阅读说明：本技术 新型冠状病毒特异性抗原肽的人源抗体、制备方法及用途 (Human source antibody of novel coronavirus specific antigen peptide, preparation method and use ) 是由 杨衡 李利利 高美玲 王雅楠 段静 万定一 于 2020-11-25 设计创作，主要内容包括：本公开涉及一种新型冠状病毒特异性抗原肽的人源抗体、制备方法及用途。具体来说,本公开涉及一种抗SARS-CoV-2抗体或其抗原结合片段,以及其在疾病诊断、制备COVID-19疫苗、制备预防、治疗COVID-19的药物中的用途。本公开的抗SARS-CoV-2抗体或其抗原结合片段能够结合新型冠状病毒的RBD结构域,阻断病毒入侵细胞,对于新型冠状病毒的预防、治疗或检测具有重要的临床意义。(The present disclosure relates to a human antibody of a novel coronavirus specific antigen peptide, a preparation method and uses thereof. In particular, the disclosure relates to an anti-SARS-CoV-2 antibody or antigen binding fragment thereof, and the use thereof in disease diagnosis, preparing COVID-19 vaccine, preparing medicament for preventing and treating COVID-19. The anti-SARS-CoV-2 antibody or antigen binding fragment thereof of the present disclosure can bind to the RBD domain of the novel coronavirus, block the virus-invading cells, and have important clinical significance for the prevention, treatment or detection of the novel coronavirus.)

1. An anti-SARS-CoV-2 antibody or antigen-binding fragment thereof that specifically binds to the SARS-CoV-2 epitope, wherein the SARS-CoV-2 epitope comprises an amino acid sequence as set forth in SEQ ID NO: 1, or a fragment thereof.

2. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region, wherein the sequence encoding the heavy chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 39-41.

3. The antibody or antigen-binding fragment thereof of any one of claims 1-2, comprising a light chain variable region, wherein the sequence encoding the light chain variable region comprises one or more of the following:

(a₁) As shown in SEQ ID NO: 42-44;

(a₂) As shown in SEQ ID NO: 45-47;

(a₃) As shown in SEQ ID NO: 48-50;

(a₄) As shown in SEQ ID NO: 51-53;

(a₅) As shown in SEQ ID NO: 54-56;

(a₆) As shown in SEQ ID NO: 57-59.

4. The antibody or antigen-binding fragment thereof of any one of claims 1-3, comprising a linker, wherein the sequence encoding the linker comprises the amino acid sequence set forth in SEQ ID NO: 60, or a sequence shown in seq id no.

5. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region (VH) and a light chain variable region (VL), the VH comprising a VH Complementarity Determining Region (CDR)1, a VH Complementarity Determining Region (CDR)2, and a VH Complementarity Determining Region (CDR)3, and the VL comprising a VLCDR1, a VLCDR2, and a VLCDR3, wherein,

the VH is encoded by the following amino acids: VHCDR1 comprises the amino acid sequence as set forth in SEQ ID NO: 39, VHCDR2 comprises the amino acid sequence as set forth in SEQ ID NO: 40, and VHCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 41; and is

The VL is encoded by the following amino acids: the VLCDR1 comprises the amino acid sequence set forth as SEQ ID NO: 42. SEQ ID NO: 45. SEQ ID NO: 48. SEQ ID NO: 51. SEQ ID NO: 54 or SEQ ID NO: 57 and the VLCDR2 comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 43. SEQ ID NO: 46. SEQ ID NO: 49. SEQ ID NO: 52. SEQ ID NO: 55 or SEQ ID NO: 58, and the VLCDR3 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 44. SEQ ID NO: 47. SEQ ID NO: 50. SEQ ID NO: 53. SEQ ID NO: 56 or SEQ ID NO: 59 of any one of the amino acid sequences set forth in any one of seq id nos.

6. The antibody or antigen-binding fragment thereof of claim 5, wherein the encoded antibody or antigen-binding fragment thereof comprises one or more of the following sequences:

(b₁) VH comprises the amino acid sequence as set forth in SEQ ID NO: 15, and VL comprises the amino acid sequence set forth in SEQ ID NO: 17;

(b₂) VH comprises the amino acid sequence as set forth in SEQ ID NO: 19, and VL comprises the amino acid sequence set forth in SEQ ID NO: 21;

(b₃) VH comprises the amino acid sequence as set forth in SEQ ID NO: 23, and VL comprises the amino acid sequence set forth in SEQ ID NO: 25;

(b₄) VH comprises the amino acid sequence as set forth in SEQ ID NO: 27, and VL comprises the amino acid sequence set forth in SEQ ID NO: 29;

(b₅) VH comprises the amino acid sequence as set forth in SEQ ID NO: 31, and VL comprises the amino acid sequence set forth in SEQ ID NO: 33;

(b₆) VH comprises the amino acid sequence as set forth in SEQ ID NO: 35, and VL comprises the amino acid sequence set forth in SEQ ID NO: 37;

(b₇) As shown in SEQ ID NO: 3. 5, 7, 9, 11 or 13.

7. A polynucleotide, wherein the polynucleotide is selected from any one of (a) - (d):

(a) comprises the amino acid sequence shown as SEQ ID NO: 16. SEQ ID NO: 18. SEQ ID NO: 20. SEQ ID NO: 22. SEQ ID NO: 24. SEQ ID NO: 26. SEQ ID NO: 28. SEQ ID NO: 30. SEQ ID NO: 32. SEQ ID NO: 34. SEQ ID NO: 36 or SEQ ID NO: 38 or any combination thereof;

(b) comprises the amino acid sequence shown as SEQ ID NO: 16. SEQ ID NO: 18. SEQ ID NO: 20. SEQ ID NO: 22. SEQ ID NO: 24. SEQ ID NO: 26. SEQ ID NO: 28. SEQ ID NO: 30. SEQ ID NO: 32. SEQ ID NO: 34. SEQ ID NO: 36 or SEQ ID NO: 38 or any combination thereof;

(c) a reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (a) - (b) under high stringency hybridization conditions or very high stringency hybridization conditions;

(d) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence as set forth in any one of (a) - (c).

8. The polynucleotide of claim 7, wherein the polynucleotide is selected from any one of (e) - (h):

(e) comprises the amino acid sequence shown as SEQ ID NO: 16 and SEQ ID NO: 18, comprising the nucleotide sequence shown as SEQ ID NO: 20 and SEQ ID NO: 22, comprising the nucleotide sequence shown as SEQ ID NO: 24 and SEQ ID NO: 26, comprising the nucleotide sequence shown as SEQ ID NO: 28 and SEQ ID NO: 30, comprising the nucleotide sequence set forth as SEQ ID NO: 32 and SEQ ID NO: 34, or a nucleotide sequence comprising the nucleotide sequence shown as SEQ ID NO: 36 and SEQ ID NO: 38;

(f) a nucleotide sequence comprising the reverse complement of the nucleotide sequence set forth in (e);

(g) a reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (e) - (f) under high stringency hybridization conditions or very high stringency hybridization conditions;

(h) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence as set forth in any one of (e) - (g).

9. The polynucleotide of claim 8, wherein the polynucleotide is selected from any one of (i) - (l):

(i) comprises the amino acid sequence shown as SEQ ID NO: 4. 6, 8, 10, 12 or 14;

(j) comprises the amino acid sequence shown as SEQ ID NO: 4. 6, 8, 10, 12 or 14, or a sequence complementary to the reverse complement of the sequence set forth in any one of seq id nos;

(k) (ii) a reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (i) - (j) under high stringency hybridization conditions or very high stringency hybridization conditions;

(l) (ii) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence as set forth in any one of (i) - (k).

10. A vector, wherein said vector comprises a polynucleotide according to any one of claims 7-9.

11. An isolated host cell, wherein said host cell comprises the vector of claim 10.

12. A method for producing a host cell stably expressing a target protein, wherein the method comprises the step of transforming a starting host cell with the vector of claim 10; optionally, the host cell is a chinese hamster ovary cell.

13. A method of producing a protein of interest, the method comprising using the host cell of claim 11, or producing the protein of interest by the method of claim 12.

14. An antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof is prepared by the method of claim 13.

15. A kit comprising an antibody or antigen-binding fragment thereof according to any one of claims 1-6 or claim 14.

16. Use of a kit according to claim 15 in the manufacture of a kit for detecting COVID-19.

17. A pharmaceutical composition or vaccine comprising an antibody or antigen-binding fragment thereof according to any one of claims 1 to 6 or claim 14.

18. Use of an antibody or antigen-binding fragment thereof according to any one of claims 1 to 6 or claim 14, or a pharmaceutical composition or vaccine according to claim 17, in the manufacture of a medicament for the treatment or prevention of COVID-19.

19. A method of treating or preventing covi-19, wherein an antibody or antigen-binding fragment thereof according to any one of claims 1 to 6 or claim 14, or a pharmaceutical composition or vaccine according to claim 17, is administered to an animal.

Technical Field

The disclosure belongs to the field of biomedicine, and relates to a novel human antibody combined with coronavirus specific antigen peptide and application thereof. Specifically, the disclosure relates to a monoclonal antibody, which specifically binds to the RBD structural domain of SARS-CoV-2 virus, the structural domain is located in SARS-CoV-2 virus S protein, and the application of the antigen peptide in preparing COVID-19 vaccine and medicament for preventing and treating COVID-19.

Background

Since the outbreak of new coronary pneumonia, more than 210 countries and regions have been reached, more than 70 billion people are affected, and the precious life of more than 30 million people is lost. At present, domestic epidemic situations are well controlled, but novel coronavirus is still abused worldwide. The development of an effective diagnosis, prevention or treatment method for the new coronary pneumonia is a problem which needs to be solved at present.

The novel coronavirus (SARS-CoV-2) belongs to the genus coronavirus B, linear single-stranded RNA (ssRNA) virus. The genome is about 29903 nucleotides in total and contains 10 genes. Since 10/1/2020, the first SARS-CoV-2 genome sequence data was published, and thereafter a plurality of genome sequences of novel coronaviruses isolated from patients were published in succession. In 22 months 1 in 2020, the genome science data center formally releases 2019 a novel coronavirus resource library. Through data analysis, the genome sequence of the 2019 novel coronavirus (SARS-CoV-2) has 80% similarity with the SARS virus outbreak in 2003, and has the highest similarity with the genome sequence of Bat SARS-likecoronavirus isolate Bat-SL-CoVZC45 collected from bats in China in month 2 in 2017, and the similarity is 88%. By 30 months and 1 year 2020, there have been 6 organizations worldwide publishing 13 new coronaviral genome sequences on the "global shared influenza virus database GISAID".

The novel coronavirus (SARS-CoV-2) is an enveloped positive-strand RNA virus containing a 30kb genome and four structural proteins, i.e., spike protein (S), envelope protein (E), membrane protein (M), and nucleocapsid protein (N). The S protein regulates viral attachment to receptors on the target host cell. The function of the E protein is to assemble the virus and act as an ion channel; the M protein together with the E protein plays a role in virus assembly and is involved in the biosynthesis of new viral particles; the N protein forms a ribonucleoprotein complex with viral RNA. The surface spike glycoprotein (S protein) of the novel coronavirus is responsible for attachment to host cells through interaction with the host cell surface receptor (ACE 2). The S protein exists as a homotrimer with 1200 more amino acids per monomer. In the S protein of SARS-CoV-2, a small domain containing residues 306-575 was identified as the Receptor Binding Domain (RBD), in which residues 439-508, called the Receptor Binding Motif (RBM), directly mediated the interaction with ACE 2. Entry of coronaviruses into cells depends on binding of the viral spike protein to cellular receptors and initiation of the S protein by host cell proteases. Elucidating which cytokines are utilized by 2019-nCoV may provide a new idea for the spread of viruses and the discovery of therapeutic targets. The SARS-CoV-2Spike protein is composed of S1 structural domain and S2 structural domain. S1 contains a Receptor Binding Domain (RBD) that specifically binds to angiotensin converting enzyme 2(ACE2), the receptor on target cells, and is the most critical step in its infection process. It is therefore generally accepted that SARS-CoV-2Spike Protein (RBD) is of potential value for the diagnosis of viruses. Recombinant RBD protein vaccines are one of the important new corona vaccine options.

The phage display technology was originally developed by the british Medical Research Council (Medical Research Council) in 1990, and is an antibody cloning technology for screening specific antigens by preparing a human antibody library (library) and expressing it on the surface of phage in the form of antibody fragments (Fab, ScFv). It has been proposed that almost all possibilities of recombinant human monoclonal antibodies specifically reactive with antigens can be screened from a single pot antibody library system, and thus, when using phage display antibody technology, a variety of antibody fragments (Fab or ScFv) can be obtained that can be used for in vivo diagnosis or therapy. The invention relates to an antibody cloning technology for screening specific antigens by constructing a phage humanized antibody library by using PBMC of patients with COVID-19 and specifically binding with an RBD (receptor binding domain) of spike protein.

Disclosure of Invention

Problems to be solved by the invention

In view of the problems of the prior art, for example: the problem of the need for effective diagnostic and therapeutic means for new coronaviruses. To this end, the present disclosure provides an anti-SARS-CoV-2 antibody or antigen-binding fragment thereof, capable of specifically binding to the RBD domain of SARS-CoV-2 virus. The RBD structural domain is one of the key factors of SARS-CoV-2 virus invading cells, and can block the invasion of the novel coronavirus to the cells by specifically binding RBD, thereby realizing the treatment, prevention or diagnosis of the novel coronavirus.

Means for solving the problems

(1) An anti-SARS-CoV-2 antibody or antigen-binding fragment thereof that specifically binds to the SARS-CoV-2 epitope, wherein the SARS-CoV-2 epitope comprises an amino acid sequence as set forth in SEQ ID NO: 1, or a fragment thereof.

(2) The antibody or antigen-binding fragment thereof of (1), comprising a heavy chain variable region, wherein the sequence encoding the heavy chain variable region comprises the amino acid sequence set forth in SEQ ID NO: 39-41.

(3) The antibody or antigen-binding fragment thereof according to any one of (1) to (2), comprising a light chain variable region, wherein the sequence encoding the light chain variable region comprises one or more of the following sequences:

(a₁) As shown in SEQ ID NO: 42-44;

(a₂) As shown in SEQ ID NO: 45-47;

(a₃) As shown in SEQ ID NO: 48-50;

(a₄) As shown in SEQ ID NO: 51-53;

(a₅) As shown in SEQ ID NO: 54-56;

(a₆) As shown in SEQ ID NO: 57-59.

(4) The antibody or antigen-binding fragment thereof according to any one of (1) to (3), comprising a linker, wherein the sequence encoding the linker comprises the amino acid sequence set forth in SEQ ID NO: 60, or a sequence shown in seq id no.

(5) The antibody or antigen-binding fragment thereof according to (1), which comprises a heavy chain variable region (VH) and a light chain variable region (VL), the VH comprising a VH Complementarity Determining Region (CDR)1, a VH Complementarity Determining Region (CDR)2, and a VH Complementarity Determining Region (CDR)3, and the VL comprising a VLCDR1, a VLCDR2, and a VLCDR3, wherein,

the VH is encoded by the following amino acids: VHCDR1 comprises the amino acid sequence as set forth in SEQ ID NO: 39, VHCDR2 comprises the amino acid sequence as set forth in SEQ ID NO: 40, and VHCDR3 comprises the amino acid sequence set forth in SEQ ID NO: 41; and is

The VL is encoded by the following amino acids: the VLCDR1 comprises the amino acid sequence set forth as SEQ ID NO: 42. SEQ ID NO: 45. SEQ ID NO: 48. SEQ ID NO: 51. SEQ ID NO: 54 or SEQ ID NO: 57 and the VLCDR2 comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 43. SEQ ID NO: 46. SEQ ID NO: 49. SEQ ID NO: 52. SEQ ID NO: 55 or SEQ ID NO: 58, and the VLCDR3 comprises the amino acid sequence set forth in any one of SEQ ID NOs: 44. SEQ ID NO: 47. SEQ ID NO: 50. SEQ ID NO: 53. SEQ ID NO: 56 or SEQ ID NO: 59 of any one of the amino acid sequences set forth in any one of seq id nos.

(6) The antibody or antigen-binding fragment thereof of (5), wherein the encoded antibody or antigen-binding fragment thereof comprises one or more of the following sequences:

(b₁) VH comprises the amino acid sequence as set forth in SEQ ID NO: 15, and VL comprises the amino acid sequence set forth in SEQ ID NO: 17;

(b₂) VH comprises the amino acid sequence as set forth in SEQ ID NO: 19, and VL comprises the amino acid sequence set forth in SEQ ID NO: 21;

(b₃) VH comprises the amino acid sequence as set forth in SEQ ID NO: 23, and VL comprises the amino acid sequence set forth in SEQ ID NO: 25;

(b₄) VH comprises the amino acid sequence as set forth in SEQ ID NO: 27, and VL comprises the amino acid sequence set forth in SEQ ID NO: 29;

(b₅) VH comprises the amino acid sequence as set forth in SEQ ID NO: 31, and VL comprises the amino acid sequence set forth in SEQ ID NO: 33;

(b₆) VH comprises the amino acid sequence as set forth in SEQ ID NO: 35, and VL comprises the amino acid sequence set forth in SEQ ID NO: 37;

(b₇) As shown in SEQ ID NO: 3. 5, 7, 9, 11 or 13.

(7) A polynucleotide, wherein the polynucleotide is selected from any one of (a) - (d):

(a) comprises the amino acid sequence shown as SEQ ID NO: 16. SEQ ID NO: 18. SEQ ID NO: 20. SEQ ID NO: 22. SEQ ID NO: 24. SEQ ID NO: 26. SEQ ID NO: 28. SEQ ID NO: 30. SEQ ID NO: 32. SEQ ID NO: 34. SEQ ID NO: 36 or SEQ ID NO: 38 or any combination thereof;

(b) comprises the amino acid sequence shown as SEQ ID NO: 16. SEQ ID NO: 18. SEQ ID NO: 20. SEQ ID NO: 22. SEQ ID NO: 24. SEQ ID NO: 26. SEQ ID NO: 28. SEQ ID NO: 30. SEQ ID NO: 32. SEQ ID NO: 34. SEQ ID NO: 36 or SEQ ID NO: 38 or any combination thereof;

(c) a reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (a) - (b) under high stringency hybridization conditions or very high stringency hybridization conditions;

(d) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence as set forth in any one of (a) - (c).

(8) The polynucleotide according to (7), wherein the polynucleotide is selected from any one of (e) to (h):

(e) comprises the amino acid sequence shown as SEQ ID NO: 16 and SEQ ID NO: 18, comprising the nucleotide sequence shown as SEQ ID NO: 20 and SEQ ID NO: 22, comprising the nucleotide sequence shown as SEQ ID NO: 24 and SEQ ID NO: 26, comprising the nucleotide sequence shown as SEQ ID NO: 28 and SEQ ID NO: 30, comprising the nucleotide sequence set forth as SEQ ID NO: 32 and SEQ ID NO: 34, or a nucleotide sequence comprising the nucleotide sequence shown as SEQ ID NO: 36 and SEQ ID NO: 38;

(f) a nucleotide sequence comprising the reverse complement of the nucleotide sequence set forth in (e);

(g) a reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (e) - (f) under high stringency hybridization conditions or very high stringency hybridization conditions;

(h) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence as set forth in any one of (e) - (g).

(9) The polynucleotide of (8), wherein the polynucleotide is selected from any one of (i) - (l):

(i) comprises the amino acid sequence shown as SEQ ID NO: 4. 6, 8, 10, 12 or 14;

(j) comprises the amino acid sequence shown as SEQ ID NO: 4. 6, 8, 10, 12 or 14, or a sequence complementary to the reverse complement of the sequence set forth in any one of seq id nos;

(k) (ii) a reverse complement of a sequence that is capable of hybridizing to the nucleotide sequence set forth in any one of (i) - (j) under high stringency hybridization conditions or very high stringency hybridization conditions;

(l) (ii) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequence identity to a nucleotide sequence as set forth in any one of (i) - (k).

(10) A vector, wherein said vector comprises the polynucleotide according to any one of (7) to (9).

(11) An isolated host cell, wherein said host cell comprises the vector of (10).

(12) A method for producing a host cell stably expressing a target protein, wherein said method comprises the steps of (10) transforming the initial host cell with the vector; optionally, the host cell is a chinese hamster ovary cell.

(13) A method for producing a protein of interest, which comprises producing the protein of interest using the host cell of (11) or by the method of (12).

(14) An antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof is produced by the method of (13).

(15) A kit, wherein the kit comprises the antibody or antigen-binding fragment thereof according to any one of (1) to (6) or (14).

(16) And (15) application of the kit in preparation of a kit for detecting COVID-19.

(17) A pharmaceutical composition or vaccine comprising the antibody or antigen-binding fragment thereof according to any one of (1) to (6) or (14).

(18) Use of the antibody or antigen-binding fragment thereof of any one of (1) to (6) or (14), or the pharmaceutical composition or vaccine of (17) in the manufacture of a medicament for treating or preventing COVID-19.

(19) A method of treating or preventing COVID-19, wherein the antibody or antigen-binding fragment thereof according to any one of (1) to (6) or (14), or the pharmaceutical composition or vaccine according to (17) is administered to an animal.

ADVANTAGEOUS EFFECTS OF INVENTION

In one embodiment, the present disclosure provides a human antibody capable of specifically binding to a novel coronavirus, which is capable of blocking the intracellular invasion of the novel coronavirus by binding to the RBD domain of the novel coronavirus, thereby preventing or treating the novel coronavirus. On the other hand, the specific combination with the novel coronavirus can realize the detection of the virus, and the virus can be used for clinical diagnosis of patients with new coronary pneumonia.

In one embodiment, the present disclosure provides polynucleotides encoding human antibodies capable of specifically binding to novel coronaviruses, vectors, host cells, and the like, enabling the expression, production, and production of monoclonal antibodies.

In one embodiment, the present disclosure provides a method for making a human antibody capable of specifically binding to a novel coronavirus.

Drawings

Description of the reference numerals

FIG. 1 shows PCR agarose gel electrophoresis of VL and VH-VL libraries including PBMC from new coronary patients and PBMC from normal humans as controls.

Figure 2 shows a quality report for sequencing of phage display libraries, including libraries constructed from neocoronary and normal PBMCs.

FIG. 3 shows the result of agarose gel electrophoresis verification of the recombinant plasmid RBD-PATX2, and the purity of the purified RBDSDS-PAGE electrophoresis verification, the purity is more than 90%.

Fig. 4 shows the ELISA results at different dilution concentrations of the antibody.

FIGS. 5A-5H show the results of antibody neutralization experiments, and FIG. 5A shows the inhibition rate of the screened antibody sequences against SARS-CoV-2 pseudovirus; FIGS. 5B-5H show the results of the measurement of the inhibition rate of antibodies RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 and R3P2-G1 against SARS-CoV-2 Euvirus (in FIGS. 5B-5H: SARS-CoV2-NP or SARS-CoV-2-NP).

Detailed Description

Definition of

In the claims and/or the description of the present disclosure, the words "a" or "an" or "the" may mean "one", but may also mean "one or more", "at least one", and "one or more than one".

As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Also, the terms "comprising," "having," "including," or "containing" are intended to be inclusive and mean that there may be additional, unrecited elements or method steps.

Throughout this specification, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.

Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.

As used in this disclosure, the term "SARS-CoV-2", also known as "2019-nCoV", means a 2019 novel coronavirus.

As used in this disclosure, the term "COVID-19" means a novel coronavirus pneumonia (Corona Virus Disease 2019), abbreviated as "new Corona pneumonia", and refers to pneumonia caused by 2019 infection with a novel coronavirus (SARS-CoV-2).

"sequence identity" and "percent identity" in the present disclosure refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions in the aligned polynucleotides or polypeptides containing the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotides or polypeptides containing different nucleotide or amino acid residues. Polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or deleted nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or both polynucleotides). Polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or deleting amino acids (i.e., amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

The term "phage display technology" in the present disclosure is a biological technology in which a DNA sequence of a foreign protein or polypeptide is inserted into an appropriate position of a structural gene of a coat protein of a bacteriophage, so that the foreign gene is expressed in accordance with the expression of the coat protein, and at the same time, the foreign protein is displayed on the surface of the bacteriophage in accordance with the reassembly of the bacteriophage.

The term "antibody" in the present disclosure refers to an immunoglobulin or a fragment thereof or a derivative thereof, and includes any polypeptide comprising an antigen binding site thereof, whether produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single chain, chimeric, synthetic, recombinant, hybrid, mutant, grafted antibodies. The term "antibody" also includes antibody fragments such as Fab, F (ab') 2, FV, scFv, Fd, dAb, and other antibody fragments that retain antigen binding function. Typically, such fragments will include antigen binding fragments.

The term "single chain antibody" (scFv) in the present disclosure is an antibody in which the variable region of the heavy chain and the variable region of the light chain of an antibody are linked by a short peptide (also called linker) of a limited number of amino acids.

The term "peripheral blood mononuclear cells" (PBMCs) in the present disclosure are cells with a mononuclear in the peripheral blood, including lymphocytes and monocytes.

The term "RBD" in the present disclosure means that a Receptor Binding Domain (RBD) of the coronavirus S protein plays an important role in binding the virus to angiotensin-converting enzyme 2(ACE2) on the surface of a host cell and entering the host cell. The RBD has good accuracy and specificity for the novel coronavirus, and can be used for detecting SARS-CoV-2; meanwhile, RBD plays a role in the process of invading cells by SARS-CoV-2, and the recognition and specific binding of RBD can be used for the treatment of the diseases caused by SARS-CoV-2.

The term "IMGT numbering scheme" in this disclosure is the introduction of a novel standardized numbering system for all protein sequences of the human immunoglobulin superfamily by Lefranc et al, including variable domains from antibody light and heavy chains and T cell receptor chains from different species. The IMGT numbering method is based on germline V sequence (germ-line V) alignment to count residues consecutively.

In the technical schemes described in the present disclosure, unless otherwise specified, all antibody numbering schemes employed in the present disclosure for antibodies are IMGT numbering schemes.

In some embodiments, the disclosure relates to stringency of hybridization conditions for defining the degree of complementarity of two polynucleotides. Alternatively, the aforementioned polynucleotide may be selected from DNA. "stringency" as used in this disclosure refers to the conditions of temperature and ionic strength during hybridization and the presence or absence of certain organic solvents. The higher the stringency, the higher the degree of complementarity between the target nucleotide sequence and the labeled polynucleotide sequence. "stringent conditions" refer to temperature and ionic conditions under which only nucleotide sequences having a high frequency of complementary bases will hybridize. The term "hybridizes under high or very high stringency conditions" as used herein describes the conditions used for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in molecular μ Lar Biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6. Specific hybridization conditions mentioned in this disclosure are as follows: 1) high stringency hybridization conditions: washing one or more times in 6X sodium chloride/sodium citrate (SSC) at about 45 ℃ and then 0.2X SSC, 0.1% SDS at 65 ℃; 2) very high stringency hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65 ℃ and then washed one or more times with 0.2 XSSC, 1% SDS at 65 ℃.

anti-SARS-CoV-2 antibody or antigen binding fragment thereof

The SARS-CoV-2Spike protein is composed of S1 structural domain and S2 structural domain, and is one of the keys of the new coronavirus infection and invasion of cells. S1 contains a Receptor Binding Domain (RBD) that specifically binds to the receptor angiotensin converting enzyme 2(ACE2) on target cells, which is the most critical step in its infection process. Therefore, SARS-CoV-2Spike Protein (RBD) is widely considered to be of potential value for the diagnosis of viruses. Recombinant RBD protein vaccines are one of the important new corona vaccine options.

In some embodiments, the amino acid sequence of the RBD is as set forth in SEQ ID NO: 1, the N end of the RBD contains a signal peptide sequence of MPLLLPLLWAGALA, so that the expression of the RBD protein can be effectively improved. And after the RBD protein is expressed and is subjected to post-translational modification, the signal peptide can be cut, and the screening of the anti-SARS-CoV-2 antibody is not influenced. The gene sequence of RBD is shown as SEQ ID NO: 2, respectively. Artificially synthesizing a gene sequence of the RBD, recombining the RBD gene into an expression vector PATX2 to obtain an expression vector of RBD-PATX2, wherein the cloning site is a cloning site EcoR1/Not 1.

In some embodiments, the RBD-PATX2 expression vector is transfected into a HEK293F cell line for culture, and the supernatant is collected for nickel column purification to obtain the RBD protein.

In some embodiments, phage display technology is used to screen for antibodies or antigen-binding fragments with high affinity for RBD proteins. Exemplary antibodies or antigen-binding fragments with high affinity for the RBD protein include polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single chain, chimeric, synthetic, recombinant, hybrid, mutated, grafted antibodies, or antibody fragments such as Fab, F (ab') 2, FV, scFv, Fd, dAb, and others that retain antigen-binding function.

Specifically, PBMCs from patients with COVID-19 were removed to construct phage display libraries comprising heavy chain variable regions (VH) and light chain variable regions (VL) and biopanning with RBD proteins was performed to screen for human antibodies that specifically bind to the novel coronavirus.

The Molecular biological methods used in the present disclosure can be referred to the corresponding methods described in publications such as "Current Protocols in Molecular Biology, Wiley publication", "Molecular Cloning, A Laboratory Manual, Cold spring harbor Laboratory publication", and the like.

Examples

Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

All reagents used in the examples were commercially available unless otherwise noted.

Example 1 construction method of human ScFv phage display library

Table 1 main reagents used in this example

1. Library construction

1.1 Assembly of the heavy chain variable region (VH) and the light chain variable region (VL)

TABLE 2 PCR reaction conditions and procedures

Wherein, the three steps of denaturation, annealing and extension (1) are repeated for 30 times.

The primer sequence is as follows:

Forward(F):

5′L-VH 1：ACAGGTGCCCACTCCCAGGTGCAG(SEQ ID NO：61)

5′L-VH 3：AAGGTGTCCAGTGTGARGTGCAG(SEQ ID NO：62)

5′L-VH 4/6：CCCAGATGGGTCCTGTCCCAGGTGCAG(SEQ ID NO：63)

5′L-VH 5/7：CAAGGAGTCTGTTCCGAGGTGCAG(SEQ ID NO：64)

5′L Vκ1/2：ATGAGGSTCCCYGCTCAGCTGCTGG(SEQ ID NO：65)

5′L Vκ3：CTCTTCCTCCTGCTACTCTGGCTCCCAG(SEQ ID NO：66)

5′L Vκ4/5：ATTTCTCTGTTGCTCTGGATCTCTG(SEQ ID NO：67)

5′L Vλ1：GGTCCTGGGCCCAGTCTGTGCTG(SEQ ID NO：68)

5′L Vλ2：GGTCCTGGGCCCAGTCTGCCCTG(SEQ ID NO：69)

5′L Vλ3：GCTCTGTGACCTCCTATGAGCTG(SEQ ID NO：70)

5′L Vλ4/5：GGTCTCTCTCSCAGCYTGTGCTG(SEQ ID NO：71)

5′L Vλ6：GTTCTTGGGCCAATTTTATGCTG(SEQ ID NO：72)

5′L Vλ7：GGTCCAATTCYCAGGCTGTGGTG(SEQ ID NO：73)

5′L Vλ8/9/10：GAGTGGATTCTCAGACTGTGGTG(SEQ ID NO：74)

Reverse(R):

3′Cκ：TGCTGTCCTTGCTGTCCTGCT(SEQ ID NO：75)

3′Cλ：CACCAGTGTGGCCTTGTTGGCTTG(SEQ ID NO：76)

the results of agarose gel electrophoresis after PCR are shown in FIG. 1.

1.2 construction of a light chain variable region phage display library

1.2.1 preparation of pATA-scFv-2 vector as library clone

1.2.2 digestion vectors and PCR products

TABLE 3 digestion of vector and PCR product reaction System

	pATA-scFv-2 vector	Heavy chain/light chain variable region PCR product
			Vectors or PCR products	25μg	10μg
Fast Digest NheI	5μl	2μl
			Fast Digest NotI	5μl	2μl
10×Fast Digest Buffer	25μl	10μl
			ddH2O	The total amount of the solution was 250. mu.L	The total amount of the solution was 100. mu.L

1.2.3 connection

TABLE 4 ligation reaction System

T4 DNA Ligase(Thermo)	8μl
		10×T4 DNA Ligase buffer	15μl
Vector(NheI/NotI)	1.5μg
		VL fragment(NheI/NotI)	0.5μg
H2O	Added to the reaction system in a total of 150. mu.l

Incubating at 16 deg.C for 15h, and heating and inactivating at 65 deg.C for 10 min.

1.2.4 electrotransfer

1) Preparation of TG1 competent cells.

2) 2ml SOC medium (Sigma, S1797) was prewarmed at 37 ℃. Electroporation tubes (0.2 cm gap) were placed on ice (one tube per shift reaction).

3) The electrically active cells were removed from the-80 ℃ freezer and placed on wet ice until they were completely thawed (5-10 minutes). After thawing the cells, they were mixed by gentle tapping.

4) Carefully pipette 50. mu.L of the DNA mixture into a cold electroporation cuvette without introducing foam. Quickly gently wave the small cup with your wrist down to sediment the cells to the bottom of the well.

5) Electroporation was 600 Ω, 10 μ F and 2.5 kV. Within 10 seconds after the pulse, 2mL of pre-heated SOC medium was added to each tube immediately. Stirring was carried out at 37 ℃ for 1 hour at 220 rpm.

6) All the electrotransformation medium was collected. Serial dilutions of 10. mu.L product were propagated in 100. mu.L SOC in LB medium with Amp/glucose. Left overnight at 37 ℃. The total number of transformants was calculated by counting the number of colonies, multiplying by the culture volume, and dividing by the plating volume.

1.3 construction of VL-VH phage display libraries

1.3.1 digestion vectors and PCR products

TABLE 5 digestion reaction System

1.3.2 connection

TABLE 6 ligation reaction System

T4 DNA Ligase(Thermo)	8μl
		10×T4 DNA Ligase buffer	15μl
VL-vector(sfiI/XhoI)	1.5μg
		VH(sfiI/XhoI)	0.45μg
H2O	Added to the reaction system in a total of 150. mu.l

Incubating at 16 deg.C for 15h, and heating and inactivating at 65 deg.C for 10 min.

1.3.3 electrotransfer

The procedure is as in 1.2.4

1.3.4 library evaluation

1) Colony PCR

PCR was performed using the constructed library as a template

TABLE 7 PCR reaction conditions

Wherein, the three steps of denaturation, annealing and extension (1) are repeated for 30 times.

Template Here is a library of constructed antibodies

The primer sequence is as follows:

Forward(F):TGCTCGGGGATCCGAATTCT(SEQ ID NO：77)

Reverse(R):TCGAGTGCGGCCGCAAGCTT(SEQ ID NO：78)

2) sequencing

Selecting positive clones, and sequencing the positive clones by Wuhan Pongzhike biotechnology limited.

The sequencing quality control results are shown in FIG. 2.

1.4 expression of RBD protein

Artificially synthesizing an RBD gene sequence, and recombining the RBD gene into an expression vector plasmid PATX2 to obtain an RBD-PATX2 expression vector; the amino acid sequence of the cloning site EcoR1/Not1 and RBD is shown in SEQ ID NO: 1, and the gene sequence is shown as SEQ ID NO: 2 is shown in the specification;

transfecting the RBD-PATX2 expression vector into an HEK293F cell line for culturing, collecting supernatant, and purifying by a nickel column to obtain RBD protein; the purified RBD was subjected to SDS-PAGE (polyacrylamide gel electrophoresis) to verify its purity.

The result of the agarose gel electrophoresis verification and the purity verification agarose gel electrophoresis picture of the recombinant plasmid RBD-PATX2 are shown in figure 3, and the purity of the purified RBD SDS-PAGE electrophoresis verification purity is more than 90%.

EXAMPLE 2 preparation of monoclonal antibody specifically binding to the novel coronavirus RBD

Table 8 main reagents used in this example

Reagent	Numbering	Manufacturer(s)
			96-well plate	42592	Costar
Tween 20	P2287	Sigma
			Tris	RES3098T-B7	Sigma
Glycine	G8200	Solarbio
			PEG	181986	Sigma
PBS	C10010500BT	Life
			BSA	A104912-100g	aladdin
Skim milk	6342932	BD

2.1 first wheel

2.1.1 biopanning

(1) Coating: the RBD recombinant protein was diluted to 50. mu.g/ml with PBS, and 1ml was taken in an immunization tube and coated overnight at 4 ℃.

(2) Washing: discard the tube and wash the tube three times with 5ml 0.05% PBST.

(3) And (3) sealing: 5ml of 5% skim milk (PBS) was added to the tube and incubated at 30 ℃ for 2 hours.

(4) Washing: discard the tube and wash the tube three times with 5ml 0.05% PBST.

(5) And (3) incubation: phage library was diluted with 1% skim milk (PBS lysis) to a titer of 1x 10¹²pfu/ml. Adding 1m into an immune tube, and incubating for 2 hours at room temperature by gentle shaking.

(6) Washing: discard the tube and wash the tube three times with 5ml 0.05% PBST.

(7) And (3) elution: the RBD-bound phage was eluted with 1ml of glycine-hydrochloric acid (pH2.2) and neutralized with Tris-HCl to pH 7.0.

2.1.2 determination of the titer of diluted phages

(1) Coli TG1 was cultured until OD₆₀₀＝0.4-0.6。

(2) mu.L of diluted eluted phage was mixed with 190. mu.L of E.coli TG 1.

(3) The incubation mixture was incubated at 37 ℃ for 30 minutes and then poured into 2 XYT-A (Amp 100. mu.g/ml) medium. The medium was cultured in inverted condition at 37 ℃ overnight.

2.1.3 phage library amplification

(1) Coli TG1 was added to 800. mu.l of 2YT medium and mixed culture was performed at 37 ℃ until OD was known₆₀₀＝0.4-0.6.

(2) Transferring TG1 cultured to logarithmic phase into 10ml 2YT-G (final concentration 2% glucose) culture solution, and culturing at 37 deg.C to OD on shaker₆₀₀＝0.4-0.6。

(3) The eluted product was added and incubated at 37 ℃ for 30 minutes and shaken at 37 ℃ for 30 minutes.

(4) 30ml of 2YT-AG culture medium (final concentration 0.1% Amp, 2% glucose) was added thereto, and shake-cultured at 37 ℃ for 1 hour. (5) M13KO7(M13KO7: TG1 ═ 20:1) was added, and the mixture was incubated at 37 ℃ for 30 minutes and shaken at 37 ℃ for 30 minutes.

(6) The bacterial suspension was centrifuged at 5000rpm for 10 minutes. Resuspend with 40ml2YT-AK and incubate overnight at 30 ℃ with a shaker.

(7) Centrifugation was carried out at 8000rpm for 10 minutes, the supernatant was removed, resuspended in 1ml PBS, centrifuged at 12000rpm for 5 minutes, and the supernatant was transferred to a new 1.5ml centrifuge tube.

2.1.4 phage library titer determination after amplification

The procedure is as in 2.1.2

2.2 second to fourth wheels

2.2.1 biopanning

Repeating the step for 2.1 times in a circulating way, wherein the eluted phage after the amplification of the previous round is used for each input phage library.

TABLE 9 results of biopanning

2.3 polyclonal phage ELISA

(1) Coating: antigen group: RBD recombinant protein was diluted to 4. mu.g/ml with PBS, added to the microplate at 100ul per well, and coated overnight at 4 ℃. Control group: 100ul PBS was added to each well of the microplate and coated overnight at 4 ℃.

(2) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(3) And (3) sealing: mu.l of 5% skim milk (PBS) was added to each well of the microplate and incubated at 30 ℃ for 2 hours.

(4) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(5) Phage incubation: eluted phages after each round of amplification were diluted to the required titer with 1% skim milk (PBS lysis). Mu.l of the solution was added to the microplate in each well and incubated for 2 hours at room temperature with gentle shaking.

(6) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(7) And (3) secondary antibody incubation: anti-M13-HRP antibody (1:5000) was diluted with 1% skim milk (PBS solubilized). Mu.l of the suspension was added to each well and incubated at 37 ℃ for 1 hour.

(8) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(9) Color development: add 100. mu.L of TMB to each well, incubate at room temperature, add 100. mu.L of 2M HCl to each well to stop the reaction, and read the values OD450nm-OD630nM on a microplate reader.

TABLE 10 results of polyclonal phage ELISA

2.4 monoclonal phage ELISA (polyclonal based on the third round of elution)

(1) Eluting phage infection: a portion of the diluted third round of eluted phage was mixed with 200ul of E.coli TG1 in log phase. The mixture was incubated at 37 ℃ for 30 minutes and poured onto 2 XYT-A (Amp 100. mu.g/ml) solid medium. Incubated at 37 ℃ overnight.

(2) Monoclonal phage amplification: 196 single clones were picked from the infected plates, inoculated into 600ul of 2 XYT-A (Amp 100. mu.g/ml) liquid medium, cultured with shaking at 37 ℃ for 2h, supplemented with a suitable amount of helper phage M13KO7(M13KO7: TG1 ═ 20:1), incubated at 37 ℃ for 30 minutes, and shaken at 37 ℃ for 30 minutes. The bacterial suspension was centrifuged at 4000rpm for 10 minutes. Resuspend with 600ul 2YT-AK (Amp 100. mu.g/ml, Kan 50. mu.g/ml) and incubate overnight at 30 ℃ with a shaker. The next day, the bacterial solution was centrifuged at 8000rpm for 10 minutes, and the supernatant was removed for further use.

(3) Coating: antigen group: RBD recombinant protein was diluted to 4. mu.g/ml with PBS, added to the microplate at 100ul per well, and coated overnight at 4 ℃. Control group: 100ul PBS was added to each well of the microplate and coated overnight at 4 ℃.

(4) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(5) And (3) sealing: mu.l of 5% skim milk (PBS) was added to each well of the microplate and incubated at 30 ℃ for 2 hours.

(6) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(7) Phage incubation: mu.l of monoclonal culture supernatant per well was added to the microplate and incubated for 2 hours at room temperature with gentle shaking.

(8) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(9) And (3) secondary antibody incubation: anti-M13-HRP antibody (1:5000) was diluted with 1% skim milk (PBS solubilized). Mu.l of the suspension was added to each well and incubated at 37 ℃ for 1 hour.

(10) Washing: the microplate was discarded and each well was washed three times with 300. mu.l, 0.05% PBST.

(11) Color development: add 100. mu.L of TMB to each well, incubate at room temperature, add 100. mu.L of 2M HCl to each well to stop the reaction, and read the values OD450nm-OD630nM on a microplate reader.

TABLE 11 results of monoclonal phage ELISA

First plate (R3P1)96 monoclonal ELISA results

Second plate (R3P2)96 monoclonal ELISA results

We identified clonidine of the antigen group greater than 3 times the control group as positive clones, which were sent for sequencing. The wrong antibody sequences and repeated antibody sequences are eliminated, and finally 6 high-affinity antibody sequences are obtained. The sequence of the high specificity antibody is as follows.

2.5 sequencing of antibody sequences

Screening the obtained phage positive clones, and performing full sequence sequencing to obtain corresponding antibody heavy chain light chains, wherein the full sequence is as follows:

the amino acid sequence of the RBD-R3P1-A12 antibody is shown as SEQ ID NO: 3;

the nucleotide sequence of the RBD-R3P1-A12 antibody is shown as SEQ ID NO: 4;

the amino acid sequence of the RBD-R3P2-A2 antibody is shown as SEQ ID NO: 5;

the nucleotide sequence of the RBD-R3P2-A2 antibody is shown as SEQ ID NO: 6;

the amino acid sequence of the RBD-R3P2-B5 antibody is shown as SEQ ID NO: 7;

the nucleotide sequence of the RBD-R3P2-B5 antibody is shown as SEQ ID NO: 8;

the amino acid sequence of the RBD-R3P1-B6 antibody is shown as SEQ ID NO: 9;

the nucleotide sequence of the RBD-R3P1-B6 antibody is shown as SEQ ID NO: 10;

the amino acid sequence of the RBD-R3P1-E4 antibody is shown as SEQ ID NO: 11;

the nucleotide sequence of the RBD-R3P1-E4 antibody is shown as SEQ ID NO: 12;

the amino acid sequence of the RBD-R3P2-G1 antibody is shown as SEQ ID NO: 13, and (c) a sequence set forth in (c);

the nucleotide sequence of the RBD-R3P2-G1 antibody is shown as SEQ ID NO: 14, or a sequence shown in fig. 14;

the amino acid sequence of the heavy chain of the RBD-R3P1-A12 antibody is shown as SEQ ID NO: 15, or a sequence shown in seq id no;

the nucleotide sequence of the heavy chain of the RBD-R3P1-A12 antibody is shown as SEQ ID NO: 16;

the amino acid sequence of the RBD-R3P1-A12 antibody light chain is shown as SEQ ID NO: 17;

the nucleotide sequence of the RBD-R3P1-A12 antibody light chain is shown as SEQ ID NO: 18, or a sequence shown in seq id no;

the amino acid sequence of the heavy chain of the RBD-R3P2-A2 antibody is shown as SEQ ID NO: 19;

the nucleotide sequence of the heavy chain of the RBD-R3P2-A2 antibody is shown as SEQ ID NO: 20;

the amino acid sequence of the RBD-R3P2-A2 antibody light chain is shown as SEQ ID NO: 21;

the nucleotide sequence of the RBD-R3P2-A2 antibody light chain is shown as SEQ ID NO: 22;

the amino acid sequence of the heavy chain of the RBD-R3P2-B5 antibody is shown as SEQ ID NO: 23;

the nucleotide sequence of the heavy chain of the RBD-R3P2-B5 antibody is shown as SEQ ID NO: 24;

the amino acid sequence of the RBD-R3P2-B5 antibody light chain is shown as SEQ ID NO: 25;

the nucleotide sequence of the RBD-R3P2-B5 antibody light chain is shown as SEQ ID NO: 26;

the amino acid sequence of the heavy chain of the RBD-R3P1-B6 antibody is shown as SEQ ID NO: 27, or a sequence set forth in seq id no;

the nucleotide sequence of the heavy chain of the RBD-R3P1-B6 antibody is shown as SEQ ID NO: 28;

the amino acid sequence of the RBD-R3P1-B6 antibody light chain is shown as SEQ ID NO: 29;

the nucleotide sequence of the RBD-R3P1-B6 antibody light chain is shown as SEQ ID NO: 30;

the amino acid sequence of the heavy chain of the RBD-R3P1-E4 antibody is shown as SEQ ID NO: 31;

the nucleotide sequence of the heavy chain of the RBD-R3P1-E4 antibody is shown as SEQ ID NO: 32;

the amino acid sequence of the RBD-R3P1-E4 antibody light chain is shown as SEQ ID NO: 33;

the nucleotide sequence of the RBD-R3P1-E4 antibody light chain is shown as SEQ ID NO: 34;

the amino acid sequence of the heavy chain of the RBD-R3P2-G1 antibody is shown as SEQ ID NO: 35;

the nucleotide sequence of the heavy chain of the RBD-R3P2-G1 antibody is shown as SEQ ID NO: 36;

the amino acid sequence of the RBD-R3P2-G1 antibody light chain is shown as SEQ ID NO: 37;

the nucleotide sequence of the RBD-R3P2-G1 antibody light chain is shown as SEQ ID NO: 38;

the amino acid sequence of CDR1 of the heavy chain of the RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 or RBD-R3P2-G1 antibody is shown as SEQ ID NO: 39;

the amino acid sequence of CDR2 of the heavy chain of the RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 or RBD-R3P2-G1 antibody is shown as SEQ ID NO: 40;

the amino acid sequence of CDR3 of the heavy chain of the RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 or RBD-R3P2-G1 antibody is shown as SEQ ID NO: 41;

the amino acid sequence of CDR1 of the RBD-R3P1-A12 antibody light chain is shown as SEQ ID NO: 42;

the amino acid sequence of CDR2 of the RBD-R3P1-A12 antibody light chain is shown as SEQ ID NO: 43;

the amino acid sequence of CDR3 of the RBD-R3P1-A12 antibody light chain is shown as SEQ ID NO: 44, or a sequence shown in SEQ ID NO;

the amino acid sequence of CDR1 of the RBD-R3P2-A2 antibody light chain is shown as SEQ ID NO: 45, and (c) a sequence shown as 45;

the amino acid sequence of CDR2 of the RBD-R3P2-A2 antibody light chain is shown as SEQ ID NO: 46;

the amino acid sequence of CDR3 of the RBD-R3P2-A2 antibody light chain is shown as SEQ ID NO: 47;

the amino acid sequence of CDR1 of the RBD-R3P2-B5 antibody light chain is shown as SEQ ID NO: 48;

the amino acid sequence of CDR2 of the RBD-R3P2-B5 antibody light chain is shown as SEQ ID NO: 49;

the amino acid sequence of CDR3 of the RBD-R3P2-B5 antibody light chain is shown as SEQ ID NO: 50;

the amino acid sequence of CDR1 of the RBD-R3P1-B6 antibody light chain is shown as SEQ ID NO: 51;

the amino acid sequence of CDR2 of the RBD-R3P1-B6 antibody light chain is shown as SEQ ID NO: 52;

the amino acid sequence of CDR3 of the RBD-R3P1-B6 antibody light chain is shown as SEQ ID NO: 53, or a sequence shown in SEQ ID NO;

the amino acid sequence of CDR1 of the RBD-R3P1-E4 antibody light chain is shown as SEQ ID NO: 54, or a sequence shown in SEQ ID NO;

the amino acid sequence of CDR2 of the RBD-R3P1-E4 antibody light chain is shown as SEQ ID NO: 55;

the amino acid sequence of CDR3 of the RBD-R3P1-E4 antibody light chain is shown as SEQ ID NO: 56;

the amino acid sequence of CDR1 of the RBD-R3P2-G1 antibody light chain is shown as SEQ ID NO: 57;

the amino acid sequence of CDR2 of the RBD-R3P2-G1 antibody light chain is shown as SEQ ID NO: 58;

the amino acid sequence of CDR3 of the RBD-R3P2-G1 antibody light chain is shown as SEQ ID NO: 59;

the linker amino acid sequence is as shown in SEQ ID NO: 60, or a sequence shown in seq id no.

Example 3ELISA detection of OD values of antibodies at different dilution concentrations

ELISA experiment steps of enzyme-linked immunosorbent assay:

1. MES powder (SIGMA, Lot # SLBZ3485) was formulated with ddH2O into a MES buffer of 0.1M, pH ═ 6.0; 2. EDC (C8H17N3, Thermo Scientific, Lot # TB257918) was diluted to 10mg/ml with ddH 2O.

2. The antibody was diluted with 0.1M MES buffer to 4. mu.g/ml or in a gradient to calculate the EC 50.

3. Setting negative control in the micro-porous plate, and adding 10 mul EDC solution and 50 mul polypeptide solution into each hole; the remaining wells were filled with 10. mu.l EDC solution and 50. mu.l MES buffer. And (5) lightly shaking and mixing. Placing the plate with pressure sensitive adhesive strip at 4 deg.C overnight or at room temperature for more than two hours.

4. Removing the non-drying adhesive tape, sucking off the liquid in the holes, adding 300 mu l of ddH2O into each hole, standing for 2 minutes, discarding the liquid, and patting the plate dry. Repeat the above step 2 times.

5. Blocking solutions of 1% BSA (10 XPBST: Solambio, Cat # P1033-500; BSA: Solambio, Cat # A8020) were prepared using 1XPBST, 200. mu.l of blocking solution was added to each well and blocked for 1 hour at room temperature.

6. Discard the well liquid and pat the plate dry. RBD protein was diluted 1:500 with blocking solution, 100. mu.l of diluted serum was added to each well, and the reaction was carried out at room temperature for 1 hour.

7. Discard the liquid in the wells, add 300. mu.l of 1XPBST to each well, stand for 2 minutes, discard the liquid, and pat the plate dry. Repeat the above step 2 times.

8. HRP-labeled Goat Anti-Human IgG (Cwbio, Cat # CW0169S) was applied to the cells using a blocking solution at a ratio of 1: diluted at 5000, 100. mu.l/well, and reacted at room temperature for 40 minutes.

9. Repeat procedure 7, wash plate 5 times with 1 XPBST.

10. 100. mu.l of TMB-ELISA developing solution (Thermo Scientific, Lot # TK2666052) was added to each well, and the reaction was carried out for 5-15 minutes in the absence of light.

11. The reaction was stopped by adding 50. mu.l of 2M H2SO4 solution to each well.

12. The OD value of each well was measured by setting the wavelength of the microplate reader to 450nm, and the value was read within 30 minutes after the termination of the reaction.

EC50 was calculated from the binding capacity of the antibody dilution gradient to RBD, and the results are shown in fig. 4. Compared with the reported antibodies S309 and CR3022 in the literature, the self-produced 6 RBD antibodies have better affinity with the RBD than S309.

Example 4 neutralization experiment

4.1 preparation before experiment

4.1.1 equilibration reagents

Taking out the reagent (pancreatin, DMEM complete medium) stored at 2-8 deg.C, balancing to room temperature for more than 30min

4.1.2 operator

The experimental operation is carried out by trained experimental operators, and before the experimental operation, the operators can get into the experimental area for the experimental operation by changing the clothes (wearing disposable aseptic clothes, changing work shoes, wearing a mask, a cap and disposable medical latex gloves) in the clean area.

4.2 Experimental procedures

4.2.1 inactivating the serum (or plasma) to be detected in 56 ℃ water bath for 30min, centrifuging for 3min at 6000g, and transferring the supernatant to a 1.5ml centrifuge tube for standby.

4.2.2 taking 96-well plate, adding DMEM complete medium (1% double antibody, 25mM HEPES, 10% FBS) 150. mu.l/well in column 2 (cell control CC, see Table 2), adding DMEM complete medium 100. mu.l/well in columns 3-11 (column 3 is virus control VV, column 4-11 is sample well), adding DMEM complete medium 42.5. mu.l/well in B4-B11 well.

4.2.3 plasma sample 1 (7.5. mu.l) … … was added to wells B4 and B5 and so on, and plasma sample 4 (7.5. mu.l) was added to wells B10 and B11.

4.2.4 adjust the multi-channel pipette to 50 μ l, gently and repeatedly blow and suck the liquid in the B4-B11 holes for 6-8 times, fully and uniformly mix, then transfer 50 μ l of liquid to the corresponding C4-C11, and suck and discard 50 μ l of liquid, wherein the sample adding sequence and the sample adding mode refer to Table 12.

TABLE 12 sample addition sequence and sample addition mode

4.2.5 dilution of pseudovirus to 2x 10 with DMEM complete Medium⁴TCID50/ml (diluted by the dilution factor given) was added to 50. mu.l per well in columns 3-11 to give a pseudovirus content of 1x 10 per well³A hole.

4.2.6 the 96-well plate was placed in a cell incubator (37 ℃, 5% CO)₂) Incubate for 1 hour.

4.2.7 when the incubation time is half an hour, taking out the Huh-7 cells prepared in advance in the incubator (the confluence rate is 80% -90%), taking a T75 culture bottle as an example, removing the culture medium in the bottle, adding 5ml of PBS buffer solution to clean the cells, pouring off the PBS, adding 3ml of 0.25% pancreatin-EDTA to immerse the cells for digestion for 1 minute, pouring off the pancreatin, placing the cells in the cell incubator for digestion for 5 minutes, slightly beating the side wall of the culture bottle to make the cells fall off, adding 10ml of culture medium to neutralize the pancreatin, blowing for several times, transferring the cells to a centrifuge tube, centrifuging for 5 minutes at 210g, pouring off the supernatant, completely culturing the cells with 10ml of DMEM, counting the cells, diluting the cells with 5 x 10 complete culture medium to 5⁵One per ml.

4.2.8 incubations to 1 hour, add 100. mu.l cells per well in 96-well plates, 5 x 10 cells per well⁴And (4) respectively.

4.2.9 gently shaking the 96-well plate to disperse cells uniformly in the well, placing the 96-well plate in a cell culture box at 37 deg.C and 5% CO₂Culturing for 20-28 hours.

4.2.1020-28 hours later, the 96-well plate is taken out from the cell culture box, 150 μ l of supernatant is sucked from each sample loading hole by a multi-channel pipette, then 100 μ l of luciferase detection reagent is added, and the reaction is carried out for 2min at room temperature in a dark place.

And 4.2.11 after the reaction is finished, repeatedly blowing and sucking the liquid in the reaction hole for 6-8 times by using a multi-channel pipette to fully lyse the cells, sucking 150 mu l of liquid from each hole, adding the liquid into a corresponding 96-hole chemiluminescence detection plate, and placing the plate in a chemiluminescence detector to read the luminescence value.

4.2.12 calculation of neutralization inhibition: the inhibition rate was [1- (mean value of luminescence intensity of sample group-CC mean value of blank control)/(mean value of luminescence intensity of negative group VC-CC mean value of blank control) ]. 100%.

4.2.13 IC50 was calculated by the Reed-Muench method based on the results of neutralization inhibition. Fig. 5 shows a graph of the results of the neutralization experiment. Wherein, FIG. 5A shows the inhibition rate of the screened antibody sequences against SARS-CoV-2 pseudovirus; FIGS. 5B-5H show the results of the inhibition rate measurements of antibodies RBD-R3P1-A12 (FIG. 5B: A12), RBD-R3P2-A2 (FIG. 5D, 5G: A2), RBD-R3P2-B5 (FIG. 5C: B5), RBD-R3P1-B6 (FIG. 5E: B6), RBD-R3P1-E4 (FIG. 5B, 5H: E4) and R3P2-G1 (FIG. 5F: G1) against SARS-CoV-2 euvirus (FIG. 5B-5H: SARS-CoV2-NP or SARS-CoV-2-NP), wherein antibody concentrations-1, -2, -3 represent concentrations 63ng,250ng,1ug, respectively. According to the results of neutralization experiments of six RBD antibodies SARS-CoV-2 pseudovirus and euvirus, the result of E4 is most obvious, and the antibody has obvious inhibiting effect on the euvirus.

The present disclosure is not intended to be limited in scope by the specifically disclosed embodiments, which are provided, for example, to illustrate aspects of the present disclosure. Various modifications to the compositions and methods will be apparent from the description and teachings herein. Such variations may be practiced without departing from the true scope and spirit of the disclosure, and are intended to fall within the scope of the disclosure.

Sequence listing

<110> Suzhou Fagaku Biotechnology Ltd

Suzhou Institute of Systems Medicine

<120> human antibody of novel coronavirus specific antigen peptide, preparation method and application

<130> 6A59-2093437I

<141> 2020-11-25

<160> 78

<170> SIPOSequenceListing 1.0

<210> 1

<211> 247

<212> PRT

<213> Artificial Sequence

<400> 1

Met Pro Leu Leu Leu Leu Leu Pro Leu Leu Trp Ala Gly Ala Leu Ala

1 5 10 15

Arg Val Gln Pro Thr Glu Ser Ile Val Arg Phe Pro Asn Ile Thr Asn

20 25 30

Leu Cys Pro Phe Gly Glu Val Phe Asn Ala Thr Arg Phe Ala Ser Val

35 40 45

Tyr Ala Trp Asn Arg Lys Arg Ile Ser Asn Cys Val Ala Asp Tyr Ser

50 55 60

Val Leu Tyr Asn Ser Ala Ser Phe Ser Thr Phe Lys Cys Tyr Gly Val

65 70 75 80

Ser Pro Thr Lys Leu Asn Asp Leu Cys Phe Thr Asn Val Tyr Ala Asp

85 90 95

Ser Phe Val Ile Arg Gly Asp Glu Val Arg Gln Ile Ala Pro Gly Gln

100 105 110

Thr Gly Lys Ile Ala Asp Tyr Asn Tyr Lys Leu Pro Asp Asp Phe Thr

115 120 125

Gly Cys Val Ile Ala Trp Asn Ser Asn Asn Leu Asp Ser Lys Val Gly

130 135 140

Gly Asn Tyr Asn Tyr Leu Tyr Arg Leu Phe Arg Lys Ser Asn Leu Lys

145 150 155 160

Pro Phe Glu Arg Asp Ile Ser Thr Glu Ile Tyr Gln Ala Gly Ser Thr

165 170 175

Pro Cys Asn Gly Val Glu Gly Phe Asn Cys Tyr Phe Pro Leu Gln Ser

180 185 190

Tyr Gly Phe Gln Pro Thr Asn Gly Val Gly Tyr Gln Pro Tyr Arg Val

195 200 205

Val Val Leu Ser Phe Glu Leu Leu His Ala Pro Ala Thr Val Cys Gly

210 215 220

Pro Lys Lys Ser Thr Asn Leu Val Lys Asn Lys Cys Val Asn Phe Ser

225 230 235 240

Gly His His His His His His

245

<210> 2

<211> 741

<212> DNA

<213> Artificial Sequence

<400> 2

atgcctctgc tgctgctgct ccccctgctg tgggccggag ctctggctag ggtgcagccc 60

accgagagca tcgtgaggtt ccccaatatc acaaatctgt gtcccttcgg cgaggtgttt 120

aacgccacca ggtttgcctc cgtgtacgcc tggaatagga agagaatcag caattgtgtg 180

gccgactaca gcgtgctgta caattccgcc agcttctcca ccttcaagtg ctacggcgtg 240

agccccacca agctgaatga cctgtgtttt accaatgtgt acgccgacag cttcgtgatc 300

aggggcgatg aggtgaggca gatcgccccc ggccagacag gcaagatcgc cgattacaat 360

tacaagctgc ctgatgattt taccggctgt gtgatcgcct ggaatagcaa taacctggat 420

agcaaggtgg gcggcaacta caattacctg tacagactgt ttagaaagtc caacctgaag 480

cccttcgaga gggacatcag caccgagatc taccaggccg gctccacacc ttgtaacggc 540

gtggagggct tcaactgcta ctttcccctg cagagctacg gcttccagcc caccaatggc 600

gtgggctacc agccttacag agtggtggtg ctgagctttg agctgctgca cgcccccgcc 660

accgtgtgtg gacctaagaa gagcaccaat ctggtgaaga ataagtgcgt gaacttcagc 720

ggccaccacc accaccatca c 741

<210> 3

<211> 247

<212> PRT

<213> Artificial Sequence

<400> 3

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Glu Ile Val Met Thr

130 135 140

Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu

145 150 155 160

Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser Tyr Leu Ala Trp Tyr

165 170 175

Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Ala Ser

180 185 190

Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly

195 200 205

Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala

210 215 220

Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro Trp Thr Phe Gly Gln

225 230 235 240

Gly Thr Lys Val Glu Ile Lys

245

<210> 4

<211> 741

<212> DNA

<213> Artificial Sequence

<400> 4

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccctgg tcaccgtctc gagtggtggt 360

ggcggttctg gtggtggtgg tagcggtggc ggtggtagtg gcggtggcgg tgctagcgaa 420

attgtaatga cacagtctcc aggcaccctg tctttgtctc caggggaaag agccaccctc 480

tcctgcaggg ccagtcagag tgttagcagc agctacttag cctggtacca gcagaaacct 540

ggccaggctc ccaggctcct catctatggt gcatccagca gggccactgg catcccagac 600

aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag actggagcct 660

gaggattttg cagtgtatta ctgtcagcag tatggtagct caccgtggac gttcggccaa 720

gggaccaagg tggagatcaa a 741

<210> 5

<211> 247

<212> PRT

<213> Artificial Sequence

<400> 5

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Glu Ile Val Met Thr

130 135 140

Gln Ser Pro Ser Val Leu Pro Leu Phe Pro Gly Glu Ser Gly Ser Leu

145 150 155 160

Ser Cys Arg Ala Ser Gln Asn Val Gly Asp Phe Leu Ala Trp Tyr Gln

165 170 175

His Lys Pro Gly Gln Ala Pro Lys Leu Leu Ile Tyr Gly Ala Thr Asn

180 185 190

Arg Pro Thr Gly Ile Pro Asp Arg Phe Ser Gly Thr Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Arg Met Glu Pro Glu Asp Phe Ala Val

210 215 220

Tyr Phe Cys Gln Gln Tyr Gly Thr Ser Pro Pro Ile Thr Phe Gly Pro

225 230 235 240

Gly Thr Lys Val Asp Ile Lys

245

<210> 6

<211> 741

<212> DNA

<213> Artificial Sequence

<400> 6

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggacaatgg tcaccgtctc gagtggtggt 360

ggcggttctg gtggtggtgg tagcggtggc ggtggtagtg gcggtggcgg tgctagcgaa 420

atagtgatga cgcagtctcc cagtgttctg cctctgtttc caggagaaag cggctccctc 480

tcctgcaggg ccagtcagaa tgttggcgac ttcttagcct ggtaccagca taaacctggc 540

caggctccca agctcctcat ctatggtgca accaacaggc ccactggcat ccccgacagg 600

ttcagtggca ccgggtctgg gacagacttc acgctgacca tcagtagaat ggaacctgaa 660

gattttgcag tgtacttctg tcagcaatac gggacctcac cgcctatcac tttcggccct 720

gggaccaaag tggatatcaa a 741

<210> 7

<211> 246

<212> PRT

<213> Artificial Sequence

<400> 7

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Glu Ile Val Met Thr

130 135 140

Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Val Thr Leu

145 150 155 160

Ser Cys Arg Thr Ser Gln Ser Val Ser Arg Phe Phe Ser Trp Tyr Gln

165 170 175

Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile His Thr Ala Ser Thr

180 185 190

Arg Ala Thr Asp Ile Pro Asp Arg Phe Ser Ala Ser Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Ser Ala Met

210 215 220

Tyr Tyr Cys Gln His Tyr Gly Ala Ser Pro Tyr Thr Phe Gly Gln Gly

225 230 235 240

Thr Lys Val Asp Ile Lys

245

<210> 8

<211> 738

<212> DNA

<213> Artificial Sequence

<400> 8

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccctgg tcaccgtctc gagtggtggt 360

ggcggttctg gtggtggtgg tagcggtggc ggtggtagtg gcggtggcgg tgctagcgaa 420

attgtaatga cacagtctcc aggcaccctg tctttgtctc caggggaaag agttaccctc 480

tcctgcagga ccagtcagag tgttagtcgt ttcttctcct ggtaccagca gaaacctggc 540

caggctccca ggctcctcat ccatactgca tccaccaggg ccactgacat cccagacagg 600

ttcagtgcca gtgggtctgg gacagacttc actctcacca tcagcagact ggagcctgaa 660

gattctgcaa tgtattactg tcagcactat ggtgcctcac cgtacacttt tggccaaggg 720

accaaagtgg atatcaaa 738

<210> 9

<211> 247

<212> PRT

<213> Artificial Sequence

<400> 9

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Glu Ile Val Leu Thr

130 135 140

Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu

145 150 155 160

Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser Tyr Leu Ala Trp Tyr

165 170 175

Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Ala Ser

180 185 190

Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly

195 200 205

Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala

210 215 220

Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro Gly Thr Phe Gly Gln

225 230 235 240

Gly Thr Lys Val Asp Ile Lys

245

<210> 10

<211> 741

<212> DNA

<213> Artificial Sequence

<400> 10

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccctgg tcaccgtctc gagtggtggt 360

ggcggttctg gtggtggtgg tagcggtggc ggtggtagtg gcggtggcgg tgctagcgaa 420

attgtgctga ctcagtctcc aggcaccctg tctttgtctc caggggaaag agccaccctc 480

tcctgcaggg ccagtcagag tgttagcagc agctacttag cctggtacca gcagaaacct 540

ggccaggctc ccaggctcct catctatggt gcatccagca gggccactgg catcccagac 600

aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag actggagcct 660

gaagattttg cagtgtatta ctgtcagcag tatggtagct caccggggac ttttggccag 720

gggaccaaag tggatatcaa a 741

<210> 11

<211> 245

<212> PRT

<213> Artificial Sequence

<400> 11

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Asp Ile Val Met Thr

130 135 140

Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile

145 150 155 160

Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr Leu Ala Trp Tyr Gln

165 170 175

Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr

180 185 190

Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr

195 200 205

Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr

210 215 220

Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Arg Phe Gly Pro Gly Thr

225 230 235 240

Lys Val Glu Ile Lys

245

<210> 12

<211> 735

<212> DNA

<213> Artificial Sequence

<400> 12

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc gagtggtggt 360

ggcggttctg gtggtggtgg tagcggtggc ggtggtagtg gcggtggcgg tgctagcgac 420

atcgtgatga cccagtctcc atcctccctg tctgcatctg taggagacag agtcaccatc 480

acttgccggg ccagtcaggg cattagcagt tatttagcct ggtatcagca aaaaccaggg 540

aaagccccta agctcctgat ctatgctgca tccactttgc aaagtggggt cccatcaagg 600

ttcagcggca gtggatctgg gacagatttc actctcacca tcagcagcct gcagcctgaa 660

gattttgcaa cttattactg tcaacaactt aatagttacc cccggtttgg acctgggacc 720

aaggtggaga tcaaa 735

<210> 13

<211> 247

<212> PRT

<213> Artificial Sequence

<400> 13

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Gln Ala Val Leu Thr

130 135 140

Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys Thr Ala Arg Ile Thr

145 150 155 160

Cys Gly Gly Asn His Ile Gly Ser Lys Ser Val Asn Trp Tyr Gln Gln

165 170 175

Lys Ser Gly Gln Ala Pro Val Leu Val Ile Tyr Ser Asp Ser Asp Arg

180 185 190

Pro Ser Gly Ile Pro Ala Arg Phe Ser Gly Ser Asn Ser Gly Asp Thr

195 200 205

Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala Asp Tyr

210 215 220

Tyr Cys Gln Val Trp Asp Asn Arg Ser Asp His Trp Val Phe Gly Gly

225 230 235 240

Gly Thr Gln Leu Thr Val Leu

245

<210> 14

<211> 741

<212> DNA

<213> Artificial Sequence

<400> 14

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc gagtggtggt 360

ggcggttctg gtggtggtgg tagcggtggc ggtggtagtg gcggtggcgg tgctagccag 420

gctgtgctga ctcagccacc ctcagtgtca gtggccccag gaaagacggc cagaataacc 480

tgtgggggaa accacattgg aagtaagagt gtgaactggt accagcagaa gtcaggccag 540

gcccctgtgc tggtcatcta ttctgatagc gaccggccct cagggatacc tgcgcgattc 600

tctggctcca actctgggga cacggccacc ctgaccatca gcagggtcga agccggggat 660

gaggccgact attactgtca ggtgtgggat aatcgtagtg atcattgggt gttcggcgga 720

ggcacccagc tgaccgtcct c 741

<210> 15

<211> 118

<212> PRT

<213> Artificial Sequence

<400> 15

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 16

<211> 354

<212> DNA

<213> Artificial Sequence

<400> 16

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccctgg tcaccgtctc gagt 354

<210> 17

<211> 108

<212> PRT

<213> Artificial Sequence

<400> 17

Glu Ile Val Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser

20 25 30

Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro

85 90 95

Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105

<210> 18

<211> 324

<212> DNA

<213> Artificial Sequence

<400> 18

gaaattgtaa tgacacagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60

ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120

cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac tggcatccca 180

gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240

cctgaggatt ttgcagtgta ttactgtcag cagtatggta gctcaccgtg gacgttcggc 300

caagggacca aggtggagat caaa 324

<210> 19

<211> 118

<212> PRT

<213> Artificial Sequence

<400> 19

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Met Val Thr Val Ser Ser

115

<210> 20

<211> 354

<212> DNA

<213> Artificial Sequence

<400> 20

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggacaatgg tcaccgtctc gagt 354

<210> 21

<211> 108

<212> PRT

<213> Artificial Sequence

<400> 21

Glu Ile Val Met Thr Gln Ser Pro Ser Val Leu Pro Leu Phe Pro Gly

1 5 10 15

Glu Ser Gly Ser Leu Ser Cys Arg Ala Ser Gln Asn Val Gly Asp Phe

20 25 30

Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Gly Ala Thr Asn Arg Pro Thr Gly Ile Pro Asp Arg Phe Ser Gly

50 55 60

Thr Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Met Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr Gly Thr Ser Pro Pro

85 90 95

Ile Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys

100 105

<210> 22

<211> 324

<212> DNA

<213> Artificial Sequence

<400> 22

gaaatagtga tgacgcagtc tcccagtgtt ctgcctctgt ttccaggaga aagcggctcc 60

ctctcctgca gggccagtca gaatgttggc gacttcttag cctggtacca gcataaacct 120

ggccaggctc ccaagctcct catctatggt gcaaccaaca ggcccactgg catccccgac 180

aggttcagtg gcaccgggtc tgggacagac ttcacgctga ccatcagtag aatggaacct 240

gaagattttg cagtgtactt ctgtcagcaa tacgggacct caccgcctat cactttcggc 300

cctgggacca aagtggatat caaa 324

<210> 23

<211> 118

<212> PRT

<213> Artificial Sequence

<400> 23

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 24

<211> 354

<212> DNA

<213> Artificial Sequence

<400> 24

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccctgg tcaccgtctc gagt 354

<210> 25

<211> 107

<212> PRT

<213> Artificial Sequence

<400> 25

Glu Ile Val Met Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Val Thr Leu Ser Cys Arg Thr Ser Gln Ser Val Ser Arg Phe

20 25 30

Phe Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

His Thr Ala Ser Thr Arg Ala Thr Asp Ile Pro Asp Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro

65 70 75 80

Glu Asp Ser Ala Met Tyr Tyr Cys Gln His Tyr Gly Ala Ser Pro Tyr

85 90 95

Thr Phe Gly Gln Gly Thr Lys Val Asp Ile Lys

100 105

<210> 26

<211> 321

<212> DNA

<213> Artificial Sequence

<400> 26

gaaattgtaa tgacacagtc tccaggcacc ctgtctttgt ctccagggga aagagttacc 60

ctctcctgca ggaccagtca gagtgttagt cgtttcttct cctggtacca gcagaaacct 120

ggccaggctc ccaggctcct catccatact gcatccacca gggccactga catcccagac 180

aggttcagtg ccagtgggtc tgggacagac ttcactctca ccatcagcag actggagcct 240

gaagattctg caatgtatta ctgtcagcac tatggtgcct caccgtacac ttttggccaa 300

gggaccaaag tggatatcaa a 321

<210> 27

<211> 118

<212> PRT

<213> Artificial Sequence

<400> 27

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 28

<211> 354

<212> DNA

<213> Artificial Sequence

<400> 28

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccctgg tcaccgtctc gagt 354

<210> 29

<211> 108

<212> PRT

<213> Artificial Sequence

<400> 29

Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Ser

20 25 30

Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Pro

85 90 95

Gly Thr Phe Gly Gln Gly Thr Lys Val Asp Ile Lys

100 105

<210> 30

<211> 324

<212> DNA

<213> Artificial Sequence

<400> 30

gaaattgtgc tgactcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60

ctctcctgca gggccagtca gagtgttagc agcagctact tagcctggta ccagcagaaa 120

cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac tggcatccca 180

gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240

cctgaagatt ttgcagtgta ttactgtcag cagtatggta gctcaccggg gacttttggc 300

caggggacca aagtggatat caaa 324

<210> 31

<211> 118

<212> PRT

<213> Artificial Sequence

<400> 31

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser

115

<210> 32

<211> 354

<212> DNA

<213> Artificial Sequence

<400> 32

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc gagt 354

<210> 33

<211> 106

<212> PRT

<213> Artificial Sequence

<400> 33

Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Arg

85 90 95

Phe Gly Pro Gly Thr Lys Val Glu Ile Lys

100 105

<210> 34

<211> 318

<212> DNA

<213> Artificial Sequence

<400> 34

gacatcgtga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggccagtca gggcattagc agttatttag cctggtatca gcaaaaacca 120

gggaaagccc ctaagctcct gatctatgct gcatccactt tgcaaagtgg ggtcccatca 180

aggttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240

gaagattttg caacttatta ctgtcaacaa cttaatagtt acccccggtt tggacctggg 300

accaaggtgg agatcaaa 318

<210> 35

<211> 118

<212> PRT

<213> Artificial Sequence

<400> 35

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Val Ser Ser Asn

20 25 30

Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Arg Gly Leu Glu Trp Val

35 40 45

Ser Leu Ile Tyr Pro Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg Asn Thr Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val Trp Gly Gln Gly Thr

100 105 110

Thr Val Thr Val Ser Ser

115

<210> 36

<211> 354

<212> DNA

<213> Artificial Sequence

<400> 36

caggtgcagc tggtgcaatc tggaggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggggt caccgtcagt agcaactaca tgagctgggt ccgccaggct 120

ccagggaggg ggcttgagtg ggtctcactt atttatcccg gtggtagcac atactacgca 180

gactccgtga agggccgatt caccatctcc agagacaatt ccaggaacac gctgtatctt 240

caaatgaaca gcctgagagc cgaggacacg gccgtgtatt actgtgcgag agatctttca 300

gaaaaggggg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc gagt 354

<210> 37

<211> 108

<212> PRT

<213> Artificial Sequence

<400> 37

Gln Ala Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Lys

1 5 10 15

Thr Ala Arg Ile Thr Cys Gly Gly Asn His Ile Gly Ser Lys Ser Val

20 25 30

Asn Trp Tyr Gln Gln Lys Ser Gly Gln Ala Pro Val Leu Val Ile Tyr

35 40 45

Ser Asp Ser Asp Arg Pro Ser Gly Ile Pro Ala Arg Phe Ser Gly Ser

50 55 60

Asn Ser Gly Asp Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Asn Arg Ser Asp His

85 90 95

Trp Val Phe Gly Gly Gly Thr Gln Leu Thr Val Leu

100 105

<210> 38

<211> 324

<212> DNA

<213> Artificial Sequence

<400> 38

caggctgtgc tgactcagcc accctcagtg tcagtggccc caggaaagac ggccagaata 60

acctgtgggg gaaaccacat tggaagtaag agtgtgaact ggtaccagca gaagtcaggc 120

caggcccctg tgctggtcat ctattctgat agcgaccggc cctcagggat acctgcgcga 180

ttctctggct ccaactctgg ggacacggcc accctgacca tcagcagggt cgaagccggg 240

gatgaggccg actattactg tcaggtgtgg gataatcgta gtgatcattg ggtgttcggc 300

ggaggcaccc agctgaccgt cctc 324

<210> 39

<211> 8

<212> PRT

<213> Artificial Sequence

<400> 39

Gly Val Thr Val Ser Ser Asn Tyr

1 5

<210> 40

<211> 7

<212> PRT

<213> Artificial Sequence

<400> 40

Ile Tyr Pro Gly Gly Ser Thr

1 5

<210> 41

<211> 12

<212> PRT

<213> Artificial Sequence

<400> 41

Ala Arg Asp Leu Ser Glu Lys Gly Gly Met Asp Val

1 5 10

<210> 42

<211> 7

<212> PRT

<213> Artificial Sequence

<400> 42

Gln Ser Val Ser Ser Ser Tyr

1 5

<210> 43

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 43

Gly Ala Ser

1

<210> 44

<211> 9

<212> PRT

<213> Artificial Sequence

<400> 44

Gln Gln Tyr Gly Ser Ser Pro Trp Thr

1 5

<210> 45

<211> 6

<212> PRT

<213> Artificial Sequence

<400> 45

Gln Asn Val Gly Asp Phe

1 5

<210> 46

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 46

Gly Ala Thr

1

<210> 47

<211> 10

<212> PRT

<213> Artificial Sequence

<400> 47

Gln Gln Tyr Gly Thr Ser Pro Pro Ile Thr

1 5 10

<210> 48

<211> 6

<212> PRT

<213> Artificial Sequence

<400> 48

Gln Ser Val Ser Arg Phe

1 5

<210> 49

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 49

Thr Ala Ser

1

<210> 50

<211> 9

<212> PRT

<213> Artificial Sequence

<400> 50

Gln His Tyr Gly Ala Ser Pro Tyr Thr

1 5

<210> 51

<211> 7

<212> PRT

<213> Artificial Sequence

<400> 51

Gln Ser Val Ser Ser Ser Tyr

1 5

<210> 52

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 52

Gly Ala Ser

1

<210> 53

<211> 9

<212> PRT

<213> Artificial Sequence

<400> 53

Gln Gln Tyr Gly Ser Ser Pro Gly Thr

1 5

<210> 54

<211> 6

<212> PRT

<213> Artificial Sequence

<400> 54

Gln Gly Ile Ser Ser Tyr

1 5

<210> 55

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 55

Ala Ala Ser

1

<210> 56

<211> 8

<212> PRT

<213> Artificial Sequence

<400> 56

Gln Gln Leu Asn Ser Tyr Pro Arg

1 5

<210> 57

<211> 6

<212> PRT

<213> Artificial Sequence

<400> 57

His Ile Gly Ser Lys Ser

1 5

<210> 58

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 58

Ser Asp Ser

1

<210> 59

<211> 11

<212> PRT

<213> Artificial Sequence

<400> 59

Gln Val Trp Asp Asn Arg Ser Asp His Trp Val

1 5 10

<210> 60

<211> 21

<212> PRT

<213> Artificial Sequence

<400> 60

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ala Ser

20

<210> 61

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 61

acaggtgccc actcccaggt gcag 24

<210> 62

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 62

aaggtgtcca gtgtgargtg cag 23

<210> 63

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 63

cccagatggg tcctgtccca ggtgcag 27

<210> 64

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 64

caaggagtct gttccgaggt gcag 24

<210> 65

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 65

atgaggstcc cygctcagct gctgg 25

<210> 66

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 66

ctcttcctcc tgctactctg gctcccag 28

<210> 67

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 67

atttctctgt tgctctggat ctctg 25

<210> 68

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 68

ggtcctgggc ccagtctgtg ctg 23

<210> 69

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 69

ggtcctgggc ccagtctgcc ctg 23

<210> 70

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 70

gctctgtgac ctcctatgag ctg 23

<210> 71

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 71

ggtctctctc scagcytgtg ctg 23

<210> 72

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 72

gttcttgggc caattttatg ctg 23

<210> 73

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 73

ggtccaattc ycaggctgtg gtg 23

<210> 74

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 74

gagtggattc tcagactgtg gtg 23

<210> 75

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 75

tgctgtcctt gctgtcctgc t 21

<210> 76

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 76

caccagtgtg gccttgttgg cttg 24

<210> 77

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 77

tgctcgggga tccgaattct 20

<210> 78

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 78

tcgagtgcgg ccgcaagctt 20