阅读说明：本技术 柯萨奇病毒a10型毒株及其应用 (Coxsackie virus A10 type strain and application thereof ) 是由 张改梅 李国顺 朱凤才 樊欢 嵇红 赵丽丽 谢学超 马廷涛 陈磊 肖海峰 顾美荣 于 2021-09-23 设计创作，主要内容包括：本发明涉及生物技术领域,具体公开了柯萨奇病毒A10型毒株及其应用。本发明的柯萨奇病毒A10型毒株,其P1结构蛋白的氨基酸序列如SEQ ID NO.1所示。该毒株交叉中和能力好、遗传稳定、毒力强,为建立稳定的感染动物模型提供了攻击毒株,并可作为柯萨奇病毒A10型免疫血清的中和抗体效价测定的检测毒株,为柯萨奇病毒A10型相关单/多价疫苗研发提供了技术支持。(The invention relates to the technical field of biology, and particularly discloses a coxsackievirus A10 type strain and application thereof. The amino acid sequence of the P1 structural protein of the coxsackie virus A10 strain is shown in SEQ ID NO. 1. The strain has good cross neutralization capability, stable heredity and strong toxicity, provides an attack strain for establishing a stable infection animal model, can be used as a detection strain for measuring the titer of a neutralizing antibody of coxsackie virus A10 type immune serum, and provides technical support for research and development of a coxsackie virus A10 type related single/multi-valent vaccine.)

1. The coxsackievirus A10 strain is characterized in that the amino acid sequence of the P1 structural protein is shown as SEQ ID NO. 1.

2. The strain of coxsackievirus a10 of claim 1, further comprising non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D;

the amino acid sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown in SEQ ID NO. 4-10.

3. The strain of coxsackievirus A10 according to claim 2, wherein in the genome of the strain, the coding gene sequence of the P1 structural protein is shown as SEQ ID NO.2, and the coding gene sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown as SEQ ID NO. 11-17.

4. The strain of coxsackievirus A10 of claim 1, having a genomic sequence as shown in SEQ ID No.3 or as shown in the complementary sequence of the sequence shown in SEQ ID No. 3.

5. The strain of Coxsackie virus A10 according to any one of claims 1 to 4, which is deposited in the China general microbiological culture Collection center (CGMCC) with the deposit number of CGMCC No. 19533.

6. A biomaterial characterized by being any one of the following (1) to (8):

(1) p1 structural protein with the sequence shown as SEQ ID NO. 1;

(2) nucleic acid molecule of P1 structural protein with the coding sequence shown in SEQ ID NO. 1;

(3) a nucleic acid molecule with a sequence shown as SEQ ID NO.3 or a complementary sequence of the sequence shown as SEQ ID NO. 3;

(4) an expression cassette comprising the nucleic acid molecule of (2) or (3);

(5) a recombinant vector comprising the nucleic acid molecule of (2) or (3);

(6) a recombinant microorganism comprising the nucleic acid molecule of (2) or (3);

(7) a cell line comprising the nucleic acid molecule of (2) or (3);

(8) a primer or a probe for detecting the nucleic acid molecule in (2) or (3).

7. A virus-like particle of a coxsackievirus a10 type strain, which comprises a P1 structural protein and any one or more selected from non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D;

the P1 structural protein has a sequence shown in SEQ ID NO.1, and the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D respectively have sequences shown in SEQ ID NO. 4-10.

8. Any one of the following uses of the coxsackievirus a10 type strain of any one of claims 1 to 5, the biological material of claim 6 or the virus-like particle of claim 7:

(1) the application in the immunogenicity evaluation of Coxsackie virus vaccines;

(2) the application in detecting the content of the immune serum neutralizing antibody of the coxsackie virus;

(3) the application in the protective evaluation of Coxsackie virus vaccines;

(4) the application in preparing animal model infected by Coxsackie virus;

(5) the application in screening or evaluating the drug effect of the drugs for preventing and/or treating diseases caused by the coxsackie virus;

(6) the application in preparing a reagent or a kit for diagnosing coxsackie virus infection;

(7) the application in the epidemiological investigation of the Coxsackie virus;

(8) the application in preparing vaccines for preventing and/or treating diseases caused by coxsackie virus;

(9) the application in preparing the medicine for preventing and/or treating the diseases caused by the coxsackie virus;

(10) the application in preparing the antibody for preventing and/or treating diseases caused by the coxsackie virus;

(11) the application in preparing antiserum for preventing and/or treating diseases caused by coxsackie virus.

9. An antibody or antiserum produced using the coxsackievirus A10 strain of any one of claims 1-5, the biological material of claim 6 or the virus-like particle of claim 7 as an immunogen.

10. A product characterized in that it contains any one or a combination of more of the following (1) to (4):

(1) the strain of coxsackievirus A10 of any one of claims 1-5;

(2) the biomaterial of claim 6;

(3) the virus-like particle of claim 7;

(4) an antibody or antiserum to the coxsackievirus A10 type strain of any one of claims 1-5.

Technical Field

The invention relates to the technical field of biology, in particular to a coxsackievirus A10 type strain and application thereof.

Background

The hand-foot-and-mouth disease is an infectious disease caused by enteroviruses, more than 20 types of enteroviruses causing the hand-foot-and-mouth disease occur in children under 5 years old, and show that the children with mouth pain, anorexia, low fever, small herpes or small ulcer appear at the parts of hands, feet, oral cavity and the like, most children with the mouth disease can self-heal for about one week, and a few children with the mouth disease can cause complications such as myocarditis, pulmonary edema, aseptic meningoencephalitis and the like. The disease of some serious children will develop quickly and lead to death. Currently, there is a lack of effective therapeutic agents for symptomatic treatment.

In recent years, with the popularization of EV-A71 vaccine, the incidence of CV-A6 and CV-A10 is increasing year by year, and in recent epidemiological investigation, the detection rate of coxsackie virus type A10 (coxsackievirus A10 and CV-A10) in sporadic cases or outbreaks of hand-foot-and-mouth disease is gradually increasing. Epidemiological investigations in recent years have shown that CV-a10 has become one of the main etiological agents of the prevalence of hand-foot-and-mouth disease in recent years, which has presented challenges in the prevention and control of hand-foot-and-mouth disease.

The marketed EV-A71 vaccine has no cross-protection effect on CV-A10. The detection of neutralizing antibodies is one of the key indicators for carrying out CV-A10 epidemiological investigation and vaccine immunogenicity evaluation. The accuracy of the detection of the titer of the neutralizing antibody is closely related to the detection strain used. Mainly subgenotype C1 was restricted to be prevalent in a few areas in 2008-2012, but C2 gradually replaced C1 as The main subgenotype after 2010 (Ji T, Guo Y, Huang W, Shi Y, Xu Y, Tong W, Yao W, Tan Z, Zeng H, Ma J, ZHao H, Han T, Zhang Y, Yan D, Yang Q, Zhu S, Zhang Y, Xu W. The empirical sub-genetic C2 of CoxsackievirusA10 Associated with Hand, Foot and Mouth Disaseextension relating in genetic circulating in The main land of China. Sci 2018 Sep 6;8(1): 13357.). The genotype standard detection strain which accords with the current disease epidemic characteristics is established, the generation of the strain for fixed detection is carried out, the accuracy and the repeatability of the detection of the vaccine neutralizing antibody are improved, and the method has important significance for guaranteeing the immunogenicity evaluation of the vaccine preclinical and clinical tests. At present, no standard detection strain of Coxsackie virus A10 exists at home and abroad, and enterprises are urgently required to automatically screen and establish the standard detection strain.

In addition, Li Shuxuan et al published a suckling mouse model for CV-A10 vaccine and antibody evaluation (Li Shuxuan, Zhao Huang, Yang Lisheng, et al, A neoneatal mouse model of coxsackieviruses A10 infection for anti-viral evaluation [ J)]Anti viral research 2017,144: 247-. CV-A10 was infected with 1 day old BalB/C (inbred), C57BL/6 (inbred), KM (inbred), ICR (inbred) four different strains of suckling mice, 100. mu.l each, 10. mu.l each by intraperitoneal injection⁵TCID₅₀And observing for 20 days. 100% die within 7 days. The inbred line BalB/c has clear genetic background and more stable heredity, so that 1-day-old BalB/c suckling mice are used as animal models, 100 mu l of the animal models are injected into the abdominal cavity, 20 days of observation are carried out, and LD is shown₅₀Is 5.78TCID₅₀A/only. Because mice have generally poor susceptibility to strains obtained by clinical isolation, only individual clinically isolated viruses can infect the mice, and most of the clinically isolated viruses are mouse-adapted mutant strains. Therefore, under the condition that a coxsackie virus A10 type relevant detection standard strain and an attack strain for vaccine protective evaluation are not available at home and abroad at present, a new coxsackie virus A10 type strain is more necessary to meet the development requirement of the prior art.

Disclosure of Invention

The invention aims to provide a coxsackie virus A10 strain with good cross neutralization capability, stable heredity and strong toxicity and application thereof.

In order to realize the purpose of the invention, the technical scheme of the invention is as follows:

firstly, the invention provides a coxsackievirus A10 strain, wherein the amino acid sequence of the P1 structural protein is shown as SEQ ID NO. 1.

In the genome of the Coxsackie virus A10 strain, the sequence of the coding gene of the P1 structural protein is shown as SEQ ID NO. 2.

Specifically, the coxsackie virus A10 strain provided by the invention contains P1 structural protein and non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D; wherein, the amino acid sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown in SEQ ID NO. 4-10.

The genome coding sequence of the coxsackievirus A10 strain is P1 structural protein shown as SEQ ID NO.1 and non-structural protein shown as SEQ ID NO. 4-10.

Preferably, in the genome of the coxsackievirus A10 strain, the coding gene sequence of the P1 structural protein is shown as SEQ ID NO.2, and the coding gene sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown as SEQ ID NO. 11-17.

The coding genes of the structural proteins and the non-structural proteins are arranged in the order of VP4, VP2, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C and 3D on the genome of the coxsackievirus A10 strain. VP1, VP2, VP3 and VP4 constitute structural protein P1.

The invention provides a recombinant nucleic acid molecule which is formed by connecting a gene shown as SEQ ID NO.2 and genes shown as SEQ ID NO.11-17 in sequence.

Further preferably, the genome sequence of the coxsackievirus A10 strain is shown as SEQ ID NO.3 or shown as the complementary sequence of the sequence shown as SEQ ID NO. 3. The 1-746bp in the SEQ ID NO.3 is the nucleic acid sequence of 5 'UTR, 747-953bp is the nucleic acid sequence of VP4, 954-1718bp is the nucleic acid sequence of VP2, 1719-2438bp is the nucleic acid sequence of VP3, 2439-3332bp is the nucleic acid sequence of VP1, 3333-3782bp is the nucleic acid sequence of 2A, 3783-4079bp is the nucleic acid sequence of 2B, 4080-5066bp is the nucleic acid sequence of 2C, 5067-5324bp is the nucleic acid sequence of 3A, 5325-5390bp is the nucleic acid sequence of 3B, 5391-5939bp is the nucleic acid sequence of 3C, 5940-7325bp is the nucleic acid sequence of 3D, 7326-7328bp is a stop codon, and 7329-7407bp is the nucleic acid sequence of 3' UTR.

Specifically, the invention provides a Coxsackie virus A10 type strain R06030451 which is preserved in China general microbiological culture Collection center (CGMCC for short, the address: Beijing West Lu No.1, the institute of microbiology, China academy of sciences, zip code 100101) at 7.13.2021 in the morning and evening of China, and is classified and named as Coxsackie virus A10 type, and the preservation number is CGMCC No. 19533.

The genome coding sequence of the coxsackievirus A10 type strain R06030451 is a P1 structural protein shown as SEQ ID NO.1 and a non-structural protein shown as SEQ ID NO.4-10, the genome sequence of the coxsackievirus A10 type strain is shown as SEQ ID NO.3, and the subtype is C2 type.

The Coxsackie virus A10 strain provided by the invention has strong toxicity, good cross-neutralization capacity in and among genotypes, good immunogenicity, and capability of rapid propagation by taking cells such as RD and the like as stromal cells.

Further, the present invention provides a biomaterial related to the coxsackievirus a10 type, which is any one of the following (1) to (8):

(1) p1 structural protein with the sequence shown as SEQ ID NO. 1;

(2) nucleic acid molecule of P1 structural protein with the coding sequence shown in SEQ ID NO. 1;

(3) a nucleic acid molecule with a sequence shown as SEQ ID NO.3 or a complementary sequence of the sequence shown as SEQ ID NO. 3;

(4) an expression cassette comprising the nucleic acid molecule of (2) or (3);

(5) a recombinant vector comprising the nucleic acid molecule of (2) or (3);

(6) a recombinant microorganism comprising the nucleic acid molecule of (2) or (3);

(7) a cell line comprising the nucleic acid molecule of (2) or (3);

(8) a primer or a probe for detecting the nucleic acid molecule in (2) or (3).

The nucleic acid molecule described in (2) or (3) above may be a DNA molecule or an RNA molecule.

The expression cassette described in (4) above is a recombinant nucleic acid molecule obtained by linking regulatory elements for transcription and translation upstream and downstream of the nucleic acid molecule described in (2) or (3).

The recombinant vector described in (5) above is a plasmid vector, a viral vector, a phage vector or a transposon which carries the nucleic acid molecule described in (2) or (3) and is capable of replication or integration in a host cell.

The recombinant microorganism described in (6) above may be a bacterium or a virus.

The cell line described in (7) above is an animal cell line that is not reproducible as an animal individual, and may be a commonly used animal cell line for virus culture, including but not limited to other cells such as RD, Vero, MRC-5, and the like.

The primer and probe described in (8) above are oligonucleotides capable of binding to the nucleic acid molecule described in (2) or (3) and performing PCR amplification.

The invention also provides virus-like particles of the coxsackievirus A10 strain, which contain P1 structural protein and any one or more selected from non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D; the P1 structural protein has a sequence shown in SEQ ID NO.1, and the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D respectively have sequences shown in SEQ ID NO. 4-10.

The virus-like particles can express the coding genes of the structural proteins and the non-structural proteins by adopting an insect vector system.

The invention also provides an immunogenic composition comprising the strain of coxsackievirus type a10, a biological material or a virus-like particle as described above.

The immunogenic composition can contain an adjuvant which is beneficial to the coxsackievirus A10 strain to exert immunogenicity in addition to the coxsackievirus A10 strain, the biological material or the virus-like particles. The adjuvant includes, but is not limited to, aluminum adjuvants.

Further, the invention provides any one of the following applications of the coxsackievirus A10 type strain or the biological material or the virus-like particle:

(1) the application in the immunogenicity evaluation of Coxsackie virus vaccines;

(2) the application in detecting the content of the immune serum neutralizing antibody of the coxsackie virus;

(3) the application in the protective evaluation of Coxsackie virus vaccines;

(4) the application in preparing animal model infected by Coxsackie virus;

(5) the application in screening or evaluating the drug effect of the drugs for preventing and/or treating diseases caused by the coxsackie virus;

(6) the application in preparing a reagent or a kit for diagnosing coxsackie virus infection;

(7) the application in the epidemiological investigation of the Coxsackie virus;

(8) the application in preparing vaccines for preventing and/or treating diseases caused by coxsackie virus;

(9) the application in preparing the medicine for preventing and/or treating the diseases caused by the coxsackie virus;

(10) the application in preparing the antibody for preventing and/or treating diseases caused by the coxsackie virus;

(11) the application in preparing antiserum for preventing and/or treating diseases caused by coxsackie virus.

In the above (1), the application is specifically to detect a strain as a standard for evaluation of immunogenicity of a vaccine.

In (3) above, the application is specifically as a challenge strain for vaccine protective evaluation.

In the above (4), the animal model is preferably a murine model.

In the above (1) to (11), the coxsackievirus is preferably a coxsackievirus a10 type strain.

In the above (5) and (8) to (11), the disease caused by the coxsackie virus is preferably hand-foot-and-mouth disease.

The invention provides an antibody or antiserum, which is prepared by taking the coxsackie virus A10 type strain or the biological material or the virus-like particles as immunogen.

The invention also provides a method for preparing the antibody or the antiserum, which comprises the following steps: and (3) taking the coxsackie virus A10 type strain, the biological material or the virus-like particles as immunogen immune animals, and separating to obtain an anti-coxsackie virus A10 type antibody or antiserum.

The invention provides a product which contains any one or combination of more of the following (1) to (4):

(1) the above coxsackievirus A10 type strain;

(2) the above-mentioned biological material;

(3) the above virus-like particle;

(4) antibodies or antiserum against the above coxsackie virus A10 type strain.

The product is preferably a product for evaluating the immunogenicity or the protection of a coxsackievirus A10 type vaccine, or a product for constructing an animal model infected by the coxsackievirus A10 type vaccine, or a product for diagnosing, preventing or treating coxsackievirus A10 type infection.

The product may be a reagent, kit, vaccine or medicament.

As an embodiment of the invention, the product is a reagent for immunogenicity or protective evaluation of a coxsackievirus A10 type vaccine, and the reagent contains the coxsackievirus A10 type strain.

As another embodiment of the invention, the product is a reagent for constructing an animal model infected by the coxsackievirus A10, and contains the coxsackievirus A10 strain.

As another embodiment of the present invention, the product is a vaccine for preventing coxsackievirus a10 type infection, which contains the coxsackievirus a10 type strain.

The vaccine of the invention can be a whole virus inactivated vaccine, an attenuated live vaccine, a nucleic acid vaccine, a genetic engineering vaccine (subunit vaccine, live vector vaccine, gene recombinant vaccine, etc.).

Preferably, the vaccine is a whole virus inactivated vaccine, wherein the coxsackievirus a10 type strain is inactivated. The vaccine may also contain adjuvants including, but not limited to, aluminum adjuvants.

The present invention also provides a method for preparing the vaccine described above, the method comprising: culturing the coxsackievirus A10 strain on cells, harvesting virus liquid, inactivating and purifying the harvested virus liquid to obtain vaccine stock solution, and mixing the vaccine stock solution with an adjuvant.

As another embodiment of the present invention, the product is a medicament for treating coxsackievirus a10 type infection, which contains an antibody or antiserum to the coxsackievirus a10 type strain.

The invention also provides application of the product in immunogenicity evaluation or protective evaluation of a coxsackievirus A10 type vaccine and preparation of an animal model infected by the coxsackievirus.

The invention also provides the application of the product in diagnosing, preventing or treating coxsackie virus A10 type infection.

The invention has the beneficial effects that:

through virus separation, screening, plaque purification and animal challenge experiments, the screened strains have the attributes of good cross-neutralization capacity, stable heredity and strong toxicity. The virulent power of the strain provides an attacking strain for establishing a stable infection animal model.

The strain has good cross property in genotype and between genotypes, can be used as a detection strain for measuring the titer of a neutralizing antibody of coxsackie virus A10 type immune serum, and provides support for research and development of coxsackie virus A10 type related single/multi-valent vaccines.

The strain has good immunogenicity and high titer, and is injected into abdominal cavity with 10 percent of injection²CCID₅₀The virus liquid can kill 100% of 1-day-old suckling mice within 6 days. The strain is shown to be a virulent strain. Virulent strain pair with high pathogenicity and lethality for mouseThe construction of CV-A10 mouse model is very important.

Drawings

FIG. 1 is the result of the strain type cross-neutralization study in example 1 of the present invention.

FIG. 2 is a challenge strain screening-survival curve in example 5 of the present invention.

FIG. 3 shows an LD in embodiment 5 of the present invention₅₀A survival curve was determined.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The basic research method of the invention is as follows:

(1) separating pharynx and anus sample which is detected to be positive by Coxsackie virus A10 through fluorescent quantitative PCR on RD cells, carrying out 3 times of subculture adaptability, and carrying out primary identification on the obtained virus liquid, wherein the primary identification mainly comprises virus titration, antigen content determination, molecular biology identification (virus determination, nucleic acid sequence determination and analysis subtype), immunogenicity test, cross neutralization capability research, genome sequencing and the like, and suitable neutralizing antibody detection strains and attack strains (primary screening strains) are obtained primarily.

(2) And (3) carrying out plaque purification on the preliminarily screened strains respectively, carrying out 3 times of subculture adaptive culture (P4 generation) on RD cells, and verifying the harvested virus liquid, wherein the verification of the virus liquid mainly comprises virus titration. And (4) establishing an original seed according to the virus detection result in combination with the virus lesion process and the lesion fusion degree, and performing related evaluation research and passage stability research. The evaluation research mainly comprises virus titration, immunogenicity research, pathogenicity research, cross neutralization capacity research and the like. The passage stability research mainly comprises the steps of carrying out continuous passage culture on RD cells according to a certain proportion to 15 th generation of virus liquid, and carrying out virus titration and gene sequencing detection (genome sequencing analysis) on each generation of strain in the passage process. Selecting a strain with wide cross protection range, good genetic stability and high titer as a neutralizing antibody detection strain according to the research results; the strain with good genetic stability and strong pathogenicity is used as an attack strain for vaccine protective evaluation.

(3) After the neutralizing antibody detection candidate strain was established, it was subjected to virus titration. Then, the titer calibration and specificity evaluation are carried out on the test sample. The indicated titer of the test strain is determined, thereby determining the dilution factor of the test titer strain at the time of the neutralization test. The specificity evaluation aims to verify that the detected strain only has specific neutralization capacity on CV-A10 type immune serum, and does not have cross reaction on other enteroviruses such as EV-A71, CV-A6 and CV-A16 immune serum. Thereby proving that the strain is suitable for detecting the titer of the neutralizing antibody of coxsackie virus A10 type immune serum.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 preliminary screening of Coxsackie virus type A10 Strain

Treatment of clinical samples:

0.25 ml of each sample (pharyngeal anal test sample which has been detected as positive for coxsackievirus type A10 by fluorescent quantitative PCR) was added to a centrifuge tube in a biosafety cabinet. Add 2.5. mu.l of penicillin streptomycin solution, mix well, and stand overnight at 4 ℃. Centrifuged at 2000 rpm for 20min and the supernatant stored at 2-8 ℃ for inoculation.

Virus isolation and culture:

taking prepared healthy and pollution-free RD cells with the density of 80-90%, and discarding the cell culture solution. Inoculating 0.2 ml/well of the treated sample into 6-well plate, inoculating 1 well of each sample, adding 0.2 ml/well virus culture solution, and standing at 35 deg.C with 5% CO₂Adsorbing for 1h in the incubator. Then 3.5ml of virus culture medium was added to each well, and the mixture was placed at 35 ℃ in 5% CO₂And (5) standing and culturing in an incubator. Cells in 2 wells with good growth status and no specimen were set as cell control.

Harvesting viruses and performing adaptive subculture:

characteristic enterovirus cytopathic effect (CPE) profiles of the cells after inoculation were observed and recorded daily. Freezing and thawing once if CPE appears and the CPE degree reaches above + + +, harvesting cell culture, filtering with a 0.2 μm needle filter, filling virus solution with 0.2 ml/branch, storing in a refrigerator at-60 ℃, continuously passaging the virus solution for three times, freezing and thawing once per generation, centrifuging at 2000 rpm and 4 ℃ for 10 min, subpackaging the supernatant, storing in a refrigerator at-60 ℃, marking and recording. If CPE is present within 24h after inoculation, it is likely to be a toxic reaction due to non-specific components in the specimen. 100 μ l of positive isolate was taken and passed on for three generations for further observation.

Virus identification:

virus identification tests are carried out on the 3 rd generation virus liquid of the obtained virus isolation positive strains, and the virus identification tests mainly comprise virus titration, molecular biology identification (virus identification and virus genotyping) and immunogenicity tests, cross neutralization capacity research, genome sequencing and the like.

Virus titration:

(1) the detection method comprises the following steps: diluting virus liquid after three passages with serum-free culture solution in centrifuge tube in 10-fold gradient, and gradually diluting^-1~10^-8. The diluted virus was added to a 96-well plate at 8 wells/dilution, 0.1 ml/well. At the same time, 100. mu.l of RD cell suspension (1.5X 10) was added to each well⁵Pieces/ml). And adding 8-16 holes of the cell suspension into the cell suspension, wherein the volume of the cell suspension is 0.1 ml/hole, and supplementing 0.1 ml/hole of the diluent to serve as a cell control. Covering with a sealing plate, gently beating, mixing, standing at 35 deg.C and 5% CO₂And (5) standing and culturing in an incubator, and judging the result on the 7 th day. Each sample was replicated 3 times.

(2) Calculating the virus titer: calculating LgCCID according to Behrens-Karber formula₅₀。

LgCCID₅₀L-d (S-0.5), wherein:

l = log of the lowest dilution of virus used in the experiment;

d = log of dilution gradient;

s = sum of positive fractions at final decision (i.e. sum of proportion of cell pores in which CPE appears).

See in particular the ministry of health of the people's republic of China, hand-foot-and-mouth disease prevention and control guidelines (2009 edition) [ EB/OL ] (2009-06-04) http:// www.gov.cn/gzdt/2009-06/04/content _1332078. htm.

Molecular biological identification:

CV-A10 virus was identified by RT-PCR, CV-A10 positive virus strain was subjected to VP1 nucleic acid sequence determination, and CV-A10 genotyping was performed based on VP1 nucleotide sequence.

Identification of CV-A10 virus by RT-PCR:

extracting virus nucleic acid, and identifying the CV-A10 virus by applying the universal primer for EV group enterovirus nucleic acid detection and the CV-A10 nucleic acid detection primer.

(1) The amplification primers were designed as follows:

A. universal primer sequence for detecting human enterovirus nucleic acid (product length 400-

59F: 5’-CYTTGTGCGCCTGTTTT-3’（SEQ ID NO.18）；

588R: 5’-ATTGTCACCATAAGCAGCC-3’（SEQ ID NO.19）；

153F: 5’-CAAGYACTTCTGTMWCCCC-3’（SEQ ID NO.20）；

541R: 5’-CCCAAAGTAGTCGGTTCC-3’（SEQ ID NO.21）。

In the above primers, Y represents C/T, M represents A/C, and W represents A/T.

B. CV-A10 nucleic acid detection primer sequence (product length 1 kb)

CA10-VP1- WHF: 5’- GGTATCAAACCAATTACGTGGTCC -3’（SEQ ID NO.22）；

CA10-VP1- WHR: 5’-AACAAGCAGGTCTCGAGAAC-3’（SEQ ID NO.23）。

(2) Extracting virus nucleic acid:

adding reagents and virus samples into a 96-well plate according to the sequence and the dosage in the specification, then placing the 96-well plate into a nucleic acid extractor, and extracting nucleic acid according to a preset program; subpackaging the extracted nucleic acid into EP tubes, marking the information and date of the sample, and storing the sample in a refrigerator at-60 ℃.

(3) And (3) PCR amplification:

1) HEV-5' UTR universal primer PCR amplification

a. First round PCR amplification:

preparing a PCR amplification reaction system (the formula is shown in table 1) except amplification template components, adding 0.4 mu l of test sample virus genome, mixing uniformly, and putting into a PCR instrument to operate a program (shown in table 2).

TABLE 1 HEV-5' UTR Universal primer first round PCR amplification reaction System

TABLE 2 HEV-5' UTR Universal primer first round PCR amplification procedure

b. Second round of PCR amplification:

preparing a PCR amplification reaction system (the formula is shown in table 3) except amplification template components, adding 0.4 mu l of first round PCR amplification products as a template, and putting the template into a PCR instrument to run a program (shown in table 4).

TABLE 3 HEV-5' UTR Universal primer second round PCR amplification reaction System

TABLE 4 HEV-5' UTR Universal primer second round PCR amplification procedure

2) PCR amplification with CV-A10 VP1 specific primer

Preparing a PCR amplification reaction system (the formula is shown in table 5) except amplification template components, adding 0.4 mu l of test sample virus genome, mixing uniformly, and putting into a PCR instrument to run a program (shown in table 6).

TABLE 5 PCR amplification reaction System with VP1 specific primers

TABLE 6 VP1 specific primer PCR amplification procedure

3) The PCR amplification product was detected by 2% agarose gel electrophoresis.

4) Result judgment

The HEV-5' UTR universal primer amplification positive sample can observe a target band with the size of 400bp, and the VP1 specific primer amplification positive sample can observe a target band with the size of 1 kb. The laboratory diagnosis results of the specimens were judged according to table 7. Wherein HEV (-) represents a target band which is not amplified by the HEV-5 'UTR universal primer, and HEV (+) represents a target band which is amplified by the HEV-5' UTR universal primer; CV-A10 (-) represents the non-amplified target band of the CV-A10 VP1 specific primer, and CV-A10 (+) represents the amplified target band of the CV-A10 VP1 specific primer.

TABLE 7

CV-a10 genotyping:

the virus strains identified as positive for CV-A10 were subjected to VP1 nucleic acid sequence amplification and sequence determination, and CV-A10 genotyping was performed based on VP1 nucleic acid sequence. The results showed all forms C2.

Immunogenicity studies:

strains with high titers were selected and immunogenicity analysis was performed using NIH mice.

The same virus titer (7.0 LgCCID) was prepared from 20 third generation virus fluids₅₀Ml), immunized NIH mice (SPF grade, 18-22g, female), 10 strains per group, numbered separately. And (3) injecting the inactivated virus into the abdominal cavity by 500 mu l/mouse according to a two-needle immunization program for 0 and 14 days, setting a culture medium control group, collecting blood 14 days after the first-time immunization and the second-time immunization respectively, and separating serum. The titer of the anti-specific neutralizing antibody of the serum is measured by adopting a trace cell pathologic change methodPositive conversion rate and level of neutralizing antibody were analyzed.

Neutralizing antibody titer determination step: diluting the serum to be detected at a ratio of 1:8, inactivating at 56 deg.C for 30min, adding into 96-well plate at a concentration of 0.05 ml/well, diluting with 100CCID, respectively₅₀Neutralizing the CV-A10 virus suspension at 37 ℃ for 1-3 h; adding 1.5X 10⁵Each ml of RD cell suspension, 0.1 ml/well, at 35 + -0.5 deg.C and 5% CO₂And (5) culturing in an incubator for 7 d. The highest dilution that inhibited 50% of the cytopathic effects was designated as the neutralizing titer of CV-a10 antibody and expressed as the reciprocal of the dilution factor. Each test is provided with a virus back-drop test, and the back-drop result is 32-320 CCID₅₀The hole test was confirmed. The neutralizing titer is more than or equal to 8, the CV-A10 neutralizing antibody is positive, and the Geometric Mean Titer (GMT) of the negative samples is calculated according to 4.

Test results show that the primary-immunity positive conversion rate can reach more than 80%, the secondary-immunity positive conversion rate can reach 100%, the titer of a primary-immunity neutralizing antibody is between 1:19 and 1:273, and the titer of a secondary-immunity neutralizing antibody is between 1:247 and 1:7476, wherein the titer of a neutralizing antibody of R603 can reach 1:7476, which indicates that the strain is a dominant strain.

Cross-neutralization capacity study:

and (3) carrying out cross neutralization capacity research on the virus strain and the virus strain immune serum, and reflecting the cross neutralization capacity by using the titer difference of neutralizing antibodies of the virus strain to all the serum to be detected. The low fold number difference represents that the strain has more uniform cross neutralization detection capability, and the strain with high neutralizing antibody GMT and low fold difference is screened to be used as a candidate strain for detection.

a. Intratype cross-neutralization study:

the screened immunogenicity and titer gene sequences are selected to comprehensively evaluate 8 primary screening strains (R603, R210, R629, R601, R579, R620, R624 and R617) belonging to the same gene subtype, and are subjected to type-in cross-neutralization study (8 strains and corresponding 8 immune serums are subjected to cross-neutralization reaction), and the immune serums are serums collected 14 days after 2 times of immunization of mice (the specific steps are referred to the determination of the titer of the anti-specific neutralizing antibody of the serums). Cross-neutralization capacity is reflected in the neutralizing antibody titers GMT and the difference in fold number (MAX/MIN) of the strains against the whole serum. The results are shown in FIG. 1 and Table 8, and the primary screening strain numbered R603 tested each immune serum for a neutralizing antibody titer GMT of 1:2111 with a fold difference of 8.

TABLE 8

b. Intercotype cross-neutralization studies:

performing type cross neutralization research on 18 CV-A10 strains including 1A genotype (Kowaiik, Genbank no: AY 421767) and 17C 2 genotype (strain separated from China continental in 2019) (entrusted to China food and drug testing research institute for carrying out, wherein the strains and corresponding immune serum are from the China food and drug testing research institute), respectively immunizing rats at 0 w and 2 w by 1ml of all the strains, collecting blood and separating serum at 3 w, and respectively performing cross neutralization detection on all the sera and 18 CV-A10 virus strains. In the test, 5 strains (R603/R210/R629/R601/R579) with intratype cross neutralization are involved, and the results show that the fold difference of GMT (neutralizing antibody titer) of the detected serum of the 5 strains is 384-2304, wherein the fold difference of R603 is 384. The strain is shown to have relatively uniform cross neutralization detection capability on the existing coxsackie virus A and C genotypes.

EXAMPLE 2 plaque purification

And inoculating the virus diluent of the primary screened strain for primary plaque purification.

(1) Cell preparation: the RD cells grown in a monolayer are washed, digested and then inoculated into a 6-well cell culture plate, and the cell culture plate is 7 multiplied by 10⁵Each cell/well, supplemented with cell culture medium (RD cells) to 4ml, and placed with 5% CO₂ And (3) statically culturing for 48 hours at 37 +/-1 ℃ in an incubator until a compact monolayer grows. The original culture medium was discarded, and the cell surface was washed with serum-free maintenance medium (MEM culture medium), and the remaining bovine serum and dead cells were washed away.

(2) Virus preparation: the virus solution was diluted by an appropriate fold.

(3) Virus adsorption: inoculating the diluted virus solution at a concentration of 0.4 ml/well, and simultaneouslySetting virus liquid control and cell control, and setting 5% CO₂ Adsorbing for 1-2 hours at 35 ℃ in an incubator, and slightly shaking the cell plate for several times every 15-20 min during the adsorption so as to enable the cell plate to contact the whole cell surface.

(4) Covering and culturing: after adsorption, virus solution, virus control and cell control were discarded, and 3 ml/well of virus maintenance solution was added. Slowly adding the mixture of agarose and virus-maintaining solution into the rest wells along the wall, standing at room temperature for more than 30min for cooling and solidifying to obtain covering layer, and inverting the agarose-containing culture plate in 5% CO₂Culturing at 37 + -1 deg.C in incubator, culturing in positive culture plates for cell control and liquid virus control, observing and recording plaque condition (form, size and amount) and virus control lesion condition every day.

(5) And (3) plaque culture: picking up single plaque with 200 μ l tip with filter core into 1.5ml EP tube containing 100 μ l virus maintenance liquid, repeatedly blowing, mixing, inoculating into 6-well cell culture plate with cell grown to monolayer, placing 5% CO₂Incubate at 37. + -. 1 ℃ and observe CPE every day. When 75% of CPE appears in the cells, collecting the supernatant, and storing the supernatant in a refrigerator at 60 ℃ below zero. The virus passage was P2.

(6) Identification and analysis: the P2 virus passage was tested for virus titer.

(7) Strains with higher titers were selected for the second and third plaque purification, as above.

Example 3 determination of detection of candidate strains

Amplifying the strains purified by the three times of plaques to the 5 th generation to establish original seeds, carrying out related verification research and passage stability research on the original seeds, and selecting the strains with wide cross protection range, good genetic stability and high titer as detection candidate strains according to the passage stability research result. Unless otherwise specified, the detection method was the same as in example 1.

The verification research of the original seed strain mainly comprises immunogenicity, virus titration, genome sequencing analysis and cross neutralization capability research.

The research of passage stability mainly includes that the original seed virus liquid is continuously subcultured on RD cells according to a certain proportion to 15 th generation, and virus titration and genome sequence analysis are carried out on each generation of virus strain in the passage process.

The strain verification research result shows that the strain with the number of R06030451 has good immunogenicity (the positive conversion rate of the serum after primary immunization can reach 100 percent, the positive conversion rate of the serum after secondary immunization is 100 percent, the GMT value of the neutralizing antibody after secondary immunization is 1: 1691), and the titer is 8.04LgCCID₅₀And/ml, the genome sequence is consistent with that of the initially screened strain R603. The results of the intra-type cross-neutralization research (see table 9) show that the GMT value of the virus strain for detecting the immune serum neutralizing antibody is 1:913 (1: 431-1: 913), and the time difference is 8, which indicates that the virus strain has better cross-neutralization detection capability. Wherein, the strains R06170333, R06030151, R06010343 and R02100543 are original seeds obtained by carrying out multiple times of plaque purification on the primary screened strains R617, R603, R601 and R210 in the example 1.

Table 9 results of type internal cross neutralization study

The result of cross-type neutralization shows that the serum of the strain with the number of R06030451 has the smallest difference of the titer of neutralizing antibodies of all strains, is equivalent to the initially screened strain R603 strain detected in example 1, and shows that the strain with the number of R06030451 has more uniform cross-neutralization detection capability on the existing coxsackie virus A, C genotype.

Passage stability research shows that the strain with the number of R06030451 continuously passes 15 generations, and the titer trend is stable (7.92-8.58 LgCCID)₅₀Between/ml), the genomic sequence is identical. The strain is proved to have good genetic stability.

The strain with the number of R06030451 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms (CGMCC for short, the address: No.3 of the West Lu 1 of the Beijing city facing Yang district, the institute of microbiology of the Chinese academy of sciences, zip code 100101) in 7-13.2021, and is classified and named as Coxsackie virus A10 with the preservation number of CGMCC No. 19533.

The genome sequence of the R06030451 strain is shown as SEQ ID NO.3, the coding gene sequence of the P1 protein is shown as SEQ ID NO.2, the amino acid sequence of the P1 protein is shown as SEQ ID NO.1, the amino acid sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are shown as SEQ ID NO.4-10, and the coding gene sequences of the non-structural proteins 2A, 2B, 2C, 3A, 3B, 3C and 3D are respectively shown as SEQ ID NO. 11-17.

Example 4 detection of Strain titer calibration and specificity evaluation

The titer determination was carried out independently for 9 times by 3 subjects, and the result showed that the mean titer was 7.903LgCCID₅₀Per ml (95% CI: 7.868-7.937), fit a normal distribution. The special research shows that the strain is preserved in China general microbiological culture Collection center (CGMCC No.1 institute of microorganisms, China institute of sciences, postal code 100101) on 13 months at 2021 and 13 days at the same time as the Coxsackie virus A16 serum (CGMCC No.19534, the name of the strain is CGMCC, the address is CGMCC No.3 at the national institute of microorganisms at the sunny region of Beijing, and the classification of the Coxsackie virus A16), the Enterovirus 71 serum and the Coxsackie virus A6 serum (the name of the strain is CGMCC No.19532, the name of the strain is R70011631 at the 13 days at 2021 and the name of the strain is preserved in the China general microbiological culture Collection center (CGMCC No.3 at the sunny region of Beijing, the institute of China academy of microorganisms at the national institute of sciences, the postal code 101), the classification of the Coxsackie virus A6 has no cross phenomenon, see the intra-type cross-neutralization study in example 1.

Example 5 pathogenicity study

According to the immunogenicity results in example 1, the optimal 2 strains are selected for pathogenicity preliminary study, and the strain with the strongest pathogenicity is selected according to the results for LD₅₀And (5) researching.

Preliminary studies frozen 2 strains were thawed quickly and diluted to 10% with virus maintenance solution containing 2% FBS⁵CCID₅₀0.05ml, respectively intraperitoneally inoculating 50 mul of Balb/C suckling mice of 1 day old, 1 nest (5-10) of each strain, and additionally setting virus maintenance liquid containing 2% FBS as a control group.The actual number of mice was recorded. Mice were recorded for 21 consecutive days of morbidity and mortality. The results showed that the same challenge dose, the strain numbered R06030451 killed 100% of the suckling mice on day 3 after challenge, and the other strain R06010343 killed 100% of the suckling mice on day 6 after challenge, as shown in fig. 2. The strain numbered R06030451 was shown to be more virulent. The strain was therefore selected as challenge strain for LD₅₀And (5) researching.

The frozen R06030451 strain is taken to be quickly thawed, and is serially diluted by 10 times by using virus maintenance liquid containing 2 percent FBS until the dilution reaches 10³、10²、10¹、10⁰、10^-1CCID₅₀0.05ml five concentrations. Each diluted virus solution was inoculated to 50. mu.l of 1-day-old Balb/C suckling mice in each peritoneal cavity, and a virus maintenance solution containing 2% FBS was added to the control group at 1 nest (5-10 mice) per dilution. The control group was observed for non-specific deaths on day four and the actual number of mice was recorded. The mice were observed continuously for 21 days, the morbidity and mortality of the mice were recorded, and the cumulative mortality and LD of the virus were calculated according to the Reed-Muench method₅₀The value is obtained.

The survival rate of the control group for 21 days is 100%, and the test is established. Results display 10² CCID₅₀All suckling mice in the challenge group died in 6 days, while 10 CCID₅₀All suckling mice in the challenge group died in 13 days, while 1 CCID₅₀The mortality rate of the challenge group was 33.3%. Calculated according to the Reed-muench method, using the dilution as a standard, LD₅₀Is 2.5 multiplied by 10^-7(ii) a Using titer as a standard, LD₅₀Is 8.47CCID₅₀The/ml, survival curves are shown in FIG. 3. The strain is shown to be a strain with strong pathogenicity, and can be used for protective evaluation of a coxsackievirus A10 related vaccine.

EXAMPLE 6 preparation of inactivated vaccine

The original seed of Coxsackie virus A10 strain R06030451 established in example 3 is subjected to adaptive passage on Vero cells, 5 generations of virus liquid is obtained, after 3 times of plaque purification according to example 2, 4 generations of virus liquid are continuously obtained, and qualified virus liquid is obtained after identification. Adopting a cell factory or a bioreactor to carry out amplification culture on Vero cells, inoculating viruses according to MOI =0.0005, and harvesting virus liquid when the lesion reaches more than 75%. After the harvested virus liquid is centrifuged or filtered, the virus liquid is inactivated by formaldehyde 1:4000 for 3 days (or the beta-propiolactone 1:4000 is inactivated at 5 +/-3 ℃ for 1 day), and hydrolyzed at 37 ℃ for 2 hours. And (3) carrying out ultrafiltration concentration and chromatography purification on the inactivated solution, and carrying out sterilization and filtration on the purified solution to obtain a vaccine stock solution (inactivation can also be carried out after virus purification).

And adsorbing the vaccine stock solution and an aluminum hydroxide adjuvant according to a proper proportion to prepare the inactivated vaccine. The concentration of vaccine protein is 20 mug/ml, and the concentration of aluminum is 0.8 mg/ml.

Example 7 immunogenicity of inactivated vaccines

The inactivated vaccine formulated in example 6 was subjected to a mouse immunization test. The immunization method of the mice comprises the following steps: NIH mice (SPF grade, 18-22g, female) were randomly divided into 2 groups of 10 mice per group, and intraperitoneal immunization was performed according to the immunization program for 0 and 14 days, 0.5 ml/mouse, and blood was collected on days 14 and 28, while virus maintenance fluid was used as a control group. The collected serum is subjected to detection of neutralizing antibodies, the specific method is shown in example 1. The result shows that 14 days after 1 immunization, the serum titer of the vaccine group is 100 percent positive, and the level of GTMs of the neutralizing antibody can reach 1: 641; 14 days after the second immunization, the level of GTMs of neutralizing antibodies can reach 1: 3447; the positive conversion rate of the control group is 0 percent, GTMs is less than 1:8, the inactivated vaccine prepared by using the coxsackievirus A10 type strain R06030451 has good immune effect.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing Minhai Biotechnology Ltd

<120> coxsackievirus A10 type strain and application thereof

<130> KHP211120539.4YS

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 862

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Gly Ala Gln Val Ser Thr Gln Lys Ser Gly Ser His Glu Thr Gly

1 5 10 15

Asn Val Ala Thr Gly Gly Ser Thr Ile Asn Phe Thr Asn Ile Asn Tyr

20 25 30

Tyr Lys Asp Ser Tyr Ala Ala Ser Ala Thr Arg Gln Asp Phe Thr Gln

35 40 45

Asp Pro Lys Lys Phe Thr Gln Pro Val Leu Asp Ser Ile Arg Glu Leu

50 55 60

Ser Gly Pro Leu Asn Ser Pro Ser Val Glu Ala Cys Gly Tyr Ser Asp

65 70 75 80

Arg Val Ala Gln Leu Thr Val Gly Asn Ser Ser Ile Thr Thr Gln Glu

85 90 95

Ala Ala Asn Ile Val Leu Ala Tyr Gly Glu Trp Pro Glu Tyr Cys Pro

100 105 110

Asp Thr Asp Ala Thr Ala Val Asp Lys Pro Thr Arg Pro Asp Val Ser

115 120 125

Val Asn Arg Phe Tyr Thr Leu Asp Ser Lys Met Trp Gln Glu Asn Ser

130 135 140

Thr Gly Trp Tyr Trp Lys Phe Pro Asp Val Leu Asn Lys Thr Gly Val

145 150 155 160

Phe Gly Gln Asn Ala Gln Phe His Tyr Leu Tyr Arg Ser Gly Phe Cys

165 170 175

Leu His Val Gln Cys Asn Ala Ser Lys Phe His Gln Gly Ala Leu Leu

180 185 190

Val Ala Val Ile Pro Glu Phe Val Ile Ala Gly Arg Gly Ser Asn Thr

195 200 205

Lys Pro Asn Lys Ala Pro His Pro Gly Phe Thr Thr Thr Phe Pro Gly

210 215 220

Thr Thr Gly Ala Thr Phe His Asp Pro Tyr Val Leu Asp Ser Gly Val

225 230 235 240

Pro Leu Ser Gln Ala Leu Ile Tyr Pro His Gln Trp Ile Asn Leu Arg

245 250 255

Thr Asn Asn Cys Ala Thr Val Ile Val Pro Tyr Ile Asn Ala Val Pro

260 265 270

Phe Asp Ser Ala Ile Asn His Ser Asn Phe Gly Leu Ile Val Ile Pro

275 280 285

Val Ser Pro Leu Lys Tyr Ser Ser Gly Ala Thr Thr Ala Ile Pro Ile

290 295 300

Thr Ile Thr Ile Ala Pro Leu Asn Ser Glu Phe Gly Gly Leu Arg Gln

305 310 315 320

Ala Val Ser Gln Gly Ile Pro Ala Glu Leu Arg Pro Gly Thr Asn Gln

325 330 335

Phe Leu Thr Thr Asp Asp Asp Thr Ala Ala Pro Ile Leu Pro Gly Phe

340 345 350

Thr Pro Thr Pro Thr Ile His Ile Pro Gly Glu Val His Ser Leu Leu

355 360 365

Glu Leu Cys Arg Val Glu Thr Ile Leu Glu Val Asn Asn Thr Thr Glu

370 375 380

Ala Thr Gly Leu Thr Arg Leu Leu Ile Pro Val Ser Ser Gln Asn Lys

385 390 395 400

Ala Asp Glu Leu Cys Ala Ala Phe Met Val Asp Pro Gly Arg Ile Gly

405 410 415

Pro Trp Gln Ser Thr Leu Val Gly Gln Ile Cys Arg Tyr Tyr Thr Gln

420 425 430

Trp Ser Gly Ser Leu Lys Val Thr Phe Met Phe Thr Gly Ser Phe Met

435 440 445

Ala Thr Gly Lys Met Leu Val Ala Tyr Ser Pro Pro Gly Ser Ala Gln

450 455 460

Pro Ala Asn Arg Glu Thr Ala Met Leu Gly Thr His Val Ile Trp Asp

465 470 475 480

Phe Gly Leu Gln Ser Ser Val Ser Leu Val Ile Pro Trp Ile Ser Asn

485 490 495

Thr His Phe Arg Thr Ala Lys Thr Gly Gly Asn Tyr Asp Tyr Tyr Thr

500 505 510

Ala Gly Val Val Thr Leu Trp Tyr Gln Thr Asn Tyr Val Val Pro Pro

515 520 525

Glu Thr Pro Gly Glu Ala Tyr Ile Ile Ala Met Gly Ala Ala Gln Asp

530 535 540

Asn Phe Thr Leu Lys Ile Cys Lys Asp Thr Asp Glu Val Thr Gln Gln

545 550 555 560

Ala Val Leu Gln Gly Asp Pro Val Glu Asp Ile Ile His Asp Ala Leu

565 570 575

Gly Asn Thr Ala Arg Arg Ala Ile Ser Ser Val Thr Asn Val Glu Ser

580 585 590

Ala Ala Asn Thr Thr Pro Ser Ser His Arg Leu Glu Thr Gly Arg Val

595 600 605

Pro Ala Leu Gln Ala Ala Glu Thr Gly Ala Thr Ser Asn Ala Thr Asp

610 615 620

Glu Asn Met Ile Glu Thr Arg Cys Val Val Asn Arg Asn Gly Val Leu

625 630 635 640

Glu Thr Thr Ile Asn His Phe Phe Ser Arg Ser Gly Leu Val Gly Val

645 650 655

Val Asn Leu Thr Asp Gly Gly Thr Asp Thr Thr Gly Tyr Ala Thr Trp

660 665 670

Asp Ile Asp Ile Met Gly Phe Val Gln Leu Arg Arg Lys Cys Glu Met

675 680 685

Phe Thr Tyr Met Arg Phe Asn Ala Glu Phe Thr Phe Val Thr Thr Thr

690 695 700

Glu Asn Gly Glu Ala Arg Pro Tyr Met Leu Gln Tyr Met Tyr Val Pro

705 710 715 720

Pro Gly Ala Pro Lys Pro Thr Gly Arg Asp Ala Phe Gln Trp Gln Thr

725 730 735

Ala Thr Asn Pro Ser Val Phe Val Lys Leu Thr Asp Pro Pro Ala Gln

740 745 750

Val Ser Val Pro Phe Met Ser Pro Ala Ser Ala Tyr Gln Trp Phe Tyr

755 760 765

Asp Gly Tyr Pro Thr Phe Gly Gln His Pro Glu Thr Ser Asn Thr Thr

770 775 780

Tyr Gly Leu Cys Pro Asn Asn Met Met Gly Thr Phe Ala Val Arg Val

785 790 795 800

Val Ser Arg Glu Ala Ser Gln Leu Lys Leu Gln Thr Arg Val Tyr Met

805 810 815

Lys Leu Lys His Val Arg Ala Trp Val Pro Arg Pro Ile Arg Ser Gln

820 825 830

Pro Tyr Leu Leu Lys Asn Phe Pro Asn Tyr Asp Ser Ser Lys Val Thr

835 840 845

Asn Ser Ala Arg Asp Arg Ser Ser Ile Lys Gln Ala Asn Met

850 855 860

<210> 2

<211> 2586

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgggagctc aagtctcgac gcaaaaatcc ggcagtcatg agactggtaa tgtagccact 60

ggaggatcta caataaactt cactaacatc aactattata aagattctta cgccgcgtca 120

gctacccggc aagacttcac acaagatccg aagaaattca cacaaccagt gttagactct 180

attagagaac tatcaggccc tttgaactct ccttctgtgg aagcttgtgg ttatagtgat 240

agggtcgccc agctcactgt tgggaactcc tccattacta cccaagaggc tgctaatatc 300

gtattagctt atggagagtg gcctgagtac tgccctgaca cagacgcaac tgccgtggat 360

aaaccaactc gcccggacgt gtctgtcaac aggttctaca ctttggactc caaaatgtgg 420

caagaaaatt cgactggttg gtattggaag ttccctgacg tgctgaacaa aacgggtgtg 480

ttcggacaga atgcccaatt tcattacttg taccggtcgg gtttctgctt gcatgtacag 540

tgtaatgcta gtaagtttca ccagggggcc cttcttgtgg ctgtgatacc agaatttgtg 600

atcgctggca gagggtctaa cacaaaacca aataaagcgc cccacccagg gtttaccaca 660

actttccctg gcaccaccgg tgctacattc catgacccat acgttctgga ttccggggta 720

ccattgagtc aggctctaat atacccccat cagtggatca atctccgcac taacaactgt 780

gcaactgtta tagttccata catcaatgct gttccgtttg actcagccat caaccatagc 840

aattttgggc taatagtgat accagttagc ccgctgaagt attcgtccgg ggcaactact 900

gcaatcccaa tcactatcac tatagccccc ctgaattcag agtttggagg actgcgacaa 960

gccgtcagtc aaggcatccc agctgagctc aggcccggga ctaatcagtt cctgaccaca 1020

gatgatgaca ctgcagcgcc catcctccca ggattcaccc ccacacccac aattcacata 1080

ccaggggaag tacactcttt gctggagttg tgtagggtgg agactatttt ggaagtgaac 1140

aacaccacag aagcaacagg attaacaagg ctcttaatac cagtgtcctc gcagaacaaa 1200

gccgatgagt tgtgtgctgc gtttatggtt gatccaggcc gaattggacc ttggcaatct 1260

actttagttg gacagatttg ccggtattac acacaatggt ccgggtcttt gaaggtgacc 1320

tttatgttca caggatcttt tatggcaaca ggcaagatgc tggtggccta ctccccgccc 1380

ggaagcgctc aaccagccaa cagagaaacc gccatgctgg gcacgcacgt catctgggac 1440

tttgggctac aatcgtcagt ctctttggtg ataccgtgga tcagtaacac tcacttccgt 1500

actgccaaga caggtgggaa ttacgattac tatacggcgg gtgtagtgac cttatggtat 1560

cagaccaatt acgtggtccc gccagaaacc cctggagagg catatattat tgcaatgggg 1620

gcggcacaag acaacttcac tttgaagatc tgcaaggata ctgatgaagt gacacaacaa 1680

gctgtgttgc aaggtgaccc tgtggaggat ataattcatg acgctctggg aaacacagcg 1740

cgtagagcta ttagcagtgt tacaaatgtt gaatccgcgg ccaacaccac tcccagttca 1800

caccgactag agactggacg cgtaccagcg ctacaggctg cagagacggg tgccacttct 1860

aatgccacag atgagaacat gattgagacc cgttgtgtgg ttaacagaaa tggggtgttg 1920

gaaaccacta tcaaccactt cttctcccgc tctggattag tgggagtggt taacctcaca 1980

gatgggggga cggacaccac tgggtatgct acatgggaca tagacattat gggttttgtc 2040

caactccgca gaaaatgcga gatgttcaca tacatgaggt tcaacgcaga attcacattt 2100

gtcacaacga cagagaatgg agaggctcgt ccgtacatgc tacaatatat gtatgtgccc 2160

cctggcgccc ccaaaccgac gggaagggat gcctttcaat ggcaaacagc aactaaccca 2220

tcagtcttcg tcaaactcac tgaccctcct gcacaagtct cagttccttt catgtcacca 2280

gctagcgcat atcagtggtt ctatgatggt taccccactt tcggccagca cccggagacc 2340

tcaaacacaa catacggatt gtgcccaaac aatatgatgg gcacatttgc agtgagagtt 2400

gttagtagag aggcaagtca actaaaacta cagactagag tgtacatgaa gcttaagcat 2460

gtgagggcct gggtcccaag accgatcagg tctcagccat acctgctcaa aaacttcccc 2520

aattacgaca gtagcaaggt taccaacagt gcacgggacc gttccagtat caagcaagct 2580

aatatg 2586

<210> 3

<211> 7407

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttaaaccagc ctgtgggttg tacccaccca cagggcccac tgggcgctag cactccgatt 60

ctgcggaatc tttgtgcgcc tgttttataa ccctcccccg aaacttgcaa cttagaagtt 120

atgtacgtta ctgatcaaca gcaggcgtgg cataccagcc atgtcttgat caagcacttc 180

tgtaaccccg gaccgagtat caatagactg ctcacgtggt cgaaagagaa aacgttcgtt 240

atccggctaa ctacttcgag aaacctagta gcaccactga aactgcggag tgtttcgctc 300

agcacttccc ccgtgtagat caggtcgatg agtcactgct taccccacgg gtgaccgtgg 360

cagtggctgc gttggcggcc tgcctatggg gcaacccata ggacgctcta aagtggacat 420

ggtgtgaaga gtctattgag ctagttagta gtcctccggc ccctgaatgc ggctaatcct 480

aactgcggag cgcatgcccc caaaccagag ggtggtgcgt cgtaacgggt aactctgcag 540

cggaaccgac tactttgggt gtccgtgttt cttttattct cataatggct gcttatggtg 600

acaattgagg aattgttacc atatagctat tggattggcc atccggtgtg caacagagct 660

attatctacc tgtttgttgg atacattcca ttgacaccta aatccttcaa tacattgcac 720

tatatcctaa cgttgaacgc aagaaaatgg gagctcaagt ctcgacgcaa aaatccggca 780

gtcatgagac tggtaatgta gccactggag gatctacaat aaacttcact aacatcaact 840

attataaaga ttcttacgcc gcgtcagcta cccggcaaga cttcacacaa gatccgaaga 900

aattcacaca accagtgtta gactctatta gagaactatc aggccctttg aactctcctt 960

ctgtggaagc ttgtggttat agtgataggg tcgcccagct cactgttggg aactcctcca 1020

ttactaccca agaggctgct aatatcgtat tagcttatgg agagtggcct gagtactgcc 1080

ctgacacaga cgcaactgcc gtggataaac caactcgccc ggacgtgtct gtcaacaggt 1140

tctacacttt ggactccaaa atgtggcaag aaaattcgac tggttggtat tggaagttcc 1200

ctgacgtgct gaacaaaacg ggtgtgttcg gacagaatgc ccaatttcat tacttgtacc 1260

ggtcgggttt ctgcttgcat gtacagtgta atgctagtaa gtttcaccag ggggcccttc 1320

ttgtggctgt gataccagaa tttgtgatcg ctggcagagg gtctaacaca aaaccaaata 1380

aagcgcccca cccagggttt accacaactt tccctggcac caccggtgct acattccatg 1440

acccatacgt tctggattcc ggggtaccat tgagtcaggc tctaatatac ccccatcagt 1500

ggatcaatct ccgcactaac aactgtgcaa ctgttatagt tccatacatc aatgctgttc 1560

cgtttgactc agccatcaac catagcaatt ttgggctaat agtgatacca gttagcccgc 1620

tgaagtattc gtccggggca actactgcaa tcccaatcac tatcactata gcccccctga 1680

attcagagtt tggaggactg cgacaagccg tcagtcaagg catcccagct gagctcaggc 1740

ccgggactaa tcagttcctg accacagatg atgacactgc agcgcccatc ctcccaggat 1800

tcacccccac acccacaatt cacataccag gggaagtaca ctctttgctg gagttgtgta 1860

gggtggagac tattttggaa gtgaacaaca ccacagaagc aacaggatta acaaggctct 1920

taataccagt gtcctcgcag aacaaagccg atgagttgtg tgctgcgttt atggttgatc 1980

caggccgaat tggaccttgg caatctactt tagttggaca gatttgccgg tattacacac 2040

aatggtccgg gtctttgaag gtgaccttta tgttcacagg atcttttatg gcaacaggca 2100

agatgctggt ggcctactcc ccgcccggaa gcgctcaacc agccaacaga gaaaccgcca 2160

tgctgggcac gcacgtcatc tgggactttg ggctacaatc gtcagtctct ttggtgatac 2220

cgtggatcag taacactcac ttccgtactg ccaagacagg tgggaattac gattactata 2280

cggcgggtgt agtgacctta tggtatcaga ccaattacgt ggtcccgcca gaaacccctg 2340

gagaggcata tattattgca atgggggcgg cacaagacaa cttcactttg aagatctgca 2400

aggatactga tgaagtgaca caacaagctg tgttgcaagg tgaccctgtg gaggatataa 2460

ttcatgacgc tctgggaaac acagcgcgta gagctattag cagtgttaca aatgttgaat 2520

ccgcggccaa caccactccc agttcacacc gactagagac tggacgcgta ccagcgctac 2580

aggctgcaga gacgggtgcc acttctaatg ccacagatga gaacatgatt gagacccgtt 2640

gtgtggttaa cagaaatggg gtgttggaaa ccactatcaa ccacttcttc tcccgctctg 2700

gattagtggg agtggttaac ctcacagatg gggggacgga caccactggg tatgctacat 2760

gggacataga cattatgggt tttgtccaac tccgcagaaa atgcgagatg ttcacataca 2820

tgaggttcaa cgcagaattc acatttgtca caacgacaga gaatggagag gctcgtccgt 2880

acatgctaca atatatgtat gtgccccctg gcgcccccaa accgacggga agggatgcct 2940

ttcaatggca aacagcaact aacccatcag tcttcgtcaa actcactgac cctcctgcac 3000

aagtctcagt tcctttcatg tcaccagcta gcgcatatca gtggttctat gatggttacc 3060

ccactttcgg ccagcacccg gagacctcaa acacaacata cggattgtgc ccaaacaata 3120

tgatgggcac atttgcagtg agagttgtta gtagagaggc aagtcaacta aaactacaga 3180

ctagagtgta catgaagctt aagcatgtga gggcctgggt cccaagaccg atcaggtctc 3240

agccatacct gctcaaaaac ttccccaatt acgacagtag caaggttacc aacagtgcac 3300

gggaccgttc cagtatcaag caagctaata tgggtaaatt tgggcaacaa tctggcgcca 3360

tctacgttgg taactacaga gtggtcaata ggcacctggc cacccacaat gactgggcca 3420

acctggtgtg ggaagacagt tctcgagacc tgcttgtttc gtctaccacc gcccagggtt 3480

gcgatacgat tgcccgttgt gagtgtcaga caggggtgta ctattgtaac tcaaggagga 3540

aacattaccc agtcagtttc tctaaaccta gcctcgtctt cgtagaggcc agtgagtatt 3600

accctgctag atatcaatct cacctaatgc tcgctgcagg ccactctgaa cctggggatt 3660

gcgggggtat attgaggtgt cagcatggtg tggttggcat agtgtccact ggaggcaacg 3720

gtcttgtcgg ttttgctaac gtgagggacc tcttatggtt ggatgaagaa gccatggaac 3780

agggagtatc tgactatatc aagggactcg gcgacgcctt tggtactggc tttactgatg 3840

cagtgtctag ggaagtggag gccctgaaaa attacctgat tggttccgag ggagcggtgg 3900

agaagatcct gaagaacttg gtgaaactca tatcagctct ggtcatagtt atcagaagtg 3960

actacgacat ggtcaccctt accgcaactc tagctctgat tgggtgtcac gggagcccat 4020

gggcgtggat caaagcaaag acggcgtcca tcttaggtat tcctatggca cagaagcaga 4080

gtgcatcttg gcttaagaag ttcagtgata tggcgaacgc tgcaaaggga ttagagtgga 4140

tctccaacaa aatcagcaaa tttattgatt ggctcaagga aaagatcatt ccagccgcaa 4200

aggaaaaagt cgagtttctt aataacctca agcaactgcc cttgatggaa aaccaaattg 4260

ctaacttaga acagtccgct gcttcacaag aagaccttga agtcatgttt ggtaatgtgt 4320

catacctagc acacttttgt cgcaagttcc agccactcta tgcaactgaa gcgaagagag 4380

tgtacgcctt agagaagaga atgaataatt acatgcagtt caagagcaaa caccgtattg 4440

aacctgtatg tttgattatc aggggctcac caggaactgg caagtcactt gccacaggta 4500

taatagcaag agccattgct gacaaatatc actctagtgt gtactccctt ccaccagacc 4560

cagatcactt tgatggatac aagcaacaag tggtgacagt catggatgat ctgtgccaaa 4620

acccagatgg caaagatatg tcattgtttt gtcaaatggt atccactgtc gattttatac 4680

ccccaatggc ttcactggaa gaaaaaggtg tatccttcac atctaaattt gttattgctt 4740

caactaatgc tagcaacatc attgtcccca cggtctcaga ctctgacgct atccgtagga 4800

gatttttcat ggattgtgat atcgaagtga ctgactctta taagacagac ttaggccgct 4860

tagatgcagg tagggccgca aagctctgct cagagaataa cactgccaat ttcaagaggt 4920

gcagcccgct agtgtgcggt aaagccatcc aactgagaga taggaagtcc aaagtcaggt 4980

atagcgtaga cactgtggta tcagaattag ttagggagta tagcaacagg tctgctatag 5040

ggaacactat agaagcttta ttccaagggc ctcctaaatt caggcctgta agaattagtc 5100

ttgatgagaa acccgctcca gatgccatta gtgacctgct tgctagtgtt gatagtgaag 5160

aggtgcggca gtactgcaga gatcaaggat ggataatacc tgaaacgcca accaacgtgg 5220

agcggcatct caatagggca gtactagtga tgcaatccat cgctactgta gtcgcagttg 5280

tgtcccttgt ttatgttatc tacaagctat ttgctggttt ccaaggcgca tattctggag 5340

cgcccaggca agctctcaag aaacctgtgt tgaggacagc cactgttcaa gggcccagct 5400

tagattttgc cctgtccctc ctacgacgta acgtcaggca ggtgcaaacc gaccaagggc 5460

actttaccat gcttggggta cgtgaccacc ttgctatctt acctcgtcac tcgcaaccag 5520

ggaagaccat ctgggttgaa cacaagttgg tcaatgtgct tgatgctgtt gagctagtgg 5580

atgaacaagg tgttaatttg gagctcacac tagtaaccct agataccaat gagaagttta 5640

gagatgtcac caagttcatt ccagagaata tcagtggagt cagtgatgcc acattaataa 5700

tcaacactga acacatgcca tcaatgtttg tcccggtagg agatgttgtt caatatgggt 5760

tcctaaatct tagtggtaaa ccaacccaca ggaccatgat gtacaatttc cctacaaagg 5820

ctggacagtg tggaggcgtg gtaacatctg tcggtaaaat cattggcatc cacattggag 5880

gcaacgggcg tcaagggttt tgcgctggcc tgaagaggag ttactttgca agtgagcaag 5940

gtgaaatcca atgggtgaaa cctaacaagg agaccggcag attaaatatc aatggtccaa 6000

cacgcaccaa gttagagccc agtgtgttcc atgatctgtt tgagggcaac aaggagccag 6060

cagtcctaac aagcaaggat cccagattag aggttgactt tgagcaggct ctcttctcca 6120

agtatgtggg taatgtcctc cacgaacctg atgaatatgt gaagcaggca gccctccact 6180

acgcaaatca gctcaagcaa ctggatataa acaccaataa gatgagcatg gaggaagcgt 6240

gctatggcac agagaacctg gaagcaattg acctccatac tagcgcgggg tacccataca 6300

gtgctttggg cataaagaag agggacatac tagatcctac cactaaggac ataacaaaaa 6360

tgaagtttta catggataag tatggcttgg atttacctta ctccacctac gttaaagatg 6420

aacttaggcc tctggacaag atcaagaaag ggaagtcccg cttaatagaa gctagcagcc 6480

tgaatgattc agtgtacctc agaatgactt ttggccacct gtatgaagca ttccatgcaa 6540

acccagggac tgtgaccgga tcagcagttg ggtgcaatcc ggatgtgttc tggagtaaac 6600

tcccaatcct actcccaggc tcgctatttg cctttgacta ttcaggctat gatgctagtc 6660

ttagccccgt ctggtttagg gctttggaga tggtcttacg ggacatcggc tattcagagg 6720

aagcagtgtc actcatagaa ggaataaatc acacccatca tgtgtatcgg aataaaacat 6780

attgtgttct tggcgggatg ccgtcaggat gttctggtac ttccattttc aactcgatga 6840

tcaacaacat catcattagg acgcttttaa tcaaaacctt taaagggata gatctggacg 6900

agttgaatat ggtggcctat ggagatgatg tgctggctag ttatcctttc cctattgatt 6960

gtcttgagtt agctaagact ggcaaggagt atgggctgac catgacacct gcggacaaat 7020

caccttgctt caatgaagtg acgtgggaaa atgccacctt tctgaagaga gggtttctac 7080

cagatcatca attcccattc ttgattcatc ccacaatgcc catgaaagaa attcacgaat 7140

ctatacgctg gactaaagat gcgtgcaata cccaagacca tgtgcgctct ctgtgtttat 7200

tagcttggca caatggtaag gatgaatatg aaaaatttgt gagcacaatt agatcagtcc 7260

cagttgggag agcattggca attccgaatt ttgagaattt gagaagaaat tggctcgaac 7320

tattttagat ttacagttga aagctggacc ccgccagaaa tctggtcgtg ttaatgactg 7380

gtgggggtaa atttgttata cccagag 7407

<210> 4

<211> 150

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Gly Lys Phe Gly Gln Gln Ser Gly Ala Ile Tyr Val Gly Asn Tyr Arg

1 5 10 15

Val Val Asn Arg His Leu Ala Thr His Asn Asp Trp Ala Asn Leu Val

20 25 30

Trp Glu Asp Ser Ser Arg Asp Leu Leu Val Ser Ser Thr Thr Ala Gln

35 40 45

Gly Cys Asp Thr Ile Ala Arg Cys Glu Cys Gln Thr Gly Val Tyr Tyr

50 55 60

Cys Asn Ser Arg Arg Lys His Tyr Pro Val Ser Phe Ser Lys Pro Ser

65 70 75 80

Leu Val Phe Val Glu Ala Ser Glu Tyr Tyr Pro Ala Arg Tyr Gln Ser

85 90 95

His Leu Met Leu Ala Ala Gly His Ser Glu Pro Gly Asp Cys Gly Gly

100 105 110

Ile Leu Arg Cys Gln His Gly Val Val Gly Ile Val Ser Thr Gly Gly

115 120 125

Asn Gly Leu Val Gly Phe Ala Asn Val Arg Asp Leu Leu Trp Leu Asp

130 135 140

Glu Glu Ala Met Glu Gln

145 150

<210> 5

<211> 99

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Gly Val Ser Asp Tyr Ile Lys Gly Leu Gly Asp Ala Phe Gly Thr Gly

1 5 10 15

Phe Thr Asp Ala Val Ser Arg Glu Val Glu Ala Leu Lys Asn Tyr Leu

20 25 30

Ile Gly Ser Glu Gly Ala Val Glu Lys Ile Leu Lys Asn Leu Val Lys

35 40 45

Leu Ile Ser Ala Leu Val Ile Val Ile Arg Ser Asp Tyr Asp Met Val

50 55 60

Thr Leu Thr Ala Thr Leu Ala Leu Ile Gly Cys His Gly Ser Pro Trp

65 70 75 80

Ala Trp Ile Lys Ala Lys Thr Ala Ser Ile Leu Gly Ile Pro Met Ala

85 90 95

Gln Lys Gln

<210> 6

<211> 329

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Ser Ala Ser Trp Leu Lys Lys Phe Ser Asp Met Ala Asn Ala Ala Lys

1 5 10 15

Gly Leu Glu Trp Ile Ser Asn Lys Ile Ser Lys Phe Ile Asp Trp Leu

20 25 30

Lys Glu Lys Ile Ile Pro Ala Ala Lys Glu Lys Val Glu Phe Leu Asn

35 40 45

Asn Leu Lys Gln Leu Pro Leu Met Glu Asn Gln Ile Ala Asn Leu Glu

50 55 60

Gln Ser Ala Ala Ser Gln Glu Asp Leu Glu Val Met Phe Gly Asn Val

65 70 75 80

Ser Tyr Leu Ala His Phe Cys Arg Lys Phe Gln Pro Leu Tyr Ala Thr

85 90 95

Glu Ala Lys Arg Val Tyr Ala Leu Glu Lys Arg Met Asn Asn Tyr Met

100 105 110

Gln Phe Lys Ser Lys His Arg Ile Glu Pro Val Cys Leu Ile Ile Arg

115 120 125

Gly Ser Pro Gly Thr Gly Lys Ser Leu Ala Thr Gly Ile Ile Ala Arg

130 135 140

Ala Ile Ala Asp Lys Tyr His Ser Ser Val Tyr Ser Leu Pro Pro Asp

145 150 155 160

Pro Asp His Phe Asp Gly Tyr Lys Gln Gln Val Val Thr Val Met Asp

165 170 175

Asp Leu Cys Gln Asn Pro Asp Gly Lys Asp Met Ser Leu Phe Cys Gln

180 185 190

Met Val Ser Thr Val Asp Phe Ile Pro Pro Met Ala Ser Leu Glu Glu

195 200 205

Lys Gly Val Ser Phe Thr Ser Lys Phe Val Ile Ala Ser Thr Asn Ala

210 215 220

Ser Asn Ile Ile Val Pro Thr Val Ser Asp Ser Asp Ala Ile Arg Arg

225 230 235 240

Arg Phe Phe Met Asp Cys Asp Ile Glu Val Thr Asp Ser Tyr Lys Thr

245 250 255

Asp Leu Gly Arg Leu Asp Ala Gly Arg Ala Ala Lys Leu Cys Ser Glu

260 265 270

Asn Asn Thr Ala Asn Phe Lys Arg Cys Ser Pro Leu Val Cys Gly Lys

275 280 285

Ala Ile Gln Leu Arg Asp Arg Lys Ser Lys Val Arg Tyr Ser Val Asp

290 295 300

Thr Val Val Ser Glu Leu Val Arg Glu Tyr Ser Asn Arg Ser Ala Ile

305 310 315 320

Gly Asn Thr Ile Glu Ala Leu Phe Gln

325

<210> 7

<211> 86

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Gly Pro Pro Lys Phe Arg Pro Val Arg Ile Ser Leu Asp Glu Lys Pro

1 5 10 15

Ala Pro Asp Ala Ile Ser Asp Leu Leu Ala Ser Val Asp Ser Glu Glu

20 25 30

Val Arg Gln Tyr Cys Arg Asp Gln Gly Trp Ile Ile Pro Glu Thr Pro

35 40 45

Thr Asn Val Glu Arg His Leu Asn Arg Ala Val Leu Val Met Gln Ser

50 55 60

Ile Ala Thr Val Val Ala Val Val Ser Leu Val Tyr Val Ile Tyr Lys

65 70 75 80

Leu Phe Ala Gly Phe Gln

85

<210> 8

<211> 22

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Gly Ala Tyr Ser Gly Ala Pro Arg Gln Ala Leu Lys Lys Pro Val Leu

1 5 10 15

Arg Thr Ala Thr Val Gln

20

<210> 9

<211> 183

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Gly Pro Ser Leu Asp Phe Ala Leu Ser Leu Leu Arg Arg Asn Val Arg

1 5 10 15

Gln Val Gln Thr Asp Gln Gly His Phe Thr Met Leu Gly Val Arg Asp

20 25 30

His Leu Ala Ile Leu Pro Arg His Ser Gln Pro Gly Lys Thr Ile Trp

35 40 45

Val Glu His Lys Leu Val Asn Val Leu Asp Ala Val Glu Leu Val Asp

50 55 60

Glu Gln Gly Val Asn Leu Glu Leu Thr Leu Val Thr Leu Asp Thr Asn

65 70 75 80

Glu Lys Phe Arg Asp Val Thr Lys Phe Ile Pro Glu Asn Ile Ser Gly

85 90 95

Val Ser Asp Ala Thr Leu Ile Ile Asn Thr Glu His Met Pro Ser Met

100 105 110

Phe Val Pro Val Gly Asp Val Val Gln Tyr Gly Phe Leu Asn Leu Ser

115 120 125

Gly Lys Pro Thr His Arg Thr Met Met Tyr Asn Phe Pro Thr Lys Ala

130 135 140

Gly Gln Cys Gly Gly Val Val Thr Ser Val Gly Lys Ile Ile Gly Ile

145 150 155 160

His Ile Gly Gly Asn Gly Arg Gln Gly Phe Cys Ala Gly Leu Lys Arg

165 170 175

Ser Tyr Phe Ala Ser Glu Gln

180

<210> 10

<211> 462

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 10

Gly Glu Ile Gln Trp Val Lys Pro Asn Lys Glu Thr Gly Arg Leu Asn

1 5 10 15

Ile Asn Gly Pro Thr Arg Thr Lys Leu Glu Pro Ser Val Phe His Asp

20 25 30

Leu Phe Glu Gly Asn Lys Glu Pro Ala Val Leu Thr Ser Lys Asp Pro

35 40 45

Arg Leu Glu Val Asp Phe Glu Gln Ala Leu Phe Ser Lys Tyr Val Gly

50 55 60

Asn Val Leu His Glu Pro Asp Glu Tyr Val Lys Gln Ala Ala Leu His

65 70 75 80

Tyr Ala Asn Gln Leu Lys Gln Leu Asp Ile Asn Thr Asn Lys Met Ser

85 90 95

Met Glu Glu Ala Cys Tyr Gly Thr Glu Asn Leu Glu Ala Ile Asp Leu

100 105 110

His Thr Ser Ala Gly Tyr Pro Tyr Ser Ala Leu Gly Ile Lys Lys Arg

115 120 125

Asp Ile Leu Asp Pro Thr Thr Lys Asp Ile Thr Lys Met Lys Phe Tyr

130 135 140

Met Asp Lys Tyr Gly Leu Asp Leu Pro Tyr Ser Thr Tyr Val Lys Asp

145 150 155 160

Glu Leu Arg Pro Leu Asp Lys Ile Lys Lys Gly Lys Ser Arg Leu Ile

165 170 175

Glu Ala Ser Ser Leu Asn Asp Ser Val Tyr Leu Arg Met Thr Phe Gly

180 185 190

His Leu Tyr Glu Ala Phe His Ala Asn Pro Gly Thr Val Thr Gly Ser

195 200 205

Ala Val Gly Cys Asn Pro Asp Val Phe Trp Ser Lys Leu Pro Ile Leu

210 215 220

Leu Pro Gly Ser Leu Phe Ala Phe Asp Tyr Ser Gly Tyr Asp Ala Ser

225 230 235 240

Leu Ser Pro Val Trp Phe Arg Ala Leu Glu Met Val Leu Arg Asp Ile

245 250 255

Gly Tyr Ser Glu Glu Ala Val Ser Leu Ile Glu Gly Ile Asn His Thr

260 265 270

His His Val Tyr Arg Asn Lys Thr Tyr Cys Val Leu Gly Gly Met Pro

275 280 285

Ser Gly Cys Ser Gly Thr Ser Ile Phe Asn Ser Met Ile Asn Asn Ile

290 295 300

Ile Ile Arg Thr Leu Leu Ile Lys Thr Phe Lys Gly Ile Asp Leu Asp

305 310 315 320

Glu Leu Asn Met Val Ala Tyr Gly Asp Asp Val Leu Ala Ser Tyr Pro

325 330 335

Phe Pro Ile Asp Cys Leu Glu Leu Ala Lys Thr Gly Lys Glu Tyr Gly

340 345 350

Leu Thr Met Thr Pro Ala Asp Lys Ser Pro Cys Phe Asn Glu Val Thr

355 360 365

Trp Glu Asn Ala Thr Phe Leu Lys Arg Gly Phe Leu Pro Asp His Gln

370 375 380

Phe Pro Phe Leu Ile His Pro Thr Met Pro Met Lys Glu Ile His Glu

385 390 395 400

Ser Ile Arg Trp Thr Lys Asp Ala Cys Asn Thr Gln Asp His Val Arg

405 410 415

Ser Leu Cys Leu Leu Ala Trp His Asn Gly Lys Asp Glu Tyr Glu Lys

420 425 430

Phe Val Ser Thr Ile Arg Ser Val Pro Val Gly Arg Ala Leu Ala Ile

435 440 445

Pro Asn Phe Glu Asn Leu Arg Arg Asn Trp Leu Glu Leu Phe

450 455 460

<210> 11

<211> 450

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggtaaatttg ggcaacaatc tggcgccatc tacgttggta actacagagt ggtcaatagg 60

cacctggcca cccacaatga ctgggccaac ctggtgtggg aagacagttc tcgagacctg 120

cttgtttcgt ctaccaccgc ccagggttgc gatacgattg cccgttgtga gtgtcagaca 180

ggggtgtact attgtaactc aaggaggaaa cattacccag tcagtttctc taaacctagc 240

ctcgtcttcg tagaggccag tgagtattac cctgctagat atcaatctca cctaatgctc 300

gctgcaggcc actctgaacc tggggattgc gggggtatat tgaggtgtca gcatggtgtg 360

gttggcatag tgtccactgg aggcaacggt cttgtcggtt ttgctaacgt gagggacctc 420

ttatggttgg atgaagaagc catggaacag 450

<210> 12

<211> 297

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggagtatctg actatatcaa gggactcggc gacgcctttg gtactggctt tactgatgca 60

gtgtctaggg aagtggaggc cctgaaaaat tacctgattg gttccgaggg agcggtggag 120

aagatcctga agaacttggt gaaactcata tcagctctgg tcatagttat cagaagtgac 180

tacgacatgg tcacccttac cgcaactcta gctctgattg ggtgtcacgg gagcccatgg 240

gcgtggatca aagcaaagac ggcgtccatc ttaggtattc ctatggcaca gaagcag 297

<210> 13

<211> 987

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agtgcatctt ggcttaagaa gttcagtgat atggcgaacg ctgcaaaggg attagagtgg 60

atctccaaca aaatcagcaa atttattgat tggctcaagg aaaagatcat tccagccgca 120

aaggaaaaag tcgagtttct taataacctc aagcaactgc ccttgatgga aaaccaaatt 180

gctaacttag aacagtccgc tgcttcacaa gaagaccttg aagtcatgtt tggtaatgtg 240

tcatacctag cacacttttg tcgcaagttc cagccactct atgcaactga agcgaagaga 300

gtgtacgcct tagagaagag aatgaataat tacatgcagt tcaagagcaa acaccgtatt 360

gaacctgtat gtttgattat caggggctca ccaggaactg gcaagtcact tgccacaggt 420

ataatagcaa gagccattgc tgacaaatat cactctagtg tgtactccct tccaccagac 480

ccagatcact ttgatggata caagcaacaa gtggtgacag tcatggatga tctgtgccaa 540

aacccagatg gcaaagatat gtcattgttt tgtcaaatgg tatccactgt cgattttata 600

cccccaatgg cttcactgga agaaaaaggt gtatccttca catctaaatt tgttattgct 660

tcaactaatg ctagcaacat cattgtcccc acggtctcag actctgacgc tatccgtagg 720

agatttttca tggattgtga tatcgaagtg actgactctt ataagacaga cttaggccgc 780

ttagatgcag gtagggccgc aaagctctgc tcagagaata acactgccaa tttcaagagg 840

tgcagcccgc tagtgtgcgg taaagccatc caactgagag ataggaagtc caaagtcagg 900

tatagcgtag acactgtggt atcagaatta gttagggagt atagcaacag gtctgctata 960

gggaacacta tagaagcttt attccaa 987

<210> 14

<211> 258

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gggcctccta aattcaggcc tgtaagaatt agtcttgatg agaaacccgc tccagatgcc 60

attagtgacc tgcttgctag tgttgatagt gaagaggtgc ggcagtactg cagagatcaa 120

ggatggataa tacctgaaac gccaaccaac gtggagcggc atctcaatag ggcagtacta 180

gtgatgcaat ccatcgctac tgtagtcgca gttgtgtccc ttgtttatgt tatctacaag 240

ctatttgctg gtttccaa 258

<210> 15

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggcgcatatt ctggagcgcc caggcaagct ctcaagaaac ctgtgttgag gacagccact 60

gttcaa 66

<210> 16

<211> 549

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gggcccagct tagattttgc cctgtccctc ctacgacgta acgtcaggca ggtgcaaacc 60

gaccaagggc actttaccat gcttggggta cgtgaccacc ttgctatctt acctcgtcac 120

tcgcaaccag ggaagaccat ctgggttgaa cacaagttgg tcaatgtgct tgatgctgtt 180

gagctagtgg atgaacaagg tgttaatttg gagctcacac tagtaaccct agataccaat 240

gagaagttta gagatgtcac caagttcatt ccagagaata tcagtggagt cagtgatgcc 300

acattaataa tcaacactga acacatgcca tcaatgtttg tcccggtagg agatgttgtt 360

caatatgggt tcctaaatct tagtggtaaa ccaacccaca ggaccatgat gtacaatttc 420

cctacaaagg ctggacagtg tggaggcgtg gtaacatctg tcggtaaaat cattggcatc 480

cacattggag gcaacgggcg tcaagggttt tgcgctggcc tgaagaggag ttactttgca 540

agtgagcaa 549

<210> 17

<211> 1386

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggtgaaatcc aatgggtgaa acctaacaag gagaccggca gattaaatat caatggtcca 60

acacgcacca agttagagcc cagtgtgttc catgatctgt ttgagggcaa caaggagcca 120

gcagtcctaa caagcaagga tcccagatta gaggttgact ttgagcaggc tctcttctcc 180

aagtatgtgg gtaatgtcct ccacgaacct gatgaatatg tgaagcaggc agccctccac 240

tacgcaaatc agctcaagca actggatata aacaccaata agatgagcat ggaggaagcg 300

tgctatggca cagagaacct ggaagcaatt gacctccata ctagcgcggg gtacccatac 360

agtgctttgg gcataaagaa gagggacata ctagatccta ccactaagga cataacaaaa 420

atgaagtttt acatggataa gtatggcttg gatttacctt actccaccta cgttaaagat 480

gaacttaggc ctctggacaa gatcaagaaa gggaagtccc gcttaataga agctagcagc 540

ctgaatgatt cagtgtacct cagaatgact tttggccacc tgtatgaagc attccatgca 600

aacccaggga ctgtgaccgg atcagcagtt gggtgcaatc cggatgtgtt ctggagtaaa 660

ctcccaatcc tactcccagg ctcgctattt gcctttgact attcaggcta tgatgctagt 720

cttagccccg tctggtttag ggctttggag atggtcttac gggacatcgg ctattcagag 780

gaagcagtgt cactcataga aggaataaat cacacccatc atgtgtatcg gaataaaaca 840

tattgtgttc ttggcgggat gccgtcagga tgttctggta cttccatttt caactcgatg 900

atcaacaaca tcatcattag gacgctttta atcaaaacct ttaaagggat agatctggac 960

gagttgaata tggtggccta tggagatgat gtgctggcta gttatccttt ccctattgat 1020

tgtcttgagt tagctaagac tggcaaggag tatgggctga ccatgacacc tgcggacaaa 1080

tcaccttgct tcaatgaagt gacgtgggaa aatgccacct ttctgaagag agggtttcta 1140

ccagatcatc aattcccatt cttgattcat cccacaatgc ccatgaaaga aattcacgaa 1200

tctatacgct ggactaaaga tgcgtgcaat acccaagacc atgtgcgctc tctgtgttta 1260

ttagcttggc acaatggtaa ggatgaatat gaaaaatttg tgagcacaat tagatcagtc 1320

ccagttggga gagcattggc aattccgaat tttgagaatt tgagaagaaa ttggctcgaa 1380

ctattt 1386

<210> 18

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cyttgtgcgc ctgtttt 17

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

attgtcacca taagcagcc 19

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

caagyacttc tgtmwcccc 19

<210> 21

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cccaaagtag tcggttcc 18

<210> 22

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ggtatcaaac caattacgtg gtcc 24

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

aacaagcagg tctcgagaac 20