阅读说明：本技术 Sod1双表达载体及其用途 (SOD1 double expression vector and its use ) 是由 C·米勒 R·H·小布朗 于 2018-09-21 设计创作，主要内容包括：在一些方面,本公开涉及用于抑制细胞(例如,受试者的细胞)中SOD1表达的组合物和方法。在一些实施方案中,本公开描述了经工程化以表达靶向内源SOD1的抑制性核酸和编码强化的SOD1蛋白的mRNA的分离的核酸。在一些实施方案中,本公开描述的组合物和方法可用于治疗受试者的肌萎缩性侧索硬化(ALS)。(In some embodiments, the present disclosure describes an inhibitory nucleic acid engineered to express an inhibitory nucleic acid targeting endogenous SOD1 and an isolated nucleic acid encoding an enhanced SOD1 protein.)

1. An isolated nucleic acid comprising:

(a) a first region encoding one or more first mirnas comprising a nucleic acid having sufficient sequence complementarity to an endogenous mRNA of a subject to hybridize to and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes a SOD1 protein; and

(b) a second region encoding an exogenous mRNA encoding a wild-type SOD1 protein,

wherein the one or more first miRNAs do not comprise a nucleic acid having sufficient sequence complementarity to hybridize to and inhibit expression of the exogenous mRNA.

2. The isolated nucleic acid of claim 1, wherein the exogenous mRNA lacks a 5 'untranslated region (5' UTR), lacks a 3 'untranslated region (3' UTR), or lacks both a 5'UTR and a 3' UTR.

3. The isolated nucleic acid of claim 1or 2, wherein the exogenous mRNA encoding the SOD1 protein has one or more silent base pair mutations relative to an endogenous mRNA, optionally wherein the exogenous mRNA comprises a nucleic acid sequence at least 95% identical to the endogenous mRNA.

4. The isolated nucleic acid of any one of claims 1-3, wherein the wild-type SOD1 protein consists of a sequence comprising SEQ ID NO:7 (enhanced SOD 1).

5. The isolated nucleic acid of any one of claims 1 to 4, wherein the one or more first miRNAs are targeted to an untranslated region (e.g., 5'UTR or 3' UTR) of a nucleic acid encoding an endogenous mRNA.

6. The isolated nucleic acid of any one of claims 1 to 4, wherein the one or more first miRNAs are targeted to a coding sequence of a nucleic acid encoding an endogenous mRNA.

7. The isolated nucleic acid of claim 6, wherein the one or more first miRNAs are complementary to a nucleic acid comprising a sequence defined by SEQ ID NO:2, 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of RNA encoded by the sequence set forth in seq id No. 2.

8. The isolated nucleic acid of claim 6 or 7, wherein the one or more first miRNAs are encoded by a nucleic acid sequence comprising SEQ ID NO:3 and/or 4, 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides of the sequence shown in 3 and/or 4.

9. The isolated nucleic acid of claim 8, wherein the one or more first mirnas further comprise a flanking region of miR-155 or miR-30.

10. The isolated nucleic acid of any one of claims 1 to 9, further comprising a first promoter.

11. The isolated nucleic acid of claim 10, wherein the first promoter is operably linked to the first region.

12. The isolated nucleic acid of claim 10 or 11, wherein the first promoter is an RNA polymerase III (pol III) promoter, optionally wherein the pol III promoter is an H1 promoter or a U6 promoter.

13. The isolated nucleic acid of claim 10 or 11, wherein the first promoter is an RNA polymerase II (polII) promoter, optionally wherein the pol II promoter is a chicken β actin (CBA) promoter, or an endogenous SOD1 promoter (e.g., SEQ ID NO: 16).

14. The isolated nucleic acid of any one of claims 10 to 13, further comprising a second promoter, wherein the second promoter is operably linked to the second region.

15. The isolated nucleic acid of claim 14, wherein the second promoter is a pol II promoter, optionally wherein the pol II promoter is a chicken β actin (CBA) promoter, or an endogenous SOD1 promoter.

16. The isolated nucleic acid of any one of claims 1 to 15, further comprising an enhancer sequence, optionally wherein the enhancer is a Cytomegalovirus (CMV) enhancer.

17. The isolated nucleic acid of any one of claims 1 to 15, wherein the first region is located within an untranslated region (e.g., UTR) of the second region.

18. The isolated nucleic acid of claim 17, wherein the first region is located within an intron of the isolated nucleic acid.

19. The isolated nucleic acid of any one of claims 1 to 18, wherein the first region is located 5' relative to the second region.

20. The isolated nucleic acid of any one of claims 1 to 19, further comprising at least one adeno-associated virus (AAV) Inverted Terminal Repeat (ITR).

21. The isolated nucleic acid of claim 20, comprising a full-length ITR and a mutant ITR, wherein the ITR flanks the first and second regions.

22. A recombinant adeno-associated virus (rAAV) comprising:

(i) the isolated nucleic acid of any one of claims 1 to 21; and

(ii) AAV capsid proteins.

23. The rAAV of claim 22, wherein the rAAV targets CNS tissue, optionally wherein the rAAV targets neurons.

24. The rAAV according to claim 21or 23, wherein the capsid protein is an AAV9 capsid protein or an aavrh.10 capsid protein.

25. A composition comprising the isolated nucleic acid according to any one of claims 1 to 21or the rAAV according to any one of claims 22 to 24, and a pharmaceutically acceptable excipient.

26. A method of inhibiting expression of SOD1 in a cell, the method comprising delivering to the cell the isolated nucleic acid of any one of claims 1 to 21or the rAAV of any one of claims 22 to 24.

27. The method of claim 26, wherein the cell comprises a nucleic acid sequence encoding a mutant SOD1 protein.

28. A method of treating a subject having or suspected of having a L S, the method comprising:

administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1 to 21, or an effective amount of the rAAV of any one of claims 22 to 24.

29. The method of claim 28, wherein the subject comprises a nucleic acid sequence encoding a mutant SOD1 protein.

30. The method of claim 28 or 29, wherein the subject is a mammalian subject, optionally a human subject.

Background

Amyotrophic lateral sclerosis (a L S) is a progressive and often fatal motor neuron disease, sometimes with frontotemporal dementia (FTD) a L S exists in both sporadic (SA L S) and familial (FA L S) forms.about 10% of cases are transmitted as autosomal dominant traits.

In contrast, in most studies, silencing reduced the levels of both mutant toxic SOD1 protein as well as wild-type SOD1 protein.

Summary of The Invention

Aspects of the present disclosure relate to compositions and methods for modulating cytoplasmic Cu/Zn superoxide dismutase (SOD1) expression in a cell, thus, in some embodiments, methods are provided for treating a L S, in some embodiments, the present disclosure provides a synthetic nucleic acid (e.g., a synthetic microRNA) engineered to inhibit endogenous SOD1 expression in a cell or subject, in some embodiments, the present disclosure provides a nucleic acid engineered to express exogenous SOD1 in a cell or subject, in some embodiments, such exogenous SOD1 is resistant to targeting of a synthetic nucleic acid (e.g., a synthetic microRNA) targeting endogenous SOD1, thus, in some embodiments, the present disclosure provides compositions and methods for coupling delivery of (1) a synthetic microRNA to silence expression of endogenous Cu/Zn superoxide dismutase (SOD1) activity, with (2) a second construct to express a mirna 1 having exogenous resistance to the synthetic microRNA.

The present disclosure is based, in part, on the compositions and methods described herein, which address the problem of loss of neuroprotective activity due to SOD1 disproportionation by concatenating an anti-SOD 1miRNA comprising SOD1 and a cDNA expressed from an RNA engineered to be resistant to the anti-SOD 1 miRNA. In some embodiments, the constructs described in the present disclosure allow for normal levels of SOD1 disproportionation activity (e.g., in a cell or subject to which the construct has been administered), even though both the WT and the mutant endogenous SOD1 allele are completely silenced.

Thus, in some aspects, the present disclosure provides an isolated nucleic acid comprising: a first region encoding one or more first mirnas comprising a nucleic acid having sufficient sequence complementarity to an endogenous mRNA of a subject to hybridize to and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes a SOD1 protein; and a second region encoding an exogenous mRNA encoding a wild-type SOD1 protein, wherein the one or more first mirnas do not comprise a nucleic acid having a complementary sequence sufficient to hybridize to and inhibit expression of the exogenous mRNA.

In some embodiments, the exogenous mRNA lacks a 5 'untranslated region (5' UTR), lacks a 3 'untranslated region (3' UTR), or lacks both a 5'UTR and a 3' UTR.

In some embodiments, the exogenous mRNA encoding the SOD1 protein has one or more silent base pair mutations relative to the endogenous mRNA. In some embodiments, the exogenous mRNA comprises a nucleic acid sequence that is at least 95% identical to the endogenous mRNA.

In some embodiments, the wild-type SOD1 consists of SEQ ID NO:7 (enhanced SOD1 sequence).

In some embodiments, the one or more first mirnas are targeted to an untranslated region (e.g., 5'UTR or 3' UTR) of a nucleic acid encoding an endogenous mRNA. In some embodiments, the one or more first mirnas are targeted to a coding sequence of a nucleic acid encoding an endogenous mRNA.

In some embodiments, the one or more first mirnas are identical to a miRNA comprising a sequence consisting of SEQ ID NO:3, 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of RNA encoded by the sequence set forth in seq id No. 3. In some embodiments, the one or more first mirnas are identical to a miRNA comprising a sequence consisting of SEQ ID NO:2, 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of RNA encoded by the sequence set forth in seq id No. 2.

In some embodiments, the one or more first mirnas comprise SEQ ID NO:4, or 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides of, or encoded by, the sequence set forth in seq id No. 4. In some embodiments, the one or more first mirnas comprise SEQ ID NO:3, or 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides of, or encoded by, the sequence set forth in seq id No. 3. In some embodiments, the miRNA further comprises a flanking region of miR-155 or a flanking region of miR-30.

In some embodiments, the isolated nucleic acid further comprises a first promoter. In some embodiments, the first promoter is operably linked to a first region of an isolated nucleic acid as described in the present disclosure.

In some embodiments, the first promoter is an RNA polymerase iii (pol iii) promoter, such as an H1 promoter or a U6 promoter.

In some embodiments, the first promoter is an RNA polymerase II (pol II) promoter, such as the chicken β actin (CBA) promoter, or the endogenous SOD1 promoter (e.g., SEQ ID NO: 16).

In some embodiments, the isolated nucleic acid further comprises a second promoter. In some embodiments, the second promoter is operably linked to a second region of the isolated nucleic acid as described in the present disclosure.

In some embodiments, the second promoter is a pol II promoter, such as a chicken β actin (CBA) promoter, or an endogenous SOD1 promoter.

In some embodiments, the isolated nucleic acid further comprises an enhancer sequence, such as the Cytomegalovirus (CMV) enhancer.

In some embodiments, the first region is located within an untranslated region (e.g., UTR) of the second region. In some embodiments, the first region is located within an intron of the isolated nucleic acid. In some embodiments, the first region is located at 5' relative to the second region.

In some embodiments, the isolated nucleic acid further comprises at least one adeno-associated virus (AAV) Inverted Terminal Repeat (ITR). In some embodiments, the isolated nucleic acid comprises a full-length ITR and a mutant ITR. In some embodiments, the ITRs flank the first and second regions of the isolated nucleic acids described in the present disclosure.

In some embodiments, the invention provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid and an AAV capsid protein as described in the present disclosure.

In some embodiments, the rAAV targets CNS tissue. In some embodiments, the rAAV targets a neuron.

In some embodiments, the capsid protein is an AAV9 capsid protein or an aavrh.10 capsid protein.

In some aspects, the disclosure provides a composition comprising an isolated nucleic acid as described in the disclosure or a rAAV as described in the disclosure, and a pharmaceutically acceptable excipient.

In some aspects, the disclosure provides methods for inhibiting expression of SOD1 in a cell, the method comprising delivering to the cell an isolated nucleic acid as described in the disclosure or a rAAV as described in the disclosure.

In some embodiments, the cell comprises a nucleic acid sequence encoding a mutant SOD1 protein.

In some aspects, the disclosure provides methods for treating a subject having or suspected of having a L S, the method comprising administering to the subject an effective amount of an isolated nucleic acid as described in the disclosure, or an effective amount of a rAAV as described in the disclosure.

In some embodiments, the subject comprises a nucleic acid sequence encoding a mutant SOD1 protein. In some embodiments, the subject is a mammalian subject, e.g., a human subject.

Brief description of the drawings

Figure 1 shows a schematic of the construct design of a bicistronic bifunctional vector anti-Sod 1miRNA is expressed by the H1 promoter and miRNA resistant Sod1cDNA is expressed by the chicken β actin promoter and CMV enhancer (e.g., CAG promoter).

FIG. 2 shows a schematic of the construct design for a single promoter bifunctional vector the anti-Sod 1miRNA and miRNA-resistant SOD1 cDNAs are both expressed by the chicken β actin promoter and CMV enhancer (e.g., CAG promoter). anti-Sod 1miR is located in an intron.

Figure 3 shows a schematic of the construct design of a bicistronic bifunctional vector anti-Sod 1miRNA is expressed by the H1 promoter and miRNA-resistant Sod1cDNA is expressed by the chicken β actin promoter and CMV enhancer (e.g., CAG promoter) the locus of Sod1cDNA containing silent mutations relative to wild-type Sod1 ("miR-Sod resistance target") is shown.

Figure 4 shows a schematic of the construct design for a single promoter bifunctional vector both the anti-Sod 1miRNA and miRNA resistant Sod1cDNA were expressed via the chicken β actin promoter and CMV enhancer (e.g., CAG promoter), the locus of Sod1cDNA containing silent mutations relative to wild-type Sod1 ("miR-Sod resistance target") was shown, the anti-Sod 1miR is located in an intron.

Figure 5 shows a schematic of the construct design for a bicistronic bifunctional self-complementary AAV vector anti Sod1miRNA was expressed by the H1 promoter and miRNA resistant Sod1cDNA was expressed by the chicken β actin promoter and CMV enhancer (e.g., CAG promoter) the locus of Sod1cDNA containing silent mutations relative to wild-type Sod1 ("miR-Sod resistance target") was shown.

Figure 6 shows a schematic of the construct design for a bicistronic bifunctional self-complementary AAV vector anti Sod1miRNA was expressed by the H1 promoter and miRNA resistant Sod1cDNA was expressed by the chicken β actin promoter and CMV enhancer (e.g., CAG promoter), Sod1 expression construct lacks 3' utr, mutant AAV Inverted Terminal Repeat (ITR) is present at the 5' end of the construct, full length AAV ITR is at the 3' end, a locus of Sod1cDNA containing silent mutations relative to wild type Sod1 ("miR-Sod resistance target").

Figure 7 shows a schematic of the construct design for a single promoter bifunctional AAV vector both anti-Sod 1miRNA and miRNA resistant Sod1cDNA are expressed by chicken β actin promoter and CMV enhancer (e.g., CAG promoter), the locus of Sod1cDNA containing silent mutations relative to wild-type Sod1 ("miR-Sod resistance target") is shown, anti-Sod 1miR is located in the intron, AAV ITRs are located at the 5 'and 3' ends of the construct.

Figure 8 shows a schematic of the construct design for a single promoter bifunctional AAV vector both anti-Sod 1miRNA and miRNA resistant Sod1 cdnas are expressed by the chicken β actin promoter and CMV enhancer (e.g., CAG promoter), showing the locus of Sod1cDNA containing silent mutations relative to wild-type Sod1 ("miR-Sod resistance target"). Sod1 expression construct lacks 3' utr.

FIG. 9 shows a nucleic acid sequence alignment of the wild-type SOD1 coding sequence (SEQ ID NO:1) with one example of an "enhanced" SOD1 coding sequence (SEQ ID NO: 7).

Detailed Description

For example, in some aspects, the present disclosure provides compositions (e.g., bifunctional vectors) that simultaneously express in a cell or subject (i) one or more synthetic nucleic acids that inhibit a gene associated with a S (e.g., inhibitory RNAs such as miRNA, siRNA, shRNA, etc.) and (ii) an exogenous gene associated with a S that encodes a protein that is resistant to the synthetic nucleic acid, examples of genes associated with a S include, but are not limited to, C9Orf, SOD, FUS, TARDBP, stm, VCP, OPTN, PFN, UBQ N, DCTN, a S, CHMP2, FIG, HNRNAP, ATXN, ANG, SPG, vagb, NEFH, chch, ERBB, PRPH, pfr, sema, tbxa, gma 4, sant, etc., the dominant gene encoding a related to a, netx, spx, spb, netfh, chch 2, hnrnasp, thrna, thnaf, etc., as well as other genes that are related to negative genes, e.g. the gene encoding a 17, e.g., related to afd. 13, natra, 13, e.g., related to nacfd, nacsff.

Aspects of the present disclosure relate to compositions and methods for modulating the expression of cytosolic Cu/Zn superoxide dismutase (SOD1) in cells accordingly, in some embodiments, methods are provided for treating a L S in some embodiments, the present disclosure provides synthetic nucleic acids (e.g., synthetic micrornas) engineered to inhibit expression of endogenous SOD1 in a cell or subject in some embodiments, the present disclosure provides nucleic acids engineered to express exogenous SOD1 in a cell or subject in some embodiments, such exogenous SOD1 is resistant to targeting of synthetic nucleic acids (e.g., synthetic micrornas) targeting endogenous SOD 1.

Aspects of the present disclosure relate to improved gene therapy compositions and related methods for treating a L S using recombinant adeno-associated virus (rAAV) vectors, in particular, rAAV containing nucleic acids engineered to express inhibitory nucleic acids that silence genes associated with a L S, such as SOD1, in some embodiments, the present disclosure utilizes recombinant AAV (e.g., rAAV9, raavrrh 10, etc.) to deliver microRNA to the CNS to silence a L S genes, e.g., SOD 1. in some aspects, the present disclosure relates to the discovery of a vector capable of simultaneously expressing wild-type SOD1 expression (e.g., wild-type SOD 734 and mutant SOD 8295 expression) while expressing wild-type SOD1 in a subject.

In some aspects, the present disclosure provides an isolated nucleic acid comprising: a first region encoding one or more first mirnas comprising a nucleic acid having sufficient sequence complementarity to an endogenous mRNA of a subject to hybridize to and inhibit expression of the endogenous mRNA, wherein the endogenous mRNA encodes a SOD1 protein; and a second region that is a coding region for an exogenous mRNA encoding a wild-type SOD1 protein, wherein the one or more first mirnas do not comprise a nucleic acid having a complementary sequence sufficient to hybridize to and inhibit expression of the exogenous mRNA.

SOD1

As used herein, "SOD1" refers to superoxide dismutase (SOD1), which is an enzyme encoded by the SOD1 gene in humans generally, the function of SOD1 is to catalyze the disproportionation of superoxide to hydrogen peroxide and dioxygen, and to remove free radicals in vivo "wild-type SOD1" refers to a gene product (e.g., a protein) encoded by SOD1 gene that does not cause the acquisition of toxic function in a cell or subject (e.g., does not or does not cause the occurrence of a L S.) in some embodiments, the wild-type SOD1 gene encodes an mRNA transcript (e.g., a mature mRNA transcript) having the sequence shown in NCBI accession No. NM — 000454.4.

"mutant SOD1" refers to a gene product (e.g., a protein) that comprises one or more mutations (e.g., missense mutations, nonsense mutations, frameshift mutations, insertions, deletions, etc.) that result in the gene product (e.g., protein) having an altered function, e.g., gain of toxic function. Typically, a nucleic acid encoding a mutant SOD1 gene product does not comprise any silent mutations relative to a nucleic acid encoding a wild-type SOD1 gene product.

The mutations in the gene encoding superoxide dismutase (SOD1) located on chromosome 21 are associated with familial amyotrophic lateral sclerosis superoxide dismutase (SOD1) is the enzyme encoded by the SOD1 gene SOD1 binds copper and zinc ions and is ONE of the three superoxide dismutases responsible for disrupting superoxide radicals in vivo the encoded isozyme is a soluble cytoplasmic and mitochondrial membrane space protein that converts naturally occurring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide as homodimers SOD1, which occurs and causes a L S, to frequently mutate including A4V, H46R and g93a further SOD1 mutations are described, for example, by Banci et al (2008) P L oS ONE 3(2) e 1677.

The present disclosure is based, in part, on the discovery that a nucleic acid construct that simultaneously inhibits endogenous SOD1 expression (e.g., silences endogenous wild-type and endogenous mutant SOD1) and expresses exogenous SOD1 protein (e.g., expresses exogenous wild-type SOD 1or exogenous enhanced SOD1 protein) in a non-allele-specific manner allows for normal levels of SOD1 disproportionation activity, even in the event both WT and mutant endogenous SOD1 alleles are completely silenced. As used herein, "endogenous" refers to a gene (e.g., SOD1 gene) or gene product (e.g., SOD1 protein) encoded by the natural DNA of a cell. "exogenous" refers to a gene (e.g., a nucleic acid encoding an SOD1 protein, such as SOD1 cDNA) or gene product (e.g., an SOD1 protein, such as enhanced SOD1 protein) derived from a source other than the native DNA of a cell (e.g., not naturally introduced into a cell).

In some embodiments, the exogenous SOD1 nucleic acid sequence encodes an enhanced SOD1 protein. As used herein, "enhanced SOD1" refers to a nucleic acid sequence encoding a SOD1 protein that contains one or more silent mutations such that it encodes the same protein as an endogenous wild-type SOD1 protein, but has a different primary nucleic acid (e.g., DNA) sequence. Without wishing to be bound by any particular theory, the "enhanced SOD1" mRNA transcript is not inhibited by certain inhibitory RNAs (e.g., mirnas) that target endogenous SOD1 RNA transcripts (e.g., wild-type SOD1 and mutant SOD1 transcripts).

The number of silent mutations in the enhanced SOD1 nucleic acid sequence may vary. In some embodiments, the nucleic acid sequence encoding enhanced SOD1 comprises about 1 to about 50 (e.g., any integer between 1 and 50 inclusive) silent mutations relative to a wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 coding sequence). In some embodiments, the nucleic acid sequence encoding enhanced SOD1 comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 silent mutations relative to a wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 coding sequence). In some embodiments, the one or more silent mutations of the nucleic acid sequence encoding enhanced SOD1 are located in the seed region targeted by the inhibitory nucleic acid. In some embodiments, the seed region ranges from about 3 to about 25 contiguous nucleotides in length (e.g., any integer between 3 and 25, inclusive).

The nucleic acid (e.g., DNA) sequence identity between the nucleic acid encoding the exogenous (e.g., enhanced) SOD1 protein and the endogenous wild-type SOD1 protein can vary. In some embodiments, the nucleic acid sequence encoding the exogenous SOD1 protein is about 99.9% to about 85% identical to an endogenous wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 DNA coding sequence). In some embodiments, the nucleic acid sequence encoding the exogenous SOD1 protein is about 99.9%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 89%, about 88%, about 87%, about 86%, or about 85% identical to an endogenous wild-type SOD1 nucleic acid sequence (e.g., SEQ ID NO: 1; SOD1 DNA coding sequence). In some embodiments, the nucleic acid sequence encodes an exogenous SOD1 protein that has an amino acid sequence that is about 99.9% to about 90% (e.g., about 99.9%, about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, or about 90%) identical to an endogenous wild-type SOD1 amino acid sequence (e.g., SEQ ID NO: 17).

Inhibitory nucleic acids

Aspects of the disclosure relate to inhibitory nucleic acids that target SOD1 (e.g., endogenous SOD 1). In some embodiments, an inhibitory nucleic acid is a nucleic acid that hybridizes to and inhibits the function or expression of at least a portion of a target nucleic acid, e.g., RNA, pre-mRNA, mRNA. In some embodiments, the inhibitory nucleic acid is single-stranded or double-stranded. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence as set forth in SEQ ID NO: 4: CTGCATGGATTCCATGTTCAT or encoded by it (miR-SOD-127). In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence as set forth in SEQ ID NO: 3: CTGCATGGATTCCATGTTCAT or encoded by it (miR-SOD-127). In some embodiments, the inhibitory nucleic acid is a nucleic acid comprising SEQ ID NO:3 and SEQ ID NO:4, or a mature miRNA. In some embodiments, the nucleic acid sequence of SEQ ID NO:3 is the guide strand of the mature miRNA, and SEQ ID NO:4 is the passenger strand of the mature miRNA (e.g., miRNA).

In some embodiments, the inhibitory nucleic acid is 5 to 30 bases in length (e.g., 10-30, 15-25, 19-22). Inhibitory nucleic acids may also be 10-50 or 5-50 bases in length. For example, the inhibitory nucleic acid can be any one of 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the inhibitory nucleic acid comprises or consists of the base sequence of: a base sequence that is at least 80% or 90% complementary to, e.g., at least 5, 10, 15, 20, 25, or 30 bases, or up to 30 or 40 bases, of a target nucleic acid; or a base sequence having up to 6 mismatches at 10, 15, 20, 25 or 30 bases of the target nucleic acid.

In some embodiments, any one or more thymine (T) or uracil (U) nucleotides in the sequences provided herein can be replaced with any other nucleotide suitable for base pairing with an adenine nucleotide (e.g., by watson-crick base pairing). For example, T may be replaced by U, and U may be replaced by T. In some embodiments, inhibitory nucleic acids that inhibit gene expression in central nervous system cells are provided. In some embodiments, the cell is a neuron, an astrocyte or an oligodendrocyte.

In some embodiments, the inhibitory nucleic acid is a miRNA. "microRNAs" or "miRNAs" are small non-coding RNA molecules capable of mediating transcriptional or post-translational gene silencing. Typically, mirnas are transcribed as hairpin or stem-loop (e.g., having self-complementary, single-stranded backbone) duplex structures, referred to as primary mirnas (pri-mirnas), which are enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into pre-mirnas. The pri-miRNA may vary in length. In some embodiments, the pri-miRNA ranges in length from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs). In some embodiments, the pri-miRNA is greater than 200 base pairs in length (e.g., 2500, 5000, 7000, 9000 or more base pairs in length).

Pre-mirnas are also characterized by hairpin or stem-loop duplex structures, which may also vary in length. In some embodiments, the pre-miRNA ranges in size from about 40 base pairs to about 500 base pairs in length. In some embodiments, the pre-miRNA ranges in size from about 50 to 100 base pairs in length. In some embodiments, the pre-miRNA ranges in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length).

Typically, pre-mirnas are exported into the cytoplasm and enzymatically processed by Dicer to first produce imperfect miRNA/miRNA duplexes and then single-stranded mature miRNA molecules, which are then loaded into the RNA-induced silencing complex (RISC). Typically, the size of the mature miRNA molecule ranges from about 19 to about 30 base pairs in length. In some embodiments, the mature miRNA molecule is about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length. In some embodiments, an isolated nucleic acid of the present disclosure comprises a sequence encoding a pri-miRNA, pre-miRNA, or mature miRNA, the sequence comprising SEQ ID NO: 4(miR-SOD-127) and/or SEQ ID NO:3 or encoded by the sequence shown in 3.

In some aspects, the present disclosure provides isolated nucleic acids and vectors (e.g., rAAV vectors) encoding one or more artificial mirnas. As used herein, "artificial miRNA" or "amiRNA" refers to an endogenous pri-miRNA or pre-miRNA (e.g., a miRNA backbone, which is a precursor miRNA capable of producing a functional mature miRNA), wherein the miRNA and miRNA sequences (e.g., the passenger strand of the miRNA duplex) have been replaced with corresponding amiRNA/amiRNA sequences that direct efficient RNA silencing of target genes, e.g., as described by amens et al (2014), Methods mol.biol.1062: 211-. For example, in some embodiments, the artificial miRNA comprises a miR-155pri-miRNA backbone into which a sequence encoding a mature SOD 1-specific miRNA (e.g., SEQ ID NOs: 3 and/or 4; miR-SOD-127) has been inserted in place of the endogenous miR-155 mature miRNA coding sequence. In some embodiments, a miRNA (e.g., an artificial miRNA) described in the present disclosure comprises a miR-155 backbone sequence, a miR-30 backbone sequence, a miR-64 backbone sequence, a miR-106 backbone, a miR-21 backbone, a miR-1 backbone, a miR-451 backbone, a miR-126 backbone, or a miR-122 backbone sequence. In some embodiments, the inhibitory nucleic acid is a microRNA comprising a targeting sequence with a flanking region of miR-155 or miR-30.

It will be understood that in some embodiments, an isolated nucleic acid or vector (e.g., a rAAV vector) comprises a nucleic acid sequence encoding more than one (e.g., multiple, e.g., 2, 3, 4, 5, 10 or more) miRNA. In some embodiments, each of the more than one miRNA targets (e.g., specifically hybridizes or binds) the same target gene (e.g., isolated nucleic acid encoding three unique mirnas, wherein each miRNA targets the SOD1 gene). In some embodiments, each of the more than one miRNA targets (e.g., specifically hybridizes or binds) a different target gene.

Isolated nucleic acids

In some aspects, the disclosure relates to an isolated nucleic acid comprising a first expression construct encoding a synthetic microRNA for inhibiting expression of endogenous SOD1 and a second expression construct expressing an exogenous SOD1 that is resistant to synthetic microRNA (mirna).

A "nucleic acid" sequence refers to a DNA or RNA sequence. In some embodiments, the proteins and nucleic acids of the present disclosure are isolated. As used herein, the term "isolated" refers to artificially produced. The term "isolated" as used herein with respect to a nucleic acid refers to: (i) amplified in vitro, for example by Polymerase Chain Reaction (PCR); (ii) produced by cloning and recombination; (iii) purified, such as by lysis and gel separation; or (iv) synthesized, for example, by chemical synthesis. An isolated nucleic acid is one that is readily manipulated by recombinant DNA techniques well known in the art. Thus, the nucleotide sequence contained in the vector is considered to be isolated, with 5 'and 3' restriction sites known, or for which Polymerase Chain Reaction (PCR) primer sequences have been disclosed, but the nucleic acid sequence in its native state in its native host is not isolated. An isolated nucleic acid may be substantially purified, but is not required. For example, a nucleic acid isolated in a cloning or expression vector is not pure, as it may only constitute a very small percentage of the material in the cell in which it resides. However, as the term is used herein, such nucleic acid is isolated as it is readily manipulated by standard techniques known to those of ordinary skill in the art. The term "isolated" as used herein with respect to a protein or peptide refers to a protein or peptide that is isolated from its natural environment or that has been artificially produced (e.g., by chemical synthesis, by recombinant DNA techniques, etc.).

The isolated nucleic acids of the present disclosure typically comprise one or more regions of inhibitory RNA encoding one or more endogenous mrnas targeted to the subject (e.g., mRNA encoding endogenous wild-type SOD1 and/or endogenous mutant SOD 1). An isolated nucleic acid typically also comprises one or more regions encoding one or more exogenous mrnas. The proteins encoded by one or more exogenous mrnas may or may not differ in sequence composition from the proteins encoded by one or more endogenous mrnas. For example, one or more endogenous mrnas may encode wild-type and mutant versions of a particular protein, e.g., as may be the case if a subject is heterozygous for a particular mutation, and an exogenous mRNA may encode a wild-type mRNA for the same particular protein. In this case, the sequences of the exogenous mRNA and the endogenous mRNA, which typically encode the wild-type protein, differ sufficiently that the exogenous mRNA is not targeted by the inhibitory RNA or RNAs. This can be accomplished, for example, by introducing one or more silent mutations into the exogenous mRNA that encode the same protein as the endogenous mRNA, but with a different nucleic acid sequence. In this case, the exogenous mRNA may be referred to as "fortified". Alternatively, inhibitory RNAs (e.g., mirnas) may be targeted to 5 'and/or 3' untranslated regions of endogenous mrnas. These 5 'and/or 3' regions may then be removed or replaced in the exogenous mRNA so that the exogenous mRNA is not targeted by the inhibitory RNA or RNAs.

In another example, one or more endogenous mrnas may encode only mutant forms of a particular protein, e.g., may be the case where a subject is homozygous for a particular mutation, and an exogenous mRNA may encode a wild-type mRNA for the same particular protein. In this case, the sequence of the exogenous mRNA may be enhanced as described above, or one or more inhibitory RNAs may be designed to distinguish the mutated endogenous mRNA from the exogenous mRNA.

In some embodiments, an isolated nucleic acid typically comprises a first region encoding one or more first inhibitory RNAs (e.g., mirnas) comprising a nucleic acid having a sequence sufficiently complementary to an endogenous mRNA of a subject to hybridize to and inhibit expression of the endogenous mRNA (e.g., endogenous SOD1 mRNA). The isolated nucleic acid typically further comprises a second region encoding an exogenous mRNA (e.g., exogenous SOD1), wherein the protein encoded by the exogenous mRNA has an amino acid sequence at least 95% identical to the first protein, wherein the one or more first inhibitory RNAs do not comprise a nucleic acid having sufficient sequence complementarity to hybridize to and inhibit expression of the exogenous mRNA. For example, the first region may be located at any suitable location. The first region may be located within an untranslated portion of the second region. The first region may be located in any untranslated region of a nucleic acid, including, for example, introns, 5 'or 3' untranslated regions, and the like.

The region comprising the inhibitory nucleic acid (e.g., the first region) can be located at any suitable location of the isolated nucleic acid. This region may be located in any untranslated region of a nucleic acid, including, for example, introns, 5 'or 3' untranslated regions, and the like.

In some cases, it may be desirable to position the region (e.g., a first region) upstream of a first codon of a nucleic acid sequence encoding a protein (e.g., a second region encoding an exogenous SOD1 protein-encoding sequence). For example, the region may be located between the first codon and 2000 nucleotides upstream of the first codon of the protein coding sequence. This region may be located between the first codon and 1000 nucleotides upstream of the first codon of the protein coding sequence. This region may be located between the first codon and 500 nucleotides upstream of the first codon of the protein coding sequence. This region may be located between the first codon and 250 nucleotides upstream of the first codon of the protein coding sequence. This region may be located between the first codon and 150 nucleotides upstream of the first codon of the protein coding sequence.

In some cases, it may be desirable to position the region (e.g., a region encoding an inhibitory nucleic acid, such as the first region) upstream of the poly a tail of the region encoding the exogenous SOD1 protein. For example, the region may be located between the first base of the poly a tail and 2000 nucleotides upstream of the first base. This region may be located between the first base of the poly a tail and 1000 nucleotides upstream of the first base. This region may be located between the first base of the poly a tail and 500 nucleotides upstream of the first base. This region may be located between the first base of the poly a tail and 250 nucleotides upstream of the first base. This region may be located between the first base of the poly a tail and 150 nucleotides upstream of the first base. The region may be located between the first base of the poly a tail and 100 nucleotides upstream of the first base. This region may be located between the first base of the poly a tail and 50 nucleotides upstream of the first base. The region may be located between the first base of the poly a tail and 20 nucleotides upstream of the first base. In some embodiments, the region is located between the last nucleotide base of the promoter sequence and the first nucleotide base of the poly a tail sequence.

In some cases, the region encoding the inhibitory nucleic acid (e.g., the first region) may be located downstream of the last base of the poly a tail of the region encoding the exogenous SOD1 protein. This region may be between the last base of the poly a tail and 2000 nucleotides downstream of the last base. This region may be between the last base of the poly a tail and the position 1000 nucleotides downstream of the last base. This region may be between the last base of the poly a tail and a position 500 nucleotides downstream of the last base. This region may be between the last base of the poly a tail and a position 250 nucleotides downstream of the last base. This region may be between the last base of the poly a tail and 150 nucleotides downstream of the last base.

It will be understood that where an isolated nucleic acid encodes more than one miRNA, each miRNA may be positioned at any suitable location in the construct. For example, the nucleic acid encoding the first miRNA may be located in an intron of a region encoding the exogenous SOD1 protein, and the nucleic acid sequence encoding the second miRNA may be located in another region (e.g., between the last codon of the protein coding sequence and the first base of the poly a tail of the transgene).

In some embodiments, the isolated nucleic acid further comprises a nucleic acid sequence encoding one or more expression control sequences (e.g., promoters, etc.). Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and, when desired, sequences that enhance secretion of the encoded product. A wide variety of expression control sequences, including native, constitutive, inducible, and/or tissue-specific promoters, are known in the art and can be utilized.

"promoter" refers to a DNA sequence required to initiate specific transcription of a gene and recognized by the synthetic machinery of the cell or by the synthetic machinery introduced. The phrases "operatively positioned," "under control," or "under transcriptional control" refer to a promoter in the correct position and orientation relative to a nucleic acid to control RNA polymerase initiation and gene expression.

For nucleic acids encoding proteins, polyadenylation sequences are typically inserted after the transgene sequence and before the 3' AAV ITR sequences. rAAV constructs useful in the present disclosure may also contain introns, ideally located between the promoter/enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is referred to as the SV-40T intron sequence. Another vector element that may be used is an Internal Ribosome Entry Site (IRES). IRES sequences are used to produce more than one polypeptide from a single gene transcript. IRES sequences will be used to produce proteins containing more than one polypeptide chain. The selection of these and other common vector elements is routine and many such sequences are available [ see, e.g., Sambrook et al, and references cited therein, e.g., at pages 3.183.26 and 16.1716.27, and Ausubel et al, Current Protocols in molecular Biology, John Wiley & Sons, New York,1989 ]. In some embodiments, the foot-and-mouth disease virus 2A sequence is included in a polyprotein; this is a small peptide (about 18 amino acids in length) which has been shown to mediate cleavage of multiple proteins (Ryan, M D et al, EMBO, 1994; 4: 928-933; Mattion, N M et al, J Virology,1996, 11 months; p.8124-8127; Furler, S et al, Gene Therapy, 2001; 8: 864-873; and Halpin, C et al, The plant journal, 1999; 4: 453-459). The cleavage activity of The 2A sequence has previously been demonstrated in artificial systems including plasmids and Gene Therapy vectors (AAV and retroviruses) (Ryan, M D et al, EMBO, 1994; 4: 928-933; Mattion, N M et al, J Virology,1996, 11 months; p.8124-8127; Furler, S et al, Gene Therapy, 2001; 8: 864-873; and Halpin, C et al, The Plant Journal, 1999; 4: 453-459; de Felipe, P et al, Therapy, 1999; 6: 198-208; de Felipe, P et al, Human Gene Therapy, 2000; 11: 1921-1931; and Klump, H et al, Gene Therapy, 2001; 8: 811-817).

Examples of constitutive promoters include, but are not limited to, the retroviral Rous Sarcoma Virus (RSV) L TR promoter (optionally with an RSV enhancer), the Cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) [ see, e.g., Boshart et al, Cell, 41: 521-S-530 (1985) ], the SV40 promoter, the dihydrofolate reductase promoter, the β -actin promoter (e.g., the CBA promoter), the phosphoglycerate kinase (PGK) promoter, and the EF1 α promoter [ Invitrogen ]. in some embodiments, the promoter is an enhanced chicken β -actin promoter (CAG promoter). in some embodiments, the promoter is the H1 promoter or the U6 promoter.

Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature or the presence of specific physiological states, such as acute phase, specific differentiation state of the cell or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously provided promoters include the zinc-inducible sheep Metallothionein (MT) promoter, the dexamethasone (Dex) -inducible Mouse Mammary Tumor Virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); ecdysone insect promoter (No. et al, Proc. Natl. Acad. Sci. USA,93: 3346-containing 3351(1996)), tetracycline suppression system (Gossen et al, Proc. Natl. Acad. Sci. USA,89: 5547-containing 5551(1992)), tetracycline induction system (Gossen et al, Science,268: 1766-containing 1769(1995), see also Harvey et al, curr. Opin. chem. biol.,2: 512-containing 518(1998)), RU 486-induction system (Wang et al, nat. Biotech.,15: 239-containing 243(1997) and Wang et al, Gene the r.,4: 432-containing 441(1997)) and rapamycin induction system (Magari et al, J. Clin. 100: 2865-containing 2872 (1997)). Other types of inducible promoters that can be used in the present invention are those that are regulated by a particular physiological state, such as temperature, acute phase, particular differentiation state of the cell, or only in replicating cells.

In another embodiment, the native promoter of SOD1 (e.g., SEQ ID NO:16) will be used. A native promoter may be preferred when it is desired that expression of the transgene should mimic native expression. When expression of a transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus, a native promoter may be used. In another embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences may also be used to mimic native expression.

In some embodiments, the regulatory sequences confer tissue-specific Gene expression capability, in some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner.such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art.exemplary tissue-specific regulatory sequences include, but are not limited to, the liver-specific thyroxine-binding globulin (TBG) promoter, the insulin promoter, the glucagon promoter, the somatostatin promoter, the Pancreatic Polypeptide (PPY) promoter, the synapsin-1 (syn) promoter, the creatine kinase (MCK) promoter, the mammalian Desmin (DES) promoter, the α -myosin heavy chain (a-MHC) promoter or the cardiac troponin T (cTnT) promoter other exemplary promoters include the β -actin promoter, the hepatitis B virus core promoter, the Sandig et al, Gene Therr, 3:1002-9 (AFP) promoter, the Arbutinol Gene promoter, the human neuronopher promoter, the human neuronopalin promoter, the human neurona promoter, the human neurona, the human promoter.

In some embodiments, the first promoter sequence (e.g., the promoter driving expression of the protein coding region) is a pol iii polymerase (iii) promoter sequence polIII) non-limiting examples of promoter sequences include U6 and H1 promoter sequences, in some embodiments, the second promoter sequence (e.g., the promoter driving expression of the exogenous RNA coding region) is a pol iii promoter sequence, in other embodiments, a pol iii promoter sequence, a promoter sequence including a U6 and H1 promoter sequence, in other embodiments, a pol iii promoter sequence (e.g., the promoter driving expression of the exogenous RNA sequence) is a pol iii promoter sequence, in other embodiments, a pol iii promoter sequence, a promoter sequence including a dna sequence, a promoter sequence that drives expression of a chicken RNA iii protein, in other embodiments, e.g., a promoter sequence that drives expression of a promoter, a promoter sequence that drives expression of a promoter, a promoter region of a promoter.

As described further below, the isolated nucleic acid may comprise Inverted Terminal Repeats (ITRs) of an AAV serotype selected from the group consisting of: AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof.

Polycistronic constructs

Some aspects of the invention provide polycistronic (e.g., bicistronic) expression constructs comprising two or more expression cassettes of different compositions.

In various embodiments, polycistronic (e.g., bicistronic) expression constructs are provided in which the expression cassettes are positioned in different ways. For example, in some embodiments, a polycistronic expression construct is provided wherein a first expression cassette is located adjacent to a second expression cassette. In some embodiments, a polycistronic expression construct is provided, wherein the first expression cassette comprises an intron, and the second expression cassette is located within the intron of the first expression cassette. In some embodiments, the second expression cassette, which is located within an intron of the first expression cassette, comprises a promoter and a nucleic acid sequence encoding a gene product operably linked to the promoter.

In various embodiments, polycistronic (e.g., bicistronic) expression constructs are provided in which the expression cassettes are oriented in different ways. For example, in some embodiments, a polycistronic expression construct is provided wherein the first expression cassette is in the same orientation as the second expression cassette. In some embodiments, a polycistronic expression construct is provided comprising first and second expression cassettes in opposite orientations.

The term "orientation" as used herein in relation to an expression cassette refers to the directional characteristic of a given cassette or structure. In some embodiments, the expression cassette comprises a promoter at the 5' end of the encoding nucleic acid sequence, and transcription of the encoding nucleic acid sequence proceeds from the 5' end to the 3' end of the sense strand, making it a targeting cassette (e.g., 5' -promoter/(intron)/coding sequence-3 '). Since virtually all expression cassettes are oriented in this sense, one skilled in the art can readily determine the orientation of a given expression cassette relative to a second nucleic acid structure (e.g., a second expression cassette, a viral genome) or, if the cassette is contained in an AAV construct, to an AAV ITR.

For example, if a given nucleic acid construct comprises two expression cassettes, configured as 5 '-promoter 1/coding sequence 1-promoter 2/coding sequence 2-3',

>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

the expression cassettes are in the same direction and the arrows indicate the direction of transcription for each cassette. For example, if a given nucleic acid construct comprises a sense strand comprising a sequence consisting of 5 '-promoter 1/coding sequence 1-coding sequence 2/promoter 2-3',

>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<

the expression cassettes are in opposite directions to each other and the transcription direction of the expression cassettes is opposite as indicated by the arrows. In this example, the strands shown comprise promoter 2 and the antisense strand of coding sequence 2.

For another example, if the expression cassette is contained in an AAV construct, the cassette can be in the same orientation as the AAV ITRs (e.g., the structures depicted in fig. 5, etc.), or in the opposite orientation. AAV ITRs are targeted. For example, the mutated 5'ITR illustrated in figure 5 will be in the same orientation as the expression cassette encoding the H1 promoter/inhibitory RNA, but in the opposite orientation as the 3' ITR if both the ITR and the expression cassette are on the same nucleic acid strand.

rAAV vector

The isolated nucleic acid of the invention may be a recombinant adeno-associated virus (AAV) vector (rAAV vector). In some embodiments, an isolated nucleic acid as described in the present disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) Inverted Terminal Repeat (ITR) or a variant thereof. Isolated nucleic acids (e.g., recombinant AAV vectors) can be packaged into capsid proteins and administered to a subject and/or delivered to selected target cells. A "recombinant AAV (rAAV) vector" typically consists of at least a transgene and its regulatory sequences, and 5 'and 3' AAV Inverted Terminal Repeats (ITRs). As disclosed elsewhere herein, a transgene may comprise one or more regions encoding one or more inhibitory RNAs (e.g., mirnas) comprising nucleic acids that target endogenous mrnas of a subject. The transgene may also comprise regions encoding, for example, proteins and/or expression control sequences (e.g., a poly-a tail), as described elsewhere in this disclosure.

Generally, ITR sequences are about 145 base pairs (bp) in length, preferably, substantially all of the sequences encoding ITRs are used in the molecule, although minor modifications to these sequences are permitted, the ability to modify these ITR sequences is within the capabilities of those skilled in the art (see, e.g., textbooks such as Sambrook et al, "Molecular cloning.A L abortory Manual",2d ed., Cold Spring Harbor L abortory, New York (1989); and K.Fisher et al, J Virol.865.70: 520532 (1996)), a textbook of J.865.865.865.865.865.865.12: 5201996) wherein the selected transgene sequence and associated regulatory elements are flanked by 5 'and 3' AAV ITR sequences.

In some embodiments, the isolated nucleic acid further comprises a region comprising a second AAV ITR (e.g., a second region, a third region, a fourth region, etc.). In some embodiments, the second AAV ITR has a serotype selected from the group consisting of AAV1, AAV2, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, and variants thereof. In some embodiments, the second ITR is a mutant ITR that lacks a functional terminal dissociation site (TRS). The term "lacking a terminal cleavage site" can refer to an AAV ITR that comprises a mutation (e.g., a sense mutation, such as a non-synonymous mutation or a missense mutation) that eliminates the function of a terminal cleavage site (TRS) of the ITR, or to a truncated AAV ITR that lacks a nucleic acid sequence encoding a functional TRS (e.g., a Δ TRS ITR). Without wishing to be bound by any particular theory, a rAAV vector comprising an ITR lacking functional TRS produces a self-complementary rAAV vector, e.g., as described in McCarthy (2008) Molecular Therapy 16(10): 1648-1656.

In addition to the major elements of the recombinant AAV vector identified above, the vector also includes conventional control elements operatively linked to the transgene element in a manner that allows for transcription, translation and/or expression of the transgene in cells transfected with the vector or infected with the virus produced by the present invention. As used herein, "operably linked" sequences include expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and, when desired, sequences that enhance secretion of the encoded product. Many expression control sequences, including natural, constitutive, inducible, and/or tissue-specific promoters, are known in the art and can be utilized.

As used herein, a nucleic acid sequence (e.g., coding sequence) and a regulatory sequence are said to be operably linked when they are covalently linked in a manner such that expression or transcription of the nucleic acid sequence is under the influence or control of the regulatory sequence. When translation of a nucleic acid sequence into a functional protein is desired, two DNA sequences are considered to be operably linked if induction of the promoter in the 5' regulatory sequence results in transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame shift mutation, (2) interfere with the ability of the promoter region to direct transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a promoter region is operably linked to a nucleic acid sequence if it is capable of affecting the transcription of the DNA sequence such that the resulting transcript can be translated into the desired protein or polypeptide. Similarly, two or more coding regions are operably linked when they are linked in such a way that their transcription from a common promoter results in the expression of two or more proteins that have been translated in frame. In some embodiments, the operably linked coding sequences produce a fusion protein.

Recombinant adeno-associated virus (rAAV)

In some aspects, the disclosure provides an isolated AAV. The term "isolated" as used herein with respect to AAV refers to AAV that has been artificially produced or obtained. Isolated AAV can be produced using recombinant methods. Such AAV is referred to herein as "recombinant AAV". The recombinant aav (rAAV) preferably has tissue-specific targeting capabilities such that the nuclease and/or transgene of the rAAV will specifically deliver to one or more predetermined tissues. The AAV capsid is an important element that determines the ability of these tissues to be specifically targeted. Thus, rAAV can be selected having a capsid suitable for targeting a tissue.

Methods for obtaining recombinant AAV having a desired capsid protein are well known in the art. (see, e.g., US2003/0138772), the contents of which are incorporated herein by reference in their entirety). Generally, the methods comprise culturing a vector comprising a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; a recombinant AAV vector consisting of an AAV Inverted Terminal Repeat (ITR) and a transgene; and a host cell with sufficient helper functions to allow packaging of the recombinant AAV vector into an AAV capsid protein. In some embodiments, the capsid protein is a structural protein encoded by the cap gene of AAV. AAV comprises three capsid proteins, virion proteins 1 through 3 (designated VP1, VP2, and VP3), all of which are transcribed from a single cap gene by alternative splicing. In some embodiments, VP1, VP2, and VP3 have molecular weights of about 87kDa, about 72kDa, and about 62kDa, respectively. In some embodiments, upon translation, the capsid proteins form a spherical 60-mer protein shell around the viral genome. In some embodiments, the capsid proteins function to protect the viral genome, deliver the genome, and interact with the host. In some aspects, the capsid protein delivers the viral genome to the host in a tissue-specific manner.

In some embodiments, the AAV capsid protein is an AAV serotype selected from the group consisting of AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAVrh8, AAV9, AAV10, aavrh.10, AAV aav.phb, and variants of any of the foregoing. In some embodiments, the AAV capsid protein is a serotype derived from a non-human primate, such as the AAVrh10 serotype. In some embodiments, the AAV capsid protein is of AAV9 serotype.

The components cultured in the host cell to package the rAAV vector in the AAV capsid can be provided to the host cell in trans. Alternatively, any one or more desired components (e.g., recombinant AAV vectors, rep sequences, cap sequences, and/or helper functions) can be provided by a stable host cell that has been engineered to contain one or more desired components using methods known to those skilled in the art. Most suitably, such a stable host cell will contain the desired components under the control of an inducible promoter. However, the desired components may be under the control of a constitutive promoter. In the discussion of regulatory elements suitable for transgenes, examples of suitable inducible and constitutive promoters are provided herein. In another alternative, the selected stable host cell may contain the selected component under the control of a constitutive promoter and the other selected component under the control of one or more inducible promoters. For example, a stable host cell can be produced which is derived from 293 cells (which contain the E1 helper function under the control of a constitutive promoter), but which contain rep and/or cap proteins under the control of an inducible promoter. Other stable host cells may also be produced by those skilled in the art.

In some embodiments, the disclosure relates to host cells containing a nucleic acid comprising a sequence encoding an inhibitory nucleic acid targeting endogenous SOD1 and a sequence encoding a foreign protein (e.g., a foreign SOD1 protein, optionally an "enhanced" foreign SOD1 protein). In some embodiments, the present disclosure relates to compositions comprising the above-described host cells. In some embodiments, a composition comprising a host cell as described above further comprises a cryopreservative.

The methods used to construct any embodiment of the present disclosure are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering and synthetic techniques, see, e.g., Sambrook et al, Molecular Cloning: A L biology Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. similarly, methods of producing rAAV virions are well known, and the selection of suitable methods is not a limitation of the present disclosure, see, e.g., K.Fisher et al, J.Virol, 70:520 (1993) and U.S. patent No. 5,478,745.

In some embodiments, recombinant AAV may be produced using triple transfection methods (described in detail in U.S. patent No. 6,001,650.) typically, recombinant AAV helper function vectors encode "AAV helper function" sequences (i.e., rep and cap) that act in trans for productive AAV replication and encapsidation, by transfecting host cells with recombinant AAV vectors (comprising a transgene), AAV helper function vectors, and helper function vectors to be packaged into AAV particles preferably, the AAV helper function vectors support efficient AAV vector production without producing any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). non-limiting examples of vectors suitable for use in the present disclosure include pH L P19, described in U.S. patent No. 6,001,650, and pr 6cap6 vectors, described in U.S. patent No. 6,156,303, both incorporated herein by reference.

The term "transfection" is used to refer to the uptake of exogenous DNA by a cell, and when exogenous DNA is introduced inside the cell membrane, the cell is "transfected". A number of transfection techniques are generally known in the art, see, e.g., Graham et al (1973) Virology,52:456, Sambrook et al (1989) Molecular cloning, a laboratory manual, Cold Spring Harbor L organisms, New York, Davis et al (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al (1981) Gene 13: 197. such techniques can be used to introduce one or more exogenous nucleic acids, such as nucleotide integration vectors and other nucleic acid molecules, into a suitable host cell.

"host cell" refers to any cell that carries or is capable of carrying a substance of interest. Typically the host cell is a mammalian cell. The host cell can be used as a recipient for AAV helper constructs, AAV minigene plasmids, helper function vectors, or other transfer DNA associated with recombinant AAV production. The term includes progeny of the original cell that has been transfected. Thus, a "host cell" as used herein may refer to a cell that has been transfected with an exogenous DNA sequence. It is understood that progeny of a single parent cell may not necessarily be identical in morphology or in genomic or total DNA complement (DNA complement) to the original parent due to natural, accidental, or deliberate mutation.

As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Typically, a cell line is a clonal population derived from a single progenitor cell. It is also known in the art that spontaneous or induced changes in karyotype can occur during storage or transfer of such clonal populations. Thus, cells derived from the mentioned cell lines may not be exactly the same as the progenitor cells or progenitor cultures, and the mentioned cell lines include such variations.

The term "recombinant cell" as used herein refers to a cell into which has been introduced an exogenous DNA segment, e.g., a DNA segment that results in the transcription of a biologically active polypeptide or the production of a biologically active nucleic acid, e.g., RNA.

The term "vector" as used herein includes any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc., which is capable of replication when combined with appropriate control elements and which is capable of transferring gene sequences between cells. Thus, the term includes cloning and expression vectors, as well as viral vectors. In some embodiments, contemplated useful vectors are those in which the nucleic acid segment to be transcribed is under the transcriptional control of a promoter. "promoter" refers to a DNA sequence required to initiate specific transcription of a gene and recognized by the synthetic machinery of the cell or by the synthetic machinery introduced. The phrases "operatively positioned," "under control," or "under transcriptional control" refer to a promoter in the correct position and orientation relative to a nucleic acid to control RNA polymerase initiation and gene expression. The term "expression vector or construct" refers to any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid coding sequence is capable of being transcribed. In some embodiments, expression includes transcription of a nucleic acid, e.g., to produce a biologically active polypeptide product or functional RNA (e.g., guide RNA) from a transcribed gene.

The foregoing methods for packaging a recombinant vector in a desired AAV capsid to produce the rAAV of the disclosure are not meant to be limiting, and other suitable methods will be apparent to those skilled in the art.

Mode of administration

The isolated nucleic acids and rAAV of the present disclosure may be delivered to a cell or subject in a composition according to any suitable method known in the art. For example, rAAV, preferably suspended in a physiologically compatible carrier (i.e., in a composition), can be administered to a subject, i.e., a host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or non-human primate (e.g., cynomolgus monkey). In some embodiments, the host animal does not include a human.

Delivery of rAAV to a mammalian subject can be by, for example, intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream may be by injection into a vein, artery or any other vascular conduit. In some embodiments, rAAV is administered into the bloodstream by detached limb perfusion, a technique well known in the surgical arts, which essentially enables the skilled artisan to detach a limb from the systemic circulation prior to administration of rAAV virions. The skilled artisan may also apply viral particles to the vasculature of isolated limbs using a variant of the isolated limb perfusion technique described in U.S. patent No. 6,177,403 to potentially enhance transport to muscle cells or tissues. Furthermore, in certain cases, it may be desirable to deliver virosome particles to the CNS of a subject. By "CNS" is meant all cells and tissues of the brain and spinal cord of vertebrates. Thus, the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial space, bone, cartilage, and the like. Recombinant AAV can be delivered directly into the CNS or brain by injection with a needle, catheter or related device, using neurosurgical techniques known in the art, e.g., by stereotactic injection, into, for example, the ventricular region as well as the striatum (e.g., the caudate nucleus or putamen of the striatum), the spinal cord and neuromuscular junction or the lobule of the cerebellum (see, e.g., Stein et al, J Virol 73: 3424-. In some embodiments, a rAAV as described in the present disclosure is administered by intravenous injection. In some embodiments, the rAAV is administered by intracerebral injection. In some embodiments, the rAAV is administered by intrathecal injection. In some embodiments, the rAAV is administered by intrastriatal injection. In some embodiments, the rAAV is delivered by intracranial injection. In some embodiments, the rAAV is delivered by cerebellar medullary injection. In some embodiments, the rAAV is delivered by a lateral ventricle injection.

Aspects of the present disclosure relate to compositions comprising a recombinant AAV comprising a capsid protein and a nucleic acid encoding a transgene, wherein the transgene comprises a nucleic acid sequence encoding one or more mirnas. In some embodiments, each miRNA comprises SEQ ID NO:3 and/or 4(miR-SOD-127) or coded by the same. In some embodiments, each miRNA comprises SEQ ID NO:5 and/or 6 or encoded thereby. In some embodiments, the nucleic acid further comprises AAV ITRs. In some embodiments, the rAAV comprises a nucleic acid sequence consisting of SEQ ID NO: 8-15(AAV vector sequences) or a portion thereof. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

Compositions of the disclosure may comprise a rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding with one or more different transgenes). In some embodiments, the composition comprises 1, 2, 3, 4, 5,6, 7,8, 9, 10, or more different raavs, each having one or more different transgenes.

One skilled in the art can readily select an appropriate vector depending on the disorder to which the rAAV is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The choice of carrier is not a limitation of the present disclosure.

Optionally, the compositions of the present disclosure may contain other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers, in addition to the rAAV and the carrier. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

Sufficient rAAV is administered to transfect cells of the desired tissue and provide sufficient levels of gene transfer and expression without undue side effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to a selected organ (e.g., intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parenteral routes of administration. The routes of administration may be combined, if desired.

The dose of rAAV virions required to achieve a particular "therapeutic effect," e.g., the dosage unit expressed in genome copies per kilogram of body weight (GC/kg), will vary based on several factors, including but not limited to: the route of administration of the rAAV virion, the level of gene or RNA expression required to achieve a therapeutic effect, the particular disease or disorder being treated, and the stability of the gene or RNA product. One skilled in the art can readily determine the dosage range of rAAV virions for treatment of patients with a particular disease or disorder based on the factors described above, as well as other factors well known in the art.

An effective amount of rAAV is an amount sufficient to target the infected animal, targeting the desired tissue. In some embodiments, an effective amount of a rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and thus may vary from animal to tissue. For example, an effective amount of rAAV will typically contain about 10 in about 1ml to about 100ml⁹To 10¹⁶Within the solution of individual genome copies. In some cases, about 10¹¹To 10¹³Dosages between rAAV genome copies are appropriate. In certain embodiments, 10¹²Or 10¹³The individual rAAV genomic copies are effectively targeted to CNS tissues. In some cases, stable transgenic animals are produced by multiple doses of rAAV.

In some embodiments, the subject is administered no more than one rAAV dose per calendar day (e.g., a 24 hour period). In some embodiments, the subject is administered no more than one rAAV dose every 2, 3, 4, 5,6, or 7 calendar days. In some embodiments, the subject is administered no more than one rAAV dose per calendar week (e.g., 7 calendar days). In some embodiments, a dose of rAAV is administered to the subject no more than once every two weeks (e.g., once within two calendar weeks). In some embodiments, the rAAV dose is administered to the subject no more than once a calendar month (e.g., once 30 calendar days). In some embodiments, the subject is administered no more than one rAAV dose every six calendar months. In some embodiments, the subject is administered no more than one rAAV dose per calendar year (e.g., 365 days or 366 days in leap years).

In some embodiments, the rAAV composition is formulated to reduce aggregation of AAV particles in the composition, particularly when high rAAV concentrations (e.g., about 10) are present¹³GC/ml or higher). Methods for reducing rAAV aggregation are well known in the art and include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, and the like (see, e.g., Wright FR et al, molecular therapy (2005)12,171-178, the contents of which are incorporated herein by reference)

The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in the art, as are the development of suitable dosing and treatment regimens using the particular compositions described herein in a variety of treatment regimens.

Typically, these formulations may contain at least about 0.1% or more of the active compound, although the percentage of active ingredient may of course vary and may conveniently be between about 1or 2% and about 70% or 80% or more by weight or volume of the total formulation. Of course, the amount of active compound in each therapeutically useful composition can be prepared so that an appropriate dosage is obtained in any given unit dose of the compound. One skilled in the art of preparing such pharmaceutical formulations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf-life, and other pharmacological considerations, and thus, may require multiple dosages and treatment regimens.

In certain instances, it is desirable to deliver rAAV-based therapeutic constructs in a suitably formulated pharmaceutical composition disclosed herein subcutaneously, intrapersonally, intranasally, parenterally, intravenously, intramuscularly, intrathecally, or orally, intraperitoneally, or by inhalation. In some embodiments, a composition such as those described in U.S. Pat. nos. 5,543,158; 5,641,515 and 5,399,363 (each of which is incorporated herein by reference in its entirety) deliver rAAV. In some embodiments, the preferred mode of administration is by portal vein injection.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases, the form is sterile and fluid to the extent that it is easily injectable. It must be stable under the conditions of manufacture and storage, and preservation must be protected from contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

For example, for administration of an injectable aqueous solution, the solution may be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, sterile aqueous media which can be used are known to those skilled in the art. For example, a dose may be dissolved in 1ml of isotonic NaCl solution, added to 1000ml of subcutaneous lysis solution or injected into the proposed infusion site (see, e.g., "Remington's Pharmaceutical Sciences" 15 th edition, pages 1035-1038 and 1570-1580). The dosage will necessarily vary somewhat depending on the host. In any event, the person responsible for administration will determine the appropriate dosage for the individual host.

Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The rAAV compositions disclosed herein can also be formulated in neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) formed with inorganic acids such as hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, as well as organic bases such as isopropylamine, trimethylamine, histidine, procaine and the like. After formulation, the solution will be administered in a manner and in a therapeutically effective amount compatible with the formulation of the dosage form. The preparation is easily administered in various dosage forms such as injection solution, drug release capsule, etc.

As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce allergic or similar untoward reactions when administered to a host.

Delivery vehicles, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, can be used to introduce the compositions of the present disclosure into a suitable host cell. In particular, the transgene for rAAV vector delivery can be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, and the like.

For the introduction of pharmaceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein, such formulations may be preferred. The formation and use of liposomes is generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulating half-life have been developed (U.S. patent No. 5,741,516). In addition, various approaches to liposomes and liposome-like formulations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).

Liposomes have been successfully used in many cell types that are generally resistant to transfection by other methods. Furthermore, liposomes do not have the DNA length limitations typical of virus-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials have been completed to test the effectiveness of liposome-mediated drug delivery.

Liposomes are formed from phospholipids dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also known as multilamellar vesicles (M L V.) M L V typically has a diameter of 25nm to 4 μ M. sonication of M L V results in the formation of liposomes with a diameter of 200 to 4 μ MSmall Unilamellar Vesicles (SUV) in the core comprising an aqueous solution.

Alternatively, nanocapsule formulations of rAAV may be used. Nanocapsules can generally trap substances in a stable and reproducible manner. In order to avoid side effects due to intracellular polymer overload, such ultrafine particles (having a size of about 0.1 μm) should be designed using a polymer capable of being degraded in vivo. Biodegradable polyalkylcyanoacrylate nanoparticles that meet these requirements are contemplated.

In addition to the delivery methods described above, the following techniques are also contemplated as alternative methods of delivering rAAV compositions to a host. Sonophoresis (i.e., ultrasound) has been used and described in U.S. patent No. 5,656,016 as a means for increasing the rate and efficiency of drug penetration into and through the circulatory system. Other contemplated drug delivery alternatives are intraosseous injection (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations (Bourlais et al, 1998), transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208), and feedback controlled delivery (U.S. Pat. No. 5,697,899).

Application method

As used herein, "treating" refers to (a) preventing or delaying the onset of a neurodegenerative disease (e.g., A L S/FTD, etc.), (b) reducing the severity of A L S/FTD, (c) reducing or preventing the development of a symptom signature of A L S/FTD, (d) and/or preventing the worsening of a symptom signature of A L S/FTD.

In some embodiments, the subject has or is suspected of having FTD or a L S (e.g., has been identified, e.g., by a diagnostic DNA test, as having a SOD1 gene with one or more mutations that result in enhanced toxic function and/or exhibits one or more signs or symptoms of a L S.) in some embodiments, the method involves administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) carrying a nucleic acid engineered to express an inhibitory nucleic acid that targets an endogenous SOD 395 mRNA in cells of the subject, in some embodiments, the inhibitory nucleic acid comprises an inhibitory nucleic acid sequence shown in SEQ ID No. (3: 1) or an inhibitory nucleic acid sequence shown in SEQ ID No.: 127-4: 127) or an inhibitory nucleic acid encoding a SOD 39id sequence shown in SEQ ID No. or an inhibitory nucleic acid sequence encoding an SOD 396 or an inhibitory nucleic acid sequence shown in SEQ ID No. 127: 127, or an inhibitory nucleic acid sequence shown in SEQ ID No. 64.

In some embodiments, methods of inhibiting expression of SOD1 in a cell are provided. In some embodiments, the method involves delivering to a cell an isolated nucleic acid or rAAV as described in the present disclosure, wherein the inhibitory RNA is a miRNA comprising the nucleic acid sequence of SEQ ID NO: 3(GACGTACCTAAGGTACAAGTA) and/or 4(CTGCATGGATTCCATGTTCAT) or the complement of that sequence, or encoded by 5,6, 7,8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides of the sequence shown in 3(GACGTACCTAAGGTACAAGTA) and/or 4 (CTGCATGGATTCCATGTTCAT).

In light of the foregoing, certain methods provided herein involve administering to a subject an effective amount of a recombinant adeno-associated virus (rAAV) carrying any of the recombinant nucleic acids disclosed herein. Generally, an "effective amount" of a rAAV is an amount sufficient to elicit a desired biological response. In some embodiments, an effective amount refers to an amount of rAAV effective to transduce an ex vivo cell or tissue. In other embodiments, an effective amount refers to an amount effective for direct administration of the rAAV to a subject. It will be understood by those of ordinary skill in the art that the effective amount of a recombinant AAV of the invention will vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the expression product, the condition being treated, the mode of administration, and the subject. Typically, the rAAV is administered with a pharmaceutically acceptable carrier, as described elsewhere in this disclosure.

In some cases, at least one clinical outcome parameter or biomarker associated with FTD or a L S (e.g., intranuclear G) is assessed in the subject following administration of rAAV₄C₂RNA cluster, RAN-protein expression, etc.) typically, a clinical outcome parameter or biomarker assessed after administration of the rAAV is compared to a clinical outcome parameter or biomarker determined one time prior to administration of the rAAV to determine the effectiveness of the rAAVMay be the presence or absence of endogenous SOD1 expression, memory loss, or dyskinesias such as instability, stiffness, slowness, tics, muscle weakness or dysphagia, speech and language difficulties, tics (fasciculations) and muscle spasms, including those in the hands and feet.

Kits and related compositions

In some embodiments, the recombinant nucleic acids, compositions, rAAV vectors, rAAV, and the like described herein can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic, or research applications. Kits may include one or more containers containing the components of the invention and instructions for use. In particular, such kits may include one or more of the reagents described herein, as well as instructions describing the intended use and proper use of the reagents. In certain embodiments, the reagents in the kit may be pharmaceutical formulations and dosages appropriate for the particular application and for the method of administration of the formulation. Kits for research purposes may contain the appropriate concentrations or amounts of the components for conducting the various experiments.

Kits can be designed to facilitate the use of the methods described herein by a researcher and can take many forms. Where applicable, each composition of the kit may be provided in liquid form (e.g., in solution) or in solid form (e.g., dry powder). In certain instances, some compositions may be formulatable or otherwise processable (e.g., processed to an active form), for example, by the addition of suitable solvents or other substances (e.g., water or cell culture media), which may or may not be provided with a kit. As used herein, "instructions" may define parts of the instructions and/or promotions and generally relate to written instructions relating to or associated with the present packages. The instructions may also include any oral or electronic instructions provided in any manner that allows the user to clearly recognize that the instructions are associated with the kit, such as audiovisual (e.g., videotape, DVD, etc.), internet and/or network-based communication, etc. The written instructions may be in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions may also reflect approval by the agency of manufacture, use or sale for administration to an animal.

The kit may contain any one or more of the components described herein in one or more containers. As an example, in one embodiment, a kit can include instructions for mixing one or more components of the kit and/or separating and mixing samples and administering to a subject. The kit may include a container holding the reagents described herein. The reagents may be in the form of a liquid, gel or solid (powder). The reagents may be prepared aseptically, packaged in syringes and shipped frozen. Alternatively, it may be contained in a vial or other container for storage. The second container may contain other reagents prepared aseptically. Alternatively, the kit may include the active agents pre-mixed in a syringe, vial, tube or other container and transported therein. Kits may have one or more or all of the components required to administer the agent to a subject, such as a syringe, topical administration device, or IV syringe and bag.

Exemplary embodiments of the present invention will be described in more detail by the following examples. These embodiments are illustrative of the invention and those skilled in the art will recognize that the invention is not limited to these illustrative examples.

Examples