阅读说明：本技术 模块式核酸衔接头 (Modular nucleic acid adaptor ) 是由 D.克拉斯 A.洛夫乔伊 S.H.米雷布拉希姆 A.帕蒂 于 2018-06-27 设计创作，主要内容包括：本公开内容提供了用于制备核酸文库的试剂盒。所述试剂盒包括第一和第二寡核苷酸,其各自具有尾序列、共同序列以及独特标识符序列和可变长度标点标记中的至少一种。所述试剂盒进一步包括第一引物,其具有第一样品标识符序列和在所述第一引物的3’端的第一引发序列。所述第一引发序列包括所述第一寡核苷酸的所述尾序列。所述试剂盒进一步包括第二引物,其具有第二样品标识符序列和在所述第二引物的3’端的第二引发序列。所述第二引发序列与所述第二寡核苷酸的所述第二尾序列互补。(The present disclosure provides kits for preparing nucleic acid libraries. The kit includes first and second oligonucleotides, each having a tail sequence, a common sequence, and at least one of a unique identifier sequence and a variable length punctuation mark. The kit further includes a first primer having a first sample identifier sequence and a first priming sequence at the 3' end of the first primer. The first priming sequence comprises the tail sequence of the first oligonucleotide. The kit further includes a second primer having a second sample identifier sequence and a second priming sequence 3' of the second primer. The second priming sequence is complementary to the second tail sequence of the second oligonucleotide.)

1. A kit for preparing a library of nucleic acids having adaptor sequences for sequencing, the kit comprising:

a first oligonucleotide having a first tail sequence, a first common sequence, and at least one of: i) a first unique identifier sequence, and ii) a first variable length punctuation mark;

a second oligonucleotide having a second tail sequence, a second common sequence complementary to the first common sequence, and at least one of: i) a second unique identifier sequence complementary to the first unique identifier sequence, and ii) a second variable length punctuation mark complementary to the first variable length punctuation mark;

a first primer having a first sample identifier sequence and a first priming sequence at the 3' end of the first primer, the first priming sequence comprising the first tail sequence of the first oligonucleotide; and

a second primer having a second sample identifier sequence and a second priming sequence at the 3' end of the second primer, the second priming sequence being complementary to the second tail sequence of the second oligonucleotide.

2. The kit of claim 1, wherein the first sample identifier sequence and the second sample identifier sequence have a one-to-one mapping.

3. The kit of claim 2, wherein the first variable length punctuation mark has a length of 2-4 nucleotides.

4. The kit of claim 2, wherein the first variable length punctuation mark comprises at least one of a G and a C nucleotide.

5. The kit of claim 1, wherein the first unique identifier sequence has a length of at least 5 nucleotides.

6. The kit of claim 5, wherein the first unique identifier sequence has a pair-wise edit distance of at least 3.

7. A kit for preparing a library of nucleic acids having adaptor sequences for sequencing, the kit comprising:

a plurality of oligonucleotide pairs, each of said oligonucleotide pairs comprising:

a first oligonucleotide having a first tail sequence, a first common sequence, and at least one of: i) a first unique identifier sequence, and ii) a first variable length punctuation mark, and

a second oligonucleotide having a second tail sequence, a second common sequence complementary to the first common sequence, and at least one of: i) a second unique identifier sequence complementary to the first unique identifier sequence, and ii) a second variable length punctuation mark complementary to the first variable length punctuation mark,

a first primer having a first sample identifier sequence and a first priming sequence at the 3' end of the first primer, the first priming sequence comprising the first tail sequence of the first oligonucleotide; and

a second primer having a second sample identifier sequence and a second priming sequence at the 3' end of the second primer, the second priming sequence being complementary to the second tail sequence of the second oligonucleotide.

8. The kit of claim 7, wherein each of the first unique identifier sequences of each of the plurality of oligonucleotide pairs is different.

9. The kit of claim 7, wherein each of said first tail sequences of each of said plurality of oligonucleotide pairs is identical.

10. The kit of claim 7, wherein each of said second tail sequences of each of said plurality of oligonucleotide pairs is identical.

11. The kit of claim 7, wherein each of the plurality of oligonucleotide pairs anneals to form a bifurcated adaptor.

12. The kit of claim 7, wherein the first sample identifier sequence and the second sample identifier sequence have a one-to-one mapping.

13. The kit of claim 7, wherein each of the first unique identifier sequences has a length of at least 5 nucleotides.

14. The kit of claim 15, wherein each of the first unique identifier sequences has a pair-wise edit distance of at least 3.

15. A method of preparing a library of nucleic acid molecules, the method comprising:

attaching one of a plurality of oligonucleotide adaptors to each end of a target nucleic acid to provide an adaptor-target-adaptor construct, each of the plurality of oligonucleotide adaptors having:

a first oligonucleotide having a first tail sequence, a first common sequence, and at least one of: i) a first unique identifier sequence, and ii) a first variable length punctuation mark, and

a second oligonucleotide having a second tail sequence, a second common sequence complementary to the first common sequence, and at least one of: i) a second unique identifier sequence complementary to the first unique identifier sequence, and ii) a second variable length punctuation mark complementary to the first variable length punctuation mark;

annealing a first primer to the adaptor-target-adaptor construct, the first primer having a first sample identifier sequence and a first priming sequence at the 3' end of the first primer, the first priming sequence comprising the first tail sequence of the first oligonucleotide; and

extending each of the first primer and the second primer to form an extension product complementary to a respective strand of the adaptor-target-adaptor construct.

I. Definition of

In this application, unless otherwise clear from the context, (i) the term "a" may be understood to mean "at least one"; (ii) the term "or" may be understood to mean "and/or"; (iii) the terms "comprising" and "including" can be understood to encompass the enumerated components or steps, either individually or in combination with one or more additional components or steps; and (iv) the terms "about" and "approximately" can be understood to allow for a standard deviation as would be understood by one of ordinary skill in the art; and (v) where ranges are provided, endpoints are included.

Approximation: as used herein, the term "approximate" or "about," as applied to one or more considered values, refers to a value that is similar to the determined reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of either direction (greater or less) of the stated defined reference value, unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of the possible values).

Related to … …: as the term is used herein, two events or entities are "related" to each other if the presence, level, and/or form of one event or entity is related to the presence, level, and/or form of the other event or entity. For example, a particular entity (e.g., a polypeptide, genetic feature, metabolite, etc.) is considered to be associated with a particular disease, disorder, or condition if the presence, level, and/or form of that entity (e.g., polypeptide, genetic feature, metabolite, etc.) is associated with the incidence of and/or susceptibility to the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are "related" to each other physically if they interact directly or indirectly, such that they are and/or remain in physical proximity to each other. In some embodiments, two or more entities that are physically related to each other are covalently linked to each other; in some embodiments, two or more entities that are physically associated with each other are not covalently linked to each other, but are non-covalently associated, for example, via hydrogen bonding, van der waals interactions, hydrophobic interactions, magnetic properties, and combinations thereof.

Biological sample: as used herein, the term "biological sample" generally refers to a sample obtained or derived from a biological source of interest (e.g., a tissue or organism or cell culture) as described herein. In some embodiments, the source of interest comprises or consists of an organism, such as an animal or human. In some embodiments, the biological sample comprises or consists of a biological tissue or fluid. In some embodiments, the biological sample may be or include bone marrow; blood; blood cells; ascites fluid; tissue or fine needle biopsy samples; a cell-containing body fluid; (ii) free-floating nucleic acids; sputum; saliva; (ii) urine; cerebrospinal fluid, peritoneal fluid; pleural fluid (pleural fluid); feces; lymph; gynecological fluids (gynecomogic fluids); a skin swab; a vaginal swab; a buccal swab; a nasal swab; washing solutions (washings) or lavages (lavages), such as ductal or bronchoalveolar lavages; an aspirate; scrapers (scrapings); a bone marrow sample; a tissue biopsy sample; a surgical sample; other body fluids, secretions and/or excretions; and/or cells derived therefrom, etc. In some embodiments, the biological sample comprises, or consists of, cells obtained from an individual. In some embodiments, the obtained cells are or include cells from the individual from which the sample was obtained. In some embodiments, the sample is a "raw sample" obtained directly from a source of interest by any suitable means. For example, in some embodiments, the raw biological sample is obtained by a method selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of bodily fluids (e.g., blood, lymph, stool, etc.), and the like. In some embodiments, as will be clear from the context, the term "sample" refers to a preparation obtained by processing (e.g., by removing one or more components thereof and/or by adding one or more reagents thereto) an original sample. For example, filtration using a semipermeable membrane. Such "processed samples" may include, for example, nucleic acids or proteins extracted from a sample or obtained by subjecting an original sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, and the like.

Comprises the following steps: a composition or method described herein as "comprising" one or more specified elements or steps is open-ended, meaning that the specified elements or steps are essential, but that other elements or steps may be added within the scope of the composition or method. It is to be understood that a composition or method described as "comprising" (or "comprising") one or more specified elements or steps also describes a corresponding, more limited, composition or method "consisting essentially of" (or "consisting essentially of") the same specified elements or steps, thereby implying that the composition or method includes the specified essential elements or steps, and may also include additional elements or steps that do not materially affect one or more of the basic and novel characteristics of the composition or method. It is also understood that any composition or method described herein as "comprising" or "consisting essentially of" one or more specified elements or steps also describes a corresponding, more limited and enclosed composition or method "consisting of" (or "consisting of") the specified elements or steps, so as to exclude any other non-mentioned elements or steps. In any of the compositions or methods disclosed herein, known or disclosed equivalents of any specified essential elements or steps may be substituted for the elements or steps.

Designing: as used herein, the term "designed" refers to an agent, (i) whose structure is selected by the human hand; (ii) produced by methods that require a human hand; and/or (iii) differ from natural substances and other known agents.

And (3) determination: one of ordinary skill in the art, reading this specification, will appreciate that "determining" can be accomplished using any of a variety of techniques available to those of skill in the art (including, for example, the specific techniques explicitly mentioned herein) or by using any of a variety of techniques available to those of skill in the art (including, for example, the specific techniques explicitly mentioned herein). In some embodiments, the assay involves manipulation of a physical sample. In some embodiments, the determination involves consideration and/or manipulation of data or information, for example, using a computer or other processing component suitable for performing the correlation analysis. In some embodiments, the assay involves receiving relevant information and/or materials from a source. In some embodiments, the assay involves comparing one or more characteristics of the sample or entity to a comparable reference.

Identity: as used herein, the term "identity" refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be "substantially identical" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. For example, a calculation of percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for optimal comparison (e.g., gaps can be introduced in one or both of the first and second sequences for optimal alignment, and sequences that are not identical can be disregarded for comparison). In certain embodiments, the length of the sequences aligned for comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at the corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Sequence comparison and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percentage identity between two nucleotide sequences can be determined using the algorithms of Meyers and Miller (CABIOS, 1989, 4:11-17), which have been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, the nucleic acid sequence comparison using the ALIGN program uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Cmp matrices, on the other hand, can be used to determine percent identity between two nucleotide sequences using the GAP program in the GCG software package.

Sample preparation: as used herein, the term "sample" refers to a substance that is or contains a composition of interest for qualitative and/or quantitative evaluation. In some embodiments, the sample is a biological sample (i.e., from an organism (e.g., cell or organism). in some embodiments, the sample is from a geological, aquatic, astronomical, or agricultural source.

Essentially: as used herein, the term "substantially" refers to a qualitative condition that exhibits an overall or near overall degree or grade of a feature or property of interest. One of ordinary skill in the art of biology will appreciate that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completion or to achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential deficiencies inherent in many biological and chemical phenomena.

The synthesis comprises the following steps: as used herein, the word "synthetic" means produced by the human hand, and thus is in a form that does not occur in nature, either because it has a structure that does not occur in nature, or because it is associated with one or more other components with which it is not associated in nature, or with one or more other components with which it is associated in nature.

Variants: as used herein, the term "variant" refers to an entity that exhibits significant structural identity to a reference entity, but that differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared to the reference entity. In many embodiments, the variant is also functionally different from its reference entity. In general, whether a particular entity is correctly considered a "variant" of a reference entity is based on the degree to which it shares structural identity with the reference entity. As will be appreciated by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. Variants are, by definition, different chemical entities that share one or more of these characteristic structural elements. To name a few examples, a small molecule may have a characteristic core structural element (e.g., a macrocyclic core) and/or one or more characteristic pendant group(s) (pendant) moiety(s), such that variants of the small molecule are variants that share the core structural element and the characteristic pendant group moiety(s), but differ in the other pendant group moiety(s) and/or the type of bond(s) present within the core (single bond(s) versus double bond(s), E versus Z, etc.), a polypeptide may have a characteristic sequence element comprising a plurality of amino acids that have specified positions relative to each other in linear or three-dimensional space and/or contribute to a particular biological function, and a nucleic acid may have a characteristic sequence element comprising a plurality of nucleotide residues that have specified positions relative to one another in linear or three-dimensional space. For example, a variant polypeptide may differ from a reference polypeptide as a result of one or more differences in amino acid sequence and/or one or more differences in chemical moieties (e.g., carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone. In some embodiments, the variant polypeptide exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% total sequence identity to the reference polypeptide. Alternatively or additionally, in some embodiments, the variant polypeptide does not share at least one characteristic sequence element with the reference polypeptide. In some embodiments, the reference polypeptide has one or more biological activities. In some embodiments, the variant polypeptide shares one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide lacks one or more of the biological activities of the reference polypeptide. In some embodiments, the variant polypeptide exhibits a reduced level of one or more biological activities as compared to the reference polypeptide. In many embodiments, a polypeptide of interest is considered a "variant" of a parent or reference polypeptide if it has an amino acid sequence that is identical to the amino acid sequence of the parent except for a small number of sequence alterations at specific positions. Typically, less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% of the residues in a variant are substituted compared to the parent. In some embodiments, the variant has 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 substituted residues as compared to the parent. Often, variants have a very small number (e.g., less than 5, 4, 3, 2, or 1) of substituted functional residues (i.e., residues involved in a particular biological activity). Furthermore, variants typically have no more than 5, 4, 3, 2, or 1 additions or deletions, and often no additions or deletions, as compared to the parent. Furthermore, any addition or deletion is generally less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6 residues, and typically less than about 5, about 4, about 3, or about 2 residues. In some embodiments, a variant may also have one or more functional deficiencies and/or may otherwise be considered a "mutant. In some embodiments, the parent or reference polypeptide is a polypeptide found in nature. As will be appreciated by those of ordinary skill in the art, many variants of a particular polypeptide of interest are commonly found in nature, particularly when the polypeptide of interest is an infectious agent polypeptide.

Detailed description of certain embodiments

As also discussed above, in various circumstances, it may be useful to provide adaptors for nucleic acid library preparation of NGS and the like. However, current adaptor designs have several drawbacks with respect to cost of manufacture, efficiency of sequencing and accuracy of downstream base-calling (base-calling), sample identification, etc.

These and other challenges can be overcome with a modular nucleic acid adaptor according to the present disclosure. In one aspect, the disclosed adaptors can be implemented using a protocol to overcome the above challenges, whereby UIDs and SIDs are assigned to two separate sets of oligonucleotides (FIG. 1). Thus, in one embodiment, a collection of bifurcated adaptors is prepared, wherein each adaptor has a UID selected from the group of two or more different UID sequences. After ligation of the bifurcated adaptors containing the UIDs to the target nucleic acids, the resulting ligation products are amplified with primers including SIDs and optionally other sequence information, such as NGS platform-specific sequences. The resulting amplification product includes both a pair of UIDs from the initial adaptor ligation step and a SID (or a pair of SIDs) from the amplification step. It is noted that variations of the foregoing modular design are also within the scope of the present disclosure. For example, the positions of UIDs and SIDs may be exchanged. That is, UIDs on the bifurcated adaptors may replace SIDs, and SIDs included in the amplification primers may replace UIDs. As a result, SIDs were incorporated by ligation and UIDs were incorporated by PCR amplification. Still other variations of the disclosed modular nucleic acid adaptors will be apparent from the following disclosure.

One advantage of the disclosed modular nucleic acid adaptor design is that instead of each adaptor having its own SID, it is then amplified by a universal PCR primer pair, the adaptors are universal (e.g., adaptors with 16 different UIDs are grouped into one adaptor tube), and the PCR primers contain SIDs. In this design, the UIDs and SIDs are separated, allowing a reduction in the number of necessary oligonucleotides to be produced. For adaptor designs with 16 different UIDs and 16 SIDs, 64 different oligonucleotides were required instead of 274. Furthermore, these oligonucleotides are shorter than those in previous designs, which also reduces oligonucleotide synthesis costs and can also increase the efficiency of ligation (and thus assay efficiency). In one aspect, the set of different UIDs includes 2, 4, 8, 16, 32, 64, 128 or more different UID sequences. In another aspect, the set of different SIDs includes 2, 4, 8, 16, 32, 64, 128 or more different SID sequences. Notably, the number of UIDs and SIDs selected will depend on the nature of the experiment, including the number of samples desired for multiplexing, the capacity of the NGS platform (i.e., sequencing instrument), the complexity of the nucleic acid sample to be analyzed, and the like.

In another aspect of the disclosed modular nucleic acid adaptor design, instead of 2-base punctuation marks with identical GT at the end of each adaptor, the punctuation marks are synthesized in variable lengths. The use of variable length punctuation marks (fig. 1) ensures sufficient complexity at each position within the read length, thus eliminating the need for PhiX incorporation or other similar control or complexity enhancing materials. In one embodiment, the punctuation mark varies between 2-and 4-bases. In this implementation, the last base before the T-overhang is selected from a C nucleotide or a G nucleotide, thereby allowing for stronger hydrogen bonding (i.e., "G-C seals"), which may show improved ligation efficiency. In another embodiment, the terminal base of the punctuation mark is selected from any one of any nucleotides. In one aspect, punctuation marks can be designed such that a position in a sequencing read never has more than a selected percentage (e.g., 62.5%) of any bases at that position, thereby eliminating the need to add PhiX or other similar reagents when using the disclosed adaptors. A list of punctuation marks and classification details of base% at each position is shown in tables 1 and 2.

TABLE 1

TABLE 2

Hypothesis nucleic acid samples had 25% performance of each base at each position

In another aspect of the disclosure, the UIDs may be designed such that if one or more errors occur in the UID, the UID does not result in the same sequence as another UID in the ensemble of selected UID sequences. In this way, UIDs with one or more errors can be corrected or removed from further analysis. In the enclosed implementation, instead of UIDs having a length of 2 nucleotides, a UID having a length of 5 nucleotides is used, the pair-wise edit distance of which is at least 3. As defined herein, a pairwise edit distance is a measure of similarity between two strings (e.g., nucleotide sequences) as determined by counting the minimum number of operands required to translate one string into another. As used in examples of the present disclosure, the pair-wise edit distance is determined from the Levenshtein distance, where operations are limited to deletions, insertions, and substitutions; however, as will be appreciated by those of ordinary skill in the art, other methods may be used to calculate the pair-wise edit distance. In the case of the pair-wise edit distance of 3, UIDs having a single error can always be correctly identified. This allows up to 25 different UIDs (see, e.g., Faircloth, et al 2012.PLoS ONE 7(8): e 42543). In the attached implementation (Table 3), 16 UIDs were used. Different lengths of UIDs (e.g., designs with UIDs as short as 2 bases and as long as 10 bases) may also be used. In the case of 2-base UIDs and using variable punctuation marks as described herein, a UIDs + punctuation mark with a pair hamming distance (pair hamming distance) of 2 can be generated-in this implementation (table 4), a substitution error in the UIDs will never result in the same UID + punctuation mark sequence as another UID + punctuation mark in the group. As defined herein, a Hamming distance is an edit distance between two strings, where the only allowed operation is a substitution. Two additional UID schemes are shown in tables 5 and 6 below.

TABLE 3 (case 1)

Table 4 (case 4)

TABLE 5 (case 2)

TABLE 6 (case 3)

The UID and punctuation marks may be combined with any suitable adapter sequence, with reference to the adapter schemes illustrated in tables 3-6. For example, ILLUMINA i5 and i7 adaptor sequences are TCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:1) and AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO:2), respectively. The UID sequence (UID) CAGAT and i5 punctuation marks (i5 punc) C in the first row of table 3 can be combined with the ILLUMINA i5 adaptor sequence to provide the oligonucleotide sequence TCTTTCCCTACACGACGCTCTTCCGATCTCAGATC × T (SEQ ID NO:3), wherein the asterisks (—) indicate phosphorothioate linkages. Similarly, the reverse complement of UID (rc UID) ATCTG and i7 punctuation mark (i7 punc) G (i5 punctuation mark C reverse complement) can be combined with ILLUMINA i7 adaptor sequence to provide oligonucleotide sequence GATCTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO:4), wherein the sequence includes a 5' -phosphate group. Tables 3-6 each list a set of 16 different UID/punctuation mark combinations that can be used to prepare a set of 16 oligonucleotide pairs.

To prepare adaptors, each oligonucleotide pair is synthesized, purified, and annealed to provide a homogeneous population of annealed adaptors. The 16 different annealed assemblies of adaptors were then combined to produce an assembly of adaptors with 16 different UIDs. It will be appreciated that the described method may also be used to prepare collections of adaptors having more or less than 16 different UIDs.

In another aspect of the disclosure, instead of SID on only one sequencing read length, SID may be incorporated into one or two PCR primers for amplification of the products resulting from ligation of a target nucleic acid with annealed adaptors having different UIDs. By using primers with SIDs incorporated therein, two index reads (index reads) generated by sequencing will provide the SIDs. SIDs can be designed to have a one-to-one mapping within a primer pair, so that when the SID from one index read length is known, the SID from the other read length (from both ends) is predictable. This one-to-one mapping of SIDs enables the removal of read length in SIDs when a molecule from one sample associated with a first SID is attached to a molecule from another sample associated with a second SID. In the implementations shown in tables 7 and 8, SIDs are the inverse of each other (reverse). When two sequences share the same nucleotide sequence in reverse order, one sequence is considered the "reverse" of the other. For example, if a first SID has the sequence AACT, a second SID having the sequence TCAA will be the reverse of the first SID. Notably, the reverse of the sequence is different from the reverse complement of the sequence. SIDs have a minimum pair-wise edit distance of 3, so a SID can always be correctly associated with the correct SID sequence in the case of up to 1 error. Faircloth and colleagues (Faircloth, et al 2012.PLoS ONE 7(8): e42543) describe example SIDs for use with the present disclosure. Although the sequences in tables 7 and 8 include 96 SID pairs, it will be understood that still other sequences, combinations, and numbers of SIDs may be used in the context of the present disclosure.

TABLE 7

TABLE 8

In one aspect, it will be understood that embodiments of the modular nucleic acid adaptor may include any combination of the features described herein. In one example, the scheme illustrated in table 5 contemplates adaptors having UIDs of 2 nucleotides in length and variable length punctuation marks, while the scheme illustrated in table 6 contemplates adaptors having UIDs of 2 nucleotides in length and single nucleotide punctuation marks (i.e., punctuation marks do not have variable lengths).

Sequence listing

<110>ROCHE SEQUENCING SOLUTIONS, INC.

F. HOFFMANN-LA ROCHE AG

ROCHE DIAGNOSTICS GMBH

<120> Modular nucleic acid adaptor

<130>P34320-WO

<140>

<141>

<150>62/525,595

<151>2017-06-27

<160>217

<170>PatentIn version 3.5

<210>1

<211>36

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>1

tctttcccta cacgacgctc ttccgatctc agatct 36

<210>2

<211>34

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>2

agatcggaag agcacacgtc tgaactccag tcac 34

<210>3

<211>36

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>3

tctttcccta cacgacgctc ttccgatctc agatct 36

<210>4

<211>40

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>4

gatctgagat cggaagagca cacgtctgaa ctccagtcac 40

<210>5

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>5

aatgatacgg cgaccaccga gatctacacg ttaagcgaca ctctttccct acacgacgct 60

ct 62

<210>6

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>6

aatgatacgg cgaccaccga gatctacacg agaccaaaca ctctttccct acacgacgct 60

ct 62

<210>7

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>7

aatgatacgg cgaccaccga gatctacaca gccgtaaaca ctctttccct acacgacgct 60

ct 62

<210>8

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>8

aatgatacgg cgaccaccga gatctacact tcgaagcaca ctctttccct acacgacgct 60

ct 62

<210>9

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>9

aatgatacgg cgaccaccga gatctacaca tgacaggaca ctctttccct acacgacgct 60

ct 62

<210>10

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>10

aatgatacgg cgaccaccga gatctacact cgtgcataca ctctttccct acacgacgct 60

ct 62

<210>11

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>11

aatgatacgg cgaccaccga gatctacacc gaagtcaaca ctctttccct acacgacgct 60

ct 62

<210>12

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>12

aatgatacgg cgaccaccga gatctacacg aatccgtaca ctctttccct acacgacgct 60

ct 62

<210>13

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>13

aatgatacgg cgaccaccga gatctacacg aagtgctaca ctctttccct acacgacgct 60

ct62

<210>14

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>14

aatgatacgg cgaccaccga gatctacacg tccttgaaca ctctttccct acacgacgct 60

ct 62

<210>15

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>15

aatgatacgg cgaccaccga gatctacacc atgtgtgaca ctctttccct acacgacgct 60

ct 62

<210>16

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>16

aatgatacgg cgaccaccga gatctacaca cctcttcaca ctctttccct acacgacgct 60

ct 62

<210>17

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>17

aatgatacgg cgaccaccga gatctacact ccgatcaaca ctctttccct acacgacgct 60

ct 62

<210>18

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>18

aatgatacgg cgaccaccga gatctacacc gtatctcaca ctctttccct acacgacgct 60

ct 62

<210>19

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>19

aatgatacgg cgaccaccga gatctacact tgcaacgaca ctctttccct acacgacgct 60

ct 62

<210>20

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>20

aatgatacgg cgaccaccga gatctacact gataggcaca ctctttccct acacgacgct 60

ct 62

<210>21

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>21

aatgatacgg cgaccaccga gatctacaca acagtccaca ctctttccct acacgacgct 60

ct 62

<210>22

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>22

aatgatacgg cgaccaccga gatctacaca ggaacacaca ctctttccct acacgacgct 60

ct 62

<210>23

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>23

aatgatacgg cgaccaccga gatctacact cctcatgaca ctctttccct acacgacgct 60

ct 62

<210>24

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>24

aatgatacgg cgaccaccga gatctacaca gagcagaaca ctctttccct acacgacgct 60

ct 62

<210>25

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>25

aatgatacgg cgaccaccga gatctacacg aacgaagaca ctctttccct acacgacgct 60

ct 62

<210>26

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>26

aatgatacgg cgaccaccga gatctacact tgagctcaca ctctttccct acacgacgct 60

ct 62

<210>27

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>27

aatgatacgg cgaccaccga gatctacacg ctgaatcaca ctctttccct acacgacgct 60

ct 62

<210>28

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>28

aatgatacgg cgaccaccga gatctacaca gattgcgaca ctctttccct acacgacgct 60

ct 62

<210>29

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>29

aatgatacgg cgaccaccga gatctacacc aacttggaca ctctttccct acacgacgct 60

ct 62

<210>30

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>30

aatgatacgg cgaccaccga gatctacact tggtgcaaca ctctttccct acacgacgct 60

ct 62

<210>31

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>31

aatgatacgg cgaccaccga gatctacacc tgtaccaaca ctctttccct acacgacgct 60

ct 62

<210>32

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>32

aatgatacgg cgaccaccga gatctacaca ctctgagaca ctctttccct acacgacgct 60

ct 62

<210>33

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>33

aatgatacgg cgaccaccga gatctacacc tcctagtaca ctctttccct acacgacgct 60

ct 62

<210>34

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>34

aatgatacgg cgaccaccga gatctacacg ccaatacaca ctctttccct acacgacgct 60

ct 62

<210>35

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>35

aatgatacgg cgaccaccga gatctacacc ctcatctaca ctctttccct acacgacgct 60

ct 62

<210>36

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>36

aatgatacgg cgaccaccga gatctacact gagctgtaca ctctttccct acacgacgct 60

ct 62

<210>37

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>37

aatgatacgg cgaccaccga gatctacacg tctcatcaca ctctttccct acacgacgct 60

ct 62

<210>38

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>38

aatgatacgg cgaccaccga gatctacact aagcgcaaca ctctttccct acacgacgct 60

ct 62

<210>39

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>39

aatgatacgg cgaccaccga gatctacaca gctaccaaca ctctttccct acacgacgct 60

ct 62

<210>40

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>40

aatgatacgg cgaccaccga gatctacacc ttcactgaca ctctttccct acacgacgct 60

ct 62

<210>41

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>41

aatgatacgg cgaccaccga gatctacacg agagtacaca ctctttccct acacgacgct 60

ct 62

<210>42

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>42

aatgatacgg cgaccaccga gatctacacg cgttagaaca ctctttccct acacgacgct 60

ct 62

<210>43

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>43

aatgatacgg cgaccaccga gatctacaca ggcaatgaca ctctttccct acacgacgct 60

ct62

<210>44

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>44

aatgatacgg cgaccaccga gatctacacg ctacaacaca ctctttccct acacgacgct 60

ct 62

<210>45

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>45

aatgatacgg cgaccaccga gatctacact cagtaggaca ctctttccct acacgacgct 60

ct 62

<210>46

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>46

aatgatacgg cgaccaccga gatctacacc tatgcctaca ctctttccct acacgacgct 60

ct 62

<210>47

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>47

aatgatacgg cgaccaccga gatctacact gctgtgaaca ctctttccct acacgacgct 60

ct 62

<210>48

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>48

aatgatacgg cgaccaccga gatctacacc cgaagataca ctctttccct acacgacgct 60

ct 62

<210>49

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>49

aatgatacgg cgaccaccga gatctacaca gaccttgaca ctctttccct acacgacgct 60

ct 62

<210>50

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>50

aatgatacgg cgaccaccga gatctacaca ctgcttgaca ctctttccct acacgacgct 60

ct 62

<210>51

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>51

aatgatacgg cgaccaccga gatctacact aagtggcaca ctctttccct acacgacgct 60

ct 62

<210>52

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>52

aatgatacgg cgaccaccga gatctacacc gcaatgtaca ctctttccct acacgacgct 60

ct 62

<210>53

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>53

aatgatacgg cgaccaccga gatctacact gaccgttaca ctctttccct acacgacgct 60

ct 62

<210>54

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>54

aatgatacgg cgaccaccga gatctacacc ctcgaataca ctctttccct acacgacgct 60

ct 62

<210>55

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>55

aatgatacgg cgaccaccga gatctacact gctctacaca ctctttccct acacgacgct 60

ct 62

<210>56

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>56

aatgatacgg cgaccaccga gatctacacg tcgttacaca ctctttccct acacgacgct 60

ct 62

<210>57

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>57

aatgatacgg cgaccaccga gatctacaca tagtcggaca ctctttccct acacgacgct 60

ct 62

<210>58

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>58

aatgatacgg cgaccaccga gatctacact agcaggaaca ctctttccct acacgacgct 60

ct 62

<210>59

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>59

aatgatacgg cgaccaccga gatctacact acggaagaca ctctttccct acacgacgct 60

ct 62

<210>60

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>60

aatgatacgg cgaccaccga gatctacaca ggtgttgaca ctctttccct acacgacgct 60

ct 62

<210>61

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>61

aatgatacgg cgaccaccga gatctacacc cgatgtaaca ctctttccct acacgacgct 60

ct 62

<210>62

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>62

aatgatacgg cgaccaccga gatctacacc tcgacttaca ctctttccct acacgacgct 60

ct 62

<210>63

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>63

aatgatacgg cgaccaccga gatctacacg tagtaccaca ctctttccct acacgacgct 60

ct 62

<210>64

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>64

aatgatacgg cgaccaccga gatctacaca ttagccgaca ctctttccct acacgacgct 60

ct 62

<210>65

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>65

aatgatacgg cgaccaccga gatctacact ggaccataca ctctttccct acacgacgct 60

ct 62

<210>66

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>66

aatgatacgg cgaccaccga gatctacacc atctgctaca ctctttccct acacgacgct 60

ct 62

<210>67

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>67

aatgatacgg cgaccaccga gatctacacg actacgaaca ctctttccct acacgacgct 60

ct 62

<210>68

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>68

aatgatacgg cgaccaccga gatctacacg cttcacaaca ctctttccct acacgacgct 60

ct 62

<210>69

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>69

aatgatacgg cgaccaccga gatctacaca acgtagcaca ctctttccct acacgacgct 60

ct 62

<210>70

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>70

aatgatacgg cgaccaccga gatctacaca ccatgtcaca ctctttccct acacgacgct 60

ct 62

<210>71

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>71

aatgatacgg cgaccaccga gatctacacc tgtggtaaca ctctttccct acacgacgct 60

ct 62

<210>72

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>72

aatgatacgg cgaccaccga gatctacacg ttggcataca ctctttccct acacgacgct 60

ct 62

<210>73

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>73

aatgatacgg cgaccaccga gatctacacg atacctgaca ctctttccct acacgacgct 60

ct62

<210>74

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>74

aatgatacgg cgaccaccga gatctacacg acgtcataca ctctttccct acacgacgct 60

ct 62

<210>75

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>75

aatgatacgg cgaccaccga gatctacacc aggatgtaca ctctttccct acacgacgct 60

ct 62

<210>76

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>76

aatgatacgg cgaccaccga gatctacaca caccgataca ctctttccct acacgacgct 60

ct 62

<210>77

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>77

aatgatacgg cgaccaccga gatctacact gcttgctaca ctctttccct acacgacgct 60

ct 62

<210>78

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>78

aatgatacgg cgaccaccga gatctacact ggaagcaaca ctctttccct acacgacgct 60

ct 62

<210>79

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>79

aatgatacgg cgaccaccga gatctacact atgaccgaca ctctttccct acacgacgct 60

ct 62

<210>80

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>80

aatgatacgg cgaccaccga gatctacacc cgcttaaaca ctctttccct acacgacgct 60

ct 62

<210>81

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>81

aatgatacgg cgaccaccga gatctacacc ctcgttaaca ctctttccct acacgacgct 60

ct 62

<210>82

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>82

aatgatacgg cgaccaccga gatctacaca gctaagcaca ctctttccct acacgacgct 60

ct 62

<210>83

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>83

aatgatacgg cgaccaccga gatctacacc taagaccaca ctctttccct acacgacgct 60

ct 62

<210>84

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>84

aatgatacgg cgaccaccga gatctacact cacctagaca ctctttccct acacgacgct 60

ct 62

<210>85

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>85

aatgatacgg cgaccaccga gatctacacg cataacgaca ctctttccct acacgacgct 60

ct 62

<210>86

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>86

aatgatacgg cgaccaccga gatctacaca ggttcctaca ctctttccct acacgacgct 60

ct 62

<210>87

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>87

aatgatacgg cgaccaccga gatctacacc gagttagaca ctctttccct acacgacgct 60

ct 62

<210>88

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>88

aatgatacgg cgaccaccga gatctacact cttcgacaca ctctttccct acacgacgct 60

ct 62

<210>89

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>89

aatgatacgg cgaccaccga gatctacact actgctcaca ctctttccct acacgacgct 60

ct 62

<210>90

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>90

aatgatacgg cgaccaccga gatctacacc tgccataaca ctctttccct acacgacgct 60

ct 62

<210>91

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>91

aatgatacgg cgaccaccga gatctacacc caagtagaca ctctttccct acacgacgct 60

ct 62

<210>92

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>92

aatgatacgg cgaccaccga gatctacacg accgataaca ctctttccct acacgacgct 60

ct 62

<210>93

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>93

aatgatacgg cgaccaccga gatctacacc atacggaaca ctctttccct acacgacgct 60

ct 62

<210>94

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>94

aatgatacgg cgaccaccga gatctacact ctagtccaca ctctttccct acacgacgct 60

ct 62

<210>95

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>95

aatgatacgg cgaccaccga gatctacaca gtgacctaca ctctttccct acacgacgct 60

ct 62

<210>96

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>96

aatgatacgg cgaccaccga gatctacaca cctagacaca ctctttccct acacgacgct 60

ct 62

<210>97

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>97

aatgatacgg cgaccaccga gatctacacg tggtatgaca ctctttccct acacgacgct 60

ct 62

<210>98

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>98

aatgatacgg cgaccaccga gatctacacg ttatggcaca ctctttccct acacgacgct 60

ct 62

<210>99

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>99

aatgatacgg cgaccaccga gatctacaca acagcgaaca ctctttccct acacgacgct 60

ct 62

<210>100

<211>62

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>100

aatgatacgg cgaccaccga gatctacacg tcctgttaca ctctttccct acacgacgct 60

ct 62

<210>101

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>101

caagcagaag acggcatacg agatgcgaat tggtgactgg agttcagacg tgtgc 55

<210>102

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>102

caagcagaag acggcatacg agataaccag aggtgactgg agttcagacg tgtgc 55

<210>103

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>103

caagcagaag acggcatacg agataatgcc gagtgactgg agttcagacg tgtgc 55

<210>104

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>104

caagcagaag acggcatacg agatcgaagc ttgtgactgg agttcagacg tgtgc 55

<210>105

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>105

caagcagaag acggcatacg agatggacag tagtgactgg agttcagacg tgtgc 55

<210>106

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>106

caagcagaag acggcatacg agattacgtg ctgtgactgg agttcagacg tgtgc 55

<210>107

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>107

caagcagaag acggcatacg agatactgaa gcgtgactgg agttcagacg tgtgc 55

<210>108

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>108

caagcagaag acggcatacg agattgccta aggtgactgg agttcagacg tgtgc 55

<210>109

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>109

caagcagaag acggcatacg agattcgtga aggtgactgg agttcagacg tgtgc 55

<210>110

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>110

caagcagaag acggcatacg agatagttcc tggtgactgg agttcagacg tgtgc 55

<210>111

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>111

caagcagaag acggcatacg agatgtgtgt acgtgactgg agttcagacg tgtgc 55

<210>112

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>112

caagcagaag acggcatacg agatcttctc cagtgactgg agttcagacg tgtgc 55

<210>113

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>113

caagcagaag acggcatacg agatactagc ctgtgactgg agttcagacg tgtgc 55

<210>114

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>114

caagcagaag acggcatacg agatctctat gcgtgactgg agttcagacg tgtgc 55

<210>115

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>115

caagcagaag acggcatacg agatgcaacg ttgtgactgg agttcagacg tgtgc 55

<210>116

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>116

caagcagaag acggcatacg agatcggata gtgtgactgg agttcagacg tgtgc 55

<210>117

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>117

caagcagaag acggcatacg agatcctgac aagtgactgg agttcagacg tgtgc 55

<210>118

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>118

caagcagaag acggcatacg agatcacaag gagtgactgg agttcagacg tgtgc 55

<210>119

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>119

caagcagaag acggcatacg agatgtactc ctgtgactgg agttcagacg tgtgc 55

<210>120

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>120

caagcagaag acggcatacg agatagacga gagtgactgg agttcagacg tgtgc 55

<210>121

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>121

caagcagaag acggcatacg agatgaagca aggtgactgg agttcagacg tgtgc 55

<210>122

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>122

caagcagaag acggcatacg agatctcgag ttgtgactgg agttcagacg tgtgc 55

<210>123

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>123

caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgc 55

<210>124

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>124

caagcagaag acggcatacg agatgcgtta gagtgactgg agttcagacg tgtgc 55

<210>125

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>125

caagcagaag acggcatacg agatggttca acgtgactgg agttcagacg tgtgc 55

<210>126

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>126

caagcagaag acggcatacg agatacgtgg ttgtgactgg agttcagacg tgtgc55

<210>127

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>127

caagcagaag acggcatacg agataccatg tcgtgactgg agttcagacg tgtgc 55

<210>128

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>128

caagcagaag acggcatacg agatgagtct cagtgactgg agttcagacg tgtgc 55

<210>129

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>129

caagcagaag acggcatacg agattgatcc tcgtgactgg agttcagacg tgtgc 55

<210>130

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>130

caagcagaag acggcatacg agatcataac cggtgactgg agttcagacg tgtgc 55

<210>131

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>131

caagcagaag acggcatacg agattctact ccgtgactgg agttcagacg tgtgc 55

<210>132

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>132

caagcagaag acggcatacg agattgtcga gtgtgactgg agttcagacg tgtgc 55

<210>133

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>133

caagcagaag acggcatacg agatctactc tggtgactgg agttcagacg tgtgc 55

<210>134

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>134

caagcagaag acggcatacg agatacgcga atgtgactgg agttcagacg tgtgc 55

<210>135

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>135

caagcagaag acggcatacg agataccatc gagtgactgg agttcagacg tgtgc 55

<210>136

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>136

caagcagaag acggcatacg agatgtcact tcgtgactgg agttcagacg tgtgc 55

<210>137

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>137

caagcagaag acggcatacg agatcatgag aggtgactgg agttcagacg tgtgc 55

<210>138

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>138

caagcagaag acggcatacg agatagattg cggtgactgg agttcagacg tgtgc 55

<210>139

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>139

caagcagaag acggcatacg agatgtaacg gagtgactgg agttcagacg tgtgc 55

<210>140

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>140

caagcagaag acggcatacg agatcaacat cggtgactgg agttcagacg tgtgc 55

<210>141

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>141

caagcagaag acggcatacg agatggatga ctgtgactgg agttcagacg tgtgc 55

<210>142

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>142

caagcagaag acggcatacg agattccgta tcgtgactgg agttcagacg tgtgc 55

<210>143

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>143

caagcagaag acggcatacg agatagtgtc gtgtgactgg agttcagacg tgtgc 55

<210>144

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>144

caagcagaag acggcatacg agattagaag ccgtgactgg agttcagacg tgtgc 55

<210>145

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>145

caagcagaag acggcatacg agatgttcca gagtgactgg agttcagacg tgtgc 55

<210>146

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>146

caagcagaag acggcatacg agatgttcgt cagtgactgg agttcagacg tgtgc 55

<210>147

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>147

caagcagaag acggcatacg agatcggtga atgtgactgg agttcagacg tgtgc 55

<210>148

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>148

caagcagaag acggcatacg agattgtaac gcgtgactgg agttcagacg tgtgc 55

<210>149

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>149

caagcagaag acggcatacg agatttgcca gtgtgactgg agttcagacg tgtgc 55

<210>150

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>150

caagcagaag acggcatacg agattaagct ccgtgactgg agttcagacg tgtgc 55

<210>151

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>151

caagcagaag acggcatacg agatcatctc gtgtgactgg agttcagacg tgtgc 55

<210>152

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>152

caagcagaag acggcatacg agatcattgc tggtgactgg agttcagacg tgtgc 55

<210>153

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>153

caagcagaag acggcatacg agatggctga tagtgactgg agttcagacg tgtgc 55

<210>154

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>154

caagcagaag acggcatacg agataggacg atgtgactgg agttcagacg tgtgc 55

<210>155

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>155

caagcagaag acggcatacgagatgaaggc atgtgactgg agttcagacg tgtgc 55

<210>156

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>156

caagcagaag acggcatacg agatgttgtg gagtgactgg agttcagacg tgtgc 55

<210>157

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>157

caagcagaag acggcatacg agatatgtag ccgtgactgg agttcagacg tgtgc 55

<210>158

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>158

caagcagaag acggcatacg agatttcagc tcgtgactgg agttcagacg tgtgc 55

<210>159

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>159

caagcagaag acggcatacg agatccatga tggtgactgg agttcagacg tgtgc 55

<210>160

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>160

caagcagaag acggcatacg agatgccgat tagtgactgg agttcagacg tgtgc 55

<210>161

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>161

caagcagaag acggcatacg agattaccag gtgtgactgg agttcagacg tgtgc 55

<210>162

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>162

caagcagaag acggcatacg agattcgtct acgtgactgg agttcagacg tgtgc 55

<210>163

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>163

caagcagaag acggcatacg agatagcatc aggtgactgg agttcagacg tgtgc 55

<210>164

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>164

caagcagaag acggcatacg agatacactt cggtgactgg agttcagacg tgtgc 55

<210>165

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>165

caagcagaag acggcatacg agatcgatgc aagtgactgg agttcagacg tgtgc 55

<210>166

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>166

caagcagaag acggcatacg agatctgtac cagtgactgg agttcagacg tgtgc 55

<210>167

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>167

caagcagaag acggcatacg agatatggtg tcgtgactgg agttcagacg tgtgc 55

<210>168

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>168

caagcagaag acggcatacg agattacggt tggtgactgg agttcagacg tgtgc 55

<210>169

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>169

caagcagaag acggcatacg agatgtccat aggtgactgg agttcagacg tgtgc 55

<210>170

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>170

caagcagaag acggcatacg agattactgc aggtgactgg agttcagacg tgtgc 55

<210>171

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>171

caagcagaag acggcatacg agattgtagg acgtgactgg agttcagacg tgtgc55

<210>172

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>172

caagcagaag acggcatacg agattagcca cagtgactgg agttcagacg tgtgc 55

<210>173

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>173

caagcagaag acggcatacg agattcgttc gtgtgactgg agttcagacg tgtgc 55

<210>174

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>174

caagcagaag acggcatacg agatacgaag gtgtgactgg agttcagacg tgtgc 55

<210>175

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>175

caagcagaag acggcatacg agatgccagt atgtgactgg agttcagacg tgtgc 55

<210>176

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>176

caagcagaag acggcatacg agataattcg ccgtgactgg agttcagacg tgtgc 55

<210>177

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>177

caagcagaag acggcatacg agatattgct ccgtgactgg agttcagacg tgtgc 55

<210>178

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>178

caagcagaag acggcatacg agatcgaatc gagtgactgg agttcagacg tgtgc 55

<210>179

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>179

caagcagaag acggcatacg agatccagaa tcgtgactgg agttcagacg tgtgc 55

<210>180

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>180

caagcagaag acggcatacg agatgatcca ctgtgactgg agttcagacg tgtgc 55

<210>181

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>181

caagcagaag acggcatacg agatgcaata cggtgactgg agttcagacg tgtgc 55

<210>182

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>182

caagcagaag acggcatacg agattccttg gagtgactgg agttcagacg tgtgc 55

<210>183

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>183

caagcagaag acggcatacg agatgattga gcgtgactgg agttcagacg tgtgc 55

<210>184

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>184

caagcagaag acggcatacg agatcagctt ctgtgactgg agttcagacg tgtgc 55

<210>185

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>185

caagcagaag acggcatacg agatctcgtc atgtgactgg agttcagacg tgtgc 55

<210>186

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>186

caagcagaag acggcatacg agatataccg tcgtgactgg agttcagacg tgtgc 55

<210>187

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>187

caagcagaag acggcatacg agatgatgaa ccgtgactgg agttcagacg tgtgc 55

<210>188

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>188

caagcagaag acggcatacg agatatagcc aggtgactgg agttcagacg tgtgc 55

<210>189

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>189

caagcagaag acggcatacg agataggcat acgtgactgg agttcagacg tgtgc 55

<210>190

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>190

caagcagaag acggcatacg agatcctgat ctgtgactgg agttcagacg tgtgc 55

<210>191

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>191

caagcagaag acggcatacg agattccagt gagtgactgg agttcagacg tgtgc 55

<210>192

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>192

caagcagaag acggcatacg agatcagatc cagtgactgg agttcagacg tgtgc 55

<210>193

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>193

caagcagaag acggcatacg agatgtatgg tggtgactgg agttcagacg tgtgc 55

<210>194

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>194

caagcagaag acggcatacg agatcggtat tggtgactgg agttcagacg tgtgc 55

<210>195

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>195

caagcagaag acggcatacg agatagcgac aagtgactgg agttcagacg tgtgc 55

<210>196

<211>55

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>196

caagcagaag acggcatacg agatttgtcc tggtgactgg agttcagacg tgtgc 55

<210>197

<211>66

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic primers "

<400>197

aatgatacgg cgaccaccga gatctacacg ttaagcgtct ttccctacac gacgctcttc 60

cgatct 66

<210>198

<211>66

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic primers "

<400>198

caagcagaag acggcatacg agatgcgaat tggtgactgg agttcagacg tgtgctcttc 60

cgatct 66

<210>199

<211>43

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>199

tctttcccta cacgacgctc ttccgatctc agatctgatt aca 43

<210>200

<211>48

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>200

gattacactt ttgacagatc ggaagagaca cgtctgaact ccagtcac 48

<210>201

<211>48

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>201

tgtaatcaga tctgagatcg gaagagcaca cgtctgaact ccagtcac 48

<210>202

<211>44

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>202

tctttcccta cacgacgctc ttccgatctg tcaaaagtgt aatc 44

<210>203

<211>49

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>203

gattacactt ttgacagatc ggaagagcac acgtctgaac tccagtcac 49

<210>204

<211>43

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>204

tgtaatcaga tctgagatcg gaagagcgtc gtgtagggaa aga 43

<210>205

<211>44

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>205

gattacactt ttgacagatc ggaagagcgt cgtgtaggga aaga 44

<210>206

<211>66

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>206

aatgatacgg cgaccaccga gatctacacc ttaagcgtct ttccctacac gacgctcttc 60

cgatct 66

<210>207

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>207

aatgatacgg cgaccaccga gatctacacg ttaagcgtct ttccctacac gacgctcttc 60

cgatctcaga tctgattaca 80

<210>208

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>208

gattacactt ttacagatcg gaagagcaca cgtctgaact ccagtcacca attcgcatct 60

cgtatgccgt cttctgcttg 80

<210>209

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>209

gttcgtcttc tgccgtatgc tctacgctta accactgacc tcaagtctgc acacgacaag 60

gctagagtct agactaatgt 80

<210>210

<211>81

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>210

ctaatgtgaa aactgtctag ccttctcgca gcacatccct ttctgcgaat tccacatcta 60

gagccaccag cggcatagta a 81

<210>211

<211>81

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>211

gattacactt ttgacagatc ggaagagcac acgtctgaac tccagtcacc aattcgcatc 60

tcgtatgccg tcttctgctt g 81

<210>212

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>212

gttcgtcttc tgccgtatgc tctacgctta accactgacc tcaagtctgc acacgacaag 60

gctagagtct agactaatgt 80

<210>213

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>213

ttactatgcc gctggtggct ctagatgtgc aattcgcaga aagggatgtg ctgcgagaag 60

gctagagtct agactaatgt 80

<210>214

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>214

ttactatgcc gctggtggct ctagatgtgc aattcgcaga aagggatgtg ctgcgagaag 60

gctagagtct agactaatgt 80

<210>215

<211>81

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>215

gattacactt ttgacagatc ggaagagcac acgtctgaac tccagtcacc aattcgcatc 60

tcgtatgccg tcttctgctt g 81

<210>216

<211>81

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>216

gattacactt ttgacagatc ggaagagcgt cgtgtaggga aagacgctta aggtgtagat 60

ctcggtggtc gccgtatcat t 81

<210>217

<211>80

<212>DNA

<213> Artificial sequence

<220>

<221> sources

<223 >/note = "artificial sequence description: synthetic oligonucleotides "

<400>217

gttcgtcttc tgccgtatgc tctacgctta accactgacc tcaagtctgc acacgacaag 60

gctagagtct agactaatgt 80