阅读说明：本技术 一种提高氨基酸产生菌生产能力的方法 (Method for improving production capacity of amino acid producing bacteria ) 是由 钱峰慧 董枫 张姣 蒋宇 杨晟 于 2020-05-26 设计创作，主要内容包括：本发明公开了一种提高氨基酸产生菌生产能力的方法,其包括使染色体上编码α-酮戊二酸脱氢酶复合物的Elo亚基的odhA基因的调控区发生突变和/或缺失。本发明的方法能够将L-脯氨酸生产菌的L-脯氨酸生产能力提高至少3倍,构建的工程菌CCTCC NO:M 2020060在发酵生产L-脯氨酸的产量高达119.90g/L,具有工业应用前景。(The invention discloses a method for improving the productivity of amino acid producing bacteria, which comprises mutating and/or deleting the regulatory region of odhA gene of Elo subunit for coding alpha-ketoglutarate dehydrogenase complex on chromosome. The method can improve the L-proline production capacity of the L-proline producing strain by at least 3 times, and the constructed engineering strain CCTCC NO of M2020060 has the industrial application prospect in the production of L-proline through fermentation, wherein the yield of L-proline is up to 119.90 g/L.)

1.A method for improving the production capacity of amino acid producing bacteria, which is characterized by comprising the following steps: the amino acid-producing bacterium has a mutation and/or deletion of the regulatory region of the odhA gene encoding the Elo subunit of the alpha-ketoglutarate dehydrogenase complex on the chromosome.

2. The method of claim 1, wherein the amino acid is selected from the group consisting of L-glutamic acid, L-proline, L-hydroxyproline, L-arginine, L-citrulline, L-ornithine and other L-glutamic acid derivatives.

3. The method of claim 1, wherein the base sequence AGGCG of the ribosome-binding RBS region 11 to 15 bases before the start codon of the reading frame of the odhA gene is replaced with another base sequence.

4. The method of claim 3, wherein the additional base sequence is selected from the group consisting of: AGAGG, TGAGG, GGAGG, CGAGG, GAAGG.

5. The method of claim 1, wherein the mutation and/or deletion of the regulatory region of the odhA gene is a mutation and/or deletion of a sequence preceding the start codon of the reading frame of the odhA gene, said sequence comprising the start codon GTG being selected from the group consisting of:

AATAAACCCTCAAGAAGCAAGGGAGAGTACCTGCCGTG(SEQ ID NO:1)；

AATAAACCCTCAAGAAGCAAGGTAGGAGTACCTGCCGTG(SEQ ID NO:2)；

AATAAACCCTCAAGAAGCAAGAGGAGTACCTGCCGTG(SEQ ID NO:3)；

AATAAACCCTCAAGAAGCAGAGGAGTACCTGCCGTG(SEQ ID NO:4)；

AATAAACCCTCAAGAAGCAAGAGAGGAGTACCTGCCGTG(SEQ ID NO:5)；

AATAAACCAGAAGCAAGGAAAAGAGGCGAGTACCTGCCGTG(SEQ ID NO:6)。

6. the method of claim 5, wherein the regulatory region of the odhA gene is changed to SEQ ID NO 2; and the putA gene is inactivated on the chromosome of the amino acid producing bacterium; mutations in the gnd (S361F) and zwf (a243T) genes; gdh gene enhancement; inactivation of the avtA gene; mutation of proB (G149K) gene; the proB (G149K) gene was expressed as an episomal plasmid pXMJ19 and placed behind the constitutive promoter Peftu.

7. The method of claim 6, wherein the inactivation of the putA gene is mutation of arginine at position 60 of the coding region to a stop codon; the gdh gene reinforcement is to replace a natural promoter with a strong promoter Peftu; the avtA gene is inactivated by mutating leucine at the 63 th site of a coding region into a stop codon.

8. A genetically engineered bacterium which produces L-proline, characterized by being constructed according to the method of any one of claims 1 to 7.

9. The genetically engineered bacterium of claim 8, which is deposited in China center for type culture Collection with the preservation number of CCTCC NO: M2020060.

10. Use of the genetically engineered bacterium of claim 8 or 9 for the production of L-proline.

Technical Field

The invention belongs to the field of genetic engineering, relates to a method for improving the production capacity of an amino acid producing strain, and particularly relates to a method for improving the production capacity of an L-proline producing strain, an L-proline genetic engineering producing strain and application thereof.

Background

L-proline is a neutral amino acid containing imino groups, is one of 20 basic amino acids constituting proteins, and belongs to a non-essential amino acid of a human body. L-proline has a certain physiological activity and is widely used in the pharmaceutical, agricultural and food industries, in particular for its role in medical research and therapy, and is gaining increasing importance (Thi Mai Hoa, B., et al, Applied Microbiology and Biotechnology,2013.97(1): p.247-257.List, B., Tetrahedron,2002.58(28): p.5573-5590).

The current production methods of L-proline are mainly three: 1. chemical synthesis, long process route, difficult to deliver (muir, zhangzhong, li bao faithful, production and application of L-proline, fermentation science and technology communication, 2004(2): p.35-36.); 2. extracting from natural protein hydrolysate, but is not suitable for large-scale production in modern chemical industry (Cao He Yu, Zhang Zhen, separating L-proline from chicken feather, amino acid and biological resource, 1986(1): p.1-7.); 3. the direct fermentation method has low raw material cost and mild reaction conditions, and is easy for large-scale production (5374542 Process for producing 4-hydroxy-L-proline: Katsumata Ryoich; Yokoi Haruhiko Machida, Japan Assigned to Kyowa Hakko Kogyo Co Ltd. Biotechnology Advances,1995.13(4): p.719-720. Square fortune, Maoyingu, Chengchen, L-proline fermentation research. Microbiol., 1982(4): p.63-70.), and becomes the main path for producing L-proline.

There are two types of conventional L-proline producing strains: one is wild strain for producing glutamic acid, and fermentation is carried out in a direction favorable for L-proline by changing culture conditions; the development of another class of L-proline producing strains relies mainly on the selection of auxotrophic or feedback inhibition resistant mutants (Nakamori, S., et al, Agricultural and Biological Chemistry,1982.46(2): p.487-491.Araki, K., Y.Takasawa, and J.Nakajima, Agricultural and Biological Chemistry,1975.39(6): p.1193-1200.Nakanishi, T., et al, Journal of Fermentation Technology,1987.65(2): p.139-144.Ryu, W.S., et al, Journal of Microbiology and Biotechnology,1999.9(5): p.613-618), which introduce negative mutations, and the use of genetic engineering techniques to obtain L-proline producing strains avoids this problem.

In Corynebacterium glutamicum L-proline is formed from glutamate by gamma-glutamate kinase (coding gene proB), glutamate-5-semialdehyde dehydrogenase (coding gene proA) and pyrroline-5-carboxylate reductase (coding gene proC) via three-step enzymatic catalysis and one-step spontaneous cyclization (Ahn, J., et al, Biotechnology and Bioprocess Engineering,2004.9(4): p.326-329.Jensen, J.V.K.and V.F.Wendisch, Microbial Cell factors, 2013.12.Zhang, Y., et al, Biotechnology Biofuels,2017.10: p.169.), where the enzymatic activity of ProB is inhibited by feedback from L-proline (slit, R.D.and C.C.Gahan, Applied & Environmental Microbiology,2001.67(10): 4560-4565.). It is reported in a few organisms such as Pseudomonas putida that Ornithine Cyclodeaminase (OCD), which catalyzes the production of L-proline by OCD, is contained, and that heterologous expression of the ornithine cyclodeaminase gene OCD in Corynebacterium glutamicum enables the overproduction of L-proline (Jensen, J.V.K.and V.F.Wendisch, Microbial Cell industries, 2013.12.). Zhang, Y. et al, started with Corynebacterium glutamicum ATCC13032, removed feedback inhibition of L-proline from proB gene introduced into genome by G446A point mutation through rational design, knocked out (inactivated) proline dehydrogenase (encoding gene putA) blocked the conversion of L-proline to glutamic acid, replaced the promoter of cis-uricase (encoding gene acn) and replaced the start codon from TTG to ATG to increase alpha-ketoglutarate pathway flux, and over-expressed proBG446A with Ptac promoter in plasmid form constructed an L-proline producing strain Pro-6, fed-batch fermented for 60h to produce L-proline 66.43G/L (Zhang, Y., et al., Biotechnol Biofuss, 2017.10: p.169.). Jiang Y. et al used CRISPR-mediated ssDNA recombination tool to carry out saturation mutation on G149 site of Corynebacterium glutamicum ATCC13032ProB, screened a series of L-proline feedback inhibition resistant strains Corynebacterium glutamicum ATCC13032ProBG149K, and proved that the effect is best when the mutation of the ProB G149 site to lysine K, and the yield of L-proline in fermentation of 96-well plates reaches 6.6 +/-1.0G/L (Jiang, Y., et al, CRISPR-Cpf1 assisted gene editing of Corynebacterium glutamicum Nature Communications, 2017.8.).

The L-proline producing strain with higher yield obtained by a genetic engineering means has important significance for improving the benefit of L-proline production.

Disclosure of Invention

In order to construct an L-proline production strain with higher yield, the invention utilizes a genetic engineering technology to modify corynebacterium glutamicum, and obtains a strain ZQJY-9 with high L-proline yield by enhancing genes related to L-proline production, weakening branch metabolic pathways and improving the level of a cofactor NADPH, thereby improving the L-proline production capacity, reducing the production cost and having wide industrial application prospect. Based on the same principle, the method can also be applied to other amino acid producing bacteria so as to improve the production capacity of other amino acids. Specifically, the invention comprises the following technical scheme:

a method for improving the productivity of an amino acid-producing bacterium, comprising the steps of: the amino acid-producing bacterium has a mutation and/or deletion of the regulatory region of the odhA gene encoding the Elo subunit of the alpha-ketoglutarate dehydrogenase complex on the chromosome.

The amino acid is selected from L-glutamic acid, L-proline, L-hydroxyproline, L-arginine, L-citrulline, L-ornithine and other L-glutamic acid derivatives.

The amino acid-producing bacterium is selected from the group consisting of coryneform bacteria such as Escherichia coli, Corynebacterium glutamicum, Corynebacterium acetoacidophilum, Corynebacterium crenatum, Corynebacterium pekinense, Corynebacterium parvum, Corynebacterium ammoniagenes, and the like, preferably Corynebacterium glutamicum, and more preferably Corynebacterium glutamicum ATCC13032 or a strain derived therefrom.

Preferably, in the above method, the base sequence AGGCG of the ribosome-binding RBS region from 11 th to 15 th bases before the start codon of the reading frame of the odhA gene is replaced with another base sequence.

The other base sequences are selected from the group consisting of: AGAGG, TGAGG, GGAGG, CGAGG, GAAGG.

In one embodiment, the deletion of the regulatory region of the odhA gene refers to deletion of a sequence preceding the start codon of the reading frame of the odhA gene, said sequence comprising the start codon GTG at the 3' -end being selected from the group consisting of:

AATAAACCCTCAAGAAGCAAGGGAGAGTACCTGCCGTG(SEQ ID NO:1)；

AATAAACCCTCAAGAAGCAAGGTAGGAGTACCTGCCGTG(SEQ ID NO:2)；

AATAAACCCTCAAGAAGCAAGAGGAGTACCTGCCGTG(SEQ ID NO:3)；

AATAAACCCTCAAGAAGCAGAGGAGTACCTGCCGTG(SEQ ID NO:4)；

AATAAACCCTCAAGAAGCAAGAGAGGAGTACCTGCCGTG(SEQ ID NO:5)；

AATAAACCAGAAGCAAGGAAAAGAGGCGAGTACCTGCCGTG(SEQ ID NO:6)。

these sequences SEQ ID NOs:1-6 all contain the start codon GTG at the 3' -end.

Preferably, the above method comprises the steps of: the sequence before the start codon of the reading frame of the odhA gene is changed to SEQ ID NO 2; and inactivating the putA gene on the chromosome of the amino acid-producing bacterium (e.g., deleting the gene in whole or in part, or mutating a stop codon in reading frame); mutations in the gnd (S361F) and zwf (a243T) genes; gdh gene enhancement (e.g., replacement of promoter or increase in copy number); the avtA gene is inactivated (e.g., the gene is deleted in whole or in part, or the stop codon is mutated in-frame); mutation of proB (G149K) gene; the proB (G149K) gene is expressed as a free plasmid pXMJ19 and placed after the constitutive promoter Peftu, for example as a recombinant plasmid pXMJ19-Peftu:: ProBG149K, the nucleotide sequence of which is SEQ ID NO. 7.

In one embodiment, the inactivation of the putA gene is mutation of arginine at position 60 of the coding region to a stop codon; the gdh gene reinforcement is to replace a natural promoter with a strong promoter Peftu; the avtA gene is inactivated by mutating leucine at the 63 th site of a coding region into a stop codon.

The method can be particularly used for the transformation of L-proline producing bacteria and the construction of genetically engineered bacteria.

Specifically, the invention provides a method for improving the production capacity of L-proline producing bacteria, which comprises the following steps:

A. using L-proline producing bacteria as an initial strain, carrying out gene mutation of putA (R60 stop codon (namely arginine at the 60 th site of a coding region is mutated into a stop codon)), gnd (S361F) and zwf (A243T), and replacing a promoter of gdh with Peftu to overexpress the gdh gene to obtain a gdh gene enhanced strain;

B. inactivating the gene avtA (L63 stop codon) (namely, the 63 th leucine of the coding region is mutated into a stop codon)) in the gdh gene enhanced strain obtained in the step A to obtain an avtA gene inactivated strain;

C. regulating the expression of the gene odhA in the avtA gene inactivated strain obtained in the step B to obtain an odhA expression regulating strain;

D. constructing a recombinant plasmid pXMJ19-Peftu containing a gene mutant proB (G149K) in an overexpression starting strain, wherein the nucleotide sequence of the recombinant plasmid is SEQ ID NO. 7, and ProBG 149K;

E. and D, transforming the recombinant plasmid in the step D into the odhA expression regulation strain obtained in the step C to obtain the genetically engineered bacterium.

The mutations of the putA, gnd and zwf genes in the step A may be one of the mutations, two of the mutations, or three of the mutations simultaneously.

The step A has the functions of enhancing the level of a cofactor NADPH in an L-proline metabolic pathway of L-proline producing bacteria such as Corynebacterium glutamicum, blocking the degradation of L-proline, increasing the flux of glutamic acid synthesis and obtaining a gene-enhanced strain.

The function of step B is to reduce the synthesis of alanine, which is a branched pathway in the metabolic pathway of L-proline.

The role of step C above is to fine tune the TCA cycle in the metabolic pathway.

The function of step D was to express the mutant proB (G149K) as a plasmid in the attenuated strain described in step C.

In one embodiment, the L-proline-producing bacterium described in step A is Corynebacterium glutamicum ATCC13032 or a strain derived therefrom.

For example, the derived strain of Corynebacterium glutamicum ATCC13032 may be Corynebacterium glutamicum ATCC13032ProBG149K reported in the literature Jiang, Y., et al, CRISPR-Cpf1 associated genome editing of Corynebacterium glutamicum Nature Communications,2017.8.

When Corynebacterium glutamicum ATCC13032ProBG149K was used as the starting strain, the genotype of the gdh gene-enhanced strain obtained in step A may be ATCC13032ProBG149K (Δ putA, P)_eftu::gdh,GndS361F,ZwfA243T)；

The genotype of the avtA gene-inactivated strain obtained in step B was ATCC13032ProBG149K (Δ putA, P)_eftu::gdh,GndS361F,ZwfA243T,ΔavtA)；

The genotype of the odhA expression-controlling strain obtained in step C was ATCC13032ProBG149K (Δ putA, P)_eftuGdh, GndS361F, ZwfA243T, Δ avtA, odhA (regulatory region mutation));

the genotype of the genetically engineered bacterium obtained in step E is ATCC13032ProBG149K (Δ putA, P)_eftuGdh, GndS361F, ZwfA243T,. DELTA.avtA, odhA (regulatory region mutation))/pXMJ 19-Peftu ProBG 149K.

In one embodiment, step C is effected by mutating and/or deleting the regulatory region of its odhA gene. For example, the regulatory region sequence (including the start codon GTG at the 3' -end) of the odhA gene may be:

AATAAACCCTCAAGAAGCAAGGTAGGAGTACCTGCCGTG(SEQ ID NO:2)。

according to a second aspect of the present invention, there is provided a genetically engineered bacterium constructed according to the above-described method. For example, the genotype is ATCC13032ProBG149K (Δ putA, P)_eftuCorynebacterium glutamicum from gdh, GndS361F, ZwfA243T,. DELTA.avtA, odhA (regulatory region mutation))/pXMJ 19-Peftu, ProBG149K, herein referred to as ZQJY9, the strain is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020060.

According to a third aspect of the invention, the application of the genetically engineered bacterium in the production of L-proline is provided.

L-proline is preferably produced by fermentation of the above genetically engineered bacterium.

When the above genetically engineered bacterium is Corynebacterium glutamicum ATCC13032 or a strain derived therefrom, the fermentation medium consists of: (NH)₄)₂SO₄ 20g/L，KH₂PO₄ 0.5g/L，K₂HPO₄ 0.5g/L，MgSO₄ 250mg/L，FeSO₄·7H₂O 10mg/L，MnSO₄·H₂O 10mg/L，ZnSO₄·7H₂O 1mg/L，CuSO₄ 0.2mg/L，NiCl₂·6H₂O0.02 mg/L, biotin 0.2mg/L, and glucose 40 g/L.

The seed liquid culture medium comprises the following components: (NH)₄)₂SO₄5g/L of urea 5g/L, 21g/L of 3-morpholine propanesulfonic acid (MOPS), K₂HPO₄ 1g/L，KH₂PO₄ 1g/L，MgSO₄ 250mg/L，CaCl₂10mg/L, 1ml/L of trace element solution, 0.2mg/L of biotin, 0.3mg/L of protocatechuic acid, 2g/L of corn steep liquor and 60g/L of glucose, and the pH value is 7.0, wherein the trace element solution comprises the following components: FeSO₄·7H₂O 16.4g/L，MnSO₄·H₂O 100mg/L，CuSO₄ 200mg/L，ZnSO₄·7H₂O 1g/L，NiCl₂·6H₂O20 mg/L, adjusted to pH 1.0 with HCl to dissolve the above components.

Preferably, the fermentation may further comprise a feed medium of the following composition: glucose was 800 g/L.

In one embodiment, when the above Corynebacterium glutamicum ATCC13032 or a strain derived therefrom is subjected to shake flask culture, the shake flask fermentation medium (named QFYS) has the following composition: glucose. H₂O100 g/l, corn steep liquor 20g/l, (NH)₄)₂SO₄30g/l，MgSO₄·7H₂O 0.4g/l，KH₂PO₄ 1.2g/l urea 2g/l CaCO₃ 30g/l，pH 7.2。

The seed liquid culture medium in the shake flask is as follows: BHISG, BHI 37g/L, D-sorbitol 91g/L, (NH)₄)₂SO₄10g/l, glucose 20 g/l.

The method of the present invention can improve the L-proline-producing ability of the L-proline-producing bacterium by at least 3 times. After the constructed engineering bacteria CCTCC NO of M2020060 are fermented, the yield of L-proline is up to 119.90g/L, and the engineering bacteria CCTCC NO has an industrial application prospect.

The Latin scientific name of the L-proline high-yield genetic engineering bacteria constructed by the invention is Corynebacterium glutamicum, the Chinese name is Corynebacterium glutamicum, the L-proline high-yield genetic engineering bacteria are preserved in China center for type culture Collection, the preservation date is 3 months and 29 days in 2020, the preservation address is Wuhan university preservation center in Wuhan university school of eight-channel 299 in Wuhan district of Wuhan city, Hubei province, and the preservation number is CCTCC NO: M2020060.

Drawings

FIG. 1 is a schematic representation of plasmid pXMJ19-Peftu: ProBG 149K.

Detailed Description

The terms "L-proline genetically engineered producer", "L-proline producer", "genetically engineered bacterium", "L-proline genetically engineered producer" in the present context mean the same meaning, in particular, the L-proline producer ZQJY-9, i.e., the deposited strain CCTCC NO: M2020060.

The starting or original strain, the wild-type (WT) strain of the L-proline-producing bacterium of the present invention is Corynebacterium glutamicum ATCC13032, and the terms "Corynebacterium glutamicum", "Corynebacterium glutamicum ATCC 13032" and "ATCC 13032" mean the same.

The names of the genes involved in the present invention are explained as follows:

proA: glutamate-5-semialdehyde dehydrogenase

And (2) proB: gamma-glutamate kinase

And (2) proC: pyrroline-5-carboxylic acid reductase

ocd: ornithine cyclodeaminase

putA: proline dehydrogenase

acn: aconitase for head

gnd: 6-phosphogluconate dehydrogenase

zwf: glucose-6-phosphate-dehydrogenase

gdh: glutamate dehydrogenase

avtA: valine-pyruvate aminotransferase

odhA: alpha-ketoglutarate dehydrogenase

In this context, for the sake of simplicity of description, a protein such as 6-phosphogluconate dehydrogenase Gnd will sometimes be mixed with the name of the gene (DNA) Gnd encoding it, which is understood by the skilled person to represent different substances in the different description. Their meaning will be readily understood by those skilled in the art based on the context and context. For example, for Gnd, when used to describe the function or class of 6-phosphogluconate dehydrogenase, it refers to a protein; when described as a gene, refers to the gene encoding the Gnd. Obviously, the genetic mutation gnd (S361F) refers to a genetic mutation encoding mutant GndS 361F.

It is well known that the name of a gene is followed by an asterisk "to denote variants of the gene, such as: proB (G149K) refers to a mutant of proB of the gene for gamma-glutamate kinase with glycine (G) at position 149 mutated to lysine (K); gnd (S361F) refers to a mutant of the gene gnd of 6-phosphogluconate dehydrogenase in which serine (S) at position 361 is mutated into phenylalanine (F); zwf (a243T) refers to a mutant of the gene zwf of glucose-6-phosphate-dehydrogenase in which alanine (a) at position 243 is mutated to threonine (T); putA (R60 stop codon) refers to a putA mutant in which arginine (R) at position 60 is mutated to a stop codon to inactivate proline dehydrogenase; avtA (L63 stop codon) refers to an avtA mutant in which leucine (L) at position 63 is mutated to a stop codon to inactivate proline dehydrogenase.

In the construction scheme for designing the genetic engineering bacteria, a series of mutants are constructed on Corynebacterium glutamicum ATCC13032ProBG149K according to the metabolic pathway of L-proline of Corynebacterium glutamicum, such as: mutation or inactivation of the genes putA, gnd, zwf, avtA; enhancement of gdh; modulation of odhA. The inactivation of putA blocks the degradation of L-proline, the mutation of gnd and zwf increases the level of a cofactor NADPH, the inactivation of avtA reduces the synthesis of a byproduct alanine, the enhancement of gdh increases the supply of a precursor glutamic acid for L-proline biosynthesis, the regulation and control of odhA finely adjusts TCA cycle and increases the biosynthesis flux of L-proline, proB (G149K) is overexpressed in the mutant in a plasmid form to further enhance the biosynthesis flux of L-proline, so that the synthesis of L-proline is facilitated, and the engineering strain ZQJY-9 with high L-proline yield is constructed, and the preservation number is CCTCC NO: M2020060.

In the present invention, one strategy for improving the productivity of L-proline-producing bacteria is to control the expression of the odhA gene in step C by modifying the sequence of the regulatory region. If the RBS region is mutated, RBS is short for ribosome binding site (ribosome binding site) and refers to a purine G, A-rich untranslated region upstream of the initiation codon AUG. In RBS there is an SD (Shine-Dalg-arno) sequence, typically 5 nucleotides in length, which is complementary paired to the 3' end of ribosomal 16SrRNA, facilitating ribosome binding to mRNA and translation initiation.

The method for constructing the mutant strain of Corynebacterium glutamicum ATCC13032 was described in the literature reported by Jiang Y.et al (Jiang, Y., et al, Nature Communications, 2017.8). For example, the inventor starts from an original strain corynebacterium glutamicum ATCC13032, constructs a plurality of genotypes through gene modification of a plurality of steps, continuously improves the yield of L-proline, and finally obtains engineering bacteria with industrial application prospects, and the correct design idea of the invention is verified by gradually improving the yield of L-proline of strains with different genotypes according to table 1.

TABLE 1 genetically engineered bacteria constructed according to the present invention

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing herein were performed by Biotechnology engineering (Shanghai) Inc.

The molecular biological experiments herein include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., which are mainly performed with reference to molecular cloning, a guide to experiments (third edition), J. SammBruk, D.W. Lassel (America), Huangpetang, et al, scientific Press, Beijing, 2002). For example, the methods for competent cell transformation and competent cell preparation are described in Chapter 1, 96 of molecular cloning, A laboratory Manual (third edition). The specific experimental conditions can be determined by simple experiments if necessary.

Main medium and buffer:

LB culture medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride. (20 g/L agar powder was additionally added to the solid medium.)

BHIS medium: 37g/L BHI, 91g/L sorbitol. (20 g/L agar powder was additionally added to the solid medium.)

BHIS-suc Medium: 37g/L BHI, 91g/L sorbitol, 200g/L sucrose, 10g/L glucose.

20 × electrotransfer mother liquor: 80g/L glycine, 2% Tween 80.

In the following examples, the final concentration of kanamycin in the medium was 50. mu.g/ml, the final concentration of spectinomycin in the medium was 100. mu.g/ml, and the final concentration of chloramphenicol in the medium was 10. mu.g/ml.

The primer sequence information used in the following examples is shown in Table 2.

TABLE 2 primer sequences

In the table, "-F" in the name represents forward; "-R" represents reverse.

TABLE 3 repair templates for regulation of gene odhA expression

Note: the PAM sequence is underlined and the alternative bases are in upper case.

Example 1: construction of Gene putA, gnd mutant and Gene gdh enhanced Strain ZQJY-3

1. Construction of pk18mobsacB-spec-Peftu-gdh plasmid

(1) Amplification of an approximately 4.3kb fragment 1 using primers pk18-kan-zzz-F and pk18-EcoRI-R, using pk18mobsacB as template, amplification of an approximately 2.1kb fragment 1 using primers pk18-crtYf-L and pk18-crtYf-R, amplification of an approximately 2.1kb fragment 2 using plasmid pJYS 3. DELTA. crtYf reported in the literature (Jiang, Y., et al., Nature Communications,2017.8), amplification of an approximately 500bp fragment 3 using primers pk18-HindIII-F and pk18-kan-qdz-R, using pk18mobsacB as template, amplification of an approximately 500bp fragment 3 using primers pk 18-spc-F and pk 18-spc-R, amplification of an approximately 2kb fragment 2, fusion of a JYS2, JBstyyyyyyyyyz-2, and ligation of an approximately 2kb fragment 2 using primers pK 634-Kyoto obtain a cell-transfected cells (Gi 2. coli) from the literature (Jiang, Y., Atlantian, Nature Communications,2017.8) and ligation of the competent cell culture medium (Gi) to obtain a cell-2. coli strain 2. coli), LB-spec plates were plated to give plasmid pk18 mobsacB-spec-. DELTA.crtYf.

(2) The backbone vector fragment 5 was amplified from pk18 mobsacB-spec-. DELTA.crtYf with primer pk18-HindIII-F/pk18-EcoRI-R, the upstream and downstream homology arms and the Peftu promoter were amplified from ATCC13032 genome with primers gdh-L-F/gdh-L-R, etfu-F/etfu-R, gdh-R/gdh-R-R, respectively, fragment 5 was ligated with the amplified upstream and downstream homology arms and the Peftu promoter fragment Gibson, and DH 5. alpha. competent cells were transformed to obtain plasmid pk18 mobsacB-spec-Peftu-gdh.

2. Preparation of competent cells of Corynebacterium glutamicum ATCC13032ProBG149K

Corynebacterium glutamicum ATCC13032ProBG149K was streaked onto BHIS plates and cultured overnight in a 30 ℃ incubator, and a single colony was picked into BHIS tube medium and cultured overnight at 220rpm and 30 ℃. Inoculating 1ml of the bacterial liquid into a 100ml of BHIS liquid culture medium shake flask, and culturing at 30 ℃ and 220rpm for 4-6h on a constant temperature shaking bed until the OD 600 value reaches about 1.0. The whole amount of the suspension was transferred to a 50ml centrifuge tube on a clean bench, centrifuged at 4500 Xg at 4 ℃ and the supernatant was discarded, the cells were washed with 10% glycerol and resuspended, centrifuged at 4500 Xg at 4 ℃ and the supernatant was discarded after 1-time washing. Finally, 600. mu.l of 10% glycerol was added to suspend the cells, and the suspension was dispensed into 1.5ml centrifuge tubes, and each 90. mu.l of the suspension was prepared into a competent cell, which was stored in a freezer at-80 ℃.

3. Electroporation of pk18mobsacB-spec-Peftu-gdh into ATCC13032ProBG149K competent cells

Taking 1 mu g of the plasmid pk18mobsacB-spec-Peftu-gdh to corynebacterium glutamicum ATCC13032ProBG149K competent cells, uniformly mixing, transferring the mixture into an electric rotor cup, carrying out electric shock under the conditions of 25uF, 2.5kV and 200 omega, wherein the electric shock time is 5.0ms, immediately transferring the mixture into 900 mu l of BHIS liquid culture medium preheated at 46 ℃, carrying out water bath in a water bath kettle at 46 ℃ for 6min, then placing the mixture in a constant temperature shaking table, carrying out water bath at 30 ℃ and carrying out culture at 220rpm for 1h, and recovering the thalli. After recovery, 50. mu.l of the cells were spread on a BHIS plate containing spectinomycin, and the plate was inverted and cultured in a 30 ℃ incubator for 48 hours.

4. Preparation of ATCC13032ProBG149K (pk18mobsacB-spec-Peftu-gdh) competent cells

The preparation method is the same as the step 2.

5. Construction of pkts-ptac-BE3-putA-gnd-gdh plasmid

(1) Using primers pKts-F (HpaI) and pKts-R (kpnI) -1 as templates for pJYS1Peftu reported in the literature (Jiang, Y., et al., Nature Communications,2017.8), a fragment 6 of about 5.7kb was amplified, using primers rrnB-F (swaI) -1 and rrnB-R as templates for pXMJ19, a fragment 7 of 480bp was amplified, using primers UGI-F (BE3) and APOBEC1-R (BE3) -1, using pCMW-BE3 as templates for about 5.2kb fragment 8, using primers ptac-F-1 and lacIq-R as templates for about 1.4kb fragment 9, Gibson ligation of fragments 6, 7, 8, and 9, transforming a plasmid with a plasmid DH 5. alpha. -competent cell to obtain BE 3-BE-3.

(2) The plasmid pKts-ptac-BE3-putA-gnd-gdh is obtained by digesting pKts-ptac-BE3 with kpnI/swaI to recover a skeleton fragment 10 of about 12kb, synthesizing a gRNA array (array) of targeting genes putA, gnd and gdh of about 400bp, and after digestion, connecting the gRNA array and the fragment 10 by using T4 ligase and transforming.

6. Plasmid pkts-ptac-BE3-putA-gnd-gdh was transformed into ATCC13032ProBG149K (pk18mobsacB-spec-Peftu-gdh) competent cells and verified

The transformation method is the same as that in step 3. After recovery, all the cells were spread on a BHIS-suc plate containing kanamycin, and the plate was inverted and cultured in a 30 ℃ incubator for 48 hours. Single colonies on the plate were picked, PCR was performed using primers F-sputA/R-sputA, F-sgnd/R-sgnd, and F-sgdh/R-sgdh, respectively, and the PCR fragments were sequenced to verify correctness, with a fragment size of about 2 kb.

7. Plasmid loss

Selecting a single colony which is verified to be positive by PCR, inoculating the single colony in a BHIS test tube without antibiotics, and culturing overnight at 37 ℃; inoculating the subnatal bacteria solution on a BHIS plate by streaking, and culturing overnight at 37 ℃; the next day, the transformants on the BHIS plate were picked, spotted on the plate BHIS plate and the BHIS plate containing kanamycin, and inverted and cultured in a 30 ℃ incubator for 24 hours. Plasmid loss was indicated if it could grow on BHIS plates but not on kanamycin-containing BHIS plates, resulting in a genotype of ATCC13032ProBG 149K. delta. putA P_eftuStrain ZQJY-3 of gdh GndS 361F.

Example 2: construction of ZQJY-4 strain with inactivated gene zwf

1. Construction of the inactivated plasmid pK18mobsacB-ZwfA243T

Using primers pK18-F and pK18-R, vector fragment 11 of about 5.6kb was amplified using pK18mobsacB as a template, fragments 12 and 13 of about 1kb were amplified using primers zwf-aL-F/zwf-aL-R and zwf-aR-F/zwf-aR, respectively, ATCC13032 genome as a template, fragments 11, 12, 13 were Gibson ligated, DH5 α competent cells were transformed, and plasmid pK18mobsacB-zwfA243T was obtained.

2. Preparing ZQJY-3 competent cells.

The preparation method is the same as that of step 2 of example 1.

3. Transformation of plasmid pK18mobsacB-ZwfA243T into ZQJY-3 competent cells

The transformation procedure was the same as in step 3 of example 1. After recovery, all the cells were spread on a BHIS plate containing kanamycin, and the plate was inverted and cultured in an incubator at 30 ℃ for 48 hours.

4. SacB sucrose reverse sieve

Transformants on the kanamycin-containing BHIS plates were picked, inoculated into non-resistant BHIS tube medium, and cultured in a constant temperature shaker at 30 ℃ and 220rpm for 24 hours to allow double crossover. The cells were diluted 1000 times and spread on BHIS-suc plates containing 20% sucrose, and the plates were inverted and cultured in a 30 ℃ incubator for 48 hours. BHIS-suc plate transformants were picked, spotted on a plate BHIS plate and a BHIS plate containing kanamycin, respectively, and inverted and cultured in a 30 ℃ incubator for 24 hours. PCR sequencing amplification was performed using primers F-szwf/R-szwf to verify transformants that grew on BHIS plates but failed to grow on kanamycin-containing BHIS plates, positive transformants were picked into 4mL of BHIS tube medium, cultured at 30 ℃ and 220rpm on a constant temperature shaker for 24 hours, and conserved with 20% glycerol. The genotype was obtained as ATCC13032ProBG 149K. delta. putA P_eftuThe ZQJY-4 strain of gdh GndS361F ZwfA 243T.

Example 3: construction of Gene avtA-inactivated Strain ZQJY-6

1. Construction of plasmid pJYS2_ avtA

After amplifying a fragment using primers avtAspc-F and avtAspc-R and taking pJYS2_ crtYf as a template, DH5 alpha competent cells were directly transformed, and a BHIS solid plate containing spectinomycin was coated to obtain plasmid pJYS2_ avtA.

2. Synthesis of the repair template avtA (TAA)59

The repair template avtA (TAA)59 sequence is:

CAGAGATCGCTCTTCGCTCGGGTCCTTAATAATACACCGAGGTGATTGGTGATCGTGAG

3. preparing ZQJY-4 competent cells.

The preparation method is the same as that of step 2 of example 1.

4. Transformation of plasmid pJYS2_ avtA and repair template avtA (TAA)59 into ZQJY-4 competent cells

And (3) uniformly mixing 1 mu g of the plasmid pJYS2_ avtA and 1-10 mu g of a repair template avtA (TAA)59, adding the mixture into the corynebacterium glutamicum ZQJY-4 competent cells, uniformly mixing, transferring the mixture into an electric rotor, and transforming the conditions in the same way as the step 3 in the example 1. After recovery, all the cells were spread on a plate containing spectacular BHIS, and the plate was inverted and cultured in a 30 ℃ incubator for 48 hours. Single colonies on the plates were picked and PCR was performed using the primers F-savtA/R-savtA, the fragment size was about 2kb, and the PCR fragments were sequenced and verified to be correct.

5. Plasmid loss

Plasmid loss method the same as example 1, step 7, gave a genotype of ATCC13032ProBG 149K. delta. putA P_eftuGdh GndS361F ZwfA243T delta avtA strain ZQJY-6.

Example 4: construction of Strain ZQJY-7 with Gene odhA expression regulation

1. Construction of plasmid pJYS2_ odhA

After amplifying a fragment using primers sgRNA-odhA-TTTC-F and sgRNA-odhA-TTTC-R with pJYS2_ crthy as a template, DH5 α competent cells were directly transformed, and BHIS solid plates containing spectinomycin were coated to obtain plasmid pJYS2_ odhA.

2. Repair template for synthesis of odhA

The RBS of the odhA gene was AGGCG (Pfeifer-Sancar, K., et al., BMC Genomics,2013.14(1): p.888.), and we designed the RBS library as NGG/ANG for a total of 31 primers (Table 3). GTG is the initiation codon of odhA, and the second A in the primers was co-mutated to T with GAAA from 18 th to 21 th upstream of the initiation codon as PAM sequence (Table 3).

A total of 31 primers were synthesized for the repair templates used for odhA in Table 3, and the prepared concentration of the synthesized primers was 2. mu.g/. mu.l.

3. Preparing ZQJY-6 competent cells.

The preparation method is the same as that of step 2 of example 1.

4. Transformation of plasmid pJYS2_ odhA and repair template into ZQJY-6 competent cells and fermentation validation

Taking the first 15 primers, respectively mixing 0.5 mu l of repair primer in each tube, adding the mixture and more than 1 mu g of plasmid pJYS2_ avtA into corynebacterium glutamicum ZQJY-6 competent cells, uniformly mixing, transferring the mixture into a transfer cup, and transforming the conditions are the same as the step 3 in the example 1. After recovery, all thalli are taken and coated on a plate containing spectacular BHIS, and the plate is inverted and cultured in a constant temperature incubator at 30 ℃ for 48 hours; the second batch of 16 primers was transformed as before. The PCR sequencing primer is F-sodhA/R-sodhA. The fermentation data for the increased production of L-proline and the corresponding regulatory region sequences of the odhA gene are shown in Table 4, the highest producing strain produced 12.80. + -. 0.18g/L, the RBS region of the odhA gene was deleted, and the other regulatory regions were mutated, the sequences are: AATAAACCCTCAAGAAGCAAGGTAGGAGTACCTGCCGTG (SEQ ID NO:2) (including the 3' -end start codon GTG).

TABLE 4 production of strains with increased L-proline production and regulatory region sequences of the corresponding odhA genes

5. Plasmid loss

Plasmid loss method the same as example 1, step 7, the highest producing strain lost plasmid to obtain the genotype ATCC13032ProBG 149K. delta. putA P_eftuStrains ZQJY-7 of gdh GndS361F ZwfA243T delta avtAodhA (regulatory region mutation).

Example 5: construction of a Strain ZQJY-9 overexpressing the Gene mutant proB (G149K)

1. Construction of recombinant plasmid pXMJ19-Peftu ProBG149K

The pXMJ19 was digested with HpaI/EcoRI to give an about 5.3kb large fragment 14; amplifying a fragment 15 of about 1kb by using a primer proB (Peftu) -F/proB (rrnB) -R and a ZQJY-1 genome as a template; about 300bp fragment 16 was amplified using the primer Peftu (HpaI) -F/Peftu (proB) -R using ZQJY-1 genome as a template, fragments 14, 15, 16 were Gibson ligated, DH5 α competent cells were transformed, and plasmid pXMJ19-Peftu:: ProBG149K was obtained.

2. Preparing ZQJY-7 competent cells.

The preparation method is the same as that of step 2 of example 1.

3. Transformation plasmid pXMJ19-Peftu ProBG149K to ZQJY-7 competent cells

The transformation procedure was the same as in step 3 of example 1. After recovery, 50. mu.l of the cells were spread on a BHIS plate containing kanamycin, and the plate was inverted and cultured in a 30 ℃ incubator for 48 hours. Single clones were picked up into 4mL of BHIS tube medium, cultured on a constant temperature shaker at 30 ℃ for 24 hours at 220rpm, and then sterilized with 20% glycerol. The genotype was obtained as ATCC13032ProBG 149K. delta. putA P_eftuThe gene is gdh GndS361F ZwfA243T delta avtAodhA/pXMJ 19-Peftu, the ZQJY-9 strain of ProBG149K has a preservation number of CCTCC NO: M2020060.

Example 6: shake flask fermentation production of L-proline by L-proline genetic engineering bacteria ZQJY-9

The method for producing L-proline by shake flask fermentation of L-proline genetic engineering bacteria comprises the following steps:

taking L-proline gene engineering bacteria ZQJY-9 glycerol bacteria, marking a BHIS flat plate, and inversely culturing the flat plate in a 30 ℃ constant temperature incubator for 48 hours. Pick 1cm²The bacterial colony is inoculated into a 250mL shake flask containing 15mL shake flask seed culture medium, cultured for about 20h at 30 ℃ and 220rpm, 1mL shake flask seed liquid is transferred into a 500mL conical flask containing 20mL shake flask fermentation medium QFYS, cultured at 30 ℃ and 220rpm, and ammonia water is used for adjusting pH in the fermentation process. And after the fermentation is finished, measuring the content of the L-proline in the supernatant of the fermentation liquor by using HPLC. The shake flask fermentation yield of the L-proline genetically engineered bacterium ZQJY-9 is 19.68 +/-0.22 g/L.

The HPLC detection method is as follows:

the detection method comprises the following steps: the L-proline content in the fermentation broth was determined by means of in-column derivatization high performance liquid chromatography (O-phthalaldehyde-9-fluoromethylenechloroformate, OPA-FMOC).

Chromatographic conditions are as follows: agilent 1200 liquid chromatography, Eclipse Plus C18 column, 3.5 μm, 4.6 × 100mm column, DAD G1321A detector, detection wavelength UV 338nm, 10nm (bandwidth), reference 390nm, 20nm (bandwidth), flow rate: 1ml/min, column temperature: at 40 ℃.

Preparing a derivative:

boric acid buffer: 6.183g of boric acid is accurately weighed by 0.4M boric acid buffer solution, dissolved in ultrapure water, adjusted to pH 10.2 by 10M NaOH solution, and fixed to a volume bottle of 250 ml;

derivatizing agent 1: 500mg of an o-phthalaldehyde (OPA) solid was weighed out accurately, 5ml of absolute ethanol was added, 500. mu.l of mercaptopropionic acid was added, and a volume of 50ml was made up with 0.4M boric acid buffer solution of pH 10.2. The solution is preferably ready for use;

derivatizing agent 2: FMOC/acetonitrile solution: 5g/L

Preparing a mobile phase:

mobile phase A: 10mM Na₂HPO₄+10mM Na₂B₄O₇Adjusting pH to 8.2 with hydrochloric acid, and filtering with 0.22 μm filter membrane;

mobile phase B: ACN MeOH H₂O45: 45:10, constant volume of 1L for standby, and the purity of the reagent is HPLC grade.

Gradient elution procedure as in table 5:

TABLE 5 HPLC gradient elution procedure

Time (min)	Mobile phase B (%)	Mobile phase A (%)	Flow rate (ml/min)
				0	2	98	1.0
2	2	98	1.0
				15.5	57	43	1.0
15.6	57	43	1.0
				23.5	100	0	1.0
25	2	98	1.0

Example 7: l-proline gene engineering bacteria ZQJY-9 fermentation tank for fermentation production of L-proline

The method for producing L-proline by fermentation in the L-proline genetic engineering bacteria fermentation tank comprises the following steps:

fed-batch fermentations were carried out on 3L BIOFLO 110 fermentors. Taking L-proline gene engineering bacteria ZQJY-9 glycerol bacteria, marking out BHIS flat plate, inverting the flat plateThe cells were incubated at 30 ℃ for 48 hours in a constant temperature incubator. Pick 2cm from the plate²The colonies of (2) were inoculated into 2L shake flasks containing 120mL of seed liquid medium, cultured at 30 ℃ at 230rpm for 26 hours, and then inoculated into 1.2L fermentation broth in an inoculum size of 10%. The fermentation temperature is controlled at 32 ℃, the pH value of strong ammonia water is controlled at 6.9, the DO value is controlled at 30%, and the initial rotation speed is 200 rpm. The feeding was performed by using 800g/L glucose feed medium so that the glucose concentration in the fermentor medium was controlled to be in the range of 5. + -.5 g/L. And after the fermentation is finished for 80h, measuring the content of the L-proline in the supernatant of the fermentation liquid by using HPLC. The L-proline yield of ZQJY-9 reaches 119.90g/L at 80h, the conversion rate is 0.20g/g (L-proline/glucose), the yield is 1.581g/L/h, the final L-alanine yield is only 5.45g/L, and the maximum L-proline yield of ZQJY-9 reaches 120.18g/L at 76 h.

As can be seen from the experiments, the L-proline production capacity of the gene mutant strain ZQJY-9 constructed by the invention is improved by at least 3 times compared with that of the strain ATCC13032ProBG149K (namely ZQJY-1), the effective accumulation of L-proline can be realized in the fermentation process, the L-proline yield reaches 119.90g/L after fermentation in a fermentation tank, and the gene mutant strain ZQJY-9 has an industrial application prospect.

Sequence listing

<110> China academy of sciences molecular plant science remarkable innovation center

<120> a method for improving productivity of amino acid-producing bacteria

<130> SHPI2010231

<150> 2020103438899

<151> 2020-04-27

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 38

<212> DNA

<213> Artificial sequence ()

<400> 1

aataaaccct caagaagcaa gggagagtac ctgccgtg 38

<210> 2

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 2

aataaaccct caagaagcaa ggtaggagta cctgccgtg 39

<210> 3

<211> 37

<212> DNA

<213> Artificial sequence ()

<400> 3

aataaaccct caagaagcaa gaggagtacc tgccgtg 37

<210> 4

<211> 36

<212> DNA

<213> Artificial sequence ()

<400> 4

aataaaccct caagaagcag aggagtacct gccgtg 36

<210> 5

<211> 39

<212> DNA

<213> Artificial sequence ()

<400> 5

aataaaccct caagaagcaa gagaggagta cctgccgtg 39

<210> 6

<211> 41

<212> DNA

<213> Artificial sequence ()

<400> 6

aataaaccag aagcaaggaa aagaggcgag tacctgccgt g 41

<210> 7

<211> 6711

<212> DNA

<213> Artificial sequence ()

<400> 7

gtgtcagtag gcgcgtaggg taagtggggt agcggcttgt tagatatctt gaaatcggct 60

ttcaacagca ttgatttcga tgtatttagc tggccgttac cctgcgaatg tccacagggt 120

agctggtagt ttgaaaatca acgccgttgc ccttaggatt cagtaactgg cacattttgt 180

aatgcgctag atctgtgtgc tcagtcttcc aggctgctta tcacagtgaa agcaaaacca 240

attcgtggct gcgaaagtcg tagccaccac gaagtccagg aggacataca atgcgtgagc 300

gcatctccaa cgctaagcga gtggtggtga aaattggttc gtcctcattg actaacgatg 360

aggacggaca caccgtcgat cccaaccgca tcaacactat tgtcaatgcc ttgcaagcac 420

gcatggaagc tggctcggac ctcatcgttg tgtcctctgg cgcagtggcc gcgggaatgg 480

ccccgcttgg attgagcacc cggcccacgg aattggcagt caagcaggct gcagcagcag 540

tggggcaagt tcacctcatg caccagtggg gacgttcttt tgcccggtat ggtcgcccca 600

tcggccaggt gcttcttacc gcagctgatg caggaaagcg tgatcgtgcg aggaatgcgc 660

agcgtaccat cgacaagctg cgcattttgg gcgcggttcc tatcgtcaat gaaaatgaca 720

ccgtggcaac caccggtgtg aattttggtg acaacgaccg acttgctgca attgtggcgc 780

acctggtgtc ggctgatgct ttggtgctgc tcagtgacgt ggatggactt tttgataaaa 840

accctactga tcccaccgcg aagtttattt ccgaggttcg tgacggcaat gatttgaaag 900

gtgtcattgc cggcgacggc ggaaaagtgg gcaccggtgg catggcatca aaggtgtctg 960

ctgcacgttt ggcttcccga agtggcgtgc ctgtgctgtt gacctctgcg gcaaacattg 1020

gcccagcact ggaagacgcc caggtgggca ctgtattcca ccccaaggac aaccgcctct 1080

ccgcgtggaa gttctgggct ttgtatgccg cagatactgc aggaaagatc cgactcgatg 1140

acggcgcggt ggaagcagtg acctccggtg gtaaatcttt gctggctgtg ggcattactg 1200

aaatcattgg tgatttccag cagggtgaga tcgtggagat cttgggacct gccggccaaa 1260

tcatcgggcg aggcgaggtg tcctacgatt ctgatacctt gcaatcaatg gttggtatgc 1320

aaacgcagga ccttccagat ggcatgcagc gcccggtagt gcatgcagat tatctgtcca 1380

actacgccag ccgcgcgtaa gaattcagct tggctgtttt ggcggatgag agaagatttt 1440

cagcctgata cagattaaat cagaacgcag aagcggtctg ataaaacaga atttgcctgg 1500

cggcagtagc gcggtggtcc cacctgaccc catgccgaac tcagaagtga aacgccgtag 1560

cgccgatggt agtgtggggt ctccccatgc gagagtaggg aactgccagg catcaaataa 1620

aacgaaaggc tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg 1680

ctctcctgag taggacaaat ccgccgggag cggatttgaa cgttgcgaag caacggcccg 1740

gagggtggcg ggcaggacgc ccgccataaa ctgccaggca tcaaattaag cagaaggcca 1800

tcctgacgga tggccttttt gcgtttctac aaactctttt gtttattttt ctaaatacat 1860

tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 1920

aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 1980

tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 2040

ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 2100

tttcgccccg aagaacgttt tccaatgatg agcacttttg cttcctcgct cactgactcg 2160

ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 2220

ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 2280

gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 2340

gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 2400

taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 2460

accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca atgctcacgc 2520

tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 2580

cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 2640

agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 2700

gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 2760

gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 2820

tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 2880

acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 2940

cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc 3000

acctagatcc ttttggggtg ggcgaagaac tccagcatga gatccccgcg ctggaggatc 3060

atccagccat tcggggtcgt tcactggttc ccctttctga tttctggcat agaagaaccc 3120

ccgtgaactg tgtggttccg ggggttgctg atttttgcga gacttctcgc gcaattccct 3180

agcttaggtg aaaacaccat gaaacactag ggaaacaccc atgaaacacc cattagggca 3240

gtagggcggc ttcttcgtct agggcttgca tttgggcggt gatctggtct ttagcgtgtg 3300

aaagtgtgtc gtaggtggcg tgctcaatgc actcgaacgt cacgtcattt accgggtcac 3360

ggtgggcaaa gagaactagt gggttagaca ttgttttcct cgttgtcggt ggtggtgagc 3420

ttttctagcc gctcggtaaa cgcggcgatc atgaactctt ggaggttttc accgttctgc 3480

atgcctgcgc gcttcatgtc ctcacgtagt gccaaaggaa cgcgtgcggt gaccacgacg 3540

ggcttagcct ttgcctgcgc ttctagtgct tcgatggtgg cttgtgcctg cgcttgctgc 3600

gcctgtagtg cctgttgagc ttcttgtagt tgctgttcta gctgtgcctt ggttgccatg 3660

ctttaagact ctagtagctt tcctgcgata tgtcatgcgc atgcgtagca aacattgtcc 3720

tgcaactcat tcattatgtg cagtgctcct gttactagtc gtacatactc atatttacct 3780

agtctgcatg cagtgcatgc acatgcagtc atgtcgtgct aatgtgtaaa acatgtacat 3840

gcagattgct gggggtgcag ggggcggagc caccctgtcc atgcggggtg tggggcttgc 3900

cccgccggta cagacagtga gcaccggggc acctagtcgc ggataccccc cctaggtatc 3960

ggacacgtaa ccctcccatg tcgatgcaaa tctttaacat tgagtacggg taagctggca 4020

cgcatagcca agctaggcgg ccaccaaaca ccactaaaaa ttaatagtcc ctagacaaga 4080

caaacccccg tgcgagctac caactcatat gcacgggggc cacataaccc gaaggggttt 4140

caattgacaa ccatagcact agctaagaca acgggcacaa cacccgcaca aactcgcact 4200

gcgcaacccc gcacaacatc gggtctaggt aacactgagt aacactgaaa tagaagtgaa 4260

cacctctaag gaaccgcagg tcaatgaggg ttctaaggtc actcgcgcta gggcgtggcg 4320

taggcaaaac gtcatgtaca agatcaccaa tagtaaggct ctggcggggt gccataggtg 4380

gcgcagggac gaagctgttg cggtgtcctg gtcgtctaac ggtgcttcgc agtttgaggg 4440

tctgcaaaac tctcactctc gctgggggtc acctctggct gaattggaag tcatgggcga 4500

acgccgcatt gagctggcta ttgctactaa gaatcacttg gcggcgggtg gcgcgctcat 4560

gatgtttgtg ggcactgttc gacacaaccg ctcacagtca tttgcgcagg ttgaagcggg 4620

tattaagact gcgtactctt cgatggtgaa aacatctcag tggaagaaag aacgtgcacg 4680

gtacggggtg gagcacacct atagtgacta tgaggtcaca gactcttggg cgaacggttg 4740

gcacttgcac cgcaacatgc tgttgttctt ggatcgtcca ctgtctgacg atgaactcaa 4800

ggcgtttgag gattccatgt tttcccgctg gtctgctggt gtggttaagg ccggtatgga 4860

cgcgccactg cgtgagcacg gggtcaaact tgatcaggtg tctacctggg gtggagacgc 4920

tgcgaaaatg gcaacctacc tcgctaaggg catgtctcag gaactgactg gctccgctac 4980

taaaaccgcg tctaaggggt cgtacacgcc gtttcagatg ttggatatgt tggccgatca 5040

aagcgacgcc ggcgaggata tggacgctgt tttggtggct cggtggcgtg agtatgaggt 5100

tggttctaaa aacctgcgtt cgtcctggtc acgtggggct aagcgtgctt tgggcattga 5160

ttacatagac gctgatgtac gtcgtgaaat ggaagaagaa ctgtacaagc tcgccggtct 5220

ggaagcaccg gaacgggtcg aatcaacccg cgttgctgtt gctttggtga agcccgatga 5280

ttggaaactg attcagtctg atttcgcggt taggcagtac gttctcgatt gcgtggataa 5340

ggctaaggac gtggccgctg cgcaacgtgt cgctaatgag gtgctggcaa gtctgggtgt 5400

ggattccacc ccgtgcatga tcgttatgga tgatgtggac ttggacgcgg ttctgcctac 5460

tcatggggac gctactaagc gtgatctgaa tgcggcggtg ttcgcgggta atgagcagac 5520

tattcttcgc acccactaaa agcggcataa accccgttcg atattttgtg cgatgaattt 5580

atggtcaatg tcgcgggggc aaactatgat gggtcttgtt gttggcgtcc cggaaaacga 5640

ttccgaagcc caacctttca tagaaggcgg cggtggaatc gaaatctcgt gatggcaggt 5700

tgggcgtcgc ttggtcggtc atttcgaagg gcaccaataa ctgccttaaa aaaattacgc 5760

cccgccctgc cactcatcgc agtactgttg taattcatta agcattctgc cgacatggaa 5820

gccatcacag acggcatgat gaacctgaat cgccagcggc atcagcacct tgtcgccttg 5880

cgtataatat ttgcccatgg tgaaaacggg ggcgaagaag ttgtccatat tggccacgtt 5940

taaatcaaaa ctggtgaaac tcacccaggg attggctgag acgaaaaaca tattctcaat 6000

aaacccttta gggaaatagg ccaggttttc accgtaacac gccacatctt gcgaatatat 6060

gtgtagaaac tgccggaaat cgtcgtggta ttcactccag agcgatgaaa acgtttcagt 6120

ttgctcatgg aaaacggtgt aacaagggtg aacactatcc catatcacca gctcaccgtc 6180

tttcattgcc atacggaact ccggatgagc attcatcagg cgggcaagaa tgtgaataaa 6240

ggccggataa aacttgtgct tatttttctt tacggtcttt aaaaaggccg taatatccag 6300

ctgaacggtc tggttatagg tacattgagc aactgactga aatgcctcaa aatgttcttt 6360

acgatgccat tgggatatat caacggtggt atatccagtg atttttttct ccattttagc 6420

ttccttagct cctgaaaatc tcgtcgaagc tcggcggatt tgtcctactc aagctgatcc 6480

gacaaaatcc acacattatc ccaggtgtcc ggatcggtca aatacgctgc cagctcatag 6540

accgtatcca aagcatccgg ggctgatccc cggcgccagg gtggtttttc ttttcaccag 6600

tgagacgggc aacagctgat tgcccttcac cgcctggccc tgagagagtt gcagcaagcg 6660

gtccacgtgg tttgccccag caggcgaaaa tcctgtttga tggtggttaa c 6711