阅读说明：本技术 产生造血干细胞的方法 (Method for producing hematopoietic stem cells ) 是由 D·I·莎 于 2019-06-07 设计创作，主要内容包括：在一些方面和实施方案中,本发明提供用于制造造血干细胞的方法、包括用于HSCT的方法。所述方法包括提供包含造血内皮(HE)或内皮细胞的细胞群体,并且在足以刺激HSC形成的条件下增加HE和/或内皮细胞中DNA(胞嘧啶-5-)-甲基转移酶3β(Dnmt3b)和/或GTP酶IMAP家族成员6(Gimap6)的活性或表达。(In some aspects and embodiments, the invention provides methods for the manufacture of hematopoietic stem cells, including methods for HSCT. The methods comprise providing a cell population comprising a Hematopoietic Endothelial (HE) or endothelial cell, and increasing the activity or expression of DNA (cytosine-5-) -methyltransferase 3 β (Dnmt3b) and/or gtpase IMAP family member 6(Gimap6) in the HE and/or endothelial cell under conditions sufficient to stimulate the formation of HSCs.)

1. A method of preparing a population of Hematopoietic Stem Cells (HSCs), the method comprising:

providing a population comprising endothelial cells and/or Hematopoietic Endothelial (HE) cells, and

increasing the activity or expression of DNA (cytosine-5-) -methyltransferase 3 β (Dnmt3b) and/or the GTPase IMAP family member 6(Gimap6) in a cell under conditions sufficient to stimulate HSC formation.

2. The method of claim 1, further comprising restoring the HSCs.

3. The method of claim 2 comprising contacting endothelial cells and/or HE cells with an effective amount of an agonist that increases the activity or expression of Dnmt3 b.

4. The method of claim 3, wherein the agonist is a mechanosensitive receptor or mechanosensitive channel.

5. The method of claim 4, wherein the mechanosensitive receptor is Piezo1.

6. The method of claim 5, wherein the Piezo1 agonist is Yoda 1.

7. The method of claim 6, wherein the effective amount of the Yoda1 agonist is in the range of 5 to 500 μ Μ, or in the range of 5 to 100 μ Μ.

8. The method of any one of claims 1 to 7, wherein increasing activity or expression of Dnmt3b comprises increasing mRNA expression of Dnmt3b, introducing a Dnmt3b transgene and/or episome, and/or introducing a genetic modification of a Dnmt3b expression element in the endothelial cells and/or HE cells.

9. The method of claim 1, wherein the endothelial cells and/or HE cells are derived from HLA-modified or HLA-null cells, and/or transgene-free cells, and the endothelial cells and/or HE cells are optionally derived by genetic or chemical induction of iPS cells or somatic cells.

10. The method of any one of claims 1 to 9, wherein the source cells are obtained or derived from a subject, wherein the subject is optionally a universal compatible donor.

11. The method of claim 10, wherein the source cell is obtained or derived from a subject having a blood, bone marrow, metabolic, or immune disease.

12. The method of claim 11, wherein the subject does not have a hematological malignancy.

13. The method of claim 10, wherein the population of HSCs is administered to a recipient.

14. The method of claim 13, wherein the source cell is derived from the recipient.

15. The method of any one of claims 1 to 14, wherein the hematopoietic stem cells comprise long-term hematopoietic stem cells (LT-HSCs).

16. The method of claim 15 further comprising providing a biomechanical stimulus to increase activity or expression of Dnmt3 b.

17. The method of any one of claims 1-16, further comprising increasing the activity or expression of Gimap6 in endothelial cells.

18. The method of claim 17, wherein increasing the activity or expression of Gimap6 comprises increasing mRNA expression of Gimap6, introducing a Gimap6 transgene, and/or introducing episomes, and/or introducing genetic modifications of a Gimap6 expression element in HE cells.

19. The method of claim 1, wherein the method comprises providing a population comprising Hematopoietic Endothelial (HE) cells to a bioreactor.

20. The method of claim 19, wherein the bioreactor provides cyclic strain biomechanical stretching.

21. The method of claim 20 wherein the cyclic strain biomechanical stretching increases activity or expression of Dnmt3 b.

22. The method of claim 20, wherein the cyclic strain biomechanical stretching increases the activity or expression of Gimap 6.

23. The method of any of claims 1 to 22, wherein the HSCs are engrafted in the hematopoietic niche and reconstituted into functional multilineage adult blood.

24. The method of any one of claims 1 to 23, wherein the HE cells are obtained from induced pluripotent stem cells (ipscs), non-hematopoietic stem cells, somatic cells, or endothelial cells.

25. A pharmaceutical composition comprising a population of HSCs prepared according to the method of any one of claims 1 to 24, and a pharmaceutically acceptable carrier.

26. The pharmaceutical composition of claim 25, comprising at least 10²And (4) cells.

27. A method of treating a subject in need of hematopoietic stem cell therapy or transplantation, the method comprising administering to the subject a therapeutically effective amount of Hematopoietic Stem Cells (HSCs) prepared according to the method of any one of claims 1 to 24 or the pharmaceutical composition of claim 25 or 26.

28. The method of claim 27, wherein the subject has a malignant or non-malignant form of a blood, bone marrow, metabolic, or immune disease.

29. The method of claim 27 or 28, wherein the subject has multiple myeloma; non-hodgkin lymphoma; hodgkin's disease; acute myeloid leukemia; neuroblastoma; germ cell tumors; autoimmune disorders (systemic lupus erythematosus (SLE) or systemic sclerosis); myelodysplastic syndrome, or amyloidosis.

30. A Hematopoietic Stem Cell (HSC) prepared according to the method of any one of claims 1 to 24, or the pharmaceutical composition of claim 25 or 26, for use in treating a subject in need of hematopoietic stem cell therapy or transplantation.

31. The HSC or pharmaceutical composition of claim 30, wherein the subject has a malignant or non-malignant form of a blood, bone marrow, metabolic, or immune disease.

32. The HSC or pharmaceutical composition of claim 30 or 31, wherein the subject has multiple myeloma; non-hodgkin lymphoma; hodgkin's disease; acute myeloid leukemia; neuroblastoma; germ cell tumors; autoimmune disorders (systemic lupus erythematosus (SLE) or systemic sclerosis); myelodysplastic syndrome, or amyloidosis.

Background

Hematopoietic Stem Cells (HSCs) are produced during embryogenesis in different regions where specific induction events convert the mesoderm into blood stem and progenitor cells. HSCs can cause both myeloid and lymphoid lineages of blood cells in a process called hematopoiesis (hematopoiesis).

HSC transplantation (HSCT) is widely used to treat patients with blood, bone marrow, metabolic, and immune diseases. Despite advances in umbilical cord and haploid-matched (haplo-identified) stem cell transplantation, the therapeutic use of HSC transplantation is often limited, particularly in countries of minority ethnic origin and lacking national unrelated donor enrollment, due to the difficulty in finding suitable Human Leukocyte Antigen (HLA) matched donors in a timely manner. Although the mixed ethnic group accounts for 1.6% of the us population (970 ten thousand), multi-ethnic volunteers account for only 3% of 700 thousands in the enrollment (21,000), making bone marrow matching impossible for 6,000 patients. Even if a proper match is found, immune system complications such as Graft Versus Host Disease (GVHD), donor rejection, and high mortality associated with treatment can compromise patient survival. However, these complications are eliminated by autografting. Although autologous HSCs will not completely replace allogeneic HSCs, especially in the case of hematologic malignancies, they will overcome the major obstacles of HSCT, including the lack of donor availability and GVHD for patients with extensive malignant and non-malignant hematologic, immunological, and metabolic abnormalities.

Thus, there is a need to generate HSCs for HSCT, including autologous HSCs.

Disclosure of Invention

The present disclosure is based, at least in part, on the following findings: biomechanical and/or pharmacological activation of mechanosensitive receptors (e.g., Piezo1) enhances expression of Dnmt3b for Hematopoietic Stem Cell (HSC) formation. As demonstrated herein, cdh 5-mutant (cdh5-MO) embryos have heartbeat-mediated pulsation in blood vessels with no cardiac output and active blood flow. Stretching from a pulsatile source activates the Piezo1 mechanosensitive channel, further enhancing the expression of Dnmt3b in the aorto-gonadal-mesorenal (AGM) region to stimulate the transition of hematopoietic endothelial cells to HSCs. The simulation of pulsatile or pharmacological activation of Piezo1 also produced three times higher amounts of HSCs that rebuilt to normal functional multilineage adult blood after serial transplantation. In some embodiments, hematopoietic stem cells produced according to the present disclosure comprise long-term hematopoietic stem cells (LT-HSCs) that exhibit superior engraftment and are reconstituted in a recipient (recipient) into functional multilineage adult blood.

In some aspects, the invention provides methods of making HSCs, the method comprising providing a population comprising endothelial cells (e.g., Hematopoietic Endothelial (HE) cells), and increasing the activity or expression of DNA (cytosine-5-) -methyltransferase 3 β (Dnmt3b) and/or gtpase IMAP family member 6(Gimap6) in the cells under conditions sufficient to stimulate HSC formation. HSCs can be reconstituted for administration to a patient.

In some embodiments, endothelial cells are contacted with an effective amount of an agonist that increases the activity or expression of Dnmt3 b. In some embodiments, the agonist is an agonist of a mechanosensitive receptor or mechanosensitive channel. In some embodiments, the mechanosensitive receptor is Piezo1. An exemplary Piezo1 agonist is Yoda 1. In some embodiments, an effective amount of a Yoda1 agonist ranges from about 5 μ Μ to about 200 μ Μ, or about 5 μ Μ to about 100 μ Μ, or in some embodiments, about 25 μ Μ to about 100 μ Μ or about 25 μ Μ to about 50 μ Μ.

Alternatively, the activity or expression of Dnmt3b can be increased directly in endothelial cells. For example, mRNA expression of Dnmt3b can be increased by delivering mRNA transcripts to the cell, or by introducing a Dnmt3b transgene and/or episome, which has one or more modifications therein to increase or modify activity. In some embodiments, gene editing is used to introduce genetic modifications to the Dnmt3b expression element in endothelial cells or HE cells, for example, to increase promoter strength, ribosome binding, or RNA stability.

In some embodiments, the invention comprises increasing the activity or expression of Gimap6 in endothelial cells, alone or in combination with Dnmt3 b. To increase the activity or expression of Gimap6, a Gimap6mRNA transcript may be introduced into the cell, or alternatively a Gimap6 transgene and/or episome may be introduced into the cell, and/or genetic modification of the Gimap6 expression element (e.g., one or more modifications to increase promoter strength, ribosome binding, or RNA stability) may be introduced.

In various embodiments, a cell population comprising endothelial cells (e.g., Hematopoietic Endothelial (HE) cells) is introduced into a bioreactor. In some embodiments, the bioreactor provides cyclic strain biomechanical stretching. Cyclic strain biomechanical stretching increases activity or expression of Dnmt3b and/or Gimap 6. For example, a computer-controlled vacuum pumping system of nylon PDMS or similar biocompatible biomimetic membrane attached to a flexible basal plate (e.g., Flexcell)^TMA tensioning system, Cytostretcher system, or similar system) may be used to apply 2D or 3D circumferential stretching ex vivo to HE cells under defined and controlled cyclic strain conditions.

In various embodiments, the HSC transition is induced by one or more selected from the group consisting of: piezo1 activation; mechanically stretching; introducing mRNA with or without a transgene (i.e., no transgene), episomes, or genetically modifying Dnmt3 b; and/or introducing mRNA, with or without a transgene (i.e., no transgene), episomes, or genetically modifying Gimap 6.

In some embodiments, the HE cells are obtained or derived from induced pluripotent stem cells (ipscs), non-hematopoietic stem cells, or somatic cells such as fibroblasts or endothelial cells. In some embodiments, the HE cell is obtained or derived from an HLA null cell, an HLA modified cell, and/or a transgene-free cell, or is obtained or derived from the genetic induction of the HE cell by endothelial cells. Hematopoietic endothelial cells (e.g., Flkl + CD45+ cells, Flkl + CD41+ cells, or CD31+ CD43+ cells) can be obtained in any manner, including from allogeneic donor-derived source cells or from a subject to be treated with HSCs (i.e., chemical, genetic, mRNA, transgene-free, or episomal induction of hematopoietic endothelial cells by autologous or allogeneic cells. In some embodiments, developmentally plastic (developmentally plastic) endothelial cells are employed.

In various embodiments, a pharmaceutical composition for cell therapy is prepared comprising a population of HSCs prepared by the methods described herein, and a pharmaceutically acceptable carrier (vehicle). The pharmaceutical composition may comprise at least about 10²An HSC, or at least about 10³An HSC, or at least about 10⁴An HSC, or at least about 10⁵An HSC, or at least about 10⁶An HSC, or at least about 10⁷An HSC, or at least 10⁸And (4) HSC. For example, in some embodiments, a pharmaceutical composition is administered that includes about 100,000 to about 400,000 HSCs per kilogram of recipient body weight (e.g., about 200,000 cells/kg).

In some embodiments, a cell therapy is prepared comprising a population of HSCs prepared by the methods described herein. In some embodiments, the cell therapy comprises a pharmaceutically acceptable carrier. The cell therapy may comprise at least about 10²An HSC, or at least about 10³An HSC, or at least about 10⁴An HSC, or at least about 10⁵An HSC, or at least about 10⁶An HSC, or at least about 10⁷An HSC, or at least 10⁸And (4) HSC. For example, in some embodiments, a pharmaceutical composition is administered that includes about 100,000 to about 400,000 HSCs per kilogram of recipient body weight (e.g.,about 200,000 cells/kg). The number of HSC cells can be adjusted according to the age and weight of the patient.

In some embodiments, HSCs for transplantation may be produced in a relatively short period of time, such as less than about two months, or less than about one month (e.g., about 4 weeks), or less than about two weeks, or less than about one week, or less than about 6 days, or less than about 5 days, or less than about 4 days, or less than about 3 days. In some embodiments, developmentally plastic endothelial or HE cells are cultured for 1 to 4 weeks with increased Dnmt3b and/or Gimap6 activity or expression.

HSCs prepared by the methods described herein are administered to a subject (recipient), e.g., by intravenous infusion or intramedary transplantation. The method may be performed according to a myeloablative, non-myeloablative or immunotoxin-based (e.g., anti-c-Kit, anti-CD 45, etc.) regulatory scheme.

The methods described herein can be used to generate populations of HSCs for use in transplantation protocols, such as treatment of hematological (malignant and non-malignant), myeloid, metabolic, and immunological diseases. In some embodiments, the HSC population is derived from autologous cells, e.g., generated from ipscs, which are generated using cells from the recipient subject. In some embodiments, the HSC population is derived from a universal compatible donor cell or an HLA-null hematopoietic endothelial cell or similar cell that contributes to becoming a normal HSC.

These and other aspects and embodiments of the invention are described by the following detailed description of the invention.

Drawings

FIG. 1A shows transgenic embryos between 26-42hpf from flk1: mCherry⁺Cd41: eGFP produced in endothelial cells⁺Time-lapse confocal images of HSCs; the data indicate that silencing of piezo1 attenuated endothelial cell to HSC conversion, whereas pharmacological activation of piezo1(Yoda1) stimulated HSC formation in control embryos and rescued HSC formation in sih-MO embryos. Each group n is 5. P<0.05vs. control;^$P<0.05 compared to sih-MO.

FIG. 1B is a heat map of differentially expressed genes in E11.5 AGM cells treated with circulating strain and Piezo1 activator (Yoda 1); indicating that circulating strain and Piezo1 activation have similar gene expression patterns in AGM during the transition from endothelial cells to hematopoietic cells. Each group n is 3.

FIG. 1C shows a graph of a hematopoietic Colony Forming Unit (CFU) assay on E11.5 AGM cells demonstrating that Yoda 1-mediated pharmacological activation of Piezo1 stimulates the conversion of endothelial cells to hematopoietic cells. Each group n is more than or equal to 6. P <0.05vs. control. Abbreviations: GEMM (granulocytes, erythroid, macrophages, megakaryocytes); GM (granulocyte macrophage); g (granulocytes); m (macrophages); e (red line).

Fig. 1D shows a plot of a hematopoietic CFU assay on E11.5 AGM cells demonstrating that GsMtX 4-mediated pharmacological inhibition of piozo 1 attenuated the induction of circulating strain on endothelial cell to HSC conversion. Each group n is more than or equal to 6. P <0.05vs. control. Abbreviations: GEMM (granulocytes, erythroid, macrophages, megakaryocytes); GM (granulocyte macrophage); g (granulocytes); m (macrophages); e (red line).

Fig. 2A shows the experimental summary (upper panel) and the line graph (lower panel). Experimental summary (upper panel) shows a schematic representation of the serial transplantation of HSCs derived from E11.5 mouse AGM after treatment with 10% circulating strain or Yoda1 to myeloablative immune-compromised mice. Line graphs (lower panel) show the percentage of reconstituted peripheral blood chimeras from E11.5 AGM (donor; trilobate equivalent) derived HSCs in primary transplants (recipients) at four week intervals between 8-16 weeks; it was shown that the circulating strain of E11.5 AGM or pharmacological activation of Piezo1(Yoda1 treatment) stimulated the formation of HSCs. N.gtoreq.5 primary recipients per group. P<0.05vs. control;^$P<0.05vs. week 8 chimera. Three embryo equivalents of (e.e.) AGM donor cells were injected in each recipient.

FIG. 2B is a graph showing E11.5 AGM (donor; three embryo equivalents) derived HSC vs. Mac1 in primary transplants (recipients) at week 16⁺Gr1⁺Bone marrow cells, Cd8⁺Cd3⁺T cells, and B220⁺Cd19⁺Graph of percent reconstitution of B cells; it was shown that the circulatory strain or pharmacological activation of E11.5 AGM by Piezo1(Yoda1) stimulates the formation of HSCs, which are reconstituted into blood. N.gtoreq.5 primary recipients per group.

FIG. 2C is a Lin showing flow sorting of primary graft (donor) sources from secondary grafts (recipients) at four week intervals between 8-12 weeks^-Sca1⁺c-Kit⁺A line plot of the percentage of reconstituted peripheral blood chimeras of HSPCs (n ═ 2000); it was shown that cyclic strain or Yoda1 treatment of E11.5 AGM produced HSCs with continuous engraftment and self-renewal capacity. N is more than or equal to 5 secondary recipients in each group. P<0.05vs. control.

FIG. 2D is a graph showing the pairing of primary transplant (donor) -derived HSC to Mac1 in secondary transplant (recipient) at week 12⁺Gr1⁺Bone marrow cells, Cd8⁺Cd3⁺T cells, and B220⁺Cd19⁺A graph of the percent of reconstitution of B cells; it is shown that the circulating strain of E11.5 AGM or Yoda1 treatment produced HSCs that could be continuously reconstituted into blood. N is more than or equal to 5 secondary recipients in each group.

Fig. 3A shows the experimental summary (top panel) and the figure (bottom panel). Experimental summary (upper panel) shows the strategy for functional and phenotypic analysis of donor-derived blood lineages in hematopoietic tissues of primary transplants (recipient mice). Panel (lower panel) shows bone marrow derived Cd71⁺Ter119⁺Percent expression of β -major (adult), ε γ (embryo), and β -H1 (embryo) types of hemoglobin in sorted (donor) erythroid cells; the data indicate that donor HSCs generated after biomechanical stretching or Yoda1 treatment of E11.5 AGM are reconstituted into erythrocytes containing adult hemoglobin. Each group n is more than or equal to 6.

FIG. 3B is a graph showing Gr1 derived from bone marrow⁺Mac1⁺Graph of overnight culture (O/N) of sorted (donor) neutrophils followed by quantification of Myeloperoxidase (MPO) protein based on ELISA; the data indicate that after biomechanical stretching or Yoda1 treatment of E11.5 AGM, donor HSCs were generated, which were reconstituted into functional myeloid lineage cells exhibiting adequate MPO levels. N in each group is more than or equal to 5.

FIG. 3C is a graph showing an ELISA analysis of pre-immune immunoglobulin (Ig) isotypes in peripheral blood of primary transplant (recipient) mice; the data indicate that primary transplantation produces B cells with an intact immunoglobulin pool. Each group n is more than or equal to 6.

FIG. 3D is an image of two photographs of a gel showing spleen sorted Cd3⁺T cells (donors) (upper panel) or Mac1⁺T Cell Receptor (TCR) of myeloid cells (donor; negative control) (lower panel)_β) Analyzing a gene locus; the data indicate that upon biomechanical stretching or Yoda1 treatment of E11.5 AGM, donor HSCs produce T cells and display T cell receptor beta (TCR β) rearrangement that moves to the spleen and reconstitutes with sufficient TCR rearrangement to rearrange TCR_βA T cell that is a functional recombination mechanism of a locus.

Fig. 3E is a dot plot showing a delayed-type hypersensitivity assay, demonstrating that primary transplant (recipient) mice reconstituted with E11.5 AGM-derived donor HSC treated with biomechanical tension or Yoda1 have a T cell-mediated immune response. Each group n is more than or equal to 6. P <0.05 compared to right sole (right foot pad) (negative control).

Fig. 4 shows a venn plot of genes up-regulated in E11.5 AGM cells treated with circulating strain and/or Yoda1 in the context of genes up-regulated during EC vs. Venn comparison of up-regulated genes commonly used in the above analysis (r.vs.. c. c.) shows that both circumferential stretch and Piezo1 activation specifically stimulate Dnmt3b transcriptional expression and Gimap6 transcriptional expression during endothelial cell to HSC transition.

FIG. 5A shows two graphs of the protein levels of Dnmt3b and Dnmt3a in the nuclear fraction of E11.5 mouse AGM cells treated with circulating strain or Yoda 1; the data indicate that circumferential stretching or Piezo1 activation specifically stimulates the level of Dnmt3b protein expression without affecting the expression of Dnmt3 a. N in each group is more than or equal to 3. P <0.05vs. control.

FIG. 5B shows a graph of hematopoietic CFU analysis of E11.5 mouse AGM cells treated with circulating strain or Yoda1 in the presence of heptamycin (Nana); the data indicate that pharmacological inhibition by Dnmt3b attenuates endothelial cell to HSC conversion by circumferential stretching or Piezo1 activation. N is more than or equal to 6 embryos per group. P<0.05vs. control;^$P<stretching at 0.05 vs;⁺P<0.05vs.Yoda1。

FIG. 5C is a graph showing transgenic embryos between 26-42hpf from flk1: mCherry⁺Produced in endothelial cellscd41:eGFP⁺A graph of time lapse confocal imaging results of HSCs; the data indicate that silencing of Dnmt3bb.1 attenuated the endothelial cell to HSC conversion stimulated by piezo1 activation, and that esculetin was more specific for Dnmt3b than for Dnmt3 a. N in each group is more than or equal to 5. P<0.05vs. control;^$P<0.05vs.Yoda1。

Detailed Description

During fetal development, a proportion of the endothelial cells in the aortic-gonadal-mesonephros (AGM) are hematopoietic endothelial cells, which change their fate to become HSCs that eventually colonize the fetal liver and bone marrow. However, the nature of the factors that stimulate hematopoietic endothelial cells remains elusive, limiting the utility of hematopoietic endothelial cells as potential sources of functional HSCs. The shear stress on the blood flow mediated endothelial lining stimulates endothelial emergence of HSCs. However, using the Cdh 5-null zebrafish and murine models, it was determined that functional HSCs still appear despite early circulation arrest. Anderson H, et al, hepatogenic stem cells devivelop in the absence of intrinsic a 5expression, Blood 2015. According to the present disclosure, these cdh 5-silenced models are used as hubs (pivots) to study the biomechanical forces independent of shear stress and/or Nitric Oxide Synthase (NOS) that trigger the appearance of functional HSCs to study other mechanisms in which impulse pressure-mediated circumferential stretching controls HSC appearance.

Attempts to generate HSCs from hematopoietic endothelial cells in the laboratory have been largely unsuccessful, in part due to a lack of understanding of the factors that stimulate HSC emergence from hematopoietic endothelial cells. It has now been determined that peripheral vascular stretching due to pulsation from a beating heart triggers the emergence of functional HSCs from hematopoietic endothelial cells, which can eventually engraft and differentiate into committed lineages. Furthermore, activation of the stretch-sensitive transient receptor potential cation channel subfamily vanilloid member 4 (Trpv 4) channel rescues HSC formation in heart-silenced (tnnt 2; sih) embryos in the absence of heartbeat and blood flow. See WO 2017/096215, the entire contents of which are incorporated herein by reference.

The present disclosure is based, at least in part, on the following findings: biomechanical and/or pharmacological activation of mechanosensitive receptors (e.g., Piezo1) enhances Dnmt3b expression for Hematopoietic Stem Cell (HSC) formation. As demonstrated herein, cdh 5-mutant (cdh5-MO) embryos have heartbeat-mediated pulsation in blood vessels with no cardiac output and active blood flow. Stretching from a pulsatile source activates the Piezo1 mechanosensitive channel, further enhancing the expression of Dnmt3b in AGM to stimulate endothelial cell to HSC transition. The simulation of pulsatile or pharmacological activation of Piezo1 also produced a threefold amount of LT-HSCs, which were reconstituted into normal, functional multilineage adult blood following serial transplantation.

Thus, the results of the present disclosure demonstrate how heartbeat-mediated biomechanical forces stimulate the transition of cell fate and stem cell formation by activating mechanosensitive channels as well as epigenetic mechanisms. Development, expansion and maintenance of stem cell characteristics of LT-HSCs are major challenges for HSC transplantation and cell therapy for the treatment of blood and bone marrow diseases. The present disclosure provides genetic and pharmacological targets for the development of LT-HSCs.

In some aspects, the invention provides methods of making HSCs, the method comprising providing a population comprising endothelial cells (e.g., HE cells), and increasing the activity or expression of DNA (cytosine-5-) -methyltransferase 3 β (Dnmt3b) and/or gtpase IMAP family member 6(Gimap6) in the endothelial cells under conditions sufficient to stimulate HSC formation. HSCs can be reconstituted for administration to a patient.

Dnmt3b (DNA (cytosine-5-) -methyltransferase 3. beta.) is a DNA methyltransferase. Dnmt3b is located mainly in the nucleus, and its expression is developmentally regulated. Gimap6 is a member of the GTP enzyme family of immune-related proteins (GIMAP). The GIMAP protein contains GTP-binding and coiled-coil motifs.

In some embodiments, endothelial cells are contacted with an effective amount of an agonist of a mechanosensitive receptor or mechanosensitive channel that increases the activity or expression of Dnmt3 b. In some embodiments, the mechanosensitive receptor is Piezo1. An exemplary Piezo1 agonist is Yoda 1.

Yoda1(2- [5- [ [ (2, 6-dichlorophenyl) methyl ] thio ] -1,3, 4-thiadiazol-2-yl ] -pyrazine) is a small molecule agonist developed for the mechanosensitive ion channel, Piezo1. Syeda R, Chemical activation of the mechanotransduction channel, 1.elife (2015). Yoda1 has the following structure:

derivatives of Yoda1 may be used in various embodiments. For example, derivatives comprising a2, 6-dichlorophenyl core are employed in some embodiments. Exemplary agonists are disclosed in Evans EL, et al, Yoda1 analoges (Dooku1), which antagonists Yoda 1-ordered activation of Piezo1 and adoptive metabolism, British J.of Pharmacology 175(1744-1759): 2018.

In some embodiments, an effective amount of a Yoda1 agonist or derivative ranges from about 5 μ Μ to about 500 μ Μ, or about 5 μ Μ to about 200 μ Μ, or about 5 μ Μ to about 100 μ Μ, or in some embodiments, about 25 μ Μ to about 150 μ Μ, or about 25 μ Μ to about 100 μ Μ, or about 25 μ Μ to about 50 μ Μ.

Alternatively, the activity or expression of Dnmt3b can be directly increased in endothelial cells or HE cells. For example, the expression of mRNA of Dnmt3b can be increased by delivering mRNA transcripts encoded by Dnmt3b to cells, or by introducing a transgene encoding Dnmt3b, or by the absence of a transgene, without limitation, by introducing episomes into cells, which can have one or more nucleotide modifications (or encoded amino acid modifications) therein to increase or modify activity. In some embodiments, gene editing is used to introduce genetic modifications to the Dnmt3b expression element in endothelial cells, thereby increasing promoter strength, ribosome binding, RNA stability, or affecting RNA splicing.

In some embodiments, the invention comprises increasing the activity or expression of Gimap6 in endothelial cells after cyclic strain or Piezo1 activation, alone or in combination with Dnmt3b and/or other modified genomes. To increase Gimap6 activity or expression, mRNA transcripts encoding Gimap6 can be introduced into cells, or transgenically null methods can be used, including but not limited to the introduction of episomes into cells; or alternatively, a transgene encoding Gimap6, which may have one or more nucleotide modifications (or amino acid modifications encoded) therein to increase or modify activity. In some embodiments, gene editing is used to introduce genetic modifications to the Gimap6 expression element in endothelial cells (e.g., one or more modifications to increase promoter strength, ribosome binding, RNA stability, or affect RNA splicing).

In some embodiments, the mRNA and/or episome(s) (e.g., encoding Dnmt3b or Gimap6) are produced synthetically, e.g., by direct chemical synthesis or in vitro transcription, and introduced into endothelial cells. Known chemical modifications can be used to avoid innate immune responses in cells. For example, synthetic RNAs containing only typical nucleotides can bind to pattern recognition receptors and can trigger an effective immune response in cells. This response can lead to translation arrest, secretion of inflammatory cytokines, and cell death. RNA containing certain atypical nucleotides can escape detection by the innate immune system and can be efficiently translated into protein. See US 9,181,319, which is incorporated herein by reference, particularly with respect to nucleotide modifications that avoid innate immune responses. The mRNA may be introduced into the cells by known methods once or periodically during HSC production.

In some embodiments, expression of Dnmt3b and/or Gimap6 is increased by introducing a transgene into the cell, which can direct a desired level of overexpression (with various promoter strengths or other selection of expression control elements). Transgenes can be introduced using a variety of viral vectors or transfection reagents known in the art. In some embodiments, expression of Dnmt3b and/or Gimap6 is increased by transgenesis-free methods (e.g., episomal delivery).

In some embodiments, gene editing techniques are used to increase the expression or activity of Dnmt3b and/or Gimap6, for example, by introducing one or more modifications to increase promoter strength, ribosome binding or RNA stability. Various editing techniques are known, including CRISPR, Zinc Fingers (ZFs), and transcription activator-like effectors (TALEs). In some embodiments, the expression or activity of Dnmt3b and/or Gimap6 is increased by transgenesis-free methods (e.g., episomal delivery). Fusion proteins comprising one or more of these DNA binding domains and a cleavage domain of a Fokl endonuclease can be used to generate double strand breaks in a desired region of DNA in a cell (see, e.g., U.S. patent application publication No. US2012/0064620, U.S. patent application publication No. US 2011/0239315, U.S. patent No. 8,470,973, U.S. patent application publication No. US 2013/0217119, U.S. patent No. 8,420,782, U.S. patent application publication No. US 2011/0301073, U.S. patent application publication No. US 2011/0145940, U.S. patent No. 8,450,471, U.S. patent No. 8,440,431, U.S. patent No. 8,440,432, and U.S. patent application publication No. 2013/0122581, the entire contents of which are incorporated herein by reference). In some embodiments, gene editing is performed using a CRISPR-associated Cas system, as known in the art. See, e.g., US 8,697,359, US 8,906,616, and US 8,999,641, which are incorporated herein by reference in their entirety.

In various embodiments, a cell population comprising developmentally plastic endothelial cells or HE cells is introduced into a bioreactor. In some embodiments, the bioreactor provides cyclic strain biomechanical stretching as described in WO 2017/096215, the entire contents of which are incorporated herein by reference. Cyclic strain biomechanical stretching increases activity or expression of Dnmt3b and/or Gimap 6. In these embodiments, the mechanical device applies a stretching force to the cells. For example, a computer-controlled vacuum pumping system of nylon or similar biocompatible biomimetic membrane attached to a flexible culture plate (e.g., FlexCell)^TMA tensioning system, Cytostretcher system, or similar system) may be used to apply 2D or 3D circumferential stretch to HE cells in vitro under defined and controlled cyclic strain conditions.

In various embodiments, the HSC transition is induced by a means selected from at least: piezo1 activates, mechanically stretches, introduces mRNA, transgene, no transgene (e.g., episome), or genetic modification to Dnmt3b, and/or introduces mRNA, transgene, no transgene (e.g., episome), or genetic modification to Gimap 6.

The HE cells can be obtained or derived from a subject having a blood, bone marrow, metabolic, or immune disease. In some embodiments, the subject is free of a hematological malignancy. The population of HSCs can be administered to a recipient. For autologous HSC transplantation, HE cells will be derived from the recipient.

In some embodiments, the HE cells are obtained or derived from induced pluripotent stem cells (ipscs), non-hematopoietic stem cells, or somatic cells, including but not limited to fibroblasts and endothelial cells. In some embodiments, the HE cell is obtained or derived from an HLA null cell, an HLA modified cell, and/or a transgene-free cell, or from the genetic induction of the HE cell by endothelial cells. Hematopoietic endothelial cells (e.g., Flkl + CD45+ cells, Flkl + CD41+ cells, or CD31+ CD43+ cells) can be obtained in any manner, including from cells of origin of an allogeneic donor or from a subject treated with HSCs. For example, HE cells can be obtained by chemically, genetically, transgenically, or episomally inducing autologous or allogeneic cells into hematopoietic endothelial cells. In some embodiments, the HE cells are produced by ipscs produced by cells of the recipient, or by HLA-modified cells, or by cells that are HLA-null cells. In some embodiments, the HE cells are obtained or derived from cells of a subject, wherein the subject is a universal compatible donor. Methods for preparing hematopoietic endothelial cells are known in the art and include production from human pluripotent stem cells. See, WO 2017/096215 and US 2019/0119643, the entire contents of which are incorporated herein by reference. See also Ditadi et al, Nature Cell biol.17(5)580-591 (2015); sugimura et al, Nature 2017; 545(7655) 432-; Nakajima-Takagi et al, blood.2013; 121(3) 447 (458); zambidis et al, blood.2008, 11.1.d; 112(9) 3601-14 and Park et al, Cytometry A.2013, 1 month; 83(1) 114-126 (human embryoid body (hEB) -based hematopoietic endothelial cell differentiation method for efficient hiPSC differentiation); choi et al, Cell rep.2012, 9 months 27; 2(3) 553-; sandler et al, 7 months and 17 days 2014; 511(17509):312-318 (endothelial cells to hematopoietic cells); see also Sluvkin, Blood 2013122: 4035-. In some embodiments, the number of HE cells that initiate HSC production is at least about 10⁶One cell, about 10⁷Individual cell, or at least10⁸And (4) cells. In some embodiments, hematopoietic stem cells produced according to the present disclosure comprise long-term hematopoietic stem cells (LT-HSCs) that exhibit excellent engraftment and are reconstituted in a recipient into functional multilineage adult blood. In some embodiments, the HSCs include Lin-/Sca1+/c-kit + cells.

In various embodiments, a pharmaceutical composition for cell therapy is prepared comprising a population of HSCs prepared by the methods described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition may comprise at least about 10²An HSC, or at least about 10³An HSC, or at least about 10⁴An HSC, or at least about 10⁵An HSC, or at least about 10⁶An HSC, or at least about 10⁷An HSC, or at least 10⁸And (4) HSC. For example, in some embodiments, a pharmaceutical composition is administered that includes about 100,000 to about 400,000 (CD34+) HSCs per kilogram of recipient body weight (e.g., about 200,000 cells/kg).

In some embodiments, HSCs for treatment or transplantation may be produced in a relatively short period of time, e.g., less than two months, or less than one month, or less than about two weeks, or less than about one week, or less than about 6 days, or less than about 5 days, or less than about 4 days, or less than about 3 days. In some embodiments, the endothelial cells are cultured with increased Dnmt3b and/or Gimap6 activity or expression for 1 to 4 weeks.

The cellular composition may further comprise a pharmaceutically acceptable carrier (carrier) or vehicle suitable for intravenous infusion or other routes of administration, and may comprise a suitable cryoprotectant. An exemplary vehicle is DMSO (e.g., about 10% DMSO). The cell composition may be provided in a unit vial or bag and stored frozen until use. In certain embodiments, the volume of the composition is from about one fluid ounce to one pint.

HSCs produced using the methods described herein are administered to a subject (recipient), e.g., by intravenous infusion or intramedullary transplantation. The methods may be performed according to myeloablative, non-myeloablative, or immunotoxin-based (e.g., anti-c-Ki, anti-CD 45, etc.) regulatory protocols.

The methods described herein can be used to generate populations of HSCs for use in transplantation protocols, such as the treatment of hematological (malignant and non-malignant), bone marrow, metabolic, and immune diseases. In some embodiments, the population of HSCs is derived from autologous cells or universal compatible donor cells or HLA-modified or HLA-null cells. That is, the HSC population is produced from HE cells derived from developmentally plastic endothelial cells or ipscs prepared from cells of the recipient subject or from donor cells (e.g., universal donor cells, HLA-matched cells, HLA-modified cells, or HLA-null cells). In some embodiments, cells of autologous origin are used, and the recipient subject has a condition selected from the group consisting of: multiple myeloma; non-hodgkin lymphoma; hodgkin's disease; acute myeloid leukemia; neuroblastoma; germ cell tumors; autoimmune disorders (systemic lupus erythematosus (SLE), systemic sclerosis); myelodysplastic syndrome, amyloidosis; or other conditions treatable using autologous HSC transplantation. In some embodiments, cells of autologous origin are used (e.g., HSCs are produced from cells from a recipient subject), and the recipient subject does not have a hematological malignancy.

In some embodiments, the recipient subject has a condition selected from the group consisting of: acute myeloid leukemia; acute lymphocytic leukemia; chronic myeloid leukemia; chronic lymphocytic leukemia; myeloproliferative diseases; myelodysplastic syndrome; multiple myeloma; non-hodgkin lymphoma; hodgkin's disease; aplastic anemia; pure red cell aplasia; paroxysmal nocturnal hemoglobinuria; fanconi anemia; severe thalassemia; sickle cell anemia; severe Combined Immunodeficiency Disease (SCID); Wiskott-Aldrich syndrome; lymphohistiocytosis with hemophagic cells; natural metabolic errors; loosening bullous epidermis; severe congenital neutropenia; Shwachman-Diamond syndrome; congenital pure red blood cell aplastic anemia; and insufficient leukocyte adhesion. In some such embodiments, allogeneic derived or universally compatible donor cells or HLA-modified or HLA-null cells are used to produce HE cells. For example, HSCs are produced from cells in a subject other than the donor subject, i.e., the recipient subject. In some embodiments, the donor subject is paired with the recipient subject based on blood type and Human Leukocyte Antigen (HLA) typing.

As used herein, the term "about" refers to ± 10% of the relevant numerical value.

These and other aspects of the invention will now be described by way of the following non-limiting examples.

Examples

During definitive hematopoiesis, a first set of HSCs are produced from hematopoietic endothelial cells in AGMs during fetal development. Thus, as long as a pool of intrinsic and extrinsic factors present in the AGM microenvironment is established, endothelial cells and/or hematopoietic endothelial cells can become a source for developing or expanding HSCs for clinical use.

Induces seven transcription factors (ERG, HOXA5, HOXA9, HOXA10, LCOR, RUNX1, and SPI1), and inhibits TGF β and CXCR7 or activates BMP and CXCR4, enhancing the conversion of human endothelial cells to HSPC. However, these methods do not confer LT-HSC function and properties on endothelial cells or hematopoietic endothelial cells. Blood flow-mediated shear stress and subsequent NOS activation are the only known biomechanical factors that cause HSC formation. However, cdh5-MO embryos produce HSC despite defects in blood flow, as well as L-NAME mediated NOS inhibition. Therefore, it is crucial to identify the biomechanical forces, mechanosensitive pathways, and epigenetic mechanisms that not only interact in regulating HSC formation, but also have utility in the development of long-term (LT), self-renewing HSCs.

The heartbeat precedes and triggers the cycle by creating a pulse in the blood vessel. However, without circulation, the direct role of heartbeat-mediated biomechanical forces from the endothelial lining of the aorta of the vessels in HSC formation is not clear. The pulsation causes biomechanical stretching of the blood vessels and activates mechanosensitive receptors such as Transient Receptor Potential (TRP) channels, Piezo channels, degenerin/epithelial sodium channels (DEG/ENaC), and members of the K1-family. However, it is not clear whether pulsatile or mechanosensitive receptor activation can stimulate HSC formation. Even though Lis et al (Lis R, et al. Conversion of adapted endothelial to immunological compositions of hematopoietic cells Nature 2017) and Sugimura et al (Sugimura et al. Haematopologic and promoter cells from human cervical cells Nature 2017) show a method of converting human hematopoietic endothelial cells to HSPC, it is not clear which mechanism can permanently eliminate their endothelial epigenetic environment to become LT-HSC.

As disclosed herein, the present disclosure demonstrates how heartbeat and/or pulsation mediated biomechanical stretching and/or pharmacological activation of the Piezo1 mechanosensitive pathway enhances Dnmt3b expression, thereby eliminating the endothelial epigenetic environment to form HSCs (e.g., LT-HSCs). In addition, a bioreactor was developed that mimics pulsatile conditions and identified Piezo1 as a pharmacological target for stimulation and expansion of LT-HSC formation.

Heartbeat-mediated pulsation stimulates the transition of endothelial cells to HSCs.

Unbiased zebrafish Ethyl Nitrosourea (ENU) mutagenesis screen generated malbec (bw 209)^mlb) A mutant of cadherin-5(cdh5, ve-cdh) from zebrafish. Despite the blood circulation deficiency, malbec and cdh5 Mutant (MO) embryos showed normal original and definitive hematopoiesis.

To identify blood flow and the biomechanical forces independent of shear stress that stimulate endothelial cell to HSC conversion, cardiac and vascular function and anatomy were analyzed in cdh 5-deficient embryos.

Microangiography was first performed by injecting fluorescent dextran beads into the atria of the two-chambered heart of zebrafish embryos, followed by tracking of the dextran beads in the circulation. While fluorescent dextran beads entered systemic circulation through the Atrioventricular (AV) valve and ventricles in control embryos, they were trapped in the atria of cdh5 mutant embryos.

To examine the structure of the heart, hearts were isolated from control and cdh5 silenced embryos and immunohistochemistry was performed on endothelial linings (gfp) and cardiomyocytes (mf 20). It was found that in the cdh5 mutant, the atria (a), Atrioventricular (AV) valve, ventricles (V), and Outflow Tract (OT) were formed, but the AV valve was elongated and deformed.

To investigate the reasons why circulation was impaired in cdh 5-silenced embryos, vascular structure was analyzed, as well as blood circulation, heart rate, cardiac output, and cardiac tamponade in cdh 5-silenced embryos.

The integrity of the endothelial lining was analyzed in mlb x kdr dsRED embryos. Both arterial and venous structures were found to be intact in cdh 5-deficient embryos.

The chronological development of heart, heart beat, blood vessels, blood circulation, and HSC formation is conserved in zebrafish, mice, and humans. During zebrafish development, the heart begins to beat approximately 23 hours after fertilization (hpf), blood circulation begins at approximately 24-26hpf, and established HSCs emerge from hematopoietic endothelial cells in the AGM region between 30-48 hpf.

To analyze the circulation of blood vessels before and after the heart started beating, time-lapse confocal imaging was performed on control and cdh5 silenced lcr: eGFP x flk1: mCherry embryos.

It was found that lcr eGFP was accumulated in blood vessels of cdh 5-silenced embryos even after the heart started beating⁺Red blood cells; it was confirmed that there was no active circulation in the cdh5 mutant despite the onset of heartbeat and the formation of blood vessels.

To examine the function of the cdh5 silenced heart in embryos, electrophysiological and echocardiographic evaluations were performed. The heart rate of cdh5-MO embryos was comparable to the control group, but stroke volume (stroke volume) of cdh5-MO embryos was almost zero. Thus, it was determined that the cardiac output (═ stroke volume X heart rate) of cdh5-MO embryos was impaired.

cdh5-MO embryos have a pericardial edema in the heart chamber, which may be due to blood backflow from the heart. Fluid accumulation in the pericardial space can lead to reduced ventricular filling and subsequent hemodynamic damage. To examine whether cardiac tamponade is a factor in the accumulation of fluid in the pericardial space, the heart cavity of a cdh5-MO embryo was punctured and the pericardial fluid was aspirated to reduce the fluid pressure build up on the heart, as in a pericardiocentesis procedure. However, insufficient cardiac output from the cdh5 mutant heart could not be rescued.

The heartbeat of the cdh5 mutant was normal, but due to structural defects in the heart, their cardiac output was impaired, resulting in an accumulation of blood in the pericardial space. Since cdh5-MO embryos have normal hematopoietic effects, it is hypothesized that the biomechanical forces of heartbeat origin affect HSC formation in the absence of active circulation.

Although cdh5-MO embryos have a beating heart and no active circulation, they form HSCs in the aortic endothelium of their vessels. When the AGM of control zebrafish embryos was amplified, a significant pulsation of the blood vessels was noted. To distinguish the presence of pulsation in a blood vessel independent of circulating blood cells and perhaps blood flow, the pulsation frequency of the blood vessel is compared to the pulsation frequency of circulating blood cells and the motion due to blood flow. Specifically, for the system disclosed in lk1: mCherry⁺Intravascular circulation lcr eGFP⁺The double transgenic lines of erythrocytes were subjected to time-lapse confocal imaging and fourier analysis of the signals from the blood vessels and circulating blood cells. The spectrum of the blood vessel was found to have distinct peaks. Thus, pulsation and blood flow in blood vessels coexist, but their presence and properties are independent of each other.

To investigate the temporal, spatial and functional presence of pulsations in AGM at 36hpf, light sheet microscopy was performed on the vascular regions of control zebrafish embryos, followed by fourier analysis. The data further demonstrate that AGM has a significant pulse frequency at 36 hpf; this is from flk1 eGFP⁺Endothelial cell-derived runx1: mCherry⁺Time and location of endothelial cell to hematopoietic cell transition observed in time-lapse confocal imaging of HSPCs. In summary, the AGM region was found to be pulsatile, and the pulsation in AGM occurs simultaneously with the endothelial cell to hematopoietic cell conversion.

The blood vessels are subjected to constant mechanical loads from the heartbeat-mediated blood pressure and flow, causing peripheral wall stress and endothelial shear stress. When blood flow exerts shear stress on endothelial cells and causes vasodilation, the heartbeat-mediated pulsation produces circumferential tension and mechanical expansion of endothelial and smooth muscle cells.

To analyze whether cdh5-MO embryos formed HSCs by or independent of NOS activation mediated by blood flow and shear stress, HSPC expression in control and cdh5-MO embryos treated with the NOS inhibitor L-NAME was analyzed. Inhibition of NOS has been shown to attenuate HSPC formation in control embryos, but not in cdh5-MO embryos. Thus, formation of HSC from cdh5-MO embryos was not associated with NOS activation.

In summary, heartbeat-mediated pulsation stimulates endothelial cell formation into HSCs, independent of circulation.

Stretch activates Piezo1 to form HSCs.

Since biomechanical forces stimulate cell shape and fate transition, it is postulated that pulsatile-mediated periodic stretching of the hematopoietic endothelium stimulates HSC formation.

To test the function of pulsing in endothelial cell to HSC formation, a bioreactor was developed that can apply a cyclic strain to AGM cells collected from E11.5 mouse embryos (fig. 2A, top panel). Colony formation and flow analysis of hematopoietic cells experiments have shown that 10% of the circulating strain enhances the formation of pluripotent hematopoietic progenitors that can be GdCl₃The general pharmacological inhibitory effect of the mediated Stretch Activated Receptor (SAR) is reduced. GdCl₃HSPC expression in zebrafish embryos was also reduced to sih-MO embryo levels.

SAR family members have four subcategories: k1-family members, as well as the Piezo, TRP, and DEG/ENaC channels. Tissue expression and computational analysis showed the presence of Piezo1 and Trpv4 in endothelial and hematopoietic tissues, thus testing their role in endothelial cell to HSC conversion.

Loss of function analysis and pharmacological inhibition of trpv4 and piezo1 abolished expression of HSPC markers and endothelial cell to HSC transitions (fig. 1A). In contrast, pharmacological activation of trpv4 or piezo1 enhanced expression of HSPC markers in control embryos and rescued HSPC expression in sih embryos. By spatiotemporal analysis, trpv4 was not detected in the AGM region of zebrafish embryos at 36hpf, whereas Piezo1 co-localized with Cd31 (endothelial cells) and c-Kit (hematopoietic cells) in E11.5 AGM.

To consolidate the molecular mechanisms underlying stretch-mediated HSC formation, a whole transcriptome analysis of AGM treated with circulating strain or a pharmacological activator of Piezo1 was performed. Cyclic strain and Piezo1 activation were found to produce similar gene signatures (fig. 1B).

Pharmacological activation of Piezo1 further enhanced the formation of pluripotent hematopoietic progenitor cells (fig. 1C), while pharmacological inhibition of Piezo1 attenuated induction of circulation-strain mediated HSPC formation (fig. 1D). In summary, cyclic strain mediated biomechanical stretching activates Piezo1 to stimulate endothelial cell to HSC conversion.

Biomechanical stretching or Piezo1 activation produced LT-HSCs.

To analyze whether cyclic strain or Piezo1 activation resulted in long-term, self-renewing HSCs (LT-HSCs), a serial transplantation analysis was performed. Primary grafts of AGM treated with cyclic strain or Piezo1 activator showed higher engraftment and normal multiline reconstruction (fig. 2A, fig. 2B). Similarly, bone marrow from primary recipients transplanted with AGM treated with circulating strain or Piezo1 activator showed Lin^-Sca1⁺c-Kit⁺Cd48^-Cd150⁺2 to 3 times higher amount of HSC. Sorted Lin from Primary recipient sources^-Sca1⁺c-Kit⁺Transplantation of HSPCs into immunocompromised secondary recipients also resulted in higher engraftment and normal multilineage reconstitution (fig. 2C, 2D). Thus, both cyclic strain and/or Piezo1 activation are predicted to produce higher amounts of normal LT-HSC. To test this hypothesis, the hypothesis is tested by classifying the amount of Lin^-Sca1⁺c-Kit⁺HSPCs were transplanted into three immunocompromised recipients for limiting dilution assays. Three transplantation analyses indicated that circulating strain produced two to three times higher amounts of LT-HSC.

To investigate whether AGM-HSCs (donors) were engrafted and reconstituted into adult normal blood, the molecular characteristics and functional properties of the reconstituted blood lineage were then analyzed in primary recipients transplanted with control, circulation strain or Piezo1 activator-treated AGM. Analysis of donor-derived erythroid cells in bone marrow in the presence of Bcl11a, at the expense of fetuin, revealed Cd71⁺/Ter119⁺And enhanced expression of adult globin markers (fig. 3A). Further bone marrow andanalysis of donor-derived myeloid lineage cells in blood serum showed sufficient amount of Gr1⁺/Mac1⁺Myeloid lineage cells, and their production of Myeloperoxidase (MPO) (fig. 3B). Next, donor-derived chimeras in lymph node, thymus, and spleen, Mac1⁺Myeloid cell, Cd19⁺B cells, and Cd4⁺/Cd8⁺Analysis of T cells demonstrated that donor HSC-derived progenitor cells circulate and colonize in the hematopoietic niche for reconstitution into adult blood lineage. When primary graft-derived blood sera were analyzed, they were also found to produce a normal pool of pre-immunized immunoglobulins (Ig) such as IgG1, IgG2a, IgG2b, IgA and IgM (fig. 3C). Donor-derived Cd3 in spleen⁺Sorting of T cells revealed T cell receptor beta (TCR β) rearrangement, which was donor-derived Mac1 in spleen⁺Absent in myeloid cells (negative control) (fig. 3D). To analyze the functional properties of T cells in primary transplants, the delayed-type hypersensitivity assay sensitized the primary transplant by injection with sheep red blood cells, demonstrating the successful recruitment of antigen-specific functional T cells in the sole of the foot (fig. 3E). Thus, circulating strain of AGM or hematopoietic endothelial cells or Piezo1 activation results in HSCs that engraft into the hematopoietic niche and reconstitute into functional multilineage adult blood.

Biomechanical stretching and Piezo1 activation up-regulated Dnmt3b, transitioning endothelial cells to HSCs.

Since AGM is a heterogeneous tissue, it is not clear how stretch-mediated Piezo1 activation stimulates aortic endothelial cell fate to HSC. Differential gene expression signatures were developed for endothelial cells, hematopoietic endothelial cells, and HSCs sorted from E10.5 AGM. Hierarchical clustering of gene signatures generated under cyclic strain of AGM or Piezo1 activation in the context of AGM-derived endothelial cells, hematopoietic endothelial cells, and HSCs also provides a quantitative overview of the biological processes of overexpression, molecular pathways, gene expression clusters, and their Gene Ontology (GO) terminology. Analysis of venn maps of cyclic stretching during endothelial cell to HSC transition and/or up-regulation of genes mediated by Piezo1 activation identified Dnmt3b as a potential candidate mechanism for silencing of endothelial mechanisms required for HSC formation (fig. 4). In addition, Gimap6 was identified as a potential candidate mechanism for silencing the endothelial mechanisms required for HSC formation.

To validate bioinformatics and computational analysis, the spatiotemporal protein expression of Dnmt3b in E11.5 AGM was analyzed. Immunohistochemical determination shows that Dnmt3b and Cd31⁺Endothelial cells and c-Kit⁺Hematopoietic cell co-localization. Thus, it is hypothesized that Dnmt3b can stimulate endothelial cell to HSC conversion.

Although Dnmt3b and Dnmt3a are highly homologous and have unique functions in HSC maintenance or differentiation, their potential role in AGM from endothelial cells to HSC is unclear. Gene signature and tissue expression analysis excluded any possibility that Dnmt3a was involved in the formation of HSCs in AGM. To distinguish between unique or overlapping hematopoiesis of Dnmt3b and Dnmt3a, protein levels of Dnmt3b and Dnmt3a were analyzed in the nuclear fraction of circulating strain or Yoda1 treated AGM cells to determine that circulating strain or Piezo1 activation stimulates Dnmt3b protein expression in E11.5 AGM cells, but not Dnmt3a protein expression (fig. 5A).

To analyze whether pulsing of blood vessels stimulated HSC formation by Dnmt3b activation in the absence of blood flow, expression of HSPC markers was determined in cdh5-MO embryos treated with the Dnmt3b inhibitor heptamycin. Pharmacological inhibition by Dnmt3b attenuated HSPC marker expression in control and cdh5-MO embryos.

Next, the experiment of this example analyzed whether biomechanical stretching or Piezo1 activation stimulated the conversion of endothelial cells to hematopoietic cells by Dnmt3b activation. Inhibition of Dnmt3B was found to attenuate induction of pluripotent hematopoietic progenitor cell formation mediated by biomechanical stretching or Piezo1 activation (fig. 5B), and endothelial cell to hematopoietic cell conversion (fig. 5B). Although the heptamycin treatment reduced the hematopoietic cells to phenotypic endothelial cells, such endothelial cells were not functional. Overall in situ hybridization of HSPC markers of zebrafish embryos treated with either Yoda1 or without Yoda1, with either heptamycin treatment or dnmt3b-MO injection, and delayed imaging of endothelial cell to HSC conversion further demonstrated that inhibition or loss of dnmt3b attenuated Piezo1 activation-mediated increases in HSC formation (FIG. 5C). In summary, pulsation-mediated Piezo1 activation enhanced the expression of Dnmt3b in AGM to stimulate endothelial cell to HSC conversion.

HSC production by HE cells produced by human iPSCs

Briefly, hiPSC colonies were dissociated with 0.05% trypsin for 5 minutes at 37 ℃, washed with PBS + 2% FBS, and then resuspended in StemPro-34(Invitrogen,10639-, StemPro-34 replacement medium of CHIR99021 (3. mu.M), bFGF (5ng/ml), and BMP4(10 ng/ml). On day 3, the medium was replaced with StemPro-34 supplemented with VEGF (15ng/ml) and bFGF (10 ng/ml). On day 6, the medium was changed to StemPro-34 supplemented with bFGF (5ng/ml), VEGF (15ng/ml), Interleukin (IL) -6(10ng/ml), IGF-1(25ng/ml), IL-11(5ng/ml), SCF (50ng/ml) and EPO (2 IU). Cells were maintained at 5% CO₂、5％O₂And 95% humidity incubator. All cytokines were purchased from Peprotech.

In order to separate CD34⁺Cells, embryoid bodies (from day 8 onwards) dissociated with 0.05% trypsin, filtered through a 70 μm filter, and CD34 isolated by CD34 magnetic bead staining⁺The cells were then passed through an LS column (Miltenyi). Each batch was tested by FACS to verify the purity of its plates. The following antibodies were used: CD34-PEcy7(Clone 581; Biolegend), FLK1-PE (CLONE # 89106; BD), and 4', 6-diamidino-2-phenylindole (DAPI).

Separating CD34⁺Cells were resuspended in StemPro-34 medium containing Y-27632 (10. mu.M), TPO (30ng/ml), IL-3(10ng/ml), SCF (50ng/ml), IL-6(10ng/ml), IL-11(5ng/ml), IGF-1(25ng/ml), VEGF (5ng/ml), bFGF (5ng/ml), BMP4(10ng/ml), and FLT3(10ng/ml) (Ferrel et al)Human 2015). Cells were seeded at a density of 50,000 cells per well in thin-layer matrigel-coated 24-well plates. One day after inoculation, Yoda1 (between 6.25 and 100 μ M) was added to the culture. After 7 days, floating cells were collected and subjected to FACS analysis. For FACS analysis, cells were stained with CD34-PEcy7(Clone 581; Biolegend) and CD45-APC (Clone 2D 1; Biolegend). All cytokines were purchased from Peprotech.

Yoda1 induced a transition from endothelial cells to hematopoietic cells in human iPSC-derived HE cells (data not shown). The effect is dose-dependent.

Conclusion

Long term HSC development, expansion, and maintenance has been the holy grail of stem cell biology and hematopoiesis. Based on time-lapse confocal, light sheet illumination, and fourier transform analysis of zebrafish, an expandable bioreactor was established to simulate not only pulsation in the blood vessels, but also pinpo 1 activation was identified as a pharmacological target for endothelial cell conversion to LT-HSC. This study provides a novel transgene-free approach to develop LT-HSCs that can be implanted, self-refreshed, and reconstituted into multi-lineage functional adult blood under serial transplantation.

The heartbeat-mediated pulsation produces circumferential tension and causes mechanical expansion of endothelial cells and smooth muscle cells. However, Piezo1 was co-expressed between endothelial cells and hematopoietic cells in E11.5 AGM, but not in vascular smooth muscle cells of the blood vessels, suggesting that biomechanical stretching and Piezo 1-activated hematopoiesis are intrinsic to AGM-endothelial cells.

Biomechanical stretching of blood vessels can activate the Piezo1, Trpv4, K1-family members, and DEG/ENaC channels. Both Piezo1 and Trpv4 activation stimulate the conversion of endothelial cells to hematopoietic cells. However, only inhibition by piozo 1 attenuated the stretch-mediated hematopoiesis, suggesting that piozo 1 and Trpv4 may have partially repetitive effects.

Dmnt3b activation silences endothelial mechanisms, conferring HSC the ability to self-renew and reconstitute multiple lineages. Although inhibition of Dnmt3b restored hematopoietic cells to phenotypic endothelial cells, these cells lacked functional endothelial cell characteristics. This suggests that the spatiotemporal role of Dnmt3b in endothelial cell to hematopoietic cell transition is irreversible. Biomechanical stretching or Piezo1 activation enhanced spatiotemporal expression of Dnmt3b without affecting the expression of Dnmt3 a. The data indicate a difference between the hematopoietic effects of Dnmt3b and the leukemic effects of Dnmt3a during HSC development and differentiation.

The findings disclosed herein demonstrate how the biomechanical forces stimulate the transition of cell fate and confer stem cell self-renewal capacity by invoking epigenetic mechanisms. This study also provides a platform for obtaining LT-HSCs from endothelial cells or hematopoietic endothelial cells derived from Pluripotent Stem Cells (PSCs) or donor cells. While our goal is to develop a universally compatible HSC, the biobiomimetic bioreactor disclosed herein is a footstone when universally compatible non-transgenic derived cells are available for treating patients with benign and malignant hematological, metabolic, immunological, and myeloid disorders.

Materials and methods

All procedures have been approved by the Animal protection and Use Committees of the Animal Care and Use Committees of Brigham and Women's Hospital and Boston's Hospital for Women in briguern and Children.

Mice Cd45.2(C57BL6/J) and Cd45.1(SJL) were purchased from the Jackson laboratory, and morpholino zebrafish (zebrafish morpholinos) were purchased from GeneTools. Microangiography was performed by injecting fluorescently labeled dextran dye into the atrium of the zebrafish heart and recording its passage by real-time imaging. Immunostaining of zebrafish heart and mouse AGM was analyzed using an inverted fluorescence microscope. Heart tamponade, heartbeat, pulse frequency in zebrafish embryos were analyzed using bright field imaging or time-lapse confocal microscopy. Delayed confocal imaging was used to analyze the movement of red blood cells in blood vessels and the endothelial cell to HSC transition in zebrafish transgenic embryos.

Conditions such as pulsatile vessels were stimulated in vitro using a Flexcell FX-4000 machine. To analyze the role of pharmacological targets in regulating the regulation of endothelial cell to HSC transition, mouse embryo-derived AGM or whole mouse embryos were exposed ex vivo to biomechanical tension, chemicals, or drugs. Next, hematopoietic colony formation assays were performed by incubating mouse AGM-derived cells in StemCell M3434 medium for 7 days. Serially transplanted AGM-derived HSCs were performed on lethally irradiated SJL mice. The stem cell frequency after biomechanical stretching was analyzed using limiting dilution assay. To characterize AGM-HSC derived blood cells in primary transplants, the percent chimerism and reconstitution was determined using FACS, globin transcripts were analyzed using quantitative reverse transcriptase-PCR, myeloperoxidase amounts were determined using picokinene ELISA kit, TCR- β rearrangement was analyzed using PCR of the TCR- β locus, pre-immune Ig detection was analyzed using Thermo-Fisher mouse Ig typing kit, and delayed type hypersensitivity was analyzed by injection of sheep rbcs in the paw of pre-sensitized mice (rockland immunochemics).

RNA sequencing analysis was performed to determine the gene expression pattern in mouse AGM treated with cyclic strain or pharmacological modulators. Using computational algorithms, differentially expressed genes are hierarchically clustered, and their biological processes and pathways over-represented are determined. Gene expression clusters of differentially expressed genes were analyzed and their average expression levels across the entire cell population were compared. Next, wien comparisons of the upper and lower genes were constructed to analyze candidate(s) important for circulating strain or pharmacological modulator-mediated endothelial cell to HSC conversion. In addition, the expression of Dnmt3b and Dnmt3a proteins in the nuclear fraction of mouse AGM cells was analyzed using the eququick assay kit. Unless otherwise stated, data are expressed as mean ± s.d. Statistical analysis was performed by paired or unpaired student t-test. Significance was set at P < 0.05.

Animal(s) production

Wild-type AB, Casper, and transgenic zebrafish lines lcr: eGFP, flk1: mCherry, flk1: eGFP, cd41: eGFP were used for the experiments. Embryos were used for up to 4 days. Cd45.2(C57BL6/J) and Cd45.1(SJL) mice from Jackson laboratories were used for the experiments.

Morpholino group

Morpholino antisense oligonucleotides (Gene Tools; sequence shown below) were obtained and injected into one-cell caster zebrafish embryos. Injected and non-injected embryos were incubated in E3 medium at 28 ℃ until fixed.

cdh5-MO(5’-TACAAGACCGTCTACCTTTCCAATC-3’；SEQ ID NO:1)

sih-MO(5’-CATGTTTGCTCTGATCTGACACGCA-3’；SEQ ID NO:2)

piezo1-MO(5’-CAAAGTTCAGTTCAGCTCACCTCAT-3’；SEQ ID NO:3)

dnmt3bb.1-MO1(5’-TTATTTCTTCCTTCCTCATCCTGTC-3’；SEQ ID NO:4)

dnmt3bb.1-MO2(5’-CTCTCATCTGAAAGAATAGCAGAGT-3’；SEQ ID NO:5)

Chemical treatment of embryos

Zebrafish embryos were treated in E3 fish medium with the following chemical regulators: 100uM L-NAME (Fisher Scientific), 50uM digoxigenin (Sigma), 25-50uM Yoda1(Cayman Chemical), 1uM heptamycin (Nana; Fisher Scientific), 100uM gadolinium chloride (GdCl)₃(ii) a Sigma),5-10uM 4 α -phorbol 12, 13-dicaprate (4 α -phorbol 12, 13-dicamote) (4 a pdd; sigma), or GSK205(10 uM).

Microangiography

Fluorochrome-labeled dextran beads were injected into the atria of control and cdh5-MO embryos and real-time bright field video was captured using a Nikkon SMZ1500 stereomicroscope.

Heart rate and cardiac output

Images of live zebrafish hearts were acquired on an axioplan (zeiss) vertical microscope with a5 x objective using integrated incandescent lamp illumination and a FastCam-PCI high speed digital camera (photon) with a 512 x 480 pixel grayscale image sensor. The images were acquired at 250 frames per second, in each case 1088 frames (' 8 cardiac cycles). Heart rate was determined from the sequential image file using custom software (implemented in MATLAB). For each video, the diastolic and systolic ventricular long and short axes were measured manually using ImageJ and used to estimate the ventricular volume using standard geometric assumptions. For at least ten embryos per morpholino dose, cardiac output is measured as diastolic ventricular volume minus systolic ventricular volume, multiplied by the heart rate (Shin et al, 2010).

Periodic analysis

Zebrafish Casper embryos were embedded in 0.8% low melting point agarose containing tricaine (Sigma) and fixed in petri dishes. Next, real-time brightfield video of the arterial vessels in the AGM region was captured using a Nikon SMZ1500 stereomicroscope equipped with NIS Elements (Nikon) software. Video is used to quantify the pulse frequency in the blood vessel.

Bright field real time imaging

For brightfield real-time imaging, zebrafish Casper embryos were embedded in 0.8% low melting point agarose containing tricaine (Sigma) and fixed in petri dishes. Real-time brightfield video and still images were captured using a Nikon SMZ1500 stereo microscope equipped with NIS Elements (Nikon) software.

Confocal microscope

Cd41: eGFP was fused to flk1: mCherry zebrafish and flk1: mCherry zebrafish with lcr: eGFP and their transgenic embryos injected with morpholinos. Transgenic embryos were placed in low melting agarose and paired from 30 to 42hpf using a rotating disk confocal microscope with flk1⁺Endothelial cell-derived cd41 eGFP⁺HSC were time-lapse confocal imaged. At flk1: mCherry⁺Analysis of endothelial cells in background lcr eGFP⁺Relative movement of red blood cells. We performed image analysis using imaris (biplane) software.

Whole in situ hybridization

Bulk in situ hybridization was performed as described previously.

Heart tamponade

A microneedle was used at 48hpf to pierce the pericardial sac and release fluid accumulated around the heart of the cdh 5-MO-injected zebrafish embryo.

Immunostaining

E10.5 chimeric mouse embryos were harvested, embedded in paraffin blocks, sectioned transversely, and immunostained with primary anti-Piezo 1 (rabbit anti-mouse IgG; Abcam), Cd31 (donkey anti-mouse IgG; R & D Systems), c-Kit (rabbit anti-mouse IgG; R & D Systems), or Dnmt3b (donkey anti-mouse IgG; Abcam) and 4,6 diamidino-2-phenylindole (DAPI) antibodies, as well as secondary antibodies Alexa Fluor 488 (donkey anti-rabbit IgG; Fisher Scientific) and Alexa Fluor 647 (donkey anti-goat IgG; Abcam) to detect their expression in the E10.5 AGM region.

Expression of flk1(GFP), mf2(mCherry), and DAPI (violet) was determined in hearts isolated from control and cdh5-MO silenced zebrafish embryos.

AGM explants

E11.5 AGM was harvested from C57BL6/J Cd45.2 mouse embryos and a three-embryo equivalent single cell suspension was inoculated into each well of a BioFlex six-well plate (Flexcell). We applied cyclic strain: (FX-4000^TMTonicity system) and/or with chemical regulators (25-50. mu.M Yoda1, 1. mu.M heptamycin, 100. mu.M Gdcl₃1uM GsMTx4, 5-20 μ M4 α PDD, 10uM GSK205) and cultured the cells overnight. Next, the harvested cells were used for transplantation, Fluorescence Activated Cell Sorting (FACS) analysis, and Colony Forming Unit (CFU) assay.

In vitro incubation of drugs with embryos

E11.5 mouse embryos were obtained from the uterus of regularly mated pregnant females and placed in sterile glass vials containing FBS, 1mM glucose, 1% penicillin-streptomycin, and/or selected chemical modifiers (25-50. mu.M Yoda1, 1. mu.M heptamycin, 5-20. mu.M 4. alpha. PDD, or 10. mu.M GSK 205). We placed the glass vials in a separate incubator (BTC Engineering, Cambridge, UK) with a constant gas supply (21% 0) from a roller device (rotating to-30 rpm)₂、5％CO₂The balance being N₂) And constant temperature of 37 ℃. After 24 hours, AGM was harvested to analyze the formation of hematopoietic cells by FACS and CFU assays.

Transplantation

For primary transplantation, three embryo equivalents of untreated or treated (circulating strain or 25 μ M Yoda1) AGM plus spleen helper cells (approximately 500,000 per mouse) were injected retro-orbitally into cd45.1(SJL) mice irradiated with a lethal dose of radiation (split dose of 10.5 cGy). For secondary and tertiary transplants, bone marrow was isolated from transplanted mice(legs, arms, pelvis, spine, sternum). Loading bone marrow into a Ficoll gradient (-1083, Sigma-Aldrich) and incubating the cells of the buffy coat with biotin-binding lineage antibodies and streptavidin microbeads (Miltenyi Biotec). Next, lineage negative (Lin) was isolated using a MACS LS chromatography column (Miltenyi Biotec)^-) Cells and donor Cd45.2 Lin sorted using a MoFlo Beckman Coulter sorter^-Sca1⁺c-Kit⁺(LSK) cells. Subsequently, sorted cd45.2 LSK cells were mixed with cd45.1 spleen helper cells (approximately 500,000 per mouse) and transplanted by retroorbital injection into cd45.1 irradiated (10.5 cGy split dose) SJL mice.

Surviving recipients were counted as responses to limiting dilution assays: from the poisson distribution, a confidence interval of 1/(stem cell frequency) was calculated from ELDA.

CFU and FACS assays

For CFU assays, cells from AGM explants or ex vivo were seeded in MethoCult GF M3434 medium (StemCell Technologies). 7 days after inoculation, we analyzed them for their ability to form colonies of granulocytes, erythroid, macrophages, megakaryocytes (GEMM), Granulocytic Macrophages (GM), granulocytes (G), macrophages (M), and erythroid (E).

AGM cells from explants and ex vivo were stained with Sca1-Pacific-Blue (E13-161.7, Biolegend) and Flk1-APC-Cy7(Avas 12. alpha.1, BD). The blood of the transplanted mice was stained with the following antibody cocktail: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Cd3-PE (145-2C11, Biolegend), Cd8-PE (53-6.7, Biolegend), Mac1-APC (M1/70, Biolegend), Gr1-APC (108412, Biolegend), Cd19-APC-CY7(6D5, Biolegend), B220-APC-CY7(RA3-6B2, Biolegend).

Cells from bone marrow, spleen, thymus, and lymph nodes of E11.5 AGM cell-transplanted mice were stained with the following antibody groups: bone marrow LT-HSC Cd45.2-FITC (104, Biolegend), Ter 119-biotin (TER-119BD), Gr 1-biotin (RB6-8C5, BD), Cd 5-biotin (53-7.3, BD), Cd8 a-biotin (53-6.7, BD), B220-biotin (RA3-6B2, BD), streptavidin-Pacific Blue (eBioscience), Sca1-PE-CY7(D7, eBioscience), cKit-APC (2B8, eBioscience), Cd48-APC-CY7(HM48-1, BD), Cd150-PE-CY5(TC15-12F12.2, Biolegend). Erythroid development in bone marrow RI-RV: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Ter119-APC (TER-119, Biolegend), Cd71-PE (R17217, eBioscience). Bone marrow granulocytes: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Gr1-PE, (RB6-8C5, BD); mac1-APC (M1/70, Biolegend). Spleen, thymus and lymph node T cells: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Cd8-PE (53-6.7, Biolegend), Cd4-APC (RM4-5, eBioscience). Spleen, thymus and lymph node bone marrow and B cells: Cd45.2-Pacific-Blue (104, Biolegend), Cd45.1-FITC (A20, Biolegend), Cd19-APC-CY7(6D5, Biolegend), Mac1-APC (M1/70, Biolegend). We performed all FACS analyses on a BD Fortessa cytometer. After 16 weeks of transplantation, we performed hematopoietic organ analysis.

Quantitative reverse transcriptase-polymerase chain reaction analysis (qRT-PCR)

FACS was used to sort erythroid precursors (Cd45.2) from undissolved bone marrow isolated from AGM-transplanted mice⁺,Ter119⁺,Cd71⁺). Total RNA was isolated using RNAeasy Minikit (QIAGEN) and cDNA synthesis was performed using Superscript III (Invitrogen). Real-time quantitative PCR was performed using SYBR Green (QuantaBio) on MX3000P machine with the indicated primers (Sankaran et al, 2009). We normalized the expression to glyceraldehyde-3-phosphate dehydrogenase (Gapdh) (Ochida et al, 2010).

Myeloperoxidase (MPO) expression

Mixing neutrophils (Cd45.2)⁺,Gr1⁺,Mac1⁺) FACS sorting was performed from isolated bone marrow of primary 16-week-old transplanted mice and cultured overnight (500,000 cells/mL) in IMDM with 10% FBS in 24-well plates. The supernatant was collected and used with mouse MPO/myeloperoxidase PicoKine^TMELISA kit (Boster) was used to determine MPO concentration. MPO concentration in blood serum was also determined.

PCR assay for TCR-beta rearrangement

T cells (Cd45.2)⁺,Cd3⁺) And myeloid cells (Cd45.2)⁺,Mac1⁺) FACS sorting was performed from splenocytes from 16 week primary transplanted mice. Next, genomic DNA was extracted and PCR was performed on the DH β 2.1-JH β 2.7 rearrangement in the TCR- β locus. Our samples were denatured (94 ℃,1 min), annealed (63 ℃,2 min), and extended (72 ℃,2 min) for 35 cycles. The primer sequences are as follows: 5' of DH β 2.1: 5'-GTAGGCACCTGTGGGGAAGAAACT-3', respectively; 6 of SEQ ID NO, and 3' of JH β 2.7: 5' TGAGAGCTGTCTCCTACTATCGATT; SEQ ID NO:7(Lu et al, 2017).

Pre-immune Ig detection

Blood serum was isolated from 16 week primary transplanted mice and the preimmune Ig isotypes were quantified by mouse Ig typing kit (Thermo Fisher).

Delayed type hypersensitivity reaction

Sheep red blood cells (sRBC, 10) were administered by subcutaneous (lower back) and intradermal injection (right paw)⁹Individual cells/mL, 50 μ L per site, Rockland Immunochemicals) sensitized the transplanted mice. Six days after sensitization, 2X10 in the left sole⁹Pre-sensitized mice (as controls) were challenged with an equal volume of PBS per sRBC/mL and in the right paw. After 48 hours of excitation, the thickness of the sole was measured with a micrometer caliper. We normalized the pre-excitation thickness of each sole to a percentage change on day 6.

DNA methyltransferase expression

Nuclear extracts from AGM explants were harvested using the EpiQuik nuclear extraction kit (Epigentek Group Inc.). Dnmt3b and Dnmt3a protein levels were analyzed using a colorimetric EpiQuik assay kit (Epigenek Group Inc.) according to the manufacturer's instructions. The concentrations of Dnmt3b and Dnmt3a were relative to 1. mu.g of nuclear extract protein.

RNAseq and computational analysis

Total RNA was isolated in E11.5 mouse AGM explant cultures (control, stretch, Yoda1 and 4. alpha. PDD cases) using RNAeasy MiniKit (QIAGEN). Our cDNA library was generated by BGI Americas Corporation and sequenced using HiSeq4000 equipment (Illumina), with eight samples per lane. We mapped the sequenced read fragments to the mouse reference genome GRCm38(ENSEMBL version 69) using the genomic short read nucleotide alignment program (2012-07-20). DESeq2 and DEXSeq were used to test differential expression (FDR ═ 0.1) and the use of differential exons, respectively. Gene expression clusters of differentially expressed genes were analyzed and their average expression levels across the entire cell population were compared. Next, wien comparisons were made for the upper and lower genes to analyze candidate(s) important for circulating strain or pharmacological modulator-mediated endothelial cell to HSC conversion. Specifically, we use the gplotts package in R (R Development Core Team, 2012) (Warners et al, 2017) for hierarchical clustering by bootstrap analysis. For GO analysis, we tested our overexpression of differentially expressed genes on GO classes or pathways using Fisher's exact test, and corrected multiple trials using the Bonferroni method. We performed the GO term enrichment analysis as described previously, using a P value of 0.001 as the minimum with statistically significant enrichment.

Statistical analysis

Data are presented as mean ± standard error of mean (mean ± SEM) unless otherwise indicated. Statistical analysis was performed by paired or unpaired student t-test. Significance was set at P < 0.05.