rA beta 1-3 is a mixture of three target proteins rA beta 1, rA beta 2 and rA beta 3 mixed according to a ratio of 1:1: 1.

The preparation method of the A beta-latexMIX comprises the following steps:

1) preparing 50mM MES buffer solution with the pH value of 6.0 as an activation buffer solution, and suspending polystyrene latex microspheres by using the activation buffer solution to obtain microsphere activation solution with the concentration of 1% (W/V);

2) adding 20mg of EDC into each mL of microsphere activation solution, incubating for 20min at room temperature, then adding 20mg/mL of EDC again, and continuing to incubate for 20min at room temperature to obtain microsphere incubation solution;

3) washing the microsphere incubation solution twice by using an equal volume of coating buffer solution through centrifugation or ultrafiltration, and finally suspending the polystyrene latex microspheres in the coating buffer solution to obtain microsphere suspension, wherein the coating buffer solution is MES buffer solution with the pH value of 6.0 and the concentration of 80 mM;

4) dissolving the A beta 1-mab to 1mg/mL by using a coating buffer solution to obtain an A beta 1-mab antibody solution;

5) rapidly adding the Abeta 1-mab antibody solution into the stirred microsphere suspension, continuously stirring, and incubating at room temperature for 3h to obtain a reaction solution;

6) adding 2.5ul ethanolamine into each mL of reaction solution, continuously stirring, and incubating at room temperature for 10min to obtain a cross-linked mixed solution;

7) suspending the crosslinked mixture by using a storage buffer solution through centrifugation or ultrafiltration, repeating twice, removing unbound antibody and ethanolamine to obtain latex microspheres Abeta 1-latex of Abeta 1-mab, wherein the storage buffer solution is tris buffer solution with pH 7.4;

8) obtaining latex microspheres Abeta 2-latex and Abeta 3-latex of Abeta 2-mab and Abeta 3-mab according to the operation;

9) a beta 1-latex, A beta 2-latex and A beta 3-latex were expressed as follows: 2: 3, mixing to obtain Abeta-latexMIX.

Example 4

Preparation of beta amyloid latex enhanced immunoturbidimetry kit

The kit comprises a reagent R1, a reagent R2 and a reagent calibrator;

the reagent R1 comprises the following components:

the reagent R2 comprises the following components:

the reagent calibration product comprises the following components:

the A beta-latexMIX is formed by respectively crosslinking three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab to polystyrene latex microspheres and then mixing, wherein the three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab are respectively selected from the hybridoma cell I, the hybridoma cell II and the antibody secreted by the hybridoma cell III as claimed in claim 2, and rA beta 1-3 is a mixture of three target proteins rA beta 1, rA beta 2 and rA beta 3 mixed according to a ratio of 1:1: 1.

The preparation method of the A beta-latexMIX comprises the following steps:

1) preparing 50mM MES buffer solution with the pH value of 6.0 as an activation buffer solution, and suspending polystyrene latex microspheres by using the activation buffer solution to obtain microsphere activation solution with the concentration of 1% (W/V);

2) adding 20mg of EDC into each mL of microsphere activation solution, incubating for 20min at room temperature, then adding 20mg/mL of EDC again, and continuing to incubate for 20min at room temperature to obtain microsphere incubation solution;

3) washing the microsphere incubation solution twice by using an equal volume of coating buffer solution through centrifugation or ultrafiltration, and finally suspending the polystyrene latex microspheres in the coating buffer solution to obtain microsphere suspension, wherein the coating buffer solution is MES buffer solution with the pH value of 6.0 and the concentration of 50 mM;

4) dissolving the A beta 1-mab to 1mg/mL by using a coating buffer solution to obtain an A beta 1-mab antibody solution;

5) rapidly adding the Abeta 1-mab antibody solution into the stirred microsphere suspension, continuously stirring, and incubating at room temperature for 2h to obtain a reaction solution;

6) adding 2.5ul ethanolamine into each mL of reaction solution, continuously stirring, and incubating at room temperature for 10min to obtain a cross-linked mixed solution;

7) suspending the crosslinked mixture by using a storage buffer solution through centrifugation or ultrafiltration, repeating twice, removing unbound antibody and ethanolamine to obtain latex microspheres Abeta 1-latex of Abeta 1-mab, wherein the storage buffer solution is tris buffer solution with pH 7.4;

8) obtaining latex microspheres Abeta 2-latex and Abeta 3-latex of Abeta 2-mab and Abeta 3-mab according to the operation;

9) a beta 1-latex, A beta 2-latex and A beta 3-latex were expressed as follows: 2: 3, mixing to obtain Abeta-latexMIX.

Example 5

Preparation of beta amyloid latex enhanced immunoturbidimetry kit

The kit comprises a reagent R1, a reagent R2 and a reagent calibrator;

the reagent R1 comprises the following components:

the reagent R2 comprises the following components:

the reagent calibration product comprises the following components:

the A beta-latexMIX is formed by respectively crosslinking three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab to polystyrene latex microspheres and then mixing, wherein the three monoclonal antibodies A beta 1-mab, A beta 2-mab and A beta 3-mab are respectively selected from the hybridoma cell I, the hybridoma cell II and the antibody secreted by the hybridoma cell III as claimed in claim 2, and rA beta 1-3 is a mixture of three target proteins rA beta 1, rA beta 2 and rA beta 3 mixed according to a ratio of 1:1: 1.

The preparation method of the A beta-latexMIX comprises the following steps:

1) preparing 50mM MES buffer solution with the pH value of 6.0 as an activation buffer solution, and suspending polystyrene latex microspheres by using the activation buffer solution to obtain microsphere activation solution with the concentration of 1% (W/V);

2) adding 20mg of EDC into each mL of microsphere activation solution, incubating for 20min at room temperature, then adding 20mg/mL of EDC again, and continuing to incubate for 20min at room temperature to obtain microsphere incubation solution;

3) washing the microsphere incubation solution twice by using an equal volume of coating buffer solution through centrifugation or ultrafiltration, and finally suspending the polystyrene latex microspheres in the coating buffer solution to obtain microsphere suspension, wherein the coating buffer solution is MES buffer solution with the pH value of 6.0 and the concentration of 100 mM;

4) dissolving the A beta 1-mab to 1mg/mL by using a coating buffer solution to obtain an A beta 1-mab antibody solution;

5) rapidly adding the Abeta 1-mab antibody solution into the stirred microsphere suspension, continuously stirring, and incubating at room temperature for 5h to obtain a reaction solution;

6) adding 2.5ul ethanolamine into each mL of reaction solution, continuously stirring, and incubating at room temperature for 10min to obtain a cross-linked mixed solution;

7) suspending the crosslinked mixture by using a storage buffer solution through centrifugation or ultrafiltration, repeating twice, removing unbound antibody and ethanolamine to obtain latex microspheres Abeta 1-latex of Abeta 1-mab, wherein the storage buffer solution is tris buffer solution with pH 7.4;

8) obtaining latex microspheres Abeta 2-latex and Abeta 3-latex of Abeta 2-mab and Abeta 3-mab according to the operation;

9) a beta 1-latex, A beta 2-latex and A beta 3-latex were expressed as follows: 2: 3, mixing to obtain Abeta-latexMIX.

Example 6

Evaluation of beta-amyloid latex-enhanced immunoturbidimetry kit

The analysis method comprises a two-point end point method;

the reaction direction is ascending reaction;

the calibration mode is Logit-Log (5P);

the measuring wavelength is 570 nm;

the measuring temperature is 37 ℃;

sample reagent R1 reagent R2 ═ 20:210:70(μ L)

The testing steps are as follows: aspirate 20. mu.L of sample, add 210. mu.L of reagent R1, incubate at 37 ℃ for 5min, add 70. mu.L of reagent R2, read absorbance A1 after 1min, read absorbance A2 after 3min, calculate Δ A.

The calibration method comprises the following steps: 5 point calibration, adopting Hitachi 7180 full-automatic biochemical analyzer (or other brands and models), detecting, setting the concentration of the calibrator as follows: 5.625, 11.25, 22.5, 45, 90ng/ml (mg/L).

And calculating the content of A beta in the sample according to the concentration and the delta A value.

(1) Correlation verification

The reagent prepared by the formula of example 3 is used for carrying out contrast detection with an enzyme-linked immunosorbent assay, 50 clinical serum samples are detected, the detection results are shown in table 1 below, a correlation curve between the kit and the enzyme-linked immunosorbent assay is obtained, see fig. 3, and it can be seen from fig. 3 that the correlation between the kit and a commercial human a β protein detection kit is good, and the detection results show that the linear correlation curve of the reagent and the enzyme-linked immunosorbent assay is y 0.8027x +2.7608, and the correlation coefficient R2 is 0.8152, which indicates that the two have large correlation.

TABLE 1 correlation comparison values between the kit of the present invention and enzyme-linked immunosorbent assay

(2) Linear range verification

The recombinant Abeta 1-3 purified product and physiological saline are used for preparing test products with the concentrations of 100mg/L, 50mg/L, 25mg/L, 12.5mg/L, 6.25mg/L and 0mg/L (physiological saline control), the kit is used for measuring the concentration of each test product, the diluted concentration is used as an independent variable, the measurement result is used as a dependent variable to obtain a linear regression equation, and the relative deviation of the measurement result is calculated. The results show that the linear regression equation between the measurement result and the diluted concentration is y, 1.0163x +0.1231, as shown in fig. 4, and it can be seen from fig. 4 that the linear range of the kit of the present invention is good, and the correlation coefficient R2, 0.997, shows that the linear relationship is good, and the linear range can reach 100 mg/L.

TABLE 2 validation of the Linear Range of the kit of the invention

Serial number	Concentration of dilution	Test value 1	Test value 2	Test value 3	Mean number of	Prediction value	Absolute deviation	Relative deviation of
									1	100	106.36	97.23	102.40	102.00	101.75	0.24	0.24％
2	50	47.65	51.38	54.27	51.10	50.94	0.16	0.32％
									3	25	24.66	24.89	23.18	24.24	25.53	-1.29	-5.04％
4	12.5	13.20	12.51	12.53	12.75	12.83	-0.08	-0.63％
									5	6.25	6.89	6.52	6.25	6.55	6.47	0.08	1.21％
6	0	1.15	0.89	0.97	1.00	0.12	0.88

(3) Accuracy and precision verification

And taking one portion of high-value serum and one portion of low-value serum respectively, detecting for 6 times by using the kit, taking a mean value, and comparing with a quality control target value. The result shows that the detection value has smaller relative deviation than the target value, smaller CV and higher accuracy and precision. See table 3.

Accuracy verification results of the kit described in Table 3

It should be understood that the examples and embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the present disclosure, and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this disclosure.

SEQUENCE LISTING

<110> Daqian bioengineering Co., Ltd, Anhui

<120> gene sequence group, hybridoma cell group and latex enhanced immunoturbidimetry kit for detecting beta amyloid

<130> 2020

<160> 3

<170> PatentIn version 3.1

<210> 1

<211> 234

<212> DNA

<213> Artificial sequence

<400> 1

caggcctaga aagaagtttt gggtaggctt tgtcttacag tgttattatt tatgagtaaa 60

actaattggt tgtcctgcat actttaatta tgatgtaata caggttctgg gttgacaaat 120

atcaagacgg aggagatctc tgaagtgaag atggatgcag aattccgaca tgactcagga 180

tatgaagttc atcatcaaaa attggtacgt aaaataattt acctctttcc acta 234

<210> 2

<211> 231

<212> DNA

<213> Artificial sequence

<400> 2

gactcaggat atgaagttca tcatcaaaaa ttggtacgta aaataattta cctctttcca 60

ctactgtttg tcctcatcca aatgtccccg tcatttaaga aatgaaattc ttctaattgc 120

gtttataaat tgtaaattat attgcattta gaaattaaaa ttctttttct taatttgttt 180

tcaaggtgtt ctttgcagaa gatgtgggtt caaacaaagg tgcaatcatt g 231

<210> 3

<211> 165

<212> DNA

<213> Artificial sequence

<400> 3

tcattggact catggtgggc ggtgttgtca tagcgacagt gatcgtcatc accttggtga 60

tgctgaagaa gaaacagtac acatccattc atcatggtgt ggtggaggta ggtaaacttg 120

actgcatgtt tccaagtggg aattaagact atgagagaat taggc 165