Antibody activity modification and screening method thereof

文档序号：842183 发布日期：2021-04-02 浏览：1206次中文

阅读说明：本技术 抗体活性改造及其筛选方法 (Antibody activity modification and screening method thereof ) 是由李福彬赵英杰刘小波张燕石欢张慧慧于 2020-09-21 设计创作，主要内容包括：本发明公开了一种抗体的激动活性的改造方法,包括对所述抗体的重链恒定区进行修饰,以提高或者降低所述抗体的柔性,从而分别获得激动活性降低和提高的抗体。该方法简单便捷,可以通过改造获得激动活性增强或降低的抗体,以适应不同类别抗体的需要,具有广泛的应用前景。(The invention discloses a method for modifying the agonistic activity of an antibody, which comprises modifying a heavy chain constant region of the antibody to increase or decrease the flexibility of the antibody, thereby obtaining an antibody with decreased agonistic activity and increased agonistic activity, respectively. The method is simple and convenient, can obtain the antibody with enhanced or reduced agonistic activity by modification so as to adapt to the requirements of different types of antibodies, and has wide application prospect.)

1. A method of modulating antibody flexibility or modulating antibody agonistic activity comprising mutating the upper and/or middle hinge domain of the CH1 hinge region, said mutation altering the number and/or proportion of less sterically hindered amino acids in the upper and/or middle hinge domain of the hinge region, or altering the length of the upper and/or middle hinge domain.

2. The method of claim 1, wherein said method is a method of up-regulating antibody flexibility or down-regulating antibody agonistic activity, said mutation(s) increasing the number and/or proportion of less sterically hindered amino acids in the upper and/or middle hinge domain of the CH1 hinge region, or increasing the length of the upper and/or middle hinge domain,

preferably, the mutation is selected from one or more of (1) insertion of 1,2, 5 or at least 6 less hindered amino acids in the upper hinge domain, (2) deletion of more hindered amino acids from the upper and/or middle hinge domain, (3) mutation of more hindered amino acids in the upper and/or middle hinge domain to less hindered amino acids; wherein the less sterically hindered amino acid is selected from the group consisting of: glycine (G), alanine (a), serine (S), valine (V), threonine (T), isoleucine (I), leucine (L); the sterically hindered amino acid is selected from proline (P), hydroxyproline (O), asparagine (N), aspartic acid (D), pyroglutamic acid (U), glutamine (Q), lysine (K), glutamic acid (E), methionine (M), histidine (H), phenylalanine (F), arginine (R), tyrosine (Y), tryptophan (W),

more preferably still, the first and second liquid crystal compositions are,

item (1) is the insertion of 1,2, 5 or at least 6 less hindered amino acids, preferably said at least 6 are 6, 12 or 18, at least after the 1 st, at least 2, at least 3 rd, at least 4 th or at least 5 th amino acid from the N-terminus of the upper hinge domain or between the upper hinge domain and the middle hinge domain,

item (2) is a deletion of the more sterically hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the C-terminus of the upper and/or middle hinge domain,

item (3) includes mutations of the upper and/or middle hinge domains to the corresponding regions of IgG3 or mIgG2a, or mutations of the hinge region to the hinge region of IgG3 or mIgG2a, or mutations of the CH 1-hinge region to the CH 1-hinge region of IgG3 or mIgG2 a.

3. The method of claim 2, wherein the insertion of item (1) is an insertion of 1,2, 5 or at least 6 amino acids selected from the group consisting of G and S,

preferably, the item(1) Is inserted between the upper hinge domain and the middle hinge domain with G, GS, SG, GSGSGSG, SGSGS, GGGGS, GGGSG, GGSGG, GSGGG, SGGGG, GSGSG, GSSGG, GGSSG, GSGGS, GGSGS, GGGSS, SGGSG, SGSGSGSGG, SSGGG, SGGGS, SGS, SGGSS, SSGGS, SGSSG, SSGSG, SSGGG, GSSGS, GSSGSSS, GGSSS, GSSSSG, GSSSS, SGSSSS, SSSS, SSGS GSS, SSSG, or (GSGSGS)_nWherein_nIs 1,2 or 3.

4. The method of claim 1, wherein the method is a method of down-regulating antibody flexibility or up-regulating antibody agonistic activity, wherein the mutation reduces the number and/or proportion of less sterically hindered amino acids in the upper hinge domain of the CH1 hinge region, or reduces the length of the upper hinge domain,

preferably, the mutation is selected from one or more of (1) insertion of 3 or 4 less hindered amino acids in the upper hinge domain (2) deletion of less hindered amino acids from the upper and/or middle hinge domain, (3) mutation of less hindered amino acids in the upper and/or middle hinge domain to more hindered amino acids, (4) insertion of more hindered amino acids in the upper and/or middle hinge domain; wherein the less sterically hindered amino acid is selected from the group consisting of: glycine (G), alanine (a), serine (S), valine (V), threonine (T), isoleucine (I), leucine (L); the sterically hindered amino acid is selected from proline (P), hydroxyproline (O), asparagine (N), aspartic acid (D), pyroglutamic acid (U), glutamine (Q), lysine (K), glutamic acid (E), methionine (M), histidine (H), phenylalanine (F), arginine (R), tyrosine (Y), tryptophan (W),

more preferably still, the first and second liquid crystal compositions are,

item (1) is an insertion of 3 or 4 less hindered amino acids after at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the N-terminus of the upper hinge domain or between the upper hinge domain and the middle hinge domain,

item (2) is a deletion of a less hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the C-terminus of the upper and/or middle hinge domain,

item (3) includes the mutation of the upper and/or middle hinge domain to the corresponding region of IgG1, IgG2 or IgA2, or the mutation of the hinge region to the hinge region of IgG1, IgG2 or IgA2, or the mutation of the CH 1-hinge region to the CH 1-hinge region of IgG1, IgG2 or IgA2,

item (4) is at least 1, at least 2, at least 3, e.g., 1 to 20, 1 to 15, or 1 to 10 amino acids having a larger steric hindrance inserted between the upper hinge domain and the middle hinge domain or after at least 1, at least 2, at least 3, at least 4, or at least 5 amino acids from the N-terminus of the upper hinge domain.

5. The method according to claim 4, wherein the insertion in item (1) is an insertion of 3 or 4 amino acids selected from the group consisting of G and S,

preferably, item (1) is the insertion of GSG, GGS, SGG, GSS, SGS, SGG, GGGS, GGSG, GSGG, SGGG, GGSs, GSGs, SGGs, GSSG, SSSG, SSGS, SGSs or GSSs between the upper hinge domain and the middle hinge domain.

6. The method of claim 2 or 3,

the antibody is an agonistic antibody, and/or

The antibody after mutation has a flexibility greater than or equal to IgG3, and/or

Mutations to the antibody do not significantly reduce the affinity of the antibody for the antigen it specifically targets, and/or

The radius of gyration (Rg) of the antibody after mutation is larger thanAnd/or

The antibody is a human antibody, a chimeric antibody or a humanized antibody.

7. The method of claim 4 or 5,

the antibody is an agonistic antibody, and/or

The antibody after mutation is not more flexible than human IgG1, and/or

Mutations to the antibody do not significantly reduce the affinity of the antibody for the antigen it specifically targets, and/or

The radius of gyration (Rg) of the antibody after mutation isPreferably isOr Rg smaller than human IgG1, and/or

The antibody is a human, chimeric or humanized antibody, and/or

The antibody specifically recognizes a receptor in the TNF receptor superfamily, and/or

The antibody is an anti-CD 40 antibody or an anti-DR 5 antibody.

8. A method for screening for agonistic activity of an antibody, comprising the steps of:

1) providing an agonistic antibody as a parent, and providing a variant of the parent in which a CH 1-hinge region is modified on the basis of the parent, wherein an antibody in which the CH 1-hinge region of the parent is replaced with a CH 1-hinge region of human IgG1 is referred to as a human IgG1 variant;

2) detecting the flexibility of the female parent and the variant;

3) according to the flexibility detection result, antibodies with flexibility not higher than that of the human IgG1 variant are screened from all the agonist antibodies, and the antibodies have better agonist activity.

Preferably, the step 2) includes:

2.1) providing an antigen capable of specifically binding to the antigen-binding portion of the agonist antibody;

2.2) respectively labeling the antigens with a pair of donor fluorescent molecules and acceptor fluorescent molecules capable of realizing fluorescence resonance energy transfer to obtain donor fluorescent labeled antigens and acceptor fluorescent labeled antigens;

2.3) adding the donor fluorescent labeled antigen and the acceptor fluorescent labeled antigen into the agonist antibody respectively;

and 2.4) exciting the donor fluorescent molecules, and detecting fluorescent signals emitted by the donor fluorescent molecules and fluorescent signals emitted by the acceptor fluorescent molecules, wherein the ratio of the fluorescent signal intensities is in positive correlation with the flexibility degree of the excited antibody.

Preferably, the step 2) includes:

2.1) detecting any one or more of the following parameters of the antibody parent and the variant by using a small angle X-ray scattering method: radius of gyration (Rg), dimensional Kratky plots (or Kratky plots) characteristics, P (R)/I (0) (or P (R)) distribution, P (R)/I (0) (or P (R)) large size distribution, radius of gyration (Rg) calculated by EOM method, maximum interatomic distance (Dmax) distribution calculated by EOM method, Rflex or R σ value calculated by EOM method;

2.2) the larger the gyration radius (Rg), the higher the degree of raising of a Dimensionless Kratky plots (or Kratky plots), the wider the gyration radius (Rg) and the maximum interatomic distance (Dmax) distribution calculated by an EOM method, and the larger the numerical values of Rflex and R sigma, the stronger the antibody flexibility; conversely, the less flexible the antibody.

9. A method for detecting the flexibility of a biological macromolecule is characterized by comprising the following steps:

1) providing the biological macromolecule;

2) providing two epitope recognition molecules capable of specifically binding to two separate epitopes of said biomacromolecule, respectively;

3) respectively labeling donor fluorescent molecules and acceptor fluorescent molecules with two epitope recognition molecules, wherein the donor fluorescent molecules and the acceptor fluorescent molecules are matched with each other and can realize fluorescence resonance energy transfer;

4) mixing the two marked epitope recognition molecules with the biological macromolecules;

5) exciting the donor fluorescent molecule, detecting a fluorescent signal emitted by the acceptor fluorescent molecule, wherein the intensity of the fluorescent signal is in positive correlation with the flexibility degree of the antibody,

preferably, the biomacromolecule is a protein, a nucleic acid, a lipid molecule, a carbohydrate molecule or a complex formed by combining them,

preferably, the donor fluorescent molecule is Tb, and the acceptor fluorescent molecule paired therewith is selected from any one of D2, XL665, fluoroscein, GFP, Lucifer yellow, Acridine yellow, Proflavine, Atto465, nitrobenoxadizole, Courmarin 6, Alexa750, Cy7, Nile red, Alexa488, Dy490, Dy648, Dy647, Oregon green, Atto488, Atto495, Alexa514, Atto520, Cy2, Rhodamine6G, Alexa700, Alexa680, Atto532, Alexa532, APC, EGFP, YFP, mPlum, Atto425, Alexa430, Courmarin 343, Acridine Orange, teramine, metalformaldehyde 101, suflorine, Dy55, Dy 0557, Dy55, Dy55, Atto 57, mex 27, mex 75, mex 548, mex 75, mex 87, mex 87, mex 3, mex 87, mex 75, mex 3, mex 3, me; alternatively, the donor fluorescent molecule is Eu, and the acceptor fluorescent molecule paired with Eu is selected from any one of APC, D2, XL665, fluoroscein, GFP, Rhodamine6G, tetramethylrhododamine, sulfofordine 101, mercyanine 540, Atto565, Cy3, atto550cy3.5, Dy547, Dy548, Dy549, Dy554, Dy555, Dy556, Dy560, mCherry, mStrawberry, Alexa680, Alexa700, Alexa750, Alexa647, Cy5, Cy5.5, Cy7, Dy647, Dy648, Atto 590.

10. An antibody flexible detection method, comprising the steps of: detecting the antibody by using a small angle X-ray scattering method, wherein the antibody comprises any one or more of the following parameters: radius of gyration (Rg), dimensional Kratky plots (or Kratky plots) characteristics, P (R)/I (0) (or P (R)) distribution, P (R)/I (0) (or P (R)) large size distribution, radius of gyration (Rg) calculated by EOM method, maximum interatomic distance (Dmax) distribution calculated by EOM method, Rflex or R σ value calculated by EOM method; wherein the antibody having one or more characteristics selected from (1) a radius of gyration (Rg) greater than that of IgG1, (2) a radius of gyration (Rg) calculated by EOM method greater than that of IgG1, (3) this parameter that Rflex is greater than IgG1, and (4) R σ is greater than that of IgG1 is a flexible antibody.

Technical Field

The invention relates to the field of biological pharmacy, in particular to a method for modifying and screening the activity of an agonistic antibody or molecule.

Background

The development of biomacromolecule drugs has provided new approaches and possibilities for the treatment of a variety of diseases, particularly antibody and heavy chain constant region (including Fc fragment) -based molecular targeted therapies, including antibody and heavy chain constant region fusion proteins, with great success in the biopharmaceutical field for over thirty years and continuing to be the focus of the field. The basis of all biomacromolecule drugs is their structural characteristics, and it is these characteristics that enable them to specifically bind to biologically active molecules and affect biological processes (e.g., immune responses). Therefore, analyzing the structural characteristics of the biomacromolecule and establishing the relationship with the function of the biomacromolecule have important significance for drug research and development.

In the mode of action, biological macromolecules can be mainly classified into three categories: effector molecules that clear targets (molecules and cells), blocking molecules that block signaling pathways in which targets participate, and agonist molecules that activate signaling pathways downstream of targets. The tumor immunotherapy has made an important breakthrough in recent years. This is facilitated by the use of antibodies that enhance immune cell activity to kill tumors by blocking immunosuppressive nodes. However, there are still a large number of cancer patients who do not respond to the available treatments. Therefore, on the one hand, the existing tumor immunotherapy means needs to be optimized; on the other hand, the development of new tumor immunotherapy drugs is urgently needed. It is particularly pointed out that there is a class of tumor immunotherapy approaches called "agonistic antibodies" that can enhance the anti-tumor immune response by binding to the target molecules of immune cell surface transmission immune activation signals and activating the important immune activation signal pathways controlled thereby to indirectly kill tumor cells. However, although agonist tumor immunotherapy antibodies have demonstrated great potential in animal models and have become a widely accepted and appreciated concept for tumor immunotherapy, the development of such antibodies has not been successful to date and is currently a major challenge in the field of tumor immunotherapy. In addition, activation of the agonist antibody is also a favorable means for intervening and regulating key signal pathways of other biological processes, and has wide application prospects in the fields of disease prevention and control and treatment. For example, activation of immunosuppressive signaling pathways, may be beneficial in reducing inflammatory and autoimmune symptoms.

Disclosure of Invention

The invention mainly provides a method for modifying the agonistic activity of an antibody, which is mainly characterized in that the flexibility of the antibody is modified so as to enable the antibody to have different agonistic activities.

The invention provides a method for improving the agonistic activity of an agonistic antibody, wherein the heavy chain constant region of the agonistic antibody is modified to reduce the flexibility of the agonistic antibody.

In some embodiments, the agonistic antibody is not more flexible than human IgG1 after modification.

In some preferred embodiments, the CH 1-hinge region in the heavy chain constant region is modified, preferably by replacing the hinge region in the heavy chain constant region with a less flexible sequence, more preferably the sequence is that of the hinge region of human IgA 2.

In some preferred embodiments, the modification to the antibody does not significantly reduce the affinity of the antibody for the antigen it specifically targets.

In other preferred embodiments, the Fc region of the heavy chain constant region is further modified to increase the affinity of the agonistic antibody to fcyriib or the I/a ratio of the agonistic antibody.

In other preferred embodiments, the radius of gyration (Rg) of the agonistic antibody after modification isPreferably isOr Rg smaller than IgG1 (e.g., human IgG 1).

In other preferred embodiments, the antibody specifically recognizes a receptor in the TNF receptor superfamily; or the antibody is an anti-CD 40 antibody or an anti-DR 5 antibody.

The invention also provides a method for reducing the agonistic activity of an antibody, wherein the heavy chain constant region of the agonistic antibody is modified to improve the flexibility of the antibody. Preferably, the flexibility of the agonist antibody after modification is greater than or equal to IgG 3.

In some embodiments, the CH 1-hinge region in the heavy chain constant region is modified, preferably by inserting a flexible linker sequence into the CH 1-hinge region, preferably the flexible linker sequence is a flexible linker sequence comprising G, S, more preferably the flexible linker sequence is GSGSGS or other flexible linker sequence comprising G, S, or by replacing the CH 1-hinge region with the CH 1-hinge region of human IgG3 to increase the flexibility of the agonist antibody.

In some embodiments, the modification to the antibody does not significantly reduce the affinity of the antibody for the antigen to which it is specifically targeted.

In some preferred embodiments, the radius of gyration (Rg) of the agonistic antibody after modification is greater than

In other preferred embodiments, the Fc region of the heavy chain constant region is further modified to reduce the affinity of the agonistic antibody and fcyriib or the I/a ratio of the agonistic antibody.

In other preferred embodiments, the antibody is a human antibody, a chimeric antibody, or a humanized antibody.

The invention also provides a screening method of the agonistic activity of the antibody, which comprises the following steps:

2) detecting the flexibility of the female parent and the variant;

In some embodiments, the screening method further comprises detecting the affinity of the female parent and the variant with fcyriib and/or the I/a ratio of the agonistic antibody, comparing the detection results, and screening out antibodies with fcyriib affinity and I/a ratio not lower than that of the human IgG1 variant, which have better agonistic activity.

Preferably, the step 2) includes:

1) providing an antigen capable of specifically binding to the antigen-binding portion of the agonist antibody;

2) respectively labeling the antigens with a pair of donor fluorescent molecules and acceptor fluorescent molecules capable of realizing fluorescence resonance energy transfer to obtain donor fluorescent labeled antigens and acceptor fluorescent labeled antigens;

3) adding the donor fluorescent labeled antigen and the acceptor fluorescent labeled antigen into the agonist antibody respectively;

4) and exciting the donor fluorescent molecule, and detecting a fluorescent signal emitted by the acceptor fluorescent molecule, wherein the intensity of the fluorescent signal is in positive correlation with the flexibility degree of the excited antibody.

More preferably, the step 2) comprises:

1) detecting any one or more of the following parameters of the antibody parent and variant by small angle X-ray scattering: radius of gyration (Rg), dimensional Kratky plots (or Kratky plots) characteristics, P (R)/I (0) (or P (R)) distribution, P (R)/I (0) (or P (R)) large-size distribution, radius of gyration (Rg) calculated by EOM method, maximum interatomic distance (Dmax) distribution calculated by EOM method, Rflex or R sigma value calculated by EOM method;

2) the larger the gyration radius (Rg), the higher the rising degree of a Dimensionless Kratky plots (or Kratky plots), the wider the distribution of the gyration radius (Rg) and the maximum interatomic distance (Dmax) calculated by the EOM method, the larger the numerical values of Rflex and R sigma, and the stronger the antibody flexibility; conversely, the less flexible the antibody.

The invention also provides a detection method of the flexibility of the biomacromolecule, which comprises the following steps:

1) providing said biological macromolecules, preferably said biological macromolecules being proteins, nucleic acids, lipid molecules, carbohydrate molecules or complexes thereof bound to each other;

2) providing two epitope recognition molecules capable of specifically binding to two separate epitopes of said biomacromolecule, respectively;

4) mixing the two marked epitope recognition molecules with the biological macromolecules;

5) and exciting the donor fluorescent molecule, and detecting a fluorescent signal emitted by the acceptor fluorescent molecule, wherein the intensity of the fluorescent signal is in positive correlation with the flexibility degree of the antibody.

Preferably, the biomacromolecule exists in a conformation in which the distance between the two separate epitopes is between R0 and 2R0 of the donor and ligand fluorescent molecules.

Preferably, the distance between two individual epitopes of the biomacromolecule is likely to be between R0 and 2R0 of the donor and ligand fluorescent molecules.

In some embodiments, the biomacromolecule is an antibody, the epitope is an antigen binding site of the antibody, and the epitope recognition molecule is an antigen.

In some preferred embodiments, the donor fluorescent molecule is Tb, and the acceptor fluorescent molecule to which it is paired is selected from any one of D2, XL665, Fluorescein, GFP, Lucifer yellow, Acridine yellow, Proflavine, Atto465, nitrobenoxadizole, courrin 6, Alexa750, Cy7, Nile red, Alexa488, Dy495, Dy490, Dy648, Dy647, Oregon green, Atto488, Atto495, Alexa514, Atto520, Cy2, Rhodamine6G, Alexa700, Alexa680, Atto532, Alexa532, APC, EGFP, YFP, Dy lum, Atto425, Alexa430, Coumarin 343, Acridine Orange aland, tetramethamine, suforhode 101, Dy yellow 57, Att 55, Atto 57, Atto 35, Att 27, alberto 3, alberto 548, alberto 57, albedo 550, albedo 55, Dy55, Att 550, albedor 55, albedo 55, alborone, atzo 35, atno 35, atzo 548, atno 35, atzo lawy 2, atzo 1, atzo, at; alternatively, the donor fluorescent molecule is Eu, and the acceptor fluorescent molecule paired with Eu is selected from any one of APC, D2, XL665, fluoroscein, GFP, Rhodamine6G, tetramethylrhododamine, sulfofordamine 101, mercyanine 540, Atto565, Cy3, atto550cell 3.5, Dy547, Dy548, Dy549, Dy554, Dy555, Dy556, Dy560, mCherry, mStrawberry, Alexa680, Alexa700, Alexa750, Alexa647, Cy5, cell 5.5, Cy7, Dy647, Dy648, Atto 590.

The invention also provides a method of modulating antibody flexibility or modulating antibody agonistic activity comprising mutating the upper hinge domain of the hinge region. The mutation alters the number and/or proportion of less sterically hindered amino acids in the upper hinge domain of the hinge region, or alters the length of the upper hinge domain.

In one or more embodiments, the antibody is a human, chimeric, or humanized antibody.

In one or more embodiments, the antibody is an anti-CD 40 antibody or an anti-DR 5 antibody.

In some embodiments, the method is a method of up-regulating antibody flexibility or down-regulating antibody agonistic activity, the mutation increasing the number and/or proportion of less sterically hindered amino acids in the upper and/or middle hinge domains of the hinge region, or increasing the length of the upper and/or middle hinge domains.

In one or more embodiments, the mutation is selected from one or more of (1) insertion of 1,2, 5, or at least 6 less hindered amino acids in the upper hinge domain, (2) deletion of more sterically hindered amino acids from the upper and/or middle hinge domain, and (3) mutation of more sterically hindered amino acids to less sterically hindered amino acids in the upper and/or middle hinge domain.

In one or more embodiments, the less hindered amino acid is selected from: glycine (G), alanine (a), serine (S), valine (V), threonine (T), isoleucine (I), leucine (L). Preferably, the less sterically hindered amino acid is selected from G or S.

In one or more embodiments, the more sterically hindered amino acids include aromatic amino acids and heterocyclyl amino acids.

In one or more embodiments, the more sterically hindered amino acid is selected from the group consisting of proline (P), hydroxyproline (O), asparagine (N), aspartic acid (D), pyroglutamic acid (U), glutamine (Q), lysine (K), glutamic acid (E), methionine (M), histidine (H), phenylalanine (F), arginine (R), tyrosine (Y), tryptophan (W).

In one or more embodiments, (1) is the insertion of 1,2, 5, or at least 6 less hindered amino acids after at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th, or at least the 5 th amino acid from the N-terminus of the upper hinge domain, or between the upper hinge domain and the middle hinge domain.

In one or more embodiments, the insertion in (1) is insertion of 1,2, 5, or at least 6 amino acids selected from G and S.

Preferably, (1) is the insertion of G, GS, SG, GSGSGSG, SGSGSGS, GGGGS, GGGSG, GGSGG, GSGGG, SGGGG, GSGSGSG, GSSGG, GGSSG, GSGGS, GGSGS, GGGSS, SGGSG, SGSGSGG, SSGGG, SGGGS, SGSGSGS, SGGSS, SSGGS, SGSSG, SSGSG, SSGGG, SSSGGG, GSSGSSGS, GSSSSS, GGSSS, GSSSS, SGSSS, SSSS GS, SSSGSG, or (GSGSGSGSGSS)_nWherein n is 1,2 or 3.

In one or more embodiments, the at least 6 of (1) is 6, 12, or 18.

In one or more embodiments, (2) is the deletion of the more sterically hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the C-terminus of the upper and/or middle hinge domain.

In one or more embodiments, (3) comprises mutating the upper and/or middle hinge domain to the corresponding region of IgG3 or mIgG2a, or the hinge region to the hinge region of IgG3 or mIgG2a, or the CH 1-hinge region to the CH1 hinge region of IgG3 or mIgG2 a. The amino acid sequences of the above regions are shown in FIG. 15.

In one or more embodiments, the flexibility of the mutated antibody is greater than or equivalent to the flexibility of IgG 3.

In some embodiments, the mutation to the antibody does not significantly reduce the affinity of the antibody for the antigen to which it is specifically targeted.

In some preferred embodiments, the radius of gyration (Rg) of the agonistic antibody after mutation is greater than

In other preferred embodiments, the Fc region of the heavy chain constant region is further mutated to reduce the affinity of the agonistic antibody and fcyriib or the I/a ratio of the agonistic antibody.

In other embodiments, the method is a method of down-regulating antibody flexibility or up-regulating antibody agonistic activity, the mutation reducing the number and/or proportion of less sterically hindered amino acids in the upper and/or middle hinge domains of the hinge region, or reducing the length of the upper and/or middle hinge domains.

In one or more embodiments, the mutation is selected from one or more of (1) the insertion of a less hindered amino acid in the upper hinge domain by 3 or 4, (2) the deletion of a less hindered amino acid from the upper and/or middle hinge domain, (3) the mutation of a less hindered amino acid in the upper and/or middle hinge domain to a more hindered amino acid, and (4) the insertion of a more hindered amino acid in the upper and/or middle hinge domain.

In one or more embodiments, (1) is the insertion of 3 or 4 less blocked amino acids after at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the N-terminus of the upper hinge domain or between the upper hinge domain and the middle hinge domain.

In one or more embodiments, the insertion in (1) is insertion of 3 or 4 amino acids selected from G and S.

Preferably, (1) is the insertion of GSG, (GGS, SGG, GSS, SGS, SGG, GGGS, GGSG, GSGG, SGGG, GGSs, GSGs, SGGs, GSSG, SSGG, SGSG, SSSG, SSGS, SGSs or GSSs between the upper hinge domain and the middle hinge domain.

In one or more embodiments, (2) is the deletion of the less sterically hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the C-terminus of the upper and/or middle hinge domain.

In one or more embodiments, (3) comprises mutating the upper and/or middle hinge domain to the corresponding region of IgG1, IgG2 or IgA2, or the hinge region to the hinge region of IgG1, IgG2 or IgA2, or the CH 1-hinge region to the CH 1-hinge region of IgG1, IgG2 or IgA 2. The amino acid sequences of the above regions are shown in FIG. 15.

In one or more embodiments, the antibody specifically recognizes a receptor in the TNF receptor superfamily; or the antibody is an anti-CD 40 antibody or an anti-DR 5 antibody.

In one or more embodiments, (4) is the insertion of at least 1, at least 2, at least 3, e.g., 1-20, 1-15, or 1-10, more sterically bulky amino acids after at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th, or at least the 5 th amino acid from the N-terminus of the upper and/or middle hinge domain, or between the upper hinge domain and the middle hinge domain.

In one or more embodiments, the flexibility of the mutated antibody does not exceed the flexibility of human IgG 1.

In some preferred embodiments, the mutation to the antibody does not significantly reduce the affinity of the antibody for the antigen to which it is specifically targeted.

In other preferred embodiments, the Fc region of the heavy chain constant region is further mutated to increase the affinity of the agonistic antibody for fcyriib or the I/a ratio of the agonistic antibody.

In other preferred embodiments, the radius of gyration (Rg) of the agonistic antibody after mutation isPreferably isOr Rg smaller than IgG1 (e.g., human IgG 1).

The invention also provides an antibody flexible detection method, which comprises the following steps: detecting the antibody by using a small-angle X-ray scattering method, wherein the antibody comprises any one or more of the following parameters: radius of gyration (Rg), dimensional Kratky plots (or Kratky plots) characteristics, P (R)/I (0) (or P (R)) distribution, P (R)/I (0) (or P (R)) large size distribution, radius of gyration (Rg) calculated by EOM method, maximum interatomic distance (Dmax) distribution calculated by EOM method, Rflex or R σ value calculated by EOM method; wherein the antibody having one or more characteristics selected from (1) a radius of gyration (Rg) greater than that of IgG1, (2) a radius of gyration (Rg) calculated by EOM method greater than that of IgG1, (3) this parameter that Rflex is greater than IgG1, and (4) R σ is greater than that of IgG1 is a flexible antibody.

In one or more embodiments, the features of IgG1 described above are shown in the second column of fig. 6.

The invention has the beneficial effects that: by using the method provided by the invention, the flexibility characteristics of the antibody and other protein molecules can be analyzed more quickly; by using the method provided by the invention, an antibody modification form with obviously weakened or disappeared agonistic activity can be obtained on the basis of the maternal antibody; by using the method provided by the invention, the antibody modified form with obviously enhanced agonistic activity can be obtained on the basis of the maternal antibody.

Drawings

FIG. 1 is a schematic diagram of an antibody structure.

FIG. 2. schematic representation of the flexibility of TR-FRET assays

The human IgG2 CH 1-hinge has excellent rigidity. a. A schematic diagram of TR-FRET detection of anti-murine CD40 antibodies is shown. The anti-mouse CD40 antibody molecule mixed with CD40-Tb, CD40-D2 (the mouse-derived CD40 molecule labels the fluorescent lanthanides Tb and D2 respectively) binds to CD40-Tb and CD40-D2 at the same time, emits a TR-FRET signal, and is quantified by the relative proportion of 665nm fluorescence to 620nm fluorescence (Em665/Em620) detected after stimulation. b. Model plots showing that hinge flexibility of hIgG anti-mCD 40 antibody is directly proportional to TR-FRET signal level. On the left, anti-murine CD40 antibody with little hinge flexibility does not trigger TR-FRET signal due to the larger distance between CD40-Tb and CD 40-D2; in the middle, the flexibility of the hinge can make CD40-Tb and CD40-D2 close enough to trigger TR-FRET signal; to the right, the anti-murine CD40 antibody with large hinge flexibility produced a stronger TR-FRET signal because more molecules had a closer CD40 binding site.

FIG. 3 Crystal Structure of full Length antibody

Crystal structures of full-length human IgG1(PDB:1HZH, left) and IgG4(PDB:5DK3, right). The distance between the two antigen binding sites of the two antibodies was calculated by PyMOL software as the distance between the vertices of the respective heavy chain CDRs 3 (W100 site of 1HZH, F103 site of 5D 3K). The figure shows that the distance between two antigen binding sites of the IgG antibody crystal conformation exceeds 12 nm.

FIG. 4TR-FRET assay flexibility results

a-c TR-FRET signal level of the corresponding constant domain anti-murine CD40 antibody. The relative TR-FRET signal levels (Em665/Em620) are shown for each concentration of control IgG or anti-murine CD40 antibody of the corresponding constant domain. Bars represent mean ± SEM. P is not more than 0.05, p is not more than 0.01, p is not more than 0.001, p is not more than 0.0001, analyzed by the analysis method of two-way ANOVA with Holm-Sidak's post hoc.

FIG. 5SAXS analysis of Flexible results

The IgG3 CH 1-hinge is highly flexible. a-f Dimensionless Kratky plots (a, c, e) and normalized interatomic distance distribution (P (R)/I (0)) (b, d, f) of anti-murine CD40 antibodies (values of highest detected concentration) for the corresponding constant domains. In the Dimensionless (Dimensionless) Kratky diagram, the position of the Guinier-Kratky point (√ 3, 1.103) is marked with a black dashed line. g-l distribution of Rg (g, i, k) and Dmax (h, j, l) in the optimized set generated in the EOM analysis of the indicated antibodies (values of lowest detected concentration).

FIG. 6SAXS analysis Flexible results (data)

IgG2 and 3 are the most rigid and most flexible subtypes, respectively, of the human IgG1-3 antibody. IgG3 antibodies also had larger Rg and Dmax values (related to mean and maximum interatomic distance, respectively) compared to IgG1 and 2 antibodies. The V11 variant with the CH 1-hinge of human IgG1-3 antibody has similar Rg and Dmax distribution characteristics and R distribution characteristics as human IgG1-3 antibody, respectively_flexAnd R_σAnd (6) ranking. The different SAXS profiles as well as the parameters of IgG2 and 3 antibodies can be largely transformed with their CH 1-hinge.

FIG. 7 relationship between murine IgG antibody agonism and hinge flexibility

(a) Murine IgG antibody flexibility was detected by the SAXS method, and Dimensionless Kratky spots analysis showed that mIgG2a had greater flexibility than mIgG1, and hinge region flexibility was transferred with hinge region replacement. (b-c) the more flexible IgG2a agonism in the OT1 system is the weakest, the more rigid IgG1 agonism is the strongest, and IgG2a agonism is transferred to the chimeric antibody IgG1H2a by hinge region exchange. In 8-week-old C57B6/L WT mice, treated with 5ug DEC-OVA205 with 30ug control or 1C10 anti-mCD 40 chimeric antibody, respectively, using the OVA-specific CD8+ T cell response model, were found to have a specific OT1 cell count (B) and a specific CD8+ OT1 cell percentage (C) in spleen cells.

FIG. 8 insertion of the amino acid sequence in the hinge region was able to disrupt the IgG2 flexibility (IgG2 vs IgG2(GS)₃vs IgG2(GS)₆vs IgG2(GS)₉TR-FRET result of (1)

The data of TR-FRET experiments show that the flexibility of the hinge region variants G2GS3, G2GS6 and G2GS9 is gradually higher along with the increase of the length of the connecting sequence by inserting the connecting sequence GS into the hinge region of IgG 2.

FIG. 9 insertion of the amino acid sequence in the hinge region was able to disrupt the IgG2 flexibility (IgG2 vs IgG2(GS)₃vs IgG2(GS)₆vs IgG2(GS)₉SAXS results of

SAXS experimental data show that the insertion of the linker sequence GS in the hinge region of IgG2, hinge region variants G2GS3, G2GS6, G2GS9 become increasingly flexible with increasing linker sequence length. (a) Dimesionless Kratky analysis of the hinge region variant SAXS of hIgG 2. Increasing linker length gradually enhances antibody flexibility. (b) Molecules with greater flexibility generally adopt a more extended conformation, which can be assessed by analyzing the normalized distribution of interatomic distances (R) within macromolecules, as evidenced by the P (R)/I (0), P (R)/I (0) (or P (R)) distribution of the hIgG2 hinge region variant SAXS, with increasing linker length progressively enhancing antibody flexibility.

FIG. 10 disruption of IgG2 flexibility by insertion of amino acid sequences in the hinge region affected agonistic activity (IgG2 vs IgG2(GS)₃vs IgG2(GS)₆vs IgG2(GS)₉In vivo Activity data of

The hinge region variants G2GS3, G2GS6, G2GS9 in the OT1 system were inactive. (a-b) in the hFCGRTg mouse model, the number (a) and percentage (b) of cells of CD8+ OT1 specific cells in spleen cells were analyzed using OVA specific CD8+ T cell response model, inducing mice with 2ug DEC-OVA205 with 10ug control or 1C10 anti-mCD 40 antibody, respectively.

FIG. 11 changes in hinge region amino acid sequence can reduce IgG antibody flexibility and affect antibody agonistic activity (IgG 1vs IgG1-A2, and other examples of reduced flexibility)

(a) The data from the TR-FRET experiments show that the IgG1-A2 variant (G1A2) produced after replacing the hinge region of human IgG1 with the hinge region of IgA2 has reduced flexibility. (b) SAXS experimental data direct Kratky spots analysis showed that the IgG1a2 variant was less flexible (more rigid).

FIG. 12 modification of hinge region amino acid sequence to enhance IgG antibody flexibility can affect antibody agonistic activity (IgG 1vs IgG1-A2, example of enhancing activity)

Use of OVA-specific CD8⁺T cell response model, Fc γ R human mice were adoptively transferred OT-1 cells on day 1, DEC-OVA and control or anti-CD 40 antibody were co-immunized intraperitoneally on day 2, splenocytes collected on day 7 for quantification of OVA-specific CD8⁺T cells. Treatment and analysis of OT-1 Fine in Fc γ R-humanized mice as describedQuantification of cells and control or anti-mouse CD40 antibody to the indicated constant domain (30 μ g per mouse). Each symbol represents an individual mouse. Bars represent mean ± SEM. And p is less than or equal to 0.01, p is less than or equal to 0.001, p is less than or equal to 0.0001, and the analysis method is performed by two-way ANOVA with Holm-Sidak's post hoc. As shown, the G1A2 antibody treated animals had more antigen-specific OT-1 cell expansion (a, b) and CD8 cell expansion (c).

FIG. 13 different antibodies have different optimal antibody flexibility requirements ((a): 1C10: V11H2> V11H1> V11H3 activity data; (b): MD5-1: V11H1> V11H2> V11H3 activity data)

FIG. 14 insertions in the hinge region of amino acids other than multiples of 3-4 abolish IgG2 agonistic activity (in vivo activity data for IgG2 vs IgG2V1vs IgG2V2 vs IgG2V3 vs IgG2V4 vs IgG2V5G vs IgG2V 6)

(a) The 1C10 clone anti-CD 40 antibody stimulated spleen cells of Fc gamma R humanized mice in vitro, and the results showed that a hinge region variant with an insertion of amino acids other than 3-4 fold of the hinge region of IgG2 lost activity. (b) The anti-DR 5 antibody cloned MD5-1 stimulated MC38 tumor cells co-cultured with spleen cells of Fc γ R humanized mice in vitro, and showed that a hinge region variant with an insertion of amino acids other than a multiple of 3-4 in the V11H2 hinge region was inactivated.

FIG. 15 sequence listing of various hinges

CH1 is CH1 for the heavy chain constant region, UH is the upper hinge domain of the hinge region, MH is the middle hinge domain of the hinge region, and LH is the lower hinge domain of the hinge region.

Detailed Description

Unless defined otherwise, scientific and technical terms used herein shall have the meanings that are commonly understood by those of ordinary skill in the art. Furthermore, unless otherwise required herein, singular terms shall include the plural, and plural terms shall include the singular. Generally, the nomenclature involved in, and the techniques of, cell and tissue culture, molecular biology, immunology, and protein and nucleic acid chemistry described herein are those known and commonly used in the art.

The methods and techniques of the present invention are generally performed according to conventional methods known in the art and are described in various general and more specific references that are extracted and discussed in this specification, unless otherwise specified. See, for example: molecular Cloning by Sambrook et al: a Laboratory Manual, 2 nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)) and Current Protocols in Molecular Biology of Ausubel et al (Greene Publishing Associates (1992)), and Antibodies of Harlow and Lane: a Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990)), the contents of which are incorporated herein by reference. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions and can generally be performed according to methods known in the art or according to the methods described herein. Nomenclature related to analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry described herein, and experimental methods and techniques, are those well known and commonly used in the art. Standard techniques are used for chemosynthesis, chemical analysis, pharmaceutical preparation, formulation and drug delivery, and for patient treatment.

Unless otherwise indicated, the following terms have the following definitions:

an "antibody" (Ab) shall include, but is not limited to, a glycoprotein immunoglobulin that specifically binds an antigen and includes at least two heavy (H) chains and two light (L) chains, or antigen-binding portions thereof, interconnected by disulfide bonds. Each H chain comprises a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.

The antibody "heavy chain constant region", also known as CDs, comprises three domains, CH1, CH2 and CH3, and a hinge region located between the CH1 domain and the CH2 domain. Each light chain comprises a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region consists of one domain CL. The VH and VL regions can be further subdivided into regions of high denaturation, called Complementarity Determining Regions (CDRs), interspersed with regions that are more conserved, called Framework Regions (FRs). Each VH and VL consists of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR 4. The variable regions of the heavy and light chains comprise binding domains that interact with an antigen.

The term "hinge region" means the portion of the heavy chain constant region that connects the CH1 domain with the CH2 domain. The hinge region comprises about 25 residues and is flexible, allowing the 2N-terminal antigen-binding regions to move independently. The hinge region can be subdivided into 3 distinct domains: upper, middle and lower hinge domains (Roux et al (1998) J. Immunol.161: 4083). Altered antibody molecules have been prepared in which the number of cysteine residues in the hinge region has been increased to promote the formation of a fixed conformation of the antibody molecule, increasing the immunomodulatory activity of agonist antibodies (patent No. WO2015145360a 1).

"Fc region" (crystallizable fragment region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates binding of an immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or to the first component of the classical complement system (C1 q). Thus, an Fc region is a polypeptide that constitutes part of the constant region of a heavy chain of an (completing) antibody, except for the immunoglobulin domain of the first constant region. In IgG, IgA and IgD antibody isotypes, the Fc region is composed of two identical protein fragments from the second (CH2) and third (CH2) constant domains of the two heavy chains of an antibody; the Fc region of IgM and IgE comprises three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. For IgG, the Fc region comprises the immunoglobulin domains C γ 2 and C γ 3 and the hinge between C γ 1 and C γ 2. Although the boundaries of the Fc region of an immunoglobulin heavy chain may vary, the human IgG heavy chain Fc region is generally defined as the stretch of sequence from the amino acid residue at heavy chain position C226 or P230 to the carboxy-terminal end, where the numbering is according to the EU index, as in Kabat. The CH2 domain of the human IgG Fc region extends from about amino acid 231 to about amino acid 340, while the CH3 domain is located C-terminal to the CH2 domain of the Fc region, i.e., it extends from about amino acid 341 to about amino acid 447 of IgG. As used herein, an Fc region can be a native sequence Fc or a variant Fc. Fc may also refer to this region in an isolated state, or in a protein polypeptide comprising Fc, such as a "binding protein comprising an Fc region," also known as an "Fc fusion protein" (e.g., an antibody or immunoadhesin).

An "Fc receptor" or "FcR" is a receptor that binds the Fc region of an immunoglobulin. FcR binding to IgG antibodies include receptors of the Fc γ R family, including allelic variants and alternatively spliced forms of these receptors. The human Fc γ receptor family includes several members: fc γ RI (CD64), Fc γ RIIA (CD32a), Fc γ RIIB (CD32b), Fc γ RIIIA (CD16a), Fc γ RIIIB (CD16 b). Among them, Fc γ RIIB is the only inhibitory Fc γ receptor, and others are all activating Fc γ receptors. Most natural effector cell types co-express one or more activating Fc γ R and inhibitory Fc γ RIIB, while Natural Killer (NK) cells selectively express one activating Fc γ receptor (Fc γ RIII in mice, Fc γ RIIIA in humans), but do not express inhibitory Fc γ RIIB in mice and humans. These Fc γ receptors differ in their molecular structure and therefore have different affinities for the respective IgG antibody subclasses. Among these Fc γ receptors, Fc γ RI is a high affinity receptor, while Fc γ RIIA, Fc γ RIIB, and Fc γ RIIIA are low affinity receptors. Genetic polymorphisms are also present in these different Fc γ receptors and affect their binding affinity. The most common genetic polymorphisms are polymorphic forms of R131/H131 of Fc γ RIIA and V158/F158 of Fc γ RIIIA. Some of these polymorphic forms have been found to be associated with a variety of diseases, and the efficacy of certain therapeutic antibodies also depends on whether the patient carries a particular polymorphic form of the Fc γ receptor gene.

The amino acid numbers of the antibody of the invention, fragments thereof or domains thereof are based on the IgG Eu number.

The term "antigen binding site" refers to the amino acid residues of an antibody that are responsible for antigen binding. The antigen binding site of an antibody comprises amino acid residues from a "complementarity determining region" or "CDR". The "framework" or "FR" regions are those variable region regions that are not hypervariable region residues as defined herein. Thus, the light and heavy chain variable domains of an antibody comprise, from N-terminus to C-terminus, the regions FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR 4. In particular, the CDR3 of the heavy chain is the region that is most conducive to antigen binding and defines antibody performance. CDRs and FRs are determined according to the standard definition of the sequences of Proteins of Immunological Interest, 5 th edition, Public Health Service, National Institutes of Health, Bethesda, MD (1991) and/or residues from "hypervariable loops" in SEQ ID NO, Kabat et al.

Antibodies typically bind specifically to their cognate antigen with high affinity (likewise, the proteins of the invention may also bind specifically to their epitope recognition molecules), which is shown as 10^-5-10^-11M or less dissociation constant (KD). Any greater than about 10^- ⁴M^-1KD of (a) is generally considered to indicate non-specific binding. As used herein, an antibody that "specifically binds" to an antigen refers to an antibody that binds with high affinity to the antigen and substantially the same antigen, meaning a KD of 10^-7M or less, preferably 10^-8M or less, even more preferably 5X 10^-9M or less, most preferably 10^-8-10^-10M or less, but does not bind to unrelated antigens with high affinity. An antigen is "substantially identical" to a given antigen if it exhibits a high degree of sequence identity to the given antigen, for example, if it exhibits at least 80%, at least 90%, preferably at least 95%, more preferably at least 97%, or even more preferably at least 99% sequence identity to the sequence of the given antigen.

The immunoglobulin may be from any commonly known isotype. IgG isotypes can be subdivided into subclasses in certain species: IgG1, IgG2, IgG3 and IgG4 in humans, IgG1, IgG2a, IgG2b and IgG3 in mice. "isotype" refers to the class of antibodies (e.g., IgM or IgG1) encoded by the heavy chain constant region gene. "antibody" includes, for example, naturally occurring and non-naturally occurring antibodies; monoclonal and polyclonal antibodies; chimeric and humanized antibodies; a human or non-human antibody; fully synthesizing an antibody; and single chain antibodies.

An "agonist antibody" is an antibody that binds to and activates a receptor, and a functional example of an agonist antibody is binding to a receptor in the Tumor Necrosis Factor Receptor (TNFR) superfamily and inducing apoptosis of cells expressing TNF receptors. Assays for determining the induction of apoptosis are described in WO98/51793 and WO99/37684, both of which are specifically incorporated herein by reference. In a specific embodiment of the invention, the anti-CD 40 agonist antibody can enhance the anti-tumor immune response to kill tumor cells indirectly by binding to the target molecules of immune cells surface-transmitted immune activation signals and activating the important immune activation signal pathways controlled by the target molecules. Some examples of agonistic antibodies that have entered the clinical study stage may be found in patent PCT/CN 2017/087620.

"agonistic activity" refers to the activity of inducing changes in specific physiological activities by binding an antibody to an antigen molecule, triggering the antigen molecule to generate a signal. Antigenic molecules include receptor molecules and other molecules with signaling or physiological functions. Such specific physiological activities include, for example: proliferation activity, survival activity, differentiation activity, transcription activity, membrane transport activity, binding activity, proteolytic activity, phosphorylation/dephosphorylation activity, redox activity, transfer activity, nucleolytic activity, dehydration activity, cell death-inducing activity, apoptosis-inducing activity, and the like, but not limited thereto. The agonistic activity described herein is not limited to agonistic antibodies. In some embodiments, a decrease in agonistic activity may enhance other activities of the antibody, such as inhibitory activity.

"female parent" refers to the object of alteration during the protein alteration process. In some embodiments, the female parent is an unmodified antibody.

"variant" refers to a protein obtained from a parent that has been modified during protein engineering. In particular proteins which are derived by mutation, deletion and/or addition of the parent amino acid and which retain some or all of the function inherent in the parent.

"modification" refers to the phenomenon of altering the structure and/or function of a protein by the introduction and/or removal of chemical groups (including amino acids or fragments of amino acids, unnatural amino acids, sugar groups, acetyl groups, etc.). The "modification" of the antibody or the fragment thereof according to the present invention includes mutation, deletion, side chain modification (e.g., glycosylation, acetylation, etc.) and/or insertion of additional amino acids, etc., of the amino acids in the antibody or the fragment thereof.

"flexibility" refers to the ability to have (intra) molecular mobility, and in the present invention primarily refers to the structural variability of proteins. As used herein, when a hinge region is "flexible," it is meant that the two N-terminal antigen-binding regions to which it is attached can move independently. Also, the degree of flexibility of an antibody is described herein in terms of "flexible" meaning that the antibody is highly flexible and "stiff" meaning that the antibody is less flexible. The flexibility of the biomacromolecule can be detected by the flexible detection method provided by the invention, and particularly, the small-angle X-ray scattering method or the TR-FRET method provided by the invention can be adopted for detection.

In this patent, the variants generally have poorer agonistic activity when they are more flexible than the parent; the variants generally have better agonistic activity when they are less flexible than the mother. However, the optimal value or range of optimal values for flexibility for the variant with the most optimal agonistic activity will be different for different antibodies, and the most agonistic activity will be the greatest when flexibility reaches or falls within the optimal value range, on the basis of which increasing or decreasing flexibility may decrease. In human IgG, usually the flexibility of IgG3 is strong, and the agonistic activity of antibodies comprising the CH 1-hinge region of IgG3 is usually poor, whereas IgG2 and IgG1 are relatively less flexible, and thus the agonistic activity of antibodies comprising the CH 1-hinge region of IgG2 and IgG1 will usually be stronger than that of antibodies comprising the CH 1-hinge region of IgG 3. Thus the CH 1-hinge region of either IgG1 or IgG2 is a natural IgG CH 1-hinge region that can be selected. Indeed, while IgG2 is less flexible than IgG1, and in some antibody embodiments, the use of an IgG2 CH 1-hinge region does provide better agonistic activity than an IgG1 CH 1-hinge region and an IgG3 CH 1-hinge region, in other antibody embodiments, a flexibly intermediate IgG1 CH 1-hinge region provides better agonistic activity than an IgG2 CH 1-hinge region and an IgG3 CH 1-hinge region. Therefore, for the purpose of enhancing the agonistic activity of an antibody, it is necessary to adjust the flexibility of the antibody to a relatively low interval; preferably, the flexibility of the antibody should not exceed that of human IgG1, but not be too low; variants with optimal agonistic activity can be obtained from antibodies with lower flexibility by further activity screening. Conversely, for the purpose of reducing the agonistic activity of an antibody, it is necessary to regulate the flexibility of the antibody to a relatively high interval; preferably, the antibody should be more flexible than or equal to native IgG 3.

The Radius of gyration (Rg), also called the Radius of inertia, refers to the distance between the central point of the assumption of the differential mass of an object and the axis of rotation, and can roughly describe how close the molecular structure is. Rg reflects the volume and shape of the protein and can be used to measure the extent of protein structure. The larger the Rg, the more expansive the system, and the more flexible it is for the antibodies of the invention. In this patent, Rg is estimated by parameters obtained for small angle X-ray scattering.

The term "tumor necrosis factor receptor superfamily" or "TNF receptor superfamily" as used herein refers to receptor polypeptides that bind to cytokines of the TNF family. In general, these receptors are type I transmembrane receptors with one or more cysteine rich repeats in their extracellular region. Examples of cytokines in the TNF gene family include: tumor necrosis factor-alpha (TNF-alpha), tumor necrosis factor-beta (TNF-beta or lymphotoxin), CD30 ligand, CD27 ligand, CD40 ligand, OX-40 ligand, 4-1BB ligand, Apo-1 ligand (also known as Fas ligand or CD95 ligand), Apo-2 ligand (also known as TRAIL), Apo-3 ligand (also known as TWEAK), Osteoprotegerin (OPG), APRIL, RANK ligand (also known as TRANCE), and TALL-1 (also known as BlyS, BAFF or THANK). Examples of receptors in the TNF receptor superfamily include: tumor necrosis factor receptor type 1 (TNFR1), tumor necrosis factor receptor type 2 (TNFR2), p75 Nerve Growth Factor Receptor (NGFR), B cell surface antigen CD40, T cell antigen OX-40, Apo-1 receptor (also known as Fas or CD95), Apo-3 receptor (also known as DR3, sw1-1, TRAMP and LARD), receptor known as "transmembrane activator and CAML-interactor" (interactor) "or" TACI "), BCMA protein, DR4, DR5 (or alternatively known as Apo-2; TRAIL-R2, TR6, Tango-63, hAPO8, TRICK2 or KILLER), DR6, DcR1 (also known as TRID, LIT or TRAIL-R3), DcR2 (also known as TRAIL-R4 or TRDcR 695), OPG, CAR 3 or TNFR 8227), HVR 8653, TNFR 8658, TNFR 867, TNFR 847, TNFR 68, TNFR 847, TNFR 8414, TNFR or TNFR 36TR 7, TNFR 8414, TNFR or LARD, 4-1BB receptor and TR9(EP988,371A1).

The "affinity ratio for inhibitory Fc γ receptors as well as activating Fc γ receptors" or "I/a ratio" as described herein is equal to the affinity value of the antibody heavy chain constant region for inhibitory Fc γ receptors (e.g., human Fc γ RIIB) divided by the highest affinity value of the antibody heavy chain constant region for activating Fc γ receptors of the same species (e.g., including human Fc γ RI, Fc γ RIIA, Fc γ RIIIA, Fc γ RIIIB).

By "affinity" is meant the amount of binding capacity between two molecules, which can be measured, in general, by KD. "KD" refers to the equilibrium dissociation constant for the interaction of two molecules (e.g., a particular antibody and antigen or a ligand and receptor).

"human" antibody refers to an antibody whose variable regions have framework and CDR regions derived from human germline immunoglobulin sequences. Furthermore, if the antibody contains constant regions, the constant regions are also derived from human germline immunoglobulin sequences. The human antibodies of the invention may comprise amino acid residues that are not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-directed mutagenesis in vitro or by somatic mutation in vivo). However, as used herein, the term "human antibody" is not intended to include antibodies in which CDR sequences from the germline of other mammalian species (e.g., mouse) are grafted onto human framework sequences. The terms "human" antibody and "fully human" antibody are used synonymously.

"humanized" antibodies are those in which some, most, or all of the amino acids outside the CDR domains of the nonhuman antibody are replaced with corresponding amino acids from a human immunoglobulin. In one embodiment of a humanized form of an antibody, some, most, or all of the amino acids outside of the CDR domains are replaced by amino acids from a human immunoglobulin, while some, most, or all of the amino acids within one or more CDR regions are unchanged. Small additions, deletions, insertions, substitutions or modifications to the amino acids are permissible as long as they do not abrogate the ability of the antibody to bind to a particular antigen. "humanized" antibodies retain antigen specificity similar to the original antibody.

"chimeric antibody" refers to an antibody in which the variable regions are from one species and the constant regions are from another species, for example, an antibody in which the variable regions are from a mouse antibody and the constant regions are from a human antibody.

"Flexible linker sequence" refers to an amino acid sequence having a flexible structure. In particular embodiments of the invention, "flexible linker sequences" are used to add, insert, replace or modify the antibody hinge region to provide flexibility to the hinge region, or to increase the amino acid sequence of the original hinge region. Joshua S.Klein et al provide a series of flexible linker sequences (Design and characterization of structured Protein linkers with differential flexibility, Protein Engineering, Design & Selection vol.27no.10 pp.325-330,2014), which are incorporated by reference as specific examples of flexible linker sequences of the present invention.

Furthermore, the inventors have found that antibody flexibility can be modulated by mutating (modifying) the upper and/or middle hinge domain of the antibody (e.g., changing the number and/or proportion of less sterically hindered amino acids, or changing the length of the upper hinge domain). The inventors have also found that this modulation of antibody flexibility is closely related to the agonistic activity of the antibody; down-regulation of flexibility may increase the agonistic activity of the agonist antibody, whereas down-regulation of the agonistic activity of the agonist antibody may be desired. Herein, the less sterically hindered amino acid may be selected from: glycine (G), alanine (a), serine (S), valine (V), threonine (T), isoleucine (I), leucine (L). Preferably, the less sterically hindered amino acid is selected from G or S. More sterically hindered amino acids herein include aromatic amino acids and heterocyclyl amino acids. In one or more embodiments, the more sterically hindered amino acid is selected from the group consisting of proline (P), hydroxyproline (O), asparagine (N), aspartic acid (D), pyroglutamic acid (U), glutamine (Q), lysine (K), glutamic acid (E), methionine (M), histidine (H), phenylalanine (F), arginine (R), tyrosine (Y), tryptophan (W).

When said modulation is up-regulation of an antibodyThe mutations increase the number and/or proportion of less sterically hindered amino acids in the upper and/or middle hinge domains of the hinge region, or increase the length of the upper and/or middle hinge domains, when the body is flexible or the agonistic activity of the antibody is reduced. The mutation is selected from one or more of (1) insertion of 1,2, 5 or at least 6 less hindered amino acids in the upper hinge domain, (2) deletion of more sterically hindered amino acids from the upper and/or middle hinge domain, and (3) mutation of more sterically hindered amino acids in the upper and/or middle hinge domain to less hindered amino acids. For example, the amino acid insertion described in (1) is located at least 1 st, at least 2 nd, at least 3 rd, at least 4 th or at least 5 th amino acid after the N-terminus of the upper hinge domain, or between the upper hinge domain and the middle hinge domain. (1) The insertion described in (1) comprises 1,2, 5 or at least 6 amino acids selected from G and S. In specific embodiments, (1) G, GS, SG, GSGSGSG, SGSGSGS, GGGGS, GGGSG, GGSGG, GSGGG, SGGGG, GSGSGSG, GSSGG, GGSSG, GSGGS, GGSGS, GGGSS, SGGSGSG, SGSGSGG, SSGGG, SGGGS, SGSGSGS, SGGSS, SSGGS, SGSSG, SSGSG, SSGG, SSSGGG, GSSGSGS, GSGSS, GGSSS, GSSSSG, GSSSS, SSSS, SSGSGSS, SSGS, SSSG, or (GSGSGSGSGSGSGSSG)_nWherein_nIs 1,2 or 3. In specific embodiments, (2) is the deletion of the more sterically hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the C-terminus of the upper and/or middle hinge domain. In particular embodiments, (3) includes substitution of a sterically hindered amino acid residue such as (R, K, D) with a sterically hindered amino acid residue such as (G, S) in the upper and/or middle hinge domain; in some embodiments, (3) further comprises mutating the upper and/or middle hinge domain to the corresponding region of IgG3 or mIgG2a, or mutating the hinge region to that of IgG3 or mIgG2a, or mutating the CH 1-hinge region to that of IgG3 or mIgG2a, CH 1. In one or more embodiments, the antibody is more flexible than or equal to IgG3 after mutation. In one or more embodiments, the antibody is mutated to produce a mutant formRadius of rotation (Rg) greater than

When the modulation is down-regulation of antibody flexibility or enhancement of antibody agonistic activity, the mutation reduces the number and/or proportion of less sterically hindered amino acids in the upper and/or middle hinge domains of the hinge region, or reduces the length of the upper and/or middle hinge domains. The mutations are selected from one or more of (1) insertion of 3 or 4 less hindered amino acids in the upper hinge domain, (2) deletion of less hindered amino acids from the upper and/or middle hinge domain, (3) mutation of less hindered amino acids in the upper and/or middle hinge domain to more hindered amino acids, and (4) insertion of more hindered amino acids in the upper and/or middle hinge domain. In this case, the insertion in (1) is located at least 1 st, at least 2 nd, at least 3 rd, at least 4 th or at least 5 th amino acid after the N-terminus of the upper hinge domain, or between the upper hinge domain and the middle hinge domain. (1) Wherein n is a positive integer, e.g., 3 or 4 amino acids selected from G and S. In specific embodiments, (1) GSG, GGS, SGG, GSS, SGS, SGG, GGGS, GGSG, GSGG, SGGG, GGSs, GSGs, SGGs, GSSG, SSSG, SGSs, or GSSs is inserted between the upper hinge domain and the middle hinge domain. In specific embodiments, (2) is the deletion of the less sterically hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the C-terminus of the upper and/or middle hinge domain. In particular embodiments, (3) includes the substitution of a less sterically hindered amino acid residue, e.g., (G, S), to a more sterically hindered amino acid residue (e.g., R, K, D) in the upper and/or middle hinge domain; in some embodiments, (3) comprises mutating the upper and/or middle hinge domain to the corresponding region of IgG1, IgG2 or IgA2, or the hinge region to the hinge region of IgG1, IgG2 or IgA2, or the CH 1-hinge region to the CH 1-hinge region of IgG1, IgG2 or IgA 2. In a particular embodiment of the process of the present invention,(4) is the insertion of at least 1, at least 2, at least 3, e.g.1-20, 1-15 or 1-10 amino acids with a larger steric hindrance between the upper and/or the middle hinge domain after at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid from the N-terminus of the upper and/or the middle hinge domain. In one or more embodiments, the flexibility of the mutated antibody does not exceed the flexibility of human IgG 1. In one or more embodiments, the radius of gyration (Rg) of the mutated antibody isPreferably isOr Rg smaller than IgG1 (e.g., human IgG 1).

The term "biological macromolecule" as used herein refers to various organic molecules as the main active components in the body, which usually have relatively large molecular weights (up to ten thousand or more), and the common biological macromolecules include proteins, nucleic acids, lipids, saccharides, and products or systems formed by combining these molecules or molecular fragments, such as glycoproteins, lipoproteins, nucleoproteins, etc.

An "epitope", also called an antigenic determinant, is a chemical group present on the surface of an antigen/protein that determines the specific structure of the antigen, being that part of the antigen that can be recognized by the immune system (in particular antibodies, B-cells or T-cells). An antigenic molecule can have one or more different epitopes, each epitope having only one antigenic specificity, corresponding in size to the antigen-binding site of the corresponding antibody.

An "epitope recognition molecule" refers to a molecule that is capable of specifically binding to an epitope.

"fluorescence resonance energy transfer" (FRET) refers to the phenomenon in which, if the fluorescence emission spectrum of one fluorophore (Donor fluorophore) overlaps with the absorption spectrum of another fluorophore (Acceptor fluorophore) in different fluorophores, the transfer of fluorescence energy from the Donor to the Acceptor, i.e., quenching of Donor fluorescence and enhancement of Acceptor fluorescence, can be observed when the distance between the two fluorophores is proper (generally less than 50nm, preferably less than 10 nm).

“Radius "(R0), also known as the radius of the frocht, represents the distance between the Donor and Acceptor when 50% of the Donor fluorescent molecules (Donor) are inactivated and energy is transferred to the Acceptor fluorescent molecules (Acceptor) in FRET.

The TR-FRET is a short term for Time-Resolved fluorescence Resonance Energy Transfer analysis (Time-Resolved fluorescence Resonance Energy Transfer analysis), and the main action principle is that the Time-Resolved fluorescence molecule is used as a donor fluorescence molecule, and can Transfer Energy to an adjacent acceptor fluorescence molecule under a certain action distance, and the acceptor fluorescence molecule is excited to generate a fluorescence signal with a specific wavelength (namely, the TR-FRET signal) for detection of an experimenter. Specifically, lanthanide elements with longer emission half-life are used as donor fluorescent molecules, and the energy of light energy (a) emitted by the donor fluorescent molecules can be transferred to adjacent acceptor fluorescent molecules under a certain action distance, and the acceptor fluorescent molecules can be excited to generate emission fluorescent signals (B) with specific wavelengths (the (B/a) ratio is the 'TR-FRET signal' in the invention) for detection by an experimenter.

The "donor fluorescent molecule" and the "acceptor fluorescent molecule" of the present invention can recognize molecules (e.g., antigens) by directly labeling epitopes, and then bind to two epitopes (e.g., antigen binding sites) of proteins (e.g., antibodies), respectively; the same effect can also be achieved by indirectly labelling the epitope recognition molecule, or by directly or indirectly labelling other molecules that bind to the epitope.

The donor fluorescent molecule and the ligand fluorescent molecule employed in the TR-FRET assay of the invention may be selectively paired as follows:

1) when the donor fluorescent molecule is Eu, the acceptor fluorescent molecule to be paired with Eu may be selected from any one of APC, D2, XL665, fluoroscein, GFP, Rhodamine6G, tetramethylrhododamine, sulfofordine 101, mercyanine 540, Atto565, Cy3, atto550cy3.5, Dy547, Dy548, Dy549, Dy554, Dy555, Dy556, Dy560, mCherry, mStrawberry, Alexa680, Alexa700, Alexa750, Alexa647, Cy5, Cy5.5, Cy7, Dy647, Dy648, Atto 590;

alternatively, the first and second electrodes may be,

2) when the donor fluorescent molecule is Tb, the acceptor fluorescent molecule paired with it may be selected from: d2, XL665, Fluorescein, GFP, Lucifer yellow, Acridine yellow, Proflavine, Atto465, Nitrobenzaxadiozole, Cormarin 6, Alexa750, Cy7, Nile red, Alexa488, Dy495, Dy490, Dy648, Dy647, Oregon green, Atto488, Atto495, Alexa514, Atto520, Cy2, Rhodamine6G, Alexa700, Alexa680, Atto532, Alexa532, APC, EGFP, YFP, mPlum, Atto425, Alexa430, Coumain 343, Acridine OranDy, Metalhydronamine, Sulforhodamine 101, Merocyanine 540, Atto 36565, Cyto 0590, Cytron Ody, Cyperdy 0590, Atherdy 5, mSecurie 556, Alexa 548, Albehal 532, Alexa532, Algori 548, Cytron 565, Cytron 0590, Cybrid 5, Cyrtdy, Cybewary.

The present invention comprises the following embodiments:

item 1, a method of increasing agonistic activity of an agonistic antibody, characterized by modifying the heavy chain constant region of the agonistic antibody to reduce the flexibility of the agonistic antibody. Preferably, the modification is selected from one or more of (1) the insertion of a less hindered amino acid in 1,2, 5 or at least 6 positions in the upper hinge domain, (2) the deletion of a more hindered amino acid from the upper and/or middle hinge domain, (3) the mutation of a more hindered amino acid to a less hindered amino acid in the upper and/or middle hinge domain. More preferably, (1) is the insertion of at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid after the N-terminus of the superior hinge domain or between the superior hinge domain and the intermediate hinge domain of 1,2, 5 or at least 6 less hindered amino acids, preferably said at least 6 are 6, 12 or 18(2) deletion of the more sterically hindered amino acid starting from at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid of the C-terminus of the upper and/or middle hinge domain, (3) mutation of the upper and/or middle hinge domain to the corresponding region of IgG3 or mIgG2a, or mutation of the hinge region to the hinge region of IgG3 or mIgG2a, or mutation of the CH 1-hinge region to the CH 1-hinge region of IgG3 or mIgG2 a. More preferably, the insertion in (1) is insertion of 1,2, 5 or at least 6 amino acids selected from G and S, or (1) insertion of G, GS, SG, GSGSGSG, SGSGSGSGSGS, GGGGS, GGGSG, GGSGSGG, GGSGG, GSGGG, SGGGG, GSGSGSGSG, GSSGG, GGSSG, GSGGS, GGSGS, GGGSS, SGGSG, SGSGSGSGSGG, SSGGG, SGGGS, SGSGSGSGSGSGSGSGSGSGSGSGSGSGS, SGGSGSS, SSGGS, SGSSG, SSGSGSGSG, SSGG, GSGSGSGSGSGSGSGSGSS, GGSSS, GSSSS, SGSSSS, SSSS, SSGS, SSSGSSS, SSSSSGSSSG, SSSGSSSGSSSG, SSSGSSSG, SSSGSSSGSSGS, SSSG, or (_nWherein n is 1,2 or 3.

The method of item 2 or 1, wherein the agonist antibody is not more flexible than human IgG1 after modification.

The method of item 3, wherein the CH 1-hinge region in the heavy chain constant region is modified.

The method of item 4, wherein the hinge region in the heavy chain constant region is replaced with a less flexible sequence, preferably the sequence is the hinge region sequence of human IgA 2.

The method of any one of items 5, 1 to4, wherein the modification of the antibody does not significantly reduce the affinity of the antibody for the antigen to which it is specifically targeted.

Item 6, the method of items 1-4, wherein the Fc region of the heavy chain constant region is further modified to increase the affinity of the agonistic antibody and fcyriib or the I/a ratio of the agonistic antibody.

Item 7, the method of items 1 to4, wherein the radius of gyration (Rg) of the modified agonistic antibody isPreferably isOr Rg smaller than human IgG 1.

The method of any one of items 8 to 1 to4, wherein the antibody specifically recognizes a receptor in the TNF receptor superfamily.

The method of item 9, or any one of items 1 to4, wherein the antibody is an anti-CD 40 antibody or an anti-DR 5 antibody.

Item 10 a method of reducing agonistic activity of an antibody, wherein the heavy chain constant region of the agonistic antibody is modified to increase the flexibility of the antibody. Preferably, the modification is selected from one or more of (1) the insertion of 3 or 4 less hindered amino acids in the upper hinge domain (2) the deletion of less hindered amino acids from the upper and/or middle hinge domain, (3) the mutation of less hindered amino acids in the upper and/or middle hinge domain to more hindered amino acids, (4) the insertion of more hindered amino acids in the upper and/or middle hinge domain; more preferably, (1) the insertion of 3 or 4 less hindered amino acids after at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid at the N-terminus of the upper hinge domain or between the upper hinge domain and the middle hinge domain, (2) the deletion of less hindered amino acids starting from the C-terminus of the upper and/or middle hinge domain at least the 1 st, at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid, (3) the mutation of the upper and/or middle hinge domain to the corresponding region of IgG1, IgG2 IgA or 2, or the mutation of the hinge region to the hinge region of IgG1, IgG2 or IgA2, or the mutation of the CH 1-hinge region to the CH 1-hinge region of IgG1, IgG2 or IgA2, (4) the insertion of at least the 1 st, at the N-terminus of the upper hinge domain, or between the upper hinge domain and the middle hinge domain, At least 1, at least 2, at least 3, e.g.1-20, 1-15 or 1-10 amino acids with a larger steric hindrance are inserted after at least the 2 nd, at least the 3 rd, at least the 4 th or at least the 5 th amino acid or between the upper hinge domain and the middle hinge domain. More preferably, the insertion in (1) is insertion of 3 or 4 amino acids selected from G and S, or (1) is insertion of GSG, GGS, SGG, GSS, SGS, SGG, GGGS, GGSG, GSGG, SGGGs, GGSs, GSGs, SGGs, GSSG, SGSG, SSSG, SSGS, SGSs or GSSs between the upper hinge domain and the middle hinge domain.

The method of item 11, or item 10, wherein the agonist antibody is more flexible than or equal to IgG3 after modification.

Item 12, the method of item 10, wherein the CH 1-hinge region in the heavy chain constant region is modified to increase the flexibility of the agonist antibody.

Item 13, the method of item 12, wherein a flexible linker sequence is inserted into the CH 1-hinge region, preferably wherein the flexible linker sequence is a flexible linker sequence comprising G, S, more preferably wherein the flexible linker sequence is GSGSGS, or wherein the CH 1-hinge region is replaced by the CH 1-hinge region of human IgG 3.

The method of any one of items 14, 10 to 13, wherein the modification of the antibody does not significantly reduce the affinity of the antibody for the antigen to which it is specifically targeted.

Item 15, the method of items 10 to 13, wherein the radius of gyration (Rg) of the modified agonistic antibody is greater than that of the agonistic antibody

Item 16, the method of items 10-13, wherein the Fc region of the heavy chain constant region is further modified to reduce the affinity of the agonistic antibody and fcyriib or the I/a ratio of the agonistic antibody.

The method of any one of items 17 and 1 to 16, wherein the antibody is a human antibody, a chimeric antibody or a humanized antibody.

Item 18, a method for screening an agonistic activity of an antibody, comprising the steps of:

2) detecting the flexibility of the female parent and the variant;

Item 19, the screening method of item 18, further comprising detecting the affinity of the female parent and the variant to fcyriib and/or the I/a ratio of the agonistic antibody, comparing the detection results, and screening antibodies having the affinity of fcyriib and the I/a ratio of fcyriib not lower than that of the human IgG1 variant, which have better agonistic activity.

The screening method according to item 20 or 18, wherein the step 2) comprises:

1) providing an antigen capable of specifically binding to the antigen-binding portion of the agonist antibody;

3) adding the donor fluorescent labeled antigen and the acceptor fluorescent labeled antigen into the agonist antibody respectively;

The screening method according to item 21 or 18, wherein the step 2) comprises:

Item 22, a method for detecting the flexibility of a biological macromolecule, comprising the steps of:

1) providing the biological macromolecule;

2) providing two epitope recognition molecules capable of specifically binding to two separate epitopes of said biomacromolecule, respectively;

4) mixing the two marked epitope recognition molecules with the biological macromolecules;

The detection method according to item 23 or 22, wherein the biomacromolecule is a protein, a nucleic acid, a lipid molecule, a carbohydrate molecule, or a complex formed by binding them to each other.

Item 24, the detection method of item 22, wherein the biomacromolecule exists in a conformation wherein the distance between the two separate epitopes is between R0 and 2R0 of the donor fluorescent molecule and the ligand fluorescent molecule.

The detection method according to item 25 or 22, wherein the biological macromolecule is an antibody, the epitope is an antigen-binding site of the antibody, and the epitope-recognizing molecule is an antigen.

Item 26. the detection method of item 22, wherein the donor fluorescent molecule is Tb and the acceptor fluorescent molecule to which it is paired is selected from any one of D2, XL665, fluorscein, GFP, Lucifer yellow, Acridine yellow, Proflavine, Atto465, Nitrobenzoxadiazole, courmarrin 6, Alexa750, Cy7, Nile red, Alexa488, Dy495, Dy490, Dy648, Dy647, Oregon green, Atto495, Alexa514, Atto520, Cy2, Rhodamine6G, Alexa700, Alexa680, Atto532, Alexa532, APC, EGFP, YFP, lum, Atto425, Alexa430, mararin 343, Acridine Orange yellow 548, termine yellow, temethamine, Dy 532, Dy 51, Dy, EGFP, YFP, lumim, atmph 425, Alexa430, margosine 343, Acridine yellow 548, tmodule yellow 565, tmberrie yellow 565, siero5, mr5, mrac yellow 549, meldrum yellow 35, tmph 0582, tmph 550, tmep 35, tmberrie, tmep 35, tmberrie yellow 548, tmep 350, tmep 0582, tmep; alternatively, the donor fluorescent molecule is Eu, and the acceptor fluorescent molecule paired with Eu is selected from any one of APC, D2, XL665, fluoroscein, GFP, Rhodamine6G, tetramethylrhododamine, sulfofordine 101, mercyanine 540, Atto565, Cy3, atto550cy3.5, Dy547, Dy548, Dy549, Dy554, Dy555, Dy556, Dy560, mCherry, mStrawberry, Alexa680, Alexa700, Alexa750, Alexa647, Cy5, Cy5.5, Cy7, Dy647, Dy648, Atto 590.

The following detailed description of the preferred embodiments of the present invention, taken in conjunction with the accompanying drawings, will make the advantages and features of the invention easier to understand by those skilled in the art, and thus will clearly and clearly define the scope of the invention.

Examples

Materials and methods

1. Mouse

Fc γ R deficiency (Fc γ R α)^-/-) And Fc gamma R humanization (Fc gamma R alpha)^-/-/hFcγRI⁺/hFcγRIIAR131⁺ /hFcγRIIB⁺/hFcγRIIIAF158⁺/hFcγRIIIB⁺Or "hFCGRTg") mice (Mouse model adapting human Fcgamma receiver structure and functional direction, Proc Natl Acad Sci U S A, vol.109, No.16, pp.6181-6186,2012) and OT1 mice(inhibit Fcgamma receiver is required for the owner of the floor fault diagnosis mechanisms, J Immunol, vol.192, No.7, pp.3021-3028,2014) was provided by Jeffrey ravatch, university of Lokfield, friend. For Fc γ R humanized mice, breeding mice and chimeric mice that adoptively transmitted their bone marrow cells were used and confirmed to give the same results. To generate bone marrow chimera mice, 8-10 week old wild type C57BL/6 mice (SLAC, Shanghai, China) were lethally irradiated to 8Gy using an RS 2000pro X-ray bioirradiator (Rad Source Technologies, Inc, USA) and transferred by tail vein injection to 2X 10⁶A donor bone marrow cell. After 2 months of transplantation, peripheral blood from bone marrow reconstituted mice was collected and analyzed by flow cytometry to confirm B cells and CD11B⁺Reconstitution of human Fc γ RIIA/B expression levels in cells was over 95%. All mice were housed and maintained in a specific pathogen free animal facility at the department of zoology of the medical college of Shanghai transportation university. All animal care and studies were performed according to institutional and NIH guidelines and were approved by the SJTUSM institutional animal care and use Committee (Protocol registration Number: A-2015-014).

2. Antibodies

Anti-mouse CD40 antibodies (clone 1C10), anti-human CD40 antibodies (clone 21.4.1 and 3.1.1 of U.S. Pat. No. 5) and anti-mouse DR5 antibodies (clone MD5-1) of various heavy chain constant regions were produced according to the methods already described (inhibitor Fcgamma receptor driver and anti-tumor activity of inflammatory CD40 antibodies, Science (New York, NY), vol.333, No.6045, pp.1030 and 2011; apoptosis and activity of tissue receptor reagent in tissue receptor Fc gamma receptor, promoter of the National activity of amino acids of the biological activity of the biological genes, 109109.78). Briefly, the heavy chain expression constructs of anti-CD 40 and anti-DR 5 antibodies were prepared by subcloning human IgG constant region sequences into mammalian expression vectors having 1C10 and DR5 heavy chain gene variable domains, i.e., the heavy chain expression construct of anti-CD 40 antibody was prepared by subcloning human IgG or murine IgG constant region sequences into mammalian expression vectors having 1C10 heavy chain gene variable domainsIn the expression vector, alternatively, the heavy chain expression construct of the anti-DR 5 antibody is generated by subcloning the human IgG constant region sequence into a mammalian expression vector having the variable domain of the DR5 heavy chain gene (inhibitor Fcgamma receptor driver plus and anti-tumor activities of agonist CD40 antigens, Science (New York, N.Y.), vol.333, No.6045, pp.1030-1034,2011; apoptosis and activity of inhibitor reagents requirement Fc gamma promoter, promoter of the National Academy of Science of United States of America, vol.109, No. 66-10971,2012), or by direct mutagenesis of antibody molecules of interest, G.31-6045, G.32-6045, G.6045, G.6035-6034, antigen and activity of antigen receptor genes, volume 109, G.32-10971,2012, or by direct mutation of antibody molecules of interest, G.1030-5945, G.31, G.6045, G.31-6045). Human IgG2, 3, 4 constant region sequences (CD sequences) were obtained by gene synthesis (Biosune, Shanghai, China) based on the human IgG sequences in the IMGT database http:// www.imgt.org/. The sequences G3(H2) and G2(H3) of the chimeric constant regions were also synthesized based on IMGT sequence, where "G1-G3" are the CH2-CH3 regions of the IgG1-3 heavy chain constant region and "H1-H3" refer to the CH 1-hinge region of the IgG1-3 heavy chain constant region, respectively. V11(H1) is the previously described human IgG1 heavy chain constant region variant carrying the G237D/P238D/H268D/P271G/A330R mutations (Engineered antibody Fc variant with selective enhancement FcgammaRIIb binding over both FcgammaRILA (R131) and FcgammaRIMA (H131), Protein Eng Des Sel, vol.26, No.10, pp.589-598,2013). V11(H2) and V11(H3) use the CH 1-hinge region of the human IgG2 and IgG3 heavy chain constant regions, respectively, and the CH2-CH3 region of the V11 variant. V11(H1) -V11(H3) were synthesized according to the sequence. Based on the murine IgG sequence in the IMGT database, http:// www.imgt.org/, murine IgG1, 2a constant region sequences (CD sequences) were obtained by gene synthesis (Biosune, Shanghai, China). The sequence of the chimeric constant region G1(H2a) was obtained by a fusion molecular cloning method based on the sequences IgG1 and IgG 2. anti-CD 40 and anti-DR 5 antibody light chain expression constructs have been described in previously published articles and patents of the present invention (inhibition Fcgamma receptor active drive adjuvant and anti-tumor activities of inflammatory CD40 antibodies, Science (New York, NY), vol.333, No.6045, pp.1030-1034,2011; apoptotic and activator activity of depth receptors requiring receptor Fcgamma receptor engage, Proc Natl Acad Sci U S A, vol.109, No.27, pp.10966-10971,2012). To generate antibodies, antibody heavy and light chain expression vectors were transiently transfected into 293T cells, and the antibody secreted into the supernatant was purified using protein G Sepharose 4Fast Flow (GE Healthcare) and dialyzed into Phosphate Buffered Saline (PBS). LPS (endotoxin) levels were analyzed by endotoxin limulus reagent assay (Thermo Scientific) and confirmed<0.1EUμg^-1. SEC analysis was performed on the antibody product to assess the level of multimeric aggregates, and antibodies with no discernible multimers present were used.

The forward primer (IgG2(GS)3f) and reverse primer (IgG2(GS)3r) used for mutagenesis to generate the IgG2(GS)3 heavy chain were:

IgG2(GS)3f：5'ggtagcggaagcggtagttgttgtgtcgagtgcccaccg3'(SEQ ID NO:1)；

igg2(gs)3r：5'actaccgcttccgctacctttgcgctcaactgtcttgtc3'(SEQ ID NO:2)。

the forward primer (igg2v1f) and reverse primer (igg2v1r) used for mutagenesis to generate igg2v1 or v11h2v1 heavy chains, respectively, were:

igg2v1f：

5'acagttgagcgcaaaggttgttgtgtcgagtgcccaccgtgccca3'(SEQ ID NO:3)；

igg2v1r：

5'gcactcgacacaacaacctttgcgctcaactgtcttgtccacctt3'(SEQ ID NO:4)。

the forward primer (igg2v2f) and reverse primer (igg2v2r) used for mutagenesis to generate igg2v2 or v11h2v2 heavy chains, respectively, were:

igg2v2f：

5'aagacagttgagcgcaaaggtagctgttgtgtcgagtgcccaccgtgccca3'(SEQ ID NO:5)；

igg2v2r：

5'gcactcgacacaacagctacctttgcgctcaactgtcttgtccacctt3'(SEQ ID NO:6)。

the forward primer (igg2v3f) and reverse primer (igg2v3r) used for mutagenesis to generate igg2v3 or v11h2v3 heavy chains, respectively, were:

igg2v3f：

5'aagacagttgagcgcaaaggtagcggatgttgtgtcgagtgcccaccgtgccca3'(SEQ ID NO:7)；

igg2v3r：

5'tgggcactcgacacaacatccgctacctttgcgctcaactgtcttgtccacctt3'(SEQ ID NO:8)。

the forward primer (igg2v4f) and reverse primer (igg2v4r) used for mutagenesis to generate igg2v4 or v11h2v4 heavy chains, respectively, were:

igg2v4f：

5'aagacagttgagcgcaaaggtagcggaagctgttgtgtcgagtgcccaccgtgc3'(SEQ ID NO:9)；

igg2v4r：

5'tgggcactcgacacaacagcttccgctacctttgcgctcaactgtcttgtccacctt3'(SEQ ID NO:10)。

the forward primer (igg2v5f) and reverse primer (igg2v5r) used for mutagenesis to generate igg2v5 or v11h2v5 heavy chains, respectively, were:

igg2v5f：

5'gagcgcaaaggtagcggaagcggttgttgtgtcgagtgccca3'(SEQ ID NO:11)；

igg2v5r：

5'gacacaacaaccgcttccgctacctttgcgctcaactgtctt3'(SEQ ID NO:12)。

ova-specific cd8⁺t cell response

CD45.1 was injected by tail vein on day 1⁺OT-1 splenocytes (2X 10 cells per mouse)⁶Cells, suspended in 200. mu.l PBS) were adoptively transferred to mice and immunized on day 2 by intraperitoneal injection of 2. mu.g DEC-OVA (Differential anti processing by dense digital cell subsets in vivo, Science (New York, NY), vol.315, No.5808, pp.107-111,2007) and control or anti-CD 40 antibody (3.16-100. mu.g per mouse, as described in the legend). On day 7, splenocytes were harvested and, after lysis of erythrocytes, single cell suspensions were stained with anti-CD 4 (clone RM4-5), anti-CD 8 (clone 53-6.7), anti-CD 45.1(A20) antibodies, anti-TCR-V.alpha.2 (B20.1) to quantify OVA-specific OT-1CD8⁺T cells. OT-1CD8⁺T cells are defined as CD45.1⁺CD8⁺TCR-Vα2⁺A cell. For the intracellular IFN-y staining,spleen cells were cultured in a medium containing 1. mu.g ml of cells^-1CD28 antibody and 1. mu.g ml^-1OVA peptide (SIINFEKL) medium (RPMI containing 10% fetal bovine serum, 1% Pen-Strep, 10mM HEPES, 50. mu.M 2-mercaptoethanol) was incubated at 37 ℃ for 1 hour in 5% CO2, followed by the addition of brefeldin A (BFA) to a final concentration of 10. mu.g ml^-1And the splenocytes were cultured for another 5 hours. Cultured splenocytes were surface stained with CD4 (clone RM4-5) and CD8 (clone 53-6.7) according to the manufacturer's instructions (BD Biosciences), followed by intracellular staining for IFN-. gamma. (clone XMG1.2) and flow cytometric analysis on BD FACSCAnto II (BD Biosciences).

4. Flow cytometry

Harvesting spleen, preparing single cell suspension and lysing erythrocytes, and mixing 1-4 × 10⁶Individual splenocytes were resuspended in 50 μ l FACS buffer containing staining antibodies (1 xPBS containing 0.5% FBS, 2mM EDTA and 0.1% NaN 3) and incubated on ice for 15 minutes, then the cells were washed twice with FACS buffer, resuspended in 200 μ l FACS buffer containing DAPI or 7AAD, and analyzed by flow cytometry. For intracellular IFN-. gamma.staining, additional staining procedures were performed using the Cytofix/Cytoperm TM fixation/permeabilization solution kit (BD Biosciences) according to the manufacturer's instructions. For hFCGR^TgAnalysis of reconstitution levels of chimeric mice, heparinized blood was collected from mouse orbits and stained with anti-CD 19 (clone 1D3), anti-CD 11b (clone M1/70), anti-human CD32 (clone FLI 8.26); the reconstitution levels of human Fc γ R and human CD40 were also analyzed by staining with anti-human CD40 (clone 5C 3).

5. Small angle X-ray Scattering (SAXS)

SAXS data were collected at The national center for protein science (NCPSS) of The Shanghai synchronous radiation device (SSRF) on a beam line BL19U2 equipped with a Pilatus 1M detector (DECTRIS Ltd) (The new NCPSS BL19U2 beamline at The SSRF for small-angle X-ray scattering from biological macromolecules in solution, J Appl crystallograph, vol.49, no.Pt 5, pp.1428-1432,2016). The purified monomeric anti-CD 40 antibody was verified by Size Exclusion Chromatography (SEC). A series of diluted antibody samples (0.4-2.8mg ml) were collected^-1) All samples were in HBS buffer (150mM chloride)Sodium sulfide, 10mM HEPES PH 7.4), 60ul of each concentration sample, the sample was exposed to a capillary tube of 240 x 80 μm X beam. Data reduction, beamline intensity normalization and buffer subtraction processing were performed using the BioXTAS RAW software (version 1.2.1) developed by Cornel High Energy Synchronous Source (CHESS). SAXS data analysis was performed using software from the ATSAS program suite (version 2.8.4(r10553)) (ATSAS 2.8: a comprehensive data analysis suite for small-angle scaling from cellular solutions, J Appl Crystallogr, vol.50, No. Pt 4, pp.1212-1225,2017). SAXS data obtained from the highest concentration samples were used for Guinier analysis, p (r) analysis and Kratky plots, while data obtained from the highest and lowest concentration samples were used for EOM (Advanced evaporative modelling of flexible macromolecular analysis using X-ray solution analysis, IUCrJ, vol.2, No. pt 2, pp.207-217,2015) analysis. Radius of gyration (Rg) and I (0) are calculated from the "radius of gyration" function of program PRIMUSSURT from ATSAS program suite (version 2.8.4) (PRIMUUS: a Windows PC-based system for Small-angle scaling data Analysis, Journal of Applied crystalline mapping, vol.36, No.5, pp. 1277. 1282,2003) (Analysis of X-ray and neutron scaling from biological networks, Curr Opin Structure Biol, vol.17, No.5, pp.562-571,2007), using GNOM (Determination of the distribution of the distance of refraction in index-transform mapping for mapping, Journal of P.7, Journal of application of P-32) (P.20, Journal of P-map of P-32) (distribution of distance of P-S.7, Journal of origin mapping, QT, QT.36, MP 2, MP-map of origin mapping, QT, MP 2, MP-map of origin mapping, MP-32) (distribution of P-map of origin mapping, MP-32), the value of the Volume of Port (VP) was also estimated using the "distance distribution" function of the program PRIMUUSQT, and the value of the molecular weight (Mr) was calculated using a Bayesian inference method (Consensus Bayesian assessment of protein molecular mass from X-ray scattering data, Sci Rep, vol.8, No.1, pp.7204,2018) (the "molecular weight" module of the program PRIMUUSQT).

To apply EOM (EOM 2.1) (Advanced ensemble modifying of flexible macromolecular substances using X-ray solution profiling, IUCrJ, vol.2, No. Pt 2, pp.207-217,2015) to SAXS data of human IgG antibodies, a published method (In-depth analysis of sub-class-specific formation prediction of IgG antibodies, vol.J, No.2, No. Pt 1, pp.9-18,2015) was used. Briefly, each antibody is considered to be 5 rigid bodies connected by a flexible linker: 2 immobilized CPPC fragments extracted from the hinge of PDB 1HZH (Crystal structure of a neutral hinging human IGG against HIV-1: a template for vaccine design, Science (New York, NY), vol.293, No.5532, pp.1155-1159,2001) mimic disulfide bonds, 2 Fab and 1 Fc domain. The extracted CPPC fragment was also used as a MODEL for The second "CPRC" in The IgG3 hinge region, PDB files for Fab and Fc domains or extracted from The Crystal structure (PDB 1HZH (Crystal structure of a neutral human IGG aggregate HIV-1: a template for vaccine design, Science (New York, NY), vol.293, No.5532, pp.1155-1159,2001) for IgG2 Fc, PDB 4HAG (IgG2 Fc structure and The dynamic therapeutics of The IgG CH2-CH3 interface, Mol Immunol, vol.56, No.1-2, pp.131-139,2013)) or generated by using SWISS-pages (The MODEL of The IgG CH2-CH3 interface, Mol Immunol, vol.56, pp. 1-2, pp.131-139,2013) or generated by using SWISS-pages (The MODEL of The molecular engineering: MODEL, molecular engineering, pp.2, 36green MODEL, 362, 3 molecular engineering, 3632 Fc). For homology modeling, PDB 5W38(Structural characterization of the Man5 glycoform of human IgG3 Fc, Mol Immunol, vol.92, No. pp.28-37,2017) was chosen as template for IgG3 and V11 Fc, and PDB 6AMM (Structural-based engineering to restore high affinity binding of an isoform-selective anti-TGFbeta1 antibody, MAbs, vol.10, No.3, pp.444-452,2018) was chosen for all IgG Fab domains. EOM is performed using default settings.

6. Time resolved FRET (TR-FRET)

Mouse CD40 extracellular domain (His-tag, Novoprotein, China) was treated with terbium (Tb) and D2 (TbChemistry, Cisbio Bioassays, China) to obtain CD40-Tb (1.5Tb/CD40) and CD40-D2(0.3D2/CD 40). The CD40-Tb was inserted into a CD,CD40-D2 and control or anti-CD 40 antibody were diluted to optimal concentrations in TPBS-BSA (5 XPBS + 0.2% BSA + 0.05% Tween-20) and mixed in a Proxi plate TM-384F Plus 384-Well plate (Perkinelmer, cat # 6008260) to a final volume of 20. mu.l. The final concentration of mouse CD40-Tb was 2.6nM and the final concentration of mouse CD40-D2 was 41.6nM (concentration ratio, CD 40-Tb: CD 40-D2: 1: 16). Control and anti-mouse CD40 monoclonal antibodies were serially diluted from 512nM to 4nM 2-fold, plates were incubated at room temperature for 1 hour, and TR-FRET signals were read using a Synergy neo plate reader (Biotech Instruments, inc., usa) set as follows: at 330nm excitation, the pre-delay was recorded for 50 μ s, the fluorescence count 400 μ s was recorded as the signal through the 620nm (for Tb) and 665nm (for D2) emission filters, and the "Em 665nm/Em 620 nm" intensity ratio was analyzed as the TR-FRET signal.

7. In vitro pro-apoptotic Activity of anti-DR 5 antibodies

MC38 cells (density-80%) were plated in flat-bottom 96-well tissue culture plates (Thermo, cat # 167008) at a density of 8X 10 cells per well⁴Cells, 200. mu.l complete medium (DMEM + 10% fetal bovine serum + 1% Pen/Strep), were cultured overnight. After gently aspirating the medium, 4X 10 resuspended in 100. mu.l of complete medium was added⁵Fc gamma R alpha of lysis erythrocyte^-/-Or hFCGR^TgB6 mouse splenocytes, then 100 μ l of the solution containing 1 μ g ml^-1Control IgG, α DR 5: hIgG1, α DR 5: hIgG2, α DR 5: hIgG3, α DR 5: hIgG4, α DR 5: hIgG V11(H1), hIgG V11(H2), hIgG V11(H2) V1, hIgG V11(H2) V2, hIgG V11(H2) V3, hIgG V11(H2) V4, hIgG V11(H2) V5, hIgG V11(H2) V6 or α DR 5: hIgG V11(H3) with or without 1. mu.g ml^-1The medium of 2B6 (Jackson Immuno Research, cat # 009-. After 4 hours, cells were harvested and stained with anti-mouse CD45.2 antibody (BD, cat # 560691), followed by Annexin V FITC apoptosis detection kit I (BD Biosciences, cat # 556547) for Annexin V/PI staining and intracellular activated caspase-3 staining (clone C92-605; BD Biosciences) according to the manufacturer's instructions. Samples were analyzed by BD FACS Calibur or LSRFortessaTM X-20 flow cytometer. MC38 cells were circled based on forward, side scatter and CD45.2 negativity and analyzed for annexin V⁺PI^-Or activating caspase-3⁺Percentage of apoptotic cells.

8. Hepatotoxicity

To investigate the hepatotoxic effects of the anti-DR 5 antibody, mice were treated intravenously with 100 μ g of anti-DR 5 antibody and survival rates were monitored for 1 month. At 6 days post-treatment, levels of aspartate aminotransferase in mouse serum were analyzed using the Maxdiscovery Assay Kit (Bio Scientific) aspartate aminotransferase enzyme method according to the manufacturer's instructions.

9. Statistical analysis

Statistical analysis was performed with GraphPad Prism (version 6.01, for windows) and p-values less than 0.05 were considered statistically significant. Asterisks indicate statistical comparisons with control groups, unless otherwise indicated in the figures (. p.ltoreq.0.05,. p.ltoreq.0.01,. p.ltoreq.0.001,. p.ltoreq.0.0001).

Example 1 TR-FRET enables analysis of the principle of antibody flexibility

Previous work showed that the relationship between agonistic activity of human IgG1, 2, 3 antibodies was IgG2>IgG1>IgG3 (Chinese patent application No.: 201710429281.6, PCT/CN2017/087620) to investigate the relationship between flexibility or activity of antibodies, TR-FRET method was used to analyze the flexibility of antibodies. Using the anti-mouse CD40 antibody as an example, the mouse CD40 was labeled with TR-FRET excitation (Tb) and acceptor (D2) fluorophores, respectively, and then mixed with the anti-mouse CD40 antibody (FIG. 2a), and part of the antibody's arms were able to bind to CD40-Tb and CD40-D2, respectively. According to the principle of TR-FRET, if the distance between Tb and D2 is less than twiceRadius (2R0), excitation Tb is able to generate a TR-FRET signal, and the intensity of the signal is determined by the distribution of the distance between Tb and D2. For Tb and D2 fluorophores, the distance of 2R0 was 11.6 nm (Reference (boron-based time-gated ester restriction on protein interactions on cells, Dalton interactions (Cambridge, England:2003), vol.44, No.11, pp. 4994, 5003,2015) (response energy transfer: methods and applications, Analytical biology, vol.218, No.1, pp.1-13,1994) and cisbio.com). According to the two antibodies with complete Crystal structures, the distance between the antigen binding sites is 12-17 nanometers (Reference (Crystal Structure of a neutral human IGG against HIV-1: a template for vaccine design, Science (New York, NY), vol.293, No.5532, pp.1155-1159,2001; Structure of full-length human anti-PD1 thermal IgG4 antibody binding polypeptide, Nature structural&molecular biology, vol.22, No.12, pp.953-958,2015) and fig. 3), beyond the minimum distance at which a TR-FRET signal can be generated (fig. 2 b). Under such conditions, the flexibility of the antibody hinge region allows the arms of the antibody and the antigen to swing in solution, making it possible to reduce the distance between CD40-Tb and CD40-D2 to within 2R0(11.6 nm) (FIG. 2 b). Importantly, when the distance between Tb and D2 is decreased from 2R0, the TR-FRET signal increases exponentially with the sixth power (references (methods and applications, Analytical biochemistry, vol.218, No.1, pp.1-13,1994)), and the TR-FRET signal is greatly enhanced. Thus, the presence of more molecules in the more flexible antibody results in a smaller distance of Tb-D2, which results in a stronger TR-FRET signal; conversely, the stiff antibody hinge region limits the swinging of the antibody arms, making Tb-D2 more distant, thereby reducing the TR-FRET signal (fig. 2 b).

Example 2 TR-FRET analysis showed that the TR-FRET signal was highest for IgG3 antibody with the most flexible hinge region, and lowest for IgG2 antibody with the least flexible hinge region (fig. 4). To analyze the flexibility of different human native IgG antibodies, we compared IgG1, IgG2, and IgG3 antibodies in parallel using the TR-FRET method described above. After the anti-mouse CD40 antibody was expressed as IgG1, IgG2 and IgG3, respectively, the TR-FRET signal was measured after mixing with CD40-Tb and CD40-D2 as described above (FIG. 2 a). The results show that of the three natural IgG antibodies, the TR-FRET signal is strongest for IgG3 antibody and weakest for IgG2 antibody (fig. 4a), suggesting that IgG3 antibody is the most flexible and IgG2 antibody is stiff enough to limit its two-arm swing triggering TR-FRET signal. To further analyze whether the factor affecting the flexibility of IgG antibodies was the hinge region, we expressed V11(H1), V11(H2), and V11(H3) antibodies with the same variable and Fc regions, and hinge regions from IgG1, IgG2, and IgG3, respectively. Parallel comparisons showed that the TR-FRET signal characteristics of these three antibodies were consistent with those of the corresponding IgG antibodies (fig. 4b), suggesting that the flexibility of these IgG antibodies is mainly affected by the antibody hinge region. Further analysis of the chimeric antibodies (G2(H3) and G3(H2) antibodies) produced by exchanging the hinge region between IgG2 and IgG3 revealed that the grafted antibody hinge region sequence was able to graft the corresponding flexibility characteristics (fig. 4 c). These results indicate whether the TR-FRET analysis can distinguish between different IgG antibodies with different flexibility properties due to differences in hinge regions, where the most flexible IgG3 hinge region corresponds to the highest TR-FRET signal and the least flexible IgG2 hinge region corresponds to the lowest TR-FRET signal.

Example 3 small angle X-ray scattering (SAXS) analysis confirmed that IgG3 antibody was more flexible and IgG2 antibody was less flexible (fig. 5-6).

Small Angle X-ray Scattering is a widely accepted, but hardware-demanding, approach to biomacromolecule research that is capable of analyzing the flexibility characteristics of biomacromolecules in solution (Horw Random area Integrated distributed proteins A Small Angle Scattering Peractive, Curr Protein peptide Sc, vol.13, No.1, pp.55-75,2012). The anti-CD 40 antibody monomer molecules purified by molecular sieve were subjected to small angle scattering analysis after gradient dilution (fig. 5). Dimensionless Kratky plots results indicate that in IgG1, IgG2, and IgG3 antibodies, the vertices of the curves for IgG1 and IgG2 are both very close to the Guinier-Kratky point (R) ((R))1.103) (FIG. 5a), indicating that both IgG1 and IgG2 antibodies have the characteristics of globular proteins (NADPH oxidase activator P67(phox) proteins in solutions as a multidomain protein with semi-flexible linkers, J Struct Biol, vol.169, No.1, pp.45-53,2010; how Random area ordered proteins A Small Angle carving Peractive, Curr Protein Pept Sc, vol.13, No.1, pp.55-75,2012); meanwhile, the vertex of Dimensionless Kratky spots of IgG3 antibody was significantly moved to the upper rightIgG3 is a multifunctional domain Protein (How Random area organized Protein A Small Angle Scattering Peractive, Curr Protein peptide Sc, vol.13, No.1, pp.55-75,2012) linked by flexible connecting sequence, and the analysis result of TR-FRET on IgG3 antibody is confirmed; meanwhile, the results of P (R)/I (0), Rg, Dmax and the like which can reflect the molecular size also support that the IgG3 antibody has larger molecular size (FIG. 5b and FIG. 6) and has a more loose structure. Further analysis of the V11(H1), V11(H2) and V11(H3) antibodies showed that their low angle scattering characteristics were consistent with those of the native IgG1, IgG2 and IgG3 antibodies (fig. 5c, fig. 5d), suggesting that the flexibility of these IgG antibodies is mainly affected by the antibody hinge region. Further analysis of the chimeric antibodies generated by the IgG2 and IgG3 crossover hinge regions (G2(H3) and G3(H2) antibodies) showed that the grafted antibody hinge region sequence was able to graft the corresponding small angle scattering flexibility features (fig. 5e, fig. 5f, fig. 6). These results further support that the TR-FRET assay is an effective means to analyze the flexibility of antibody molecules. It should be noted that the Dimensionless Kratky labels characteristics of the IgG1 and IgG2 antibodies are relatively close, and it is difficult to clearly judge the flexibility difference between the two antibodies.

The flexibility of the samples can be further quantitatively evaluated using the Ensemble Optimization Method (EOM) developed for small angle scattering data analysis (In-depth analysis of sub-class-specific compatibility prediction of IgG antibodies, IUCrJ, vol.2, no.Pt 1, pp.9-18,2015; Advanced Ensemble modeling of flexible macromolecular analysis using X-ray solution characterization, IUCrJ, vol.2, no.Pt 2, pp.207-217,2015). EOM analysis results showed that the radius of gyration (Rg) and the maximum atomic distance (Dmax) distribution of the IgG2 antibody were the narrowest In all of the three natural antibodies IgG1, IgG2, and IgG3 analyzed (FIGS. 5g and 5h), consistent with previous studies (In-depth analysis of sub-specific transformation of IgG antibodies, IUCrJ, vol.2, No. Pt 1, pp.9-18,2015), while the Rg and Dmax distributions of the IgG3 antibody were the widest, suggesting that the IgG2 and IgG3 antibodies were the least flexible and most flexible of the three antibodies, respectively. In addition, Rflex and R σ values obtained from EOM analysis, which enable quantitative response flexibility, further support the flexibility relationship of the three antibodies as IgG3> IgG1> IgG2 (fig. 6). Finally, further analysis of the V11(H1), V11(H2) and V11(H3) antibodies revealed their Rg and Dmax profiles, as well as the Rflex and R σ relative relationships consistent with the corresponding native IgG1, IgG2 and IgG3 antibodies (fig. 5i, fig. 5j, fig. 6), while exchanging the hinge region of IgG2 and IgG3 antibodies also exchanged these features (fig. 5k, fig. 5l, fig. 6).

On the one hand, the above results further support the relative flexible relationship of the three natural IgG antibodies as IgG3> IgG1> IgG2 and are mainly determined by their hinge regions; on the other hand, the results further verify the analysis result of the flexibility of the TR-FRET antibody, which indicates that the TR-FRET is a very sensitive analysis method and can distinguish the flexibility of IgG1 and IgG2 without performing complicated simulation analysis.

Example 4 murine IgG mobility affects murine IgG agonism (FIG. 7)

Murine IgG antibody flexibility was detected by SAXS method, and dimension less Kratky spots analysis showed that mIgG2a showed the upward character, indicating that mIgG2a has stronger flexibility than mIgG1, and hinge region flexibility was also transferred by hinge region exchange (fig. 7 a).

To analyze the relationship between the agonistic activity and hinge region flexibility of the murine-derived agonistic antibody, the immune activation activity of the anti-CD 40 murine IgG antibody (clone 1C10) was compared between different native iggs (IgG1, IgG2a) and the hinge region-exchanged variant (IgG1(H2 a)). The results show that the agonist activity of the less flexible (more rigid) IgG1 antibody is the strongest, while the agonist activity of the more flexible IgG2a antibody is the weakest (fig. 7b, fig. 7 c). At the same time, the hinge region was replaced, and the flexible hinge region of IgG2a provided the variant IgG1(H2a) with less agonism than the parent IgG 1. These results indicate that the least flexible IgG1 hinge region provides the best agonistic activity, while the most flexible IgG2a hinge region supports the least agonistic activity in the 1C10 anti-CD 40 murine IgG antibody.

Example 5 TR-FRET assay the IgG2 hinge region mutant with enhanced flexibility and confirmed by SAXS (FIGS. 8-9)

To further validate the method of TR-FRET analysis antibody flexibility, 1-3 "GSGSGS" linking sequences were inserted into the hinge region of IgG2 antibody to generate three IgG2 variants: IgG2(GS)3, IgG2(GS)6, and IgG2(GS)9 (fig. 15), it is expected that the longer the length of the insertion sequence, the more the flexibility of the antibody is increased. The results of the TR-FRET analysis showed a significant increase in the TR-FRET signal of the antibody as the insert was increased (fig. 8), indicating increased flexibility, consistent with expectations. Analysis of the IgG2 antibody and these variants by small angle scattering showed that the longer the inserted "gsgsgsgs" linker sequence, the more pronounced the dimesionless Kratky patches of the antibody (fig. 9), indicating greater flexibility. Thus, the analysis of TR-FRET and small angle X-ray scattering for IgG2 and IgG2 variants such as IgG2(GS)3, IgG2(GS)6, IgG2(GS)9, further verifies that TR-FRET is a sensitive, quantitative, flexible assay. Together, these results also indicate that altering the length or amino acid sequence of the hinge region of an IgG antibody can alter the flexibility of the antibody, and that increasing the length of the hinge region can enhance the flexibility of the antibody.

Example 6 enhancing the flexibility of the IgG2 hinge region can reduce the agonistic activity of the IgG2 antibody (fig. 10).

Further analysis of the results of the immune activation activity of IgG2 and IgG2 variant anti-CD 40 antibodies such as IgG2(GS)3, IgG2(GS)6, IgG2(GS)9, etc. showed that the immune activation activity of the IgG2 variant anti-CD 40 antibody with greater flexibility was significantly lower than that of the IgG2 antibody, showing a lower number and proportion of antigen-specific CD 8-positive T cells (fig. 10). These results indicate that enhancing the flexibility of IgG antibodies can affect the agonistic activity of IgG antibodies. After the flexibility of the IgG2 antibody has increased to some extent, the antibody loses its agonistic activity.

Example 7 altering the hinge region amino acid sequence can enhance the flexibility of IgG antibodies (IgG 1vs IgG1-A2, among other examples of enhanced flexibility) (FIG. 11)

The sequences of the hinge regions with different flexibility characteristics can be screened from the natural hinge region and mutants by TR-FRET analysis. Among them, IgG1 antibody (IgG1A2) grafted with the IgA2 hinge region sequence exhibited a TR-FRET signal less flexible than that of IgG1 antibody, reflecting its less flexible characteristic (FIG. 11 a). IgG1a2 flexibility was further verified by SAXS method analysis, which showed a reduced profile of IgG1a2 compared to parent IgG1, indicating that IgG1a2 has lower flexibility (greater rigidity) than IgG1 (fig. 11 b).

Example 8 altering hinge region amino acid sequence to reduce IgG antibody flexibility can affect antibody agonistic activity (FIG. 12)

Further analysis of the results of the immune activation activity of the G1a2 anti-CD 40 antibody showed that G1a2 has stronger immune activation activity than IgG1 (fig. 12). These results indicate that decreasing the flexibility of IgG antibodies can also affect the agonistic activity of IgG antibodies. The antibody can obtain stronger activation activity characteristics after the flexibility of the IgG1 antibody is reduced.

Example 91C 10 cloning of the optimal native hinge region for human IgG antibodies is the IgG2 hinge region (V11H2> V11H1> V11H3)

To analyze the relationship between agonistic activity and hinge region flexibility of the agonistic antibody, the immune activation activity of three forms of the anti-CD 40 antibody (clone 1C10) having the same variable region and Fc region, different native IgG hinge regions (V11(H1), V11(H2), and V11(H3)) were compared in parallel. The results showed that the least flexible (most rigid) V11(H2) antibody had the strongest agonistic activity, while the most flexible V11(H3) antibody had the weakest agonistic activity (fig. 13 a). These results indicate that the least flexible IgG2 hinge region is able to provide the best agonistic activity, while the most flexible IgG3 hinge region supports the least agonistic activity in the 1C10 antibody.

Example 10 MD5-1 the best native hinge region for cloned human IgG antibodies is the IgG1 hinge region (V11H1> V11H2> V11H3)

To further analyze the relationship between agonistic activity and hinge region flexibility of the agonistic antibody, agonistic activity of the anti-DR 5 antibody (clone MD5-1) with the same variable region and Fc region, three forms of different native IgG hinge regions (V11(H1), V11(H2), and V11(H3)) were compared in parallel (agonistic activity of the anti-DR 5 antibody appears to be the ability to induce apoptosis). The results show that the agonist activity of the most flexible V11(H1) antibody is the strongest, while the agonist activity of the most flexible V11(H3) antibody is the weakest (fig. 13 b). These results indicate that the central, flexible IgG1 hinge region is able to provide the best agonistic activity, while the most flexible IgG3 hinge region supports the weakest agonistic activity in the MD5-1 antibody.

Example 11 insertion of amino acids other than multiples of 3-4 in the hinge region abolished human IgG2 agonistic activity

Structurally, the hinge region is a highly flexible fragment as a connecting sequence of Fab and Fc, and is rich in proline, so that the region is easy to stretch and twist to a certain extent, and complementary combination between an antigen binding part and an antigen surface of an antibody is facilitated. The number of inserted amino acids is likely to change the angle of twist, affecting subtle changes in secondary structure.

To investigate the effect of varying hinge region length on agonism, we added Glycine G (Glycine, Gly) and Serine S (Serine, Ser) sequentially between the upper and middle hinges of the 1C10 anti-CD 40 human IgG2 antibody, resulting in 6 IgG2 variants: IgG2V1, IgG2V2, IgG2V3, IgG2V4, IgG2V5, and IgG2V6 (i.e., the precursor and G2(GS) 3). To further analyze the immune activation activity of IgG2 and IgG2V1-6 IgG2 variant anti-CD 40 antibodies, spleen cells from hFCGRTg mice were isolated using an in vitro stimulated humanized Fc γ Rs spleen cell model, incubated with 30ug/ml control antibody or 1C10 clone anti-CD 40 hinge region variant, and the level of antigen presenting cell activation was measured by flow assay after 48 hours. The results show that the addition of either non-3 or 4 amino acids, based on the IgG2 hinge region, significantly abolished the agonistic effect of the antibody on antigen-presenting cell activation (fig. 14 a). To test whether the addition of non-3-4 amino acids significantly impaired hinge region rigidity was useful in other agonistic antibodies, we inserted 1-6 amino acids of the "GSGSGS" linker sequence sequentially into the hinge region of MD5-1 anti-DR 5 IgGV11(H2) antibodies, respectively, resulting in 6V 11H2 variants: IgGV11(H2) V1, IgGV11(H2) V2, IgGV11(H2) V3, IgGV11(H2) V4, IgGV11(H2) V5 and IgGV11(H2) V6. We used an in vitro pro-apoptotic model to co-culture MC38 cells with Fc γ R humanized C57B6/L or Fcgr α -/-C57B 6/L mouse spleen cells, stimulated with control IgG or MD5-1 anti-mouse DR5 antibody for 2 hours, respectively, to quantify the percentage of Annexin V + PI-apoptotic MC38 cells by flow assay. It was shown that addition of non-3 or 4 amino acids based on the V11H2 hinge region significantly disrupted antibody activity (fig. 14b), consistent with the 1C10 clone anti-mCD 40 antibody species. Taken together, these results indicate that increasing 3-4 amino acids may provide higher agonistic activity when the hinge region of the antibody is engineered than increasing it by a factor other than 3-4 amino acids.

Combining the results of the studies with the 1C10 antibody and the MD5-1 antibody indicates that the hinge regions of the antibodies that support the best agonistic activities obtained for the different antibodies are not necessarily identical, but that the flexibility of these optimal hinge regions is at the weaker end, whereas the agonistic activity of the antibody using the most flexible IgG3 hinge region of the three natural hinge regions is the worst. These results suggest, on the one hand, that in order to destroy the agonistic activity of an antibody, it can be achieved by enhancing the flexibility of the antibody to some extent; on the other hand, in order to enhance the agonistic activity of an antibody, it is necessary to screen an optimal hinge region sequence among hinge region sequences having different flexibilities against different antibody clones.

While specific embodiments of the invention have been described above for purposes of illustration, it will be appreciated by those skilled in the art that numerous variations in detail may be made without departing from the invention as described in the claims.

Sequence listing

<110> Shanghai college of medicine of transportation university

<120> modification of antibody activity and screening method thereof

<130> 207634

<141> 2020-09-21

<160> 39

<170> SIPOSequenceListing 1.0

<210> 1

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 1

ggtagcggaa gcggtagttg ttgtgtcgag tgcccaccg 39

<210> 2

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 2

actaccgctt ccgctacctt tgcgctcaac tgtcttgtc 39

<210> 3

<211> 45

<212> DNA

<213> Artificial Sequence

<400> 3

acagttgagc gcaaaggttg ttgtgtcgag tgcccaccgt gccca 45

<210> 4

<211> 45

<212> DNA

<213> Artificial Sequence

<400> 4

gcactcgaca caacaacctt tgcgctcaac tgtcttgtcc acctt 45

<210> 5

<211> 51

<212> DNA

<213> Artificial Sequence

<400> 5

aagacagttg agcgcaaagg tagctgttgt gtcgagtgcc caccgtgccc a 51

<210> 6

<211> 48

<212> DNA

<213> Artificial Sequence

<400> 6

gcactcgaca caacagctac ctttgcgctc aactgtcttg tccacctt 48

<210> 7

<211> 54

<212> DNA

<213> Artificial Sequence

<400> 7

aagacagttg agcgcaaagg tagcggatgt tgtgtcgagt gcccaccgtg ccca 54

<210> 8

<211> 54

<212> DNA

<213> Artificial Sequence

<400> 8

tgggcactcg acacaacatc cgctaccttt gcgctcaact gtcttgtcca cctt 54

<210> 9

<211> 54

<212> DNA

<213> Artificial Sequence

<400> 9

aagacagttg agcgcaaagg tagcggaagc tgttgtgtcg agtgcccacc gtgc 54

<210> 10

<211> 57

<212> DNA

<213> Artificial Sequence

<400> 10

tgggcactcg acacaacagc ttccgctacc tttgcgctca actgtcttgt ccacctt 57

<210> 11

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 11

gagcgcaaag gtagcggaag cggttgttgt gtcgagtgcc ca 42

<210> 12

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 12

gacacaacaa ccgcttccgc tacctttgcg ctcaactgtc tt 42

<210> 13

<211> 5

<212> PRT

<213> Artificial Sequence

<400> 13

Val Asp Lys Arg Val

1 5

<210> 14

<211> 10

<212> PRT

<213> Artificial Sequence

<400> 14

Glu Pro Lys Ser Cys Asp Lys Thr His Thr

1 5 10

<210> 15

<211> 5

<212> PRT

<213> Artificial Sequence

<400> 15

Cys Pro Pro Cys Pro

1 5

<210> 16

<211> 8

<212> PRT

<213> Artificial Sequence

<400> 16

Ala Pro Glu Leu Leu Gly Gly Pro

1 5

<210> 17

<211> 10

<212> PRT

<213> Artificial Sequence

<400> 17

Cys Pro Val Pro Pro Pro Pro Pro Cys Cys

1 5 10

<210> 18

<211> 5

<212> PRT

<213> Artificial Sequence

<400> 18

Val Asp Lys Thr Val

1 5

<210> 19

<211> 3

<212> PRT

<213> Artificial Sequence

<400> 19

Glu Arg Lys

<210> 20

<211> 9

<212> PRT

<213> Artificial Sequence

<400> 20

Cys Cys Val Glu Cys Pro Pro Cys Pro

1 5

<210> 21

<211> 7

<212> PRT

<213> Artificial Sequence

<400> 21

Ala Pro Pro Val Ala Gly Pro

1 5

<210> 22

<211> 12

<212> PRT

<213> Artificial Sequence

<400> 22

Glu Leu Lys Thr Pro Leu Gly Asp Thr Thr His Thr

1 5 10

<210> 23

<211> 50

<212> PRT

<213> Artificial Sequence

<400> 23

Cys Pro Arg Cys Pro Glu Pro Lys Ser Cys Asp Thr Pro Pro Pro Cys

1 5 10 15

Pro Arg Cys Pro Glu Pro Lys Ser Cys Asp Thr Pro Pro Pro Cys Pro

20 25 30

Arg Cys Pro Glu Pro Lys Ser Cys Asp Thr Pro Pro Pro Cys Pro Arg

35 40 45

Cys Pro

<210> 24

<211> 7

<212> PRT

<213> Artificial Sequence

<400> 24

Glu Ser Lys Tyr Gly Pro Pro

1 5

<210> 25

<211> 5

<212> PRT

<213> Artificial Sequence

<400> 25

Cys Pro Ser Cys Pro

1 5

<210> 26

<211> 4

<212> PRT

<213> Artificial Sequence

<400> 26

Asp Val Thr Val

<210> 27

<211> 9

<212> PRT

<213> Artificial Sequence

<400> 27

Glu Arg Lys Gly Ser Gly Ser Gly Ser

1 5

<210> 28

<211> 15

<212> PRT

<213> Artificial Sequence

<400> 28

Glu Arg Lys Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser

1 5 10 15

<210> 29

<211> 21

<212> PRT

<213> Artificial Sequence

<400> 29

Glu Arg Lys Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser Gly Ser Gly

1 5 10 15

Ser Gly Ser Gly Ser

<210> 30

<211> 4

<212> PRT

<213> Artificial Sequence

<400> 30

Glu Arg Lys Gly

<210> 31

<211> 5

<212> PRT

<213> Artificial Sequence

<400> 31

Glu Arg Lys Gly Ser

1 5

<210> 32

<211> 6

<212> PRT

<213> Artificial Sequence

<400> 32

Glu Arg Lys Gly Ser Gly

1 5

<210> 33

<211> 7

<212> PRT

<213> Artificial Sequence

<400> 33

Glu Arg Lys Gly Ser Gly Ser

1 5

<210> 34

<211> 8

<212> PRT

<213> Artificial Sequence

<400> 34

Glu Arg Lys Gly Ser Gly Ser Gly

1 5

<210> 35

<211> 5

<212> PRT

<213> Artificial Sequence

<400> 35

Val Asp Lys Lys Ile

1 5

<210> 36

<211> 4

<212> PRT

<213> Artificial Sequence

<400> 36

Val Pro Arg Asp

<210> 37

<211> 9

<212> PRT

<213> Artificial Sequence

<400> 37

Cys Gly Cys Lys Pro Cys Ile Cys Thr

1 5

<210> 38

<211> 10

<212> PRT

<213> Artificial Sequence

<400> 38

Glu Pro Arg Val Pro Ile Thr Gln Asn Pro

1 5 10

<210> 39

<211> 11

<212> PRT

<213> Artificial Sequence

<400> 39

Cys Pro Pro Leu Lys Glu Cys Pro Pro Cys Ala

1 5 10

48页详细技术资料下载

Antibody activity modification and screening method thereof

相关技术

网友询问留言