Adeno-associated virus vector variants for efficient genome editing and methods thereof

文档序号：1856616 发布日期：2021-11-19 浏览：23次中文

阅读说明：本技术 用于高效基因组编辑的腺相关病毒载体变异体和其方法 (Adeno-associated virus vector variants for efficient genome editing and methods thereof ) 是由 S·查特瑞 L·史密斯 K·王于 2015-09-23 设计创作，主要内容包括：本发明提供用于精确编辑细胞基因组的腺相关病毒(AAV)分化体F载体或AAV载体变异体(相对于AAV9)以及其方法和试剂盒。使用本文所提供的AAV分化体F载体或AAV载体变异体的靶向基因组编辑所发生的出现频率的效率展示为先前所报告的1,000到100,000倍。本发明还提供在个体中治疗疾病或病症的方法,其通过编辑所述个体的细胞的基因组来进行,所述编辑经由用如本文所描述的AAV分化体F载体或AAV载体变异体转导所述细胞和将经过转导的细胞进一步移植到所述个体中来进行,以治疗所述个体的所述疾病或病症。本文还提供在个体中通过体内基因组编辑来治疗疾病或病症的方法,所述体内基因组编辑通过向所述个体直接投与如本文所描述的AAV分化体F载体或AAV载体变异体来进行。(The present invention provides adeno-associated virus (AAV) clade F vectors or AAV vector variants (as opposed to AAV9) and methods and kits thereof for the precise editing of the genome of a cell. The efficiency of the frequency of occurrence of targeted genome editing using the AAV clade F vectors or AAV vector variants provided herein was shown to be 1,000 to 100,000 fold as previously reported. The invention also provides a method of treating a disease or disorder in an individual by editing the genome of cells of the individual via transduction of the cells with an AAV clade F vector or AAV vector variant as described herein and further transplantation of the transduced cells into the individual to treat the disease or disorder in the individual. Also provided herein are methods of treating a disease or disorder in an individual by in vivo genome editing by direct administration of an AAV clade F vector or AAV vector variant as described herein to the individual.)

1. Use of a replication-defective adeno-associated virus (AAV) in the preparation of a medicament for editing a target locus of a genome in a cell without co-transduction or co-administration of an exogenous nuclease or a nucleotide encoding an exogenous nuclease, wherein the AAV comprises:

a) an AAV capsid comprising:

(i) a capsid protein comprising an amino acid sequence having at least 90% sequence identity to amino acids 203 to 736 of any one of SEQ ID NOs 2, 3, 4, 6, 7, 10, 11, 12, 13, 14, 15, 16 or 17;

(ii) a capsid protein comprising an amino acid sequence having at least 90% sequence identity to amino acids 138 to 736 of any one of SEQ ID NOs 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16 or 17; and/or

(iii) A capsid protein comprising an amino acid sequence having at least 90% sequence identity to amino acids 1 to 736 of any one of SEQ ID NOs 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17; and

b) A calibration genome comprising (i) an editing element comprising an internucleotide linkage or a nucleotide sequence for integration into a target locus of a chromosome of a cell, (ii) a 5 'homology arm nucleotide sequence located 5' of said editing element, said nucleotide sequence having homology to a 5 'region in said chromosome relative to said target locus, and (iii) a 3' homology arm nucleotide sequence located 3 'of said editing element, said nucleotide sequence having homology to a 3' region in said chromosome relative to said target locus.

2. Use according to claim 1, wherein:

(a) the capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acid 203-736 of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 is C for amino acid 206; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO. 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO. 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO. 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO. 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO. 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO. 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO. 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO. 2 is C; or the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO. 2 is G,

(b) The capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acid 138-736 of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 amino acid 151 corresponds to amino acid R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO. 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO. 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO. 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO. 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO. 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO. 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO. 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO. 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO. 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO. 2 is C; alternatively, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO. 2 is G, and/or

(c) The capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acids 1-736 of SEQ ID NOs 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 is T for amino acid 2; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO. 2 is I; the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO. 2 is V; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO. 2 is L; the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO. 2 is D; the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO. 2 is C; the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO. 2 is H; the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO. 2 is Q; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO. 2 is A; the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO. 2 is N; the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO. 2 is S; the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO. 2 is I; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is G or Y; the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO 2 is M; the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO 2 is R; the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO. 2 is K; the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO. 2 is C; alternatively, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO. 2 is G.

3. Use according to claim 2, wherein:

(a) the capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acid 203-736 of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID No. 2 is G; the amino acid corresponding to amino acid 296 of SEQ ID NO. 2 in the capsid protein is H, the amino acid corresponding to amino acid 464 of SEQ ID NO. 2 in the capsid protein is N, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 681 of SEQ ID NO. 2 in the capsid protein is M; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO:2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO:2 is R; or the amino acid corresponding to the amino acid 501 of SEQ ID NO. 2 in the capsid protein is I, the amino acid corresponding to the amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to the amino acid 706 of SEQ ID NO. 2 in the capsid protein is C,

(b) The capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acid 138-736 of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID No. 2 is G; the amino acid corresponding to amino acid 296 of SEQ ID NO. 2 in the capsid protein is H, the amino acid corresponding to amino acid 464 of SEQ ID NO. 2 in the capsid protein is N, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 681 of SEQ ID NO. 2 in the capsid protein is M; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO:2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO:2 is R; or the amino acid corresponding to amino acid 501 of SEQ ID NO. 2 in the capsid protein is I, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 706 of SEQ ID NO. 2 in the capsid protein is C, and/or

(c) The capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acids 1-736 of SEQ ID NOs 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 is T and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID No. 2 is Q; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO. 2 is I, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is Y; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO. 2 is K; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO. 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO. 2 is S; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO. 2 is G; the amino acid corresponding to amino acid 296 of SEQ ID NO. 2 in the capsid protein is H, the amino acid corresponding to amino acid 464 of SEQ ID NO. 2 in the capsid protein is N, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 681 of SEQ ID NO. 2 in the capsid protein is M; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO:2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO:2 is R; or the amino acid corresponding to amino acid 501 of SEQ ID NO. 2 in the capsid protein is I, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 706 of SEQ ID NO. 2 in the capsid protein is C.

4. The use of any one of the preceding claims, wherein the cell is a mammalian subject and the AAV is administered to the subject in an amount effective to transduce the cell in the subject.

5. The use of any one of claims 1-4, wherein the calibration genome is absent a promoter operably linked to the editing element nucleotide sequence.

6. The use of any one of claims 1-4, wherein the calibration genome further comprises an exogenous promoter operably linked to the editing element.

7. The use of any preceding claim, wherein each 5 'and 3' homology arm nucleotide sequence independently has a nucleotide length of about 50 to 2000 nucleotides.

8. The use of any preceding claim, wherein the editing element comprises a gene or fragment thereof, a coding sequence of a gene, an exon, an intron, a 5 'untranslated region (UTR), a 3' UTR, a promoter, a splice donor, a splice acceptor, a sequence corresponding to a non-coding RNA, an insulator (insulator), or a combination thereof.

9. The use of any preceding claim, wherein the editing element is a nucleotide sequence comprising an insertion, deletion or substitution relative to a locus of interest of the chromosome.

10. The use of any one of the preceding claims, wherein the locus of interest comprises one or more mutations relative to a locus in a corresponding wild-type chromosome, optionally wherein the locus of interest comprises an null (amorphic) mutation, a neogenic (neomorphic) mutation, an anti-genic (anti-genic) mutation, an autosomal dominant mutation, an autosomal recessive mutation, or a combination thereof, and optionally wherein the locus of interest is selected from an intrachromosomal promoter, enhancer, signal sequence, intron, exon, splice donor site, splice acceptor site, internal ribosome entry site, reverse exon, insulator, gene or fragment thereof, chromosome inversion, and chromosome translocation.

11. The use of any preceding claim, wherein the calibration genome comprises a 5 'inverted terminal repeat (5' ITR) nucleotide sequence 5 'of the 5' homology arm nucleotide sequence and a 3 'inverted terminal repeat (3' ITR) nucleotide sequence 3 'of the 3' homology arm nucleotide sequence, and optionally wherein:

(a) the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO:36 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 37; or

(b) The 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO 38 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO 39.

12. The use of any preceding claim, wherein the cell is a mammalian cell, optionally wherein the cell is a myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte or retinal cell.

13. The use of any preceding claim, wherein the cell is a stem cell, optionally wherein the stem cell is a hematopoietic stem cell, an umbilical cord blood stem cell, a bone marrow stem cell, a fetal liver stem cell, or a peripheral blood stem cell, and optionally wherein the stem cell is CD34⁺A stem cell.

14. The use of any one of the preceding claims, wherein the AAV has a chromosomal integration efficiency for integrating the editing element into a target locus of a chromosome in the cell of at least about 1%, 5%, or 10%.

15. A replication-defective adeno-associated virus (AAV) comprising:

a) an AAV capsid comprising:

(i) a capsid protein comprising an amino acid sequence having at least 90% sequence identity to amino acids 203 to 736 of any one of SEQ ID NOs 2, 3, 4, 6, 7, 10, 11, 12, 13, 14, 15, 16 or 17;

(ii) A capsid protein comprising an amino acid sequence having at least 90% sequence identity to amino acids 138 to 736 of any one of SEQ ID NOs 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16 or 17; and/or

b) a corrected genome comprising (i) an editing element comprising an internucleotide linkage or a nucleotide sequence for integration into a target locus of a chromosome of a cell, (ii) a 5 'homology arm nucleotide sequence located 5' of said editing element, said nucleotide sequence having homology to a 5 'region in said chromosome relative to said target locus, and (iii) a 3' homology arm nucleotide sequence located 3 'of said editing element, said nucleotide sequence having homology to a 3' region in said chromosome relative to said target locus,

wherein the AAV integrates the editing element into a target locus of a chromosome in the cell without co-transduction or co-administration of an exogenous nuclease or a nucleotide encoding an exogenous nuclease.

16. The AAV of claim 15, wherein:

17. The AAV of claim 16, wherein:

(a) the capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acid 203-736 of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID No. 2 is G; the amino acid corresponding to amino acid 296 of SEQ ID NO. 2 in the capsid protein is H, the amino acid corresponding to amino acid 464 of SEQ ID NO. 2 in the capsid protein is N, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 681 of SEQ ID NO. 2 in the capsid protein is M; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO:2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO:2 is R; or the amino acid corresponding to the amino acid 501 of SEQ ID NO. 2 in the capsid protein is I, the amino acid corresponding to the amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to the amino acid 706 of SEQ ID NO. 2 in the capsid protein is C,

(b) The capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acid 138-736 of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID No. 2 is G; the amino acid corresponding to amino acid 296 of SEQ ID NO. 2 in the capsid protein is H, the amino acid corresponding to amino acid 464 of SEQ ID NO. 2 in the capsid protein is N, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 681 of SEQ ID NO. 2 in the capsid protein is M; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO:2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO:2 is R; or the amino acid corresponding to amino acid 501 of SEQ ID NO. 2 in the capsid protein is I, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 706 of SEQ ID NO. 2 in the capsid protein is C, and/or

(c) The capsid protein comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of amino acids 1-736 of SEQ ID NOs 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17, wherein: the capsid protein has a sequence identical to SEQ ID NO:2 is T and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID No. 2 is Q; the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO. 2 is I, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is Y; the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO. 2 is K; the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO. 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO. 2 is S; the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO. 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO. 2 is G; the amino acid corresponding to amino acid 296 of SEQ ID NO. 2 in the capsid protein is H, the amino acid corresponding to amino acid 464 of SEQ ID NO. 2 in the capsid protein is N, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 681 of SEQ ID NO. 2 in the capsid protein is M; the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO. 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO. 2 is R; the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO:2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO:2 is R; or the amino acid corresponding to amino acid 501 of SEQ ID NO. 2 in the capsid protein is I, the amino acid corresponding to amino acid 505 of SEQ ID NO. 2 in the capsid protein is R, and the amino acid corresponding to amino acid 706 of SEQ ID NO. 2 in the capsid protein is C.

18. The AAV of any one of claims 15-17, wherein the correction genome lacks a promoter operably linked to the editing element nucleotide sequence.

19. The AAV of any one of claims 15-17, wherein the correction genome further comprises an exogenous promoter operably linked to the editing element.

20. The AAV of any one of claims 15-19, wherein each 5 'and 3' homology arm nucleotide sequence independently has a nucleotide length of about 50 to 2000 nucleotides.

21. The AAV of any one of claims 15-20, wherein the editing element comprises a gene or fragment thereof, a coding sequence of a gene, an exon, an intron, a 5 'untranslated region (UTR), a 3' UTR, a promoter, a splice donor, a splice acceptor, a sequence corresponding to a non-coding RNA, an insulator (insulator), or a combination thereof.

22. The AAV of any one of claims 15-21, wherein the editing element is a nucleotide sequence comprising an insertion, deletion, or substitution relative to a target locus of the chromosome.

23. The AAV of any one of claims 15-22, wherein the target locus comprises one or more mutations relative to a locus in a corresponding wild-type chromosome, optionally wherein the target locus comprises an null (amorphic) mutation, a neogenic (neomorphic) mutation, an anti-genic (anti-genic) mutation, an autosomal dominant mutation, an autosomal recessive mutation, or a combination thereof, and optionally wherein the target locus is selected from an intrachromosomal promoter, enhancer, signal sequence, intron, exon, splice donor site, splice acceptor site, internal ribosome entry site, inverted exon, insulator, gene or fragment thereof, chromosome inversion, and chromosome translocation.

24. The AAV of any one of claims 15-23, wherein the correction genome comprises a 5 'inverted terminal repeat (5' ITR) nucleotide sequence located 5 'of the 5' homology arm nucleotide sequence and a 3 'inverted terminal repeat (3' ITR) nucleotide sequence located 3 'of the 3' homology arm nucleotide sequence, and optionally wherein:

(a) the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO:36 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 37; or

(b) The 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO 38 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO 39.

25. The AAV of any one of claims 15-24, wherein the cell is a mammalian cell, optionally wherein the cell is a myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte, or retinal cell.

26. The AAV of any one of claims 15-25, wherein the cell is a stem cell, optionally wherein the stem cell is a hematopoietic stem cell, an umbilical cord blood stem cell, a bone marrow stem cell, a fetal liver stem cell, or a peripheral blood stem cell, and optionally wherein the stem cell is CD34 ⁺A stem cell.

27. The AAV of any one of claims 15-26, wherein the AVV has a chromosomal integration efficiency of at least about 1%, 5%, or 10% for integration of the editing element into a chromosomal locus of interest in the cell.

28. A packaging system for recombinant production of adeno-associated virus (AAV), wherein the packaging system comprises

A Rep nucleotide sequence encoding one or more AAV Rep proteins;

a Cap nucleotide sequence encoding one or more AAV capsid proteins according to any one of claims 15-27; and

a calibration genome according to any one of claims 15-27;

wherein the packaging system is operable in a cell to encapsulate the calibration genome in the capsid to form the adeno-associated virus.

29. A method for recombinantly producing AAV, wherein the method comprises introducing the packaging system of claim 28 into a cell under conditions operable to encapsulate a correction genome in a capsid to form AAV.

Background

The adeno-associated virus (AAV) genome is constructed from either positive or negative single-stranded deoxyribonucleic acid (ssDNA) that is about 4.9 kilobases long. The genome comprises Inverted Terminal Repeats (ITRs) at both ends of the DNA strand, and two Open Reading Frames (ORFs): rep and cap. Rep consists of four overlapping genes encoding Rep proteins required for the AAV life cycle, and cap contains overlapping nucleotide sequences of capsid proteins: VP1, VP2, and VP3, which interact together to form a capsid with icosahedral symmetry.

Recombinant adeno-associated virus (rAAV) vectors derived from replication-defective human parvovirus AAV2, which have not been definitively identified as being pathogenic or oncogenic, have been validated as safe and effective gene transfer vehicles [3-4,6,18-19,26,31 ]. rAAV transduces non-dividing primary cells, is less immunogenic, and directly supports intra-transgene expression [6,10,20 ]. Infection with wild-type AAV is associated with oncogenic transformation, and AAV inverted terminal repeats may actually confer oncogenic protection [2,28,52-55 ]. Recent investigations of various groups of human tissues found that bone marrow and liver are the two most common sites of naturally occurring AAV isolates in humans, indicating that infection of bone marrow cells by AAV is not uncommon.

The use of viral vectors for gene therapy has long been considered. The hematopoietic system is one of the earliest targets of gene therapy due to its potential for long-term correction and easy ex vivo manipulation. However, despite considerable efforts, practical therapeutic success remains elusive [5 ]. This is due to the well-established inability of most viral vectors to efficiently transduce quiescent non-dividing Hematopoietic Stem Cells (HSCs) [23] and the safety issues arising from insertional neoplasias [15,22 ]. However, stable gene transfer by rAAV to both murine and human HSCs has been successfully demonstrated [8,11-12,24,27,29-30,37 ].

It is also difficult to effectively use viral vectors in gene therapy for the treatment of neurological conditions, particularly diseases or disorders of the central nervous system, because of the difficulty in crossing the blood-brain barrier, i.e., creating cellular and metabolic isolation of circulating blood from brain extracellular fluids by tight junctions between endothelial cells that restrict solute passage.

CD34 is a cell surface glycoprotein and a cell-cell adhesion factor. The CD34 protein was expressed in early hematopoietic and vascular tissues, and the cell expressing CD34 was named CD34⁺. rAAV has been demonstrated in immunodeficient NOD-SCID mice on human CD34⁺Chromosomal integration in HSCs [8,12,16,29]And is capable of supporting primary and secondary multiple lineagesEfficient transduction of implanted primitive, pluripotent, self-renewing human HSCs [29]. Demonstration of the propensity of rAAV to efficiently transduce primitive quiescent CD34+ CD 38-cells residing in G0 to support transduction of primitive HSCs capable of continued engraftment [24]. Despite several reports of successful rAAV-mediated gene transfer into human HSCs in vitro and into xenogenic and non-human primate HSCs in vivo, debate on the utility of rAAV for HSC transduction continues. These inconsistencies arise primarily from short-term in vitro studies assessing transduction by expression profiling, and can be attributed to the identified limitations on transgene expression by rAAV2, including viral uncoating [35 ]Intracellular transport [33 ]]Nuclear transport and second chain synthesis [36 ]]。

While AAV2 is still the most studied prototype virus for AAV-based vectors [1,13,18,21], the identification of a large number of new AAV serotypes significantly increases the lineage of potential gene transfer vectors [14 ]. AAV1, 3, and 4 were isolated as contaminants in adenovirus stocks, and AAV5 was isolated from human condylomatous warts (conylomatous warts). AAV6 was produced as a laboratory recombinant form between AAV1 and AAV 2. More recently, over 100 different isolates of naturally occurring AAV have been identified in human and non-human primate tissues. This led to the use of capsids derived from some of these isolates for pseudotyping, replacing the envelope protein of AAV2 with a novel envelope, and then packaging the rAAV2 genome using AAV2 rep and the novel capsid gene. The use of a novel capsid of proteins as part of the viral shell causes circumvention of many limitations in transgene expression associated with AAV2 [32,35-36 ].

In an effort to circumvent these limitations, recent studies have shown that novel capsid sequences cause reduced proteasome-mediated capsid degradation and increased nuclear trafficking and retention. Many of them exploit the novel capsid of the novel receptor to expand the tropism of rAAV, allowing efficient transduction of previously refractory tissues, and providing a means to circumvent the highly ubiquitous pre-existing serum immunity to AAV 2. Notably, some novel capsids appear to alter intracellular processing of rAAV. For example, dehulling and transgene expression are accelerated in the case of AAV8 as compared to the native AAV2 capsid. Recently, it was shown that transgene expression is based on capsid proteins regardless of the serotype source of Inverted Terminal Repeats (ITRs).

Naturally occurring AAV can be identified in cytokine-primed peripheral blood stem cells. The capsid sequences of these AAVs are unique. These capsids are capable of pseudotyping recombinant AAV2 genomes. U.S. patent publication No. 20130096182a1 describes capsid AAVF1-17 and its use for cell transduction and gene transfer. Any improvement for therapeutic purposes in the field of gene therapy with respect to permanent and reversible gene transfer and expression would be a significant improvement in the art. Furthermore, despite decades of research, safe and efficient gene delivery into stem cells remains a significant challenge in the art. Thus, the ability to safely genetically modify stem cells would represent a significant advance.

Furthermore, genome editing by gene targeting or correction at specific sites in the genome but not leaving footprints in the genome is attractive for accurate correction of inherited and acquired diseases. Current technology accomplishes this editing by using exogenous nucleases such as zinc finger nucleases, TAL endonucleases or the caspase 9/CRISPR system. However, these "traditional" methods are associated with the toxicity and off-target effects of endonuclease cleavage. Thus, the ability to genetically modify stem cells safely and efficiently at high frequency without the need for exogenous endonuclease cleavage would represent a significant advance.

Furthermore, current methods of gene transduction of human HSCs involve ex vivo transduction of purified donor stem cells followed by transplantation into a typically "adapted" recipient. Cell harvesting procedures are invasive and involve bone marrow harvesting or multi-day granulocyte colony stimulating factor (G-CSF) pre-sensitization of donors followed by apheresis (apheresis). Ex vivo transduction procedures may affect the hematopoietic potential of stem cells. In addition, the cells transduced in vitro must be tested for sterility, toxicity, etc. prior to transplantation. Prior to transplantation into a recipient, stem cells often must undergo adaptation using chemotherapy or radiation to ensure implantation. The procedure typically requires hospitalization of the patient for at least several days and sometimes longer. In general, this is a difficult, expensive and high risk procedure that greatly limits the utility of stem cell gene therapy. There is a need to provide better alternatives to current stem cell transduction methods without the need for purification and ex vivo transduction procedures.

Disclosure of Invention

Provided herein are adeno-associated virus (AAV) vectors (e.g., Clade F vectors, such as replication defective adeno-associated viruses (AAV) comprising a correction genome encapsulated in a capsid that is an AAV Clade F capsid) for editing the genome of a cell via homologous recombination, and methods and kits for their use.

In some aspects, the invention provides a replication-defective adeno-associated virus (AAV) comprising a correction genome enclosed in a capsid, the capsid being an AAV clade F capsid; and the calibration genome comprises (a) an editing element selected from an internucleotide linkage or a nucleotide sequence for integration into a target locus of a mammalian chromosome, (b) a 5 'homology arm nucleotide sequence located 5' of the editing element, the nucleotide sequence having homology to a 5 'region in the mammalian chromosome relative to the target locus, and (c) a 3' homology arm nucleotide sequence located 3 'of the editing element, the nucleotide sequence having homology to a 3' region in the mammalian chromosome relative to the target locus. In some aspects, the invention also provides a replication-defective adeno-associated virus (AAV) comprising a correction genome enclosed in a capsid, the capsid being an AAV clade F capsid; and the calibration genome comprises an editing element nucleotide sequence for integration into a target locus of a mammalian chromosome, the calibration genome being substantially absent of a promoter operably linked to the editing element nucleotide sequence. In other aspects, the invention provides a replication-defective adeno-associated virus (AAV) comprising a correction genome enclosed in a capsid, the capsid being an AAV clade F capsid; the calibration genome comprises editing elements selected from the group consisting of internucleotide linkages or nucleotide sequences for integration into a target locus of a mammalian chromosome in a cell; and the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome in the cell of at least about 1%. Other aspects of the invention relate to a gene editing vector comprising a replication-defective adeno-associated virus (AAV) comprising a calibration genome encapsulated in an AAV capsid, the calibration genome comprising editing elements selected from the group consisting of an internucleotide linkage or a nucleotide sequence for integration into a target locus of a chromosome of a mammalian cell; a 5' homology arm nucleotide sequence located 5' to said editing element, said nucleotide sequence having homology to a 5' region in said chromosome relative to said target locus; a 3' homology arm nucleotide sequence located 3' of said editing element, said nucleotide sequence having homology with a 3' region in said chromosome relative to said target locus; and wherein the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the chromosome of the mammalian cell in the absence of an exogenous nuclease of at least about 10%.

In some embodiments of any of the AAVs provided herein, the efficiency of chromosomal integration of the AAV in the absence of an exogenous nuclease for integrating an editing element into a target locus of a mammalian chromosome in a cell is at least about 1%.

In some embodiments of any of the AAV provided herein, the correction genome comprises a 5 'inverted terminal repeat (5' ITR) nucleotide sequence located 5 'to a 5' homology arm nucleotide sequence and a 3 'inverted terminal repeat (3' ITR) nucleotide sequence located 3 'to a 3' homology arm nucleotide sequence. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially identical to the AAV2 virus 5'ITR and AAV2 virus 3' ITR, respectively. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially mirror images of each other. In some embodiments, the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID No. 36 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID No. 37. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially identical to the AAV5 virus 5'ITR and AAV5 virus 3' ITR, respectively. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially mirror images of each other. In some embodiments, the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID No. 38 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID No. 39.

In some embodiments of any of the AAVs provided herein, the correction genome is substantially absent of a promoter operably linked to an editing element nucleotide sequence. In some embodiments of any of the AAVs provided herein, the correction genome further comprises an exogenous promoter operably linked to the editing element.

In some embodiments of any of the AAVs provided herein, the replication-defective AAV genome comprises a substantial absence of an AAV rep gene and an AAV cap gene.

In some embodiments of any of the AAV provided herein, each of the 5 'and 3' homology arm nucleotide sequences independently has a nucleotide length of between about 500 to 1000 nucleotides or between about 600 to 1000 nucleotides. In some embodiments, the 5 'and 3' homology arm nucleotide sequences have substantially equal nucleotide lengths. In some embodiments, the 5 'and 3' homology arm nucleotide sequences have asymmetric nucleotide lengths. In some embodiments, the 5 'homology arm nucleotide sequence has at least about 95% nucleotide sequence identity to a 5' region in a mammalian chromosome relative to a target locus. In some embodiments, the 3 'homology arm nucleotide sequence has at least about 95% nucleotide sequence identity to a 3' region in a mammalian chromosome relative to a target locus. In some embodiments, the 5 'homology arm nucleotide sequence has 100% identity to a 5' region in the mammalian chromosome relative to the target locus, and the 3 'homology arm nucleotide sequence has 100% identity to a 3' region in the mammalian chromosome relative to the target locus.

In some embodiments of any of the AAVs provided herein, the editing element consists of one nucleotide. In some embodiments, the target locus is a nucleotide sequence consisting of one nucleotide, and the target locus represents a point mutation of a mammalian chromosome.

In some embodiments, the locus of interest may comprise an intron of a mammalian chromosome. In some embodiments, the locus of interest may comprise an exon of a mammalian chromosome. In some embodiments, the locus of interest may comprise a non-coding region of a mammalian chromosome. In some embodiments, the locus of interest may comprise a regulatory region of a mammalian chromosome. In some embodiments, a target locus may be a locus associated with a disease condition as described herein.

In some embodiments of any of the AAVs provided herein, the editing element comprises at least 1, 2, 10, 100, 200, 500, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the editing element comprises 1 to 5500, 1 to 5000, 1 to 4500, 1 to 4000, 1 to 3000, 1 to 2000, 1 to 1000, 1 to 500, 1 to 200, or 1 to 100 nucleotides, or 2 to 5500, 2 to 5000, 2 to 4500, 2 to 4000, 2 to 3000, 2 to 2000, 2 to 1000, 2 to 500, 2 to 200, or 2 to 100 nucleotides, or 10 to 5500, 10 to 5000, 10 to 4500, 10 to 4000, 10 to 3000, 10 to 2000, 10 to 1000, 10 to 500, 10 to 200, or 10 to 100 nucleotides.

In some embodiments of any of the AAV provided herein, the editing element comprises an exon, an intron, a 5 'untranslated region (UTR), a 3' UTR, a promoter, a splice donor, a splice acceptor, a sequence encoding or non-encoding an RNA, an insulator, a gene, or a combination thereof. In some embodiments of any of the AAVs provided herein, the editing element is a fragment of a coding sequence of a gene within or across a locus of interest.

In some embodiments of any of the AAVs provided herein, the target locus is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 1; the editing element comprises m nucleotides, wherein m is an integer equal to n; and the editing element represents a substitution of a mammalian chromosomal target locus. In some embodiments of any of the AAVs provided herein, the target locus is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 1; the editing element comprises m nucleotides, wherein m is an integer greater than n; and the editing element represents a substitutional addition to a mammalian chromosomal target locus. In some embodiments of any of the AAVs provided herein, the target locus is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 2; the editing element comprises m nucleotides, wherein m is an integer less than n; and the editing element represents a substitutional deletion to a target locus of a mammalian chromosome. In some embodiments of any of the AAVs provided herein, the target locus is an internucleotide linkage; the editing element comprises m nucleotides, wherein m is an integer greater than or equal to 1; and the editing element represents an addition to a mammalian chromosomal target locus.

In some embodiments of any of the AAVs provided herein, the editing element is an internucleotide linkage. In some embodiments, the target locus is a nucleotide sequence comprising one or more nucleotides, and the editing element comprises a deletion to the mammalian chromosomal target locus.

In some embodiments of any of the AAVs provided herein, the target locus of a mammalian chromosome is a mutant target locus comprising one or more mutant nucleotides relative to a corresponding wild-type mammalian chromosome. In some embodiments, the mutant target locus comprises a point mutation, a missense mutation, a nonsense mutation, an insertion of one or more nucleotides, a deletion of one or more nucleotides, or a combination thereof. In some embodiments, the mutant target locus comprises a null (amorphic) mutation, a neomorphic (neomorphic) mutation, or an anti-morphic (antimorphic) mutation. In some embodiments, the mutant target locus comprises an autosomal dominant mutation, an autosomal recessive mutation, a heterozygote mutation, a homozygote mutation, or a combination thereof. In some embodiments, the mutant target locus is selected from the group consisting of a promoter, an enhancer, a signal sequence, an intron, an exon, a splice donor site, a splice acceptor site, an internal ribosome entry site, a reverse exon, an insulator, a gene, a chromosomal inversion, and a chromosomal translocation within a mammalian chromosome.

In some embodiments of any of the AAVs provided herein, the AAV clade F capsid comprises at least one protein selected from clade F VP1, clade F VP2, and clade F VP 3. In some embodiments, the AAV clade F capsid comprises at least two proteins selected from clade F VP1, clade F VP2, and clade F VP 3. In some embodiments, the AAV clade F capsid comprises clade F VP1, clade F VP2, and clade F VP3 proteins. In some embodiments, the AAV clade F capsid comprises VP1, VP2, or VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of SEQ ID NO:1, respectively, corresponding to the amino acid sequences of AAV9 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736 and amino acids 138 to 736 of SEQ ID NO:1, respectively, which correspond to the amino acid sequences of AAV9 capsid proteins VP1 and VP2, respectively; VP1 and VP3 proteins having at least 90% amino acid sequence identity to amino acids 1 to 736 and amino acids 203 to 736, respectively, of SEQ ID No. 1, which correspond to the amino acid sequences of AAV9 capsid proteins VP1 and VP3, respectively; or VP2 and VP3 proteins having at least 90% amino acid sequence identity with amino acids 138 to 736 and amino acids 203 to 736, respectively, of SEQ ID NO. 1, which correspond to the amino acid sequences of the AAV9 capsid proteins VP2 and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of SEQ ID NO:1, respectively, corresponding to the amino acid sequences of AAV9 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, or VP3 protein having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736 and amino acids 138 to 736 of any one of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1 and VP2, respectively; VP1 and VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736 and amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17 or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1 and VP3, respectively; or VP2 and VP3 proteins having at least 90% amino acid sequence identity with amino acids 138 to 736 and amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17 or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP2 and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736 of any one of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, or VP3 proteins encoded by nucleotide sequences comprising at least 90% nucleotide sequence identity with SEQ ID NO:18, respectively, corresponding to the nucleotide sequences encoding AAV9 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to SEQ ID No. 18; VP1 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to SEQ ID No. 18; or VP2 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to SEQ ID NO. 18. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins encoded by nucleotide sequences comprising at least 90% nucleotide sequence identity with SEQ ID No. 18, which correspond to the nucleotide sequences encoding AAV9 capsid proteins VP1, VP2, and VP 3. In some embodiments, the AAV clade F capsid comprises VP1, VP2, or VP3 protein encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOs 20, 21, 22, 23, 25, 24, 27, 28, 29, 26, 30, 31, 32, 33, 34, or 35, respectively, corresponding to the nucleotide sequences encoding AAVF1 through AAVF9 and AAVF11 through AAVF17 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins encoded by nucleotide sequences comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOs 20-35; VP1 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOS 20-35; or VP2 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOS 20-35. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOs 20, 21, 22, 23, 25, 24, 27, 28, 29, 26, 30, 31, 32, 33, 34, or 35, which corresponds to the nucleotide sequences encoding AAVF1 through AAVF9 and AAVF11 through AAVF17 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises AAV9 VP1, VP2, or VP3 capsid proteins corresponding to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID No. 1. In some embodiments, the AAV clade F capsid comprises AAV9 VP1 and VP2 capsid proteins corresponding to amino acids 1 to 736 and amino acids 138 to 736, respectively, as set forth in SEQ ID No. 1; AAV9 VP1 and VP3 capsid proteins corresponding to amino acids 1 to 736 and amino acids 203 to 736 as set forth in SEQ ID NO:1, respectively; or the AAV9 VP2 and VP3 capsid proteins corresponding to amino acids 138 to 736 and amino acids 203 to 736, respectively, as set forth in SEQ ID NO: 1. In some embodiments, the AAV clade F capsid comprises AAV9 capsid proteins VP1, VP2, and VP3, which correspond to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID No. 1. In some embodiments, the AAV clade F capsid comprises VP1 capsid protein selected from VP1 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17 corresponding to amino acids 1 to 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 capsid proteins independently selected from VP1 and VP2 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17, which correspond to amino acids 1 to 736 and amino acids 138 to 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 capsid proteins independently selected from VP1, VP2, and VP3 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17 that correspond to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13. In some embodiments, the AAV clade F capsid comprises each of VP1, VP2, and VP3 capsid proteins of any one of AAVF1 through AAVF9 and AAVF11 through AAVF17 corresponding to amino acids 1 through 736, amino acids 138 through 736, and amino acids 203 through 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively.

In some embodiments of any of the AAVs provided, the clade F capsid comprises a polypeptide sequence having a percent sequence identity of at least 95% to a polypeptide sequence selected from the group consisting of AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. As used herein, AAVF1, AAVF2, AAVF3, AAVF4, AAVF5, AAVF6, AAVF7, AAVF8, AAVF9, AAVF10, AAVF11, AAVF12, AAVF13, AAVF14, AAVF15, AAVF16, and AAVF17 are also referred to as AAVHSC1, AAVHSC2, AAVHSC3, AAVHSC4, AAVHSC5, AAVHSC6, AAVHSC7, AAVHSC8, AAVHSC9, AAVHSC10, aasc 11, AAVHSC12, AAVHSC13, AAVHSC14, AAVHSC15, AAVHSC16, and AAVHSC17, respectively. In other words, any statement to AAVF1, AAVF2, AAVF3, AAVF4, AAVF5, AAVF6, AAVF7, AAVF8, AAVF9, AAVF10, AAVF11, AAVF12, AAVF13, AAVF14, AAVF15, AAVF16, or AAVF17 is equivalent to, and can be replaced by, AAVHSC1, AAVHSC2, AAVHSC3, AAVHSC4, AAVHSC5, AAVHSC6, AAVHSC7, AAVHSC8, AAVHSC9, AAVHSC10, aasc 11, AAVHSC12, AAVHSC13, AAVHSC14, AAVHSC15, AAVHSC16, or AAVHSC17, respectively.

In some embodiments of any of the AAV provided herein, the mammalian chromosome is selected from human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, and Y. In some embodiments of any of the AAV provided herein, the mammalian chromosome is selected from mouse chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, X, and Y. In some embodiments, the mammalian chromosome is not human chromosome 19.

In some embodiments of any of the AAVs provided herein, the mammalian chromosome is a somatic chromosome. In some embodiments, the somatic cells are from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, and epithelial tissue. In some embodiments, the somatic cells are from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage. In some embodiments, the somatic cell is a CD34+ cell.

In some embodiments of any of the AAVs provided herein, the cell is a stem cell. In some embodiments, the stem cells are hematopoietic stem cells, umbilical cord stem cells, bone marrow stem cells, fetal liver stem cells, or peripheral blood stem cells. In some embodiments, the cell is selected from the group consisting of: CD34+ hematopoietic stem cell line (HSC), K562 CD34+ leukemia cell line, HepG2 human liver cell line, peripheral blood stem cell, cord blood stem cell, CD34+ peripheral blood stem cell, WI-38 human diploid fibroblast cell line, MCF7 human breast cancer cell line, Y79 human retinoblastoma cell line, SCID-X1 LBL human EBV immortalized B cell line, primary human hepatocytes, primary hepatic sinusoid endothelial cells, and primary skeletal myoblasts.

In some embodiments of any of the AAVs provided herein, the efficiency of chromosomal integration by the AAV for integrating the editing element into a target locus of a mammalian chromosome in a cell is at least about 5%. In some embodiments, the AAV has a chromosomal integration efficiency for integrating an editing element into a target locus of a mammalian chromosome in a cell of at least about 10%.

Other aspects of the invention relate to compositions comprising an AAV as described herein, wherein the compositions are in a pharmaceutically acceptable formulation. In some embodiments, the formulation is configured for administration to a mammal. In some embodiments, the formulation is configured for administration to a mammal via intravenous injection, subcutaneous injection, intramuscular injection, autologous cell transfer, or allogeneic cell transfer. In some embodiments, the pharmaceutically acceptable formulation comprises an excipient. In some embodiments, the excipient is selected from a carrier, an adjuvant, and a vehicle, or a combination thereof.

Yet other aspects of the invention relate to a packaging system for recombinantly producing an adeno-associated virus (AAV), wherein the packaging system comprises Rep nucleotide sequences encoding one or more AAV Rep proteins of an AAV clade F capsid; a Cap nucleotide sequence encoding one or more AAV Cap proteins thereof; and a calibration genome as described herein; wherein the packaging system is operable in a cell to encapsulate the calibration genome in a capsid to form the adeno-associated virus. In some embodiments, the packaging system comprises a first vector comprising Rep nucleotide sequences and Cap nucleotide sequences and a second vector comprising a corrected genome. In some embodiments, the AAV clade F capsid comprises at least one protein selected from clade F VP1, clade F VP2, and clade F VP 3. In some embodiments, the AAV clade F capsid comprises at least two proteins selected from clade F VP1, clade F VP2, and clade F VP 3. In some embodiments, the AAV clade F capsid comprises clade F VP1, clade F VP2, and clade F VP3 proteins. In some embodiments, the AAV clade F capsid is any AAV clade F capsid as described herein. In some embodiments, the Rep nucleotide sequence encodes an AAV2 Rep protein. In some embodiments, the encoded AAV2 Rep protein is at least one of Rep 78/68 or Rep 68/52. In some embodiments, the nucleotide sequence encoding the AAV2 Rep protein comprises a nucleotide sequence having a minimum percentage of sequence identity to the AAV2 Rep nucleotide sequence of SEQ ID NO:40, wherein the minimum percentage of sequence identity is at least 70% across the length of the nucleotide sequence encoding the AAV2 Rep protein. In some embodiments of any of the provided packaging systems, the packaging system further comprises a third vector, wherein the third vector is a helper viral vector. In some embodiments, the helper viral vector is a separate third vector. In some embodiments, the helper viral vector is integrated with the first vector. In some embodiments, the helper viral vector is integrated with the second vector. In some embodiments, the third vector comprises a gene encoding a helper viral protein. In some embodiments, the helper virus is selected from the group consisting of: adenovirus, herpes virus (including Herpes Simplex Virus (HSV)), vaccinia virus, and Cytomegalovirus (CMV). In some embodiments, the helper virus is an adenovirus. In some embodiments, the adenoviral genome comprises one or more adenoviral RNA genes selected from the group consisting of: e1, E2, E4 and VA. In some embodiments, the helper virus is HSV. In some embodiments, the HSV genome comprises one or more of the HSV genes selected from the group consisting of: UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL 42. In some embodiments, the first vector and the third vector are contained within a first transfection entity. In some embodiments, the nucleotides of the second vector and the third vector are contained within a second transfectant. In some embodiments, the nucleotides of the first and third vectors are cloned into a recombinant helper virus. In some embodiments, the nucleotides of the second and third vectors are cloned into a recombinant helper virus. In some embodiments, the AAV capsid is a capsid of a clade F AAV selected from the group consisting of: AAV9, AAVF1, AAVF2, AAVF3, AAVF4, AAVF5, AAVF6, AAVF7, AAVF8, AAVF9, AAVF11, AAVF12, AAVF13, AAVF14, AAVF15, AAVF16, AAVF17, AAVHU31, and AAVHU 32. In some embodiments, any of the packaging systems described herein are contained within a kit.

Other aspects of the invention relate to a method for recombinantly producing an adeno-associated virus (AAV), wherein the method comprises transfecting or transducing a cell with a packaging system as described herein under conditions operable for encapsulating a calibration genome in a capsid to form the AAV.

In other aspects, the invention provides a method for editing a target locus of a mammalian genome, wherein the method comprises transducing a cell comprising the mammalian genome with an adeno-associated virus (AAV) as described herein. In some embodiments, the cell is a mammalian stem cell. In some embodiments, the mammalian cell is from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, and epithelial tissue. In some embodiments, the mammalian cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage. In some embodiments, the mammalian cell is a stem cell. In some embodiments, the stem cells are hematopoietic stem cells, umbilical cord blood stem cells, or peripheral blood stem cells. In some embodiments, the mammalian cell is a myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte, or retinal cell. Other aspects of the invention relate to cells obtainable by any of the methods described herein.

Another aspect of the invention relates to a method for editing a target locus of a mammalian genome, wherein the method comprises: (a) obtaining mammalian cells from a mammal; (b) culturing the mammalian cell ex vivo to form an ex vivo culture; (c) transducing the mammalian cell with an adeno-associated virus (AAV) as described herein in the ex vivo culture to form a transduced mammalian cell; and (d) administering the transduced mammalian cells to the mammal.

In other aspects, the invention provides a method for editing a target locus of a mammalian genome, wherein the method comprises: (a) obtaining mammalian cells from a first mammal; (b) culturing the mammalian cell ex vivo to form an ex vivo culture; (c) transducing the mammalian cell with an adeno-associated virus (AAV) as described herein in the ex vivo culture to form a transduced mammalian cell; and (d) administering the transduced mammalian cell to a second mammal. In some embodiments, the first mammal and the second mammal are of the same species. In some embodiments, the mammalian cell is from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, and epithelial tissue. In some embodiments, the mammalian cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage. In some embodiments, the mammalian cell is a stem cell. In some embodiments, the stem cells are hematopoietic stem cells, umbilical cord blood stem cells, or peripheral blood stem cells. In some embodiments, the mammalian cell is a CD34+ cell. In some embodiments, the mammalian cell is a myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte, or retinal cell.

Another aspect of the invention provides a method for editing a target locus of a genome of a mammal, wherein the method comprises administering to the mammal an AAV as described herein or a composition as described herein in an amount effective to transduce a mammalian cell in vivo with the AAV.

In some embodiments of any of the provided methods, the AAV is transduced or administered without co-transducing or co-administering an exogenous nuclease or a nucleotide sequence encoding an exogenous nuclease.

In some embodiments of any of the provided methods, the AAV has a chromosomal integration efficiency for integrating an editing element into a target locus of a mammalian chromosome of at least about 1%. In some embodiments, the efficiency of chromosomal integration of an AAV for integrating the editing element into a target locus of a mammalian chromosome is at least about 2%, 3%, 4%, or 5%. In some embodiments, the genome-corrected editing elements are integrated into the target locus of the mammalian chromosome with a chromosomal integration efficiency of at least 10%, 20%, 40%, or 50% in the mammalian cell. In some embodiments, the genome-corrected editing elements are integrated into the target locus of the mammalian chromosome with a chromosomal integration efficiency in a range of 10% to 70%, 20% to 70%, 40% to 70%, or 50% to 70% in the mammalian cell.

In some embodiments of any of the provided methods, another characteristic of the chromosomal integration efficiency of the AAV is that the allele in the population of cells occurs at a frequency of at least about 10% for an allele comprising an editing element integrated into a target locus of a mammalian chromosome. In some embodiments, another characteristic of the chromosomal integration efficiency of the AAV is that the allele in the population of cells occurs at a frequency of at least about 50% for an allele comprising an editing element integrated into a target locus of a mammalian chromosome. In some embodiments, another characteristic of the chromosomal integration efficiency of an AAV is that the allele in the population of cells occurs at a frequency of at least about 75% for an allele comprising an editing element integrated into a target locus of a mammalian chromosome. In some embodiments, the frequency of allele occurrence in the population of cells is the frequency of allele occurrence in the population of cells in vitro.

Other aspects of the invention relate to a method for producing a transgenic non-human animal, the method comprising administering to a non-human animal an AAV as described herein or a composition as described herein; or transducing a non-human animal cell with an AAV as described herein or a composition as described herein, and implanting the cell into a host non-human animal under conditions sufficient to produce a transgenic non-human animal from the host non-human animal (e.g., by causing the implanted cell to form or become part of an embryo which then develops into a transgenic non-human animal in the host). In some embodiments, the transgenic non-human animal is crossed with another non-human animal to produce other transgenic non-human animals. In some embodiments, the non-human animal cell is derived from a zygote or an embryo of a non-human animal. In some embodiments, the non-human animal is a mouse, rat, rabbit, pig, cow, sheep, goat, chicken, cat, dog, ferret, or primate.

Other aspects of the invention relate to a transgenic non-human animal obtainable by a method described herein, such as the method described above. In some embodiments, the transgenic non-human animal is a mouse, rat, rabbit, pig, cow, sheep, goat, chicken, cat, dog, ferret, or primate.

Yet other aspects of the invention relate to tissues derived from transgenic non-human animals as described herein. In some embodiments, the organization is selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue. In some embodiments, the tissue is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage.

Other aspects of the invention relate to a cell derived from a transgenic non-human animal as described herein. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a CD34+ cell, myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte, or retinal cell. In some embodiments, the cell is an Induced Pluripotent Stem (iPS) cell. In some embodiments, the cells are from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue. In some embodiments, the cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage. In some embodiments, the cell is a stem cell. In some embodiments, the stem cells are hematopoietic stem cells, umbilical cord blood stem cells, or peripheral blood stem cells.

According to certain embodiments, an adeno-associated virus (AAV) clade F vector (e.g., a replication-defective AAV comprising a correction genome encapsulated in a clade F capsid) or an AAV vector variant (e.g., a replication-defective AAV comprising a capsid variant relative to an AAV9 capsid) is provided for editing the genome of a cell. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or one or more capsid variants (relative to AAV9 capsids), an editing element (also referred to herein as a targeting cassette) comprising one or more therapeutic nucleotide sequences to be integrated into a target locus (also referred to herein as a target site) of a genome, a 5 'homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region located upstream of the target locus (target site), and a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region located downstream of the target locus (target site). The editing element (targeting cassette) may be contained within a calibration genome as described herein, which comprises Inverted Terminal Repeats (ITRs) as described herein. In certain embodiments, the one or more clade F capsid or capsid variants can be any of the clade F capsids or capsid variants described herein. In certain embodiments, one or more clade F capsids or capsid variants may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or one or more capsid variants may comprise a polypeptide sequence selected from the group consisting of: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of seq id no: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of seq id no: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, the target locus (target site) can be a safe harbor (safe harbor) site. In certain embodiments, the safe harbor site can be the AAVS1 locus on chromosome 19. In certain embodiments, a target locus (target site) can be a locus associated with a disease condition as described herein. In certain embodiments, the cell may be a stem cell. In certain embodiments, the stem cell can be a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell.

According to certain embodiments, methods of editing a genome of a cell are provided. In certain embodiments, the method of editing the genome of a cell may comprise transducing the cell with one or more AAV clade F vectors (e.g., a replication defective AAV comprising a correction genome encapsulated in a clade F capsid) or AAV vector variants (e.g., a replication defective AAV comprising a capsid variant relative to an AAV9 capsid) as described herein. In certain embodiments, transduction can be performed in the absence of other exogenous nucleases. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants (relative to AAV9 capsids), an editing element (targeting cassette) comprising one or more therapeutic nucleotide sequences to be integrated into a target locus (target site) of a genome, a 5 'homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region upstream of the target locus (target site), and a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region downstream of the target locus (target site). Editing elements (targeting cassettes) can be contained within a calibration genome as described herein comprising ITRs as described herein. In certain embodiments, one or more clade F capsids or capsid variants may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of seq id no: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of seq id no: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, the AAV clade F vector or AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences. In certain embodiments, the target locus (target site) may be a safe harbor site. In certain embodiments, the safe harbor site can be the AAVS1 locus on chromosome 19. In certain embodiments, a target locus (target site) can be a locus associated with a disease condition as described herein. In certain embodiments, the cell may be a stem cell. In certain embodiments, the stem cell can be a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell.

According to certain embodiments, there is provided a method of treating a disease or disorder in an individual by editing the individual's cellular genome. In certain embodiments, a method of treating a disease or disorder in an individual by editing the individual's cellular genome comprises the steps of: transducing the cells of the subject with an AAV clade F vector or AAV vector variant as described herein and transplanting the transduced cells into the subject, wherein the transduced cells treat the disease or disorder. In certain embodiments, transduction of the cell can be performed in the absence of other exogenous nucleases. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants (relative to AAV9 capsids), an editing element (targeting cassette) comprising one or more therapeutic nucleotide sequences to be integrated into a target locus (target site) of a genome, a 5 'homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region upstream of the target locus (target site), and a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region downstream of the target locus (target site). Editing elements (targeting cassettes) can be contained within a calibration genome as described herein comprising ITRs as described herein. In certain embodiments, the clade F capsid or capsid variant may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of seq id no: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of seq id no: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), AAVF9(SEQ ID NO:10), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, the AAV clade F vector or AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences. In certain embodiments, the target locus (target site) may be a safe harbor site. In certain embodiments, the safe harbor site can be the AAVS1 locus on chromosome 19. In certain embodiments, a target locus (target site) can be a locus associated with a disease condition as described herein. In certain embodiments, the cell may be a stem cell. In certain embodiments, the stem cell can be a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell. In certain embodiments, the disease or disorder may be caused by one or more mutations in the genome of the cell. In certain embodiments, the disease or disorder may be selected from inherited metabolic diseases, lysosomal storage diseases, mucopolysaccharidosis, immunodeficiency diseases, and hemoglobinopathies and infections.

Also disclosed herein are methods of treating a disease or disorder in an individual by in vivo genome editing by direct administration of an AAV clade F vector or AAV vector variant as described herein to the individual. In certain embodiments, methods of treating a disease or disorder in a subject by in vivo genome editing of cells of the subject by administering an AAV clade F vector or AAV vector variant directly to the subject are disclosed. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants (relative to AAV9 capsids), an editing element (targeting cassette) comprising one or more therapeutic nucleotide sequences to be integrated into a target locus (target site) of a genome, a 5 'homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region upstream of the target locus (target site), and a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region downstream of the target locus (target site), wherein the vector transduces cells of an individual and integrates the one or more therapeutic nucleotide sequences into the genome of the cells. Editing elements (targeting cassettes) can be contained within a calibration genome as described herein comprising ITRs as described herein. In certain embodiments, one or more clade F capsids or capsid variants may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF1(SEQ ID NO:2), AAVF2(SEQ ID NO:3), AAVF11(SEQ ID NO:4), AAVF3(SEQ ID NO:5), AAVF4(SEQ ID NO:6), AAVF6(SEQ ID NO:7), AAVF7(SEQ ID NO:8), AAVF8(SEQ ID NO:9), AAVF9(SEQ ID NO:10), AAVF5(SEQ ID NO:11), AAVF12(SEQ ID NO:12), AA 17(SEQ ID NO:13), AAVF13(SEQ ID NO:14), AAVF14(SEQ ID NO:15), AAVF15(SEQ ID NO:16), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, the AAV clade F vector or AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences. In certain embodiments, the target locus (target site) may be a safe harbor site. In certain embodiments, the safe harbor site can be the AAVS1 locus on chromosome 19. In certain embodiments, a target locus (target site) can be a locus associated with a disease condition as described herein. In certain embodiments, the cell may be a stem cell. In certain embodiments, the stem cell can be a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell. In certain embodiments, the disease or disorder may be caused by one or more mutations in the genome of the cell. In certain embodiments, the disease or disorder may be selected from inherited metabolic diseases, lysosomal storage diseases, mucopolysaccharidosis, immunodeficiency diseases, and hemoglobinopathies and infections. Also disclosed herein are kits comprising one or more AAV clade F vectors or AAV vector variants for editing the genome of a cell.

Drawings

The present application contains drawings in the form of at least one color drawing. Copies of this application with color drawings will be provided by the patent office upon request and payment of the necessary fee.

Figure 1 shows clade F AAV capsid variant polypeptide sequences aligned with AAV 9. A corresponding alignment of clade F AAV capsid variant polynucleotide sequences is provided in figure 1 of U.S. patent publication No. US20130096182a 1.

Figure 2 is a graph listing some of the nucleotide mutations in the capsid for each sequence, including base changes, amino acid changes, and whether they are in VP1 or VP 3.

FIG. 3 shows a schematic of a portion of a set of donor ITR-AAVS1-FP vector constructs for genome editing. AAV vectors contain 5 'and 3' homology arms, as well as regulatory elements including 2A sequences, splice acceptor sequences, and polyadenylation sequences. Yellow fluorescent protein ("YFP" or "FP") was used as a transgene. The AAV2 ITRs flank the homology arms, and the vector genome is packaged in an AAVF capsid to form an AAVF-AAVs1-FP donor vector. Importantly, the vector containing the FP gene does not contain a promoter to drive expression. The FP gene is only expressed if it is correctly integrated into AAVS1 located downstream of the endogenous chromosomal promoter.

Fig. 4 shows a schematic map of the target chromosomal AAVS1 locus and the edited AAVS1 locus, which is the target site for transgene integration mediated by an AAVF vector. The top schematic (fig. 4A) "wild type AAVS1 locus" shows a wild type AAVS1 locus containing a 5 'homology arm and a 3' homology arm but not containing a transgene. Amplification with primers located outside the homologous regions using the "outer forward primer region" primer and the "outer reverse primer region" primer produced a fragment of approximately 1.9kb in length (see line labeled "fragment 1"), indicating a fragment that did not contain an integrated transgene. Bottom schematic (fig. 4B) "edited AAVS1 locus" shows an edited AAVS1 locus containing a 5 'homology arm, a regulatory element, an integrated transgene, and a 3' homology arm. Amplification with primers located outside the homologous regions using the "outer forward primer region" primer and the "outer reverse primer region" primer produced a fragment of approximately 3.0kb in length (see line labeled "fragment 2"), which indicates a fragment containing the transgene. Amplification of the 5 'junction region (at the junction between the 5' homology arm and the transgene) using the "outer forward primer region" primer and the "inner reverse primer" produced a fragment of approximately 1.7kb in length (see line labeled "fragment 3"). Amplification of the 3 'junction region (at the junction between the transgene and the 3' homology arm) using the "outer reverse primer region" primer and the "inner forward primer" produced a fragment of approximately 1.2kb in length (see line labeled "fragment 4"). If the transgene is not integrated, then there is no product obtained when the 5 'junction or the 3' junction is amplified.

Figure 5 shows representative scatter plots from flow cytometric analysis of YFP expression in K562 cells at 24 hours after transduction. Cells were transduced with the AAVF7 FP vector at multiple multiplicity of infection (MOI), (A) cells not transduced with any vector (not transduced), (B)50,000MOI, (C)100,000MOI, (D)200,000MOI, and (E)400,000 MOI. Data from representative samples are presented. Events above the border within each scatter plot represent cells expressing FP, indicating that in these cells, the promoterless FP gene from the donor ITR-AAVS1-FP vector is properly integrated into AAVS1 located downstream of the endogenous chromosomal promoter in human chromosome 19.

Figure 6 shows representative scatter plots from flow cytometric analysis of YFP expression in K562 cells at 72 hours after transduction. Cells were transduced with the AAVF7 FP vector at multiple multiplicity of infection (MOI), (A) cells not transduced with any vector (not transduced), (B)50,000MOI, (C)100,000MOI, (D)200,000MOI, and (E)400,000 MOI. Events above the boundary indicate cells in which the promoterless FP gene in the donor ITR-AAVS1-FP vector correctly targeted integration.

Figure 7 shows the average YFP expression percentage after targeted integration of the promoterless YFP transgene in the AAVS1 locus in CD34+ K562 leukemia cells. (A) Is shown in cells with AAVF7 vector at 50,000; 100,000; 150,000; 200,000; 300,000; and bar graphs of YFP expression at 24 hours post-MOI transduction at 400,000. (B) Is shown in cells with AAVF7 vector at 50,000; 100,000; 150,000; 200,000; and bar graph of YFP expression 72 hours after MOI transduction at 400,000. Each bar represents data compiled from up to 7 samples.

Fig. 8 shows PCR confirmed YFP transgene targeted integration into the AAVS1 locus in K562 cells. A) Gels displaying amplified DNA from representative samples of K562 cells without template, untransduced, or transduced with the AAVF7 FP vector at an MOI of 100,000. Ink ribbon 1: DNA ladder, band 2: no template control, color band 3: untransduced control, and color band 4: AAVF7 FP-transduced K562. Arrows point to an FP-integrated AAVS1 fragment of about 3.1kb or a non-integrated AAVS1 fragment of about 1.9 kb. B) Gels displaying amplified DNA from representative samples of K562 cells without template, untransduced, or transduced with the AAVF7 FP vector at an MOI of 100,000. Ink ribbon 1: DNA ladder, band 2: no template control, color band 3: untransduced control, color band 4: AAVF7 FP-transduced K562. Arrows point to either an amplified FP-integrated AAVS1 fragment of about 3.1kb or an amplified non-integrated AAVS1 fragment of about 1.9 kb.

Fig. 9 shows representative scatter plots of YFP expression after targeted integration in primary CD34+ cells at 1 day post transduction with the AAVF FP vector. (A) Cells not transduced with any vector (untransduced), (B) cells transduced with the AAVF7 FP vector, and (C) cells transduced with the AAVF17 FP vector. Cells transduced with either the AAVF7 or AAVF17 vectors exhibited substantial YFP expression (compare B and C to a, respectively) compared to untransduced cells. (b) YFP expression in (a) and (c) indicates that the promoterless FP gene delivered by the AAVF vector is precisely integrated into the chromosomal AAVS1 locus.

Fig. 10 shows representative scatter plots of YFP expression after targeted integration in primary CD34+ cells at 4 days post transduction with the AAVF FP vector. (A) Cells not transduced with any vector (untransduced), (B) cells transduced with the AAVF7 FP vector, and (C) cells transduced with the AAVF17 FP vector. Cells transduced with either the AAVF7 or AAVF17 FP vectors exhibited substantial YFP expression (compare B and C to a, respectively) compared to untransduced cells, indicating precise targeted integration of the gene delivered by the AAVF vector.

Fig. 11 shows representative scatter plots of YFP expression after targeted integration in primary CD34+ cells at 18 days post transduction with the AAVF FP vector. (A) Cells not transduced with any vector (untransduced), (B) cells transduced with the AAVF7 FP vector, and (C) cells transduced with the AAVF17 FP vector. Cells transduced with either the AAVF7 or AAVF17 FP vectors exhibited substantial YFP expression (compare B and C to a, respectively) compared to untransduced cells.

Fig. 12 shows YFP expression after targeted integration in primary CD34+ cells. (A) Tables showing the percentage of YFP-positive cells at 4, 18, 20, and 39 days post-transduction for untransduced cells and cells transduced with either the AAVF7 FP vector or the AAVF17 FP vector. (B) Line graphs showing the frequency of appearance of YFP-expressing primary CD34+ cells at 4, 18, 20, and 39 days after AAVF FP transduction at an MOI of 100,000. The line with diamonds represents untransduced cells, the line with squares represents cells transduced with the AAVF7 FP vector, and the line with triangles represents cells transduced with the AAVF17 FP vector.

Fig. 13 shows PCR confirmed targeted integration into the AAVS1 locus in primary CD34+ cells. Gels displaying amplified DNA from representative samples of primary CD34+ cells without template, untransduced, or transduced with AAVF7 FP vector at an MOI of 150,000. Ink ribbon 1: DNA ladder, band 2: no template control, color band 3: untransduced control, color band 4: DNA marker, and color band 5: AAVF7 FP vector transduced. Arrows point to the FP-integrated AAVS1 (about 1.7kb fragment) displaying the 5' junction region amplification product. The insert on the left shows the DNA ladder loaded in color bar 1.

Figure 14 shows that the sequence starting at the outer forward primer region confirms targeted integration of the YFP gene sequence into the AAVS1 locus. The sequencing results indicated that the YFP gene was present and correctly integrated into the AAVS1 locus.

Figure 15 shows that the sequence starting near the 5' homology arm confirms targeted integration of the YFP sequence into the AAVS1 locus. The sequencing results indicated that the YFP gene was present and integrated into the AAVS1 locus.

Figure 16 shows that the sequence starting near the 5' region of the regulatory element confirms targeted integration of the YFP sequence into the AAVS1 locus. The sequencing results indicated that the YFP gene was present and integrated into the AAVS1 locus.

Figure 17 shows that the sequence starting near the 3' region of the regulatory element confirms targeted integration of the YFP sequence into the AAVS1 locus. The sequencing results indicated that the YFP gene was present and integrated into the AAVS1 locus.

Figure 18 shows that the sequence starting near the 5' region of the transgene confirms targeted integration of the YFP sequence into the AAVS1 locus. The sequencing results indicated that the YFP gene was present and integrated into the AAVS1 locus.

Figure 19 shows that the sequence starting near the "inner reverse primer" region confirms targeted integration of the YFP sequence into the AAVS1 locus. The sequencing results indicated that the YFP gene was present and integrated into the AAVS1 locus.

Fig. 20 shows a schematic of the steps performed in the experiment in example 4. One million human cord blood CD34+ cells were obtained (see step 1) and injected into sub-lethal dose irradiated immunodeficient NOD/SCID adult mice (see step 2). At two hours after injection with CD34+ cells, mice were injected with AAVF-luciferase vector (i.e., AAVF 7-luciferase vector or AAVF 17-luciferase vector). Two to seven days later, mice were injected with AAVF-Venus vector (i.e., AAVF7-Venus vector or AAVF17-Venus vector) (see step 3). Finally, luciferase expression in vivo was measured at 4 weeks post-injection and Venus expression was quantified at 6 weeks post-injection (see step 4).

Figure 21 shows in vivo specific luciferase expression in representative recipients. Fig. 21A shows that immunodeficient adult mice previously xenografted with human cord blood CD34+ HSCs receiving intravenous injection of AAVF-luciferase vector show specific luciferase expression in the spine, spleen, hip, and long bones, all of which are sites of hematopoiesis after transplantation. Arrows indicate luciferase expression in spine, spleen, liver, hip and long bone. The flux for the liver and spleen was 4.08e9, and the flux for the tail was 1.74e 9. Figure 21B shows that immunodeficient adult mice receiving intravenous injection of AAVF-luciferase vector that had not previously been xenografted with human cord blood CD34+ HSCs did not show high levels of specific luciferase expression. The flux for the liver and spleen was 1.47e8, and the flux for the tail was 2.22e 8.

Figure 22 shows a histogram showing flow cytometry data for Venus-expressing human CD34+ or CD45+ cells in immunodeficient adult mice previously xenografted with human cord blood CD34+ HSCs that received AAVF7-Venus or AAVF17-Venus vector intravenous injections. Figure 22A shows flow cytometry data for femoral CD34+ cells from xenograft mice injected with AAVF7-Venus vector. 9.23% of the implanted human hematopoietic cells expressed Venus. Figure 22B shows flow cytometry data for femoral CD45+ cells from xenograft mice injected with AAVF7-Venus vector. 8.35% of the implanted human hematopoietic cells expressed Venus. Figure 22A shows flow cytometry data for femoral CD34+ cells from xenograft mice injected with AAVF17-Venus vector. 8.92% of the implanted human hematopoietic cells expressed Venus. Figure 22D shows flow cytometry data for femoral CD45+ cells from xenograft mice injected with AAVF17-Venus vector. 8.59% of the implanted human hematopoietic cells expressed Venus. Figure 22E shows flow cytometry data for vertebral CD45+ cells from xenograft mice injected with AAVF7-Venus vector. 15.3% of the implanted human hematopoietic cells expressed Venus. Figure 22F shows flow cytometry data for vertebral CD45+ cells from xenograft mice injected with AAVF17-Venus vector. 70.2% of the implanted human hematopoietic cells expressed Venus. Figure 22G shows flow cytometry data for splenic CD45+ cells from xenografted mice injected with AAVF7-Venus vector. 10.3% of the implanted human hematopoietic cells expressed Venus. Figure 22H shows flow cytometry data for splenic CD45+ cells from xenografted mice injected with AAVF17-Venus vector. 9.90% of the implanted human hematopoietic cells expressed Venus. The results from fig. 22 are also provided in table 5.

FIG. 23 shows phylogenetic profiles (phylogens) of AAV clade F viruses relative to each other and other AAV strains. The phylogenetic profile was based on nucleotide sequence homology of the AAVF viral capsid genes (Smith et al, Mol Ther.) 2014 9; 22(9): 1625-34).

Figure 24 shows a map of a single stranded AAV vector genome for insertion of a larger DNA insert. The single-stranded AAV2 genome contains AAV2 ITRs, homology arms, regulatory sequences, and a promoterless Venus Open Reading Frame (ORF). Venus is a fluorescent reporter protein. Promoterless Venus containing the Venus ORF is located downstream of the splice acceptor and 2A sequence. The Venus ORF is followed by a polyadenylation signal. Each homology arm is 800bp long and targets intron 1 of the PPP1R12C gene on chromosome 19

Fig. 25 shows a schematic diagram of insertion sites for the editing portion in AAVS 1. The transgene cassette consists of a Venus open reading frame, and the splice acceptor site followed by the 2A sequence is flanked on either side by homology arms. The homology arm is complementary to intron 1 of the human PPP1R12C gene in the AAVS1 locus on chromosome 19 and mediates insertion of Venus into a site between the two homology arms.

Fig. 26A-F show targeted genomic insertion of larger protein coding sequences into human cell lines by recombinant AAVF vectors, and demonstrate that AAVF-mediated genome editing is robust and highly efficient editing of primary cells is present in human CD34+ cells and cell lines. FIG. 26A: CD34+ represents primary human CD34+ cytokine primed peripheral blood stem cells. FIG. 26B: k562 is a human CD34+ erythroleukemia cell line. FIG. 26C: HepG2 is a human liver cell line. The percentage of cells showing Venus expression (indicating precise insertion) is shown for figures 26A-C. Figure 26D shows a representative flow profile, which shows a different population of Venus-expressing CD34+ cells after transduction with recombinant AAVF virus compared to untransduced cells. Figure 26E shows editing activity in the K562 erythroleukemia lineage of AAVF7, AAVF12, AAVF15, AAVF17 and AAV9 compared to AAV6 and AAV 8. Figure 26F shows the editing activity of the same virus in the liver cell line HepG 2. Data presentation shows the percentage of cells edited and Venus expression.

Figure 27 shows a targeted integration assay for detecting larger and smaller inserts inserted into the AAVS1 locus on human chromosome 19. The position of the primers is shown schematically. The 5' primer is complementary to the chromosomal sequence. The 3' primer is specific for the insert. The specific amplicon was predicted to be 1.7kb for the larger insert and 1kb for the smaller insert. The split primer pair (chromosome and insert specificity) makes targeted integration analysis specific.

FIGS. 28A-E show that AAVF vectors mediate nucleotide substitutions at specified genomic sites. Figure 28A shows a single-stranded AAV vector genomic map for insertion of a 10bp insert into intron 1 of the human PPP1R12C gene. This vector encodes the wild-type left homology arm (HA-L) containing the Nhe1 restriction enzyme recognition site (GCTAGC). The NS mut vector is designed to change the TA sequence in the left homology arm on chromosome 19 to AT. This change caused the conversion of the Nhe1 site to the Sph1 site, changing the sequence from GCTAGC to GCATGC. FIG. 28B shows that the left homology arm was amplified using a forward primer located upstream of the chromosomal sequence and a reverse primer located in a 10bp insert in intron 1 of the PPP1R12C gene on chromosome 19. The upper schematic indicates the relative sizes of the expected fragments produced when editing genomic DNA from K562 cells using wild type or NS Mut AAVF vectors. Fig. 28C is a gel displaying the actual amplicons derived from genomic DNA of K562 cells edited with wild type AAVF vector. The color bands show uncleaved amplicon (Un), amplicon cleaved with Nhe1 (Nhe1), and cleaved with Sph1 (Sph 1). Figure 28D shows gel electrophoresis of K562 DNA after editing with AAVF7 or AAVF17 vectors encoding wild type or NS Mut genomes. Fig. 28E shows gel electrophoresis of the hepatocellular carcinoma cell line HepG2 after editing with AAVF7 or AAVF17 vectors encoding wild-type or NS Mut genomes.

Figure 29 shows sequence analysis of DNA from cells edited with AAVF7 and AAVF17 wild-type or NS Mut vectors.

Figure 30 is a table showing that AAVF vector mediates editing in dividing and non-dividing cells and that AAVF-mediated gene editing does not require DNA synthesis. The graph shows the frequency of edited Venus-expressing cells in both dividing and non-dividing subsets of primary human CD34+ cells. The percentage of all CD34+ cells that were Venus positive and BrdU positive or negative was determined by flow cytometry. BrdU positive cells divide cells, and BrdU negative cells represent non-dividing cells.

Fig. 31A-C show the efficient editing of implanted human hematopoietic stem cells in vivo by a systemically delivered AAVF vector. Fig. 31A shows a diagram of the experimental design. Immunodeficient NOD/SCID mice were implanted with human cord blood CD34+ hematopoietic stem cells. Cells were allowed to engraft for 7 weeks prior to intravenous injection of AAVF 17-Venus. Hematopoietic cells were harvested from the vertebrae and femoral bone marrow and spleen of xenografted mice at 12.5 weeks after AAVF injection. Cells were analyzed by multicolor flow cytometry for Venus expression and the presence of human specific surface markers. In particular, Venus expression was analyzed in primitive CD34+ human hematopoietic stem/progenitor cells, CD45+ human differentiated mononuclear hematopoietic cells and glycophorin a + cells of the erythroid lineage. Figure 31B shows a schematic of the differentiation pathway of the human erythroid lineage from CD34+ progenitor cells to glycophorin a + erythrocytes. Figure 31C shows the flow cytometric profile of long-term engrafted human cells in bone marrow and spleen cells of xenografted mice at 20 weeks after transplantation. Cells were analyzed for expression of both Venus (editing marker) as well as specific human cell surface markers.

Figures 32A and B are an overview of in vivo data following intravenous injection of an AAVF vector into immunodeficient mice xenografted with human cord blood CD34+ hematopoietic stem/progenitor cells. Venus expression reflects the targeted insertion of the promoterless Venus cassette into intron 1 of the human PPP1R12C gene in human hematopoietic stem cells and progeny thereof implanted in vivo. Fig. 32B is an overview of the data in fig. 32A. Figures 32A and B show that editing is long-term, that editing is stably inherited (inserts are efficiently expressed in differentiated progeny cells), that editing in vivo is much more efficient than ex vivo transduction followed by transplantation, and that progeny of edited CD34+ cells retain Venus expression long-term.

FIG. 33 shows sequence analysis of promoterless SA/2A venus ORF targeted chromosomal insertions into K562 erythroleukemia cell lines, primary human cytokine primed peripheral blood CD34+ cells (PBSC), and HepG2 human liver cell lines. The site-specific integrated sequences are amplified using chromosome-specific primers and insert-specific primers. The amplified product was cloned into a TOPO-TA vector and sequenced using Sanger sequencing (Sanger sequencing).

FIG. 34 sequence analysis of 10bp insert targeted chromosomal insertion into primary human cytokine primed peripheral blood CD34+ cells and HepG2 human liver cell line. The site-specific integrated sequences are amplified using chromosome-specific primers and insert-specific primers. The amplified product was cloned into TOPO-TA vector and sequenced using Sanger sequencing.

Figure 35 shows the integration of AAVF-targeted smaller inserts into AAVS1-CD34+ cells.

FIG. 36 shows AAV targeting promoterless Venus and RFLP in HepG2 (liver cancer) cell line.

Fig. 37 shows a representative femoral myelocytometry plot showing the sorted total population, back gating of CD34 and glycoA-positive cells to Venus-positive and Venus-negative populations, CD 34/glycoA-positive cells in the Venus-negative population, and glycoA-positive and CD 34-positive populations.

Fig. 38 shows a representative spleen flow cytometry plot showing the sorted total population, back gating of CD34 and glycoA-positive cells to Venus-positive and Venus-negative populations, CD 34/glycoA-positive cells in Venus-negative populations, and glycoA-positive and CD 34-positive populations.

Figure 39 shows maps of CBA-mCherry and AAS1-Venus vector genomes used to determine relative transduction versus editing efficiency for AAV vectors.

Figures 40A and 40B show flow cytometry profiles of mCherry (figure 40A) and Venus (figure 40B) in human CD34+ cord blood cells. Figure 40C shows quantification of mCherry and Venus expression in CD34+ cells at 48 hours after transduction. FIG. 40D shows a comparison of relative expression of Venus and mCherry (edit ratio). The bars indicate the ratio of the proportion of cells expressing Venus as the ratio of those cells expressing mCherry with the corresponding capsid. The black horizontal bars indicate a ratio of 1, which would indicate equal Venus: mCherry expression efficiency.

Detailed Description

Certain embodiments of the invention are described in detail using specific examples, sequences and drawings. The enumerated embodiments are not intended to limit the present invention to those embodiments, as the present invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the present invention as defined by the claims. Those skilled in the art will recognize methods and materials similar or equivalent to those described herein, which can be used in the practice of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and/or patents are incorporated by reference as if fully set forth herein.

Provided herein are adeno-associated virus (AAV) clade F vectors (e.g., replication-defective AAV comprising a correction genome encapsulated in a clade F capsid) or AAV vector variants (e.g., replication-defective AAV comprising a capsid variant relative to an AAV9 capsid) and related methods developed for the precise editing of a cellular genome using homologous recombination without the need for the addition of exogenous nucleases. In certain embodiments, genome editing can include, but is not limited to, introducing an insertion, deletion, alteration, point mutation, or any combination thereof into a genomic sequence of a cell (e.g., a locus of interest of a mammalian chromosome). In certain embodiments, the AAV clade F vectors or AAV vector variants provided herein and related methods thereof can be used to insert one or more nucleotide sequences into a specific location in the genome of a cell without the need for addition of an exogenous nuclease prior to integration of the one or more nucleotide sequences. In certain embodiments, clade F vector or AAV vector variants provided herein and related methods thereof can be used to insert an internucleotide linkage into a specific location in the genome of a cell without the need for addition of an exogenous nuclease prior to integration of the internucleotide linkage. Also provided in certain embodiments are methods of treating a disease or disorder in an individual by editing the individual's cellular genome ex vivo via the steps of: transducing the cells with a clade F vector or AAV vector variant as described herein and further transplanting the transduced cells into the subject to treat the disease or disorder in the subject. Also provided herein are methods of treating a disease or disorder in an individual by in vivo genome editing by direct administration of a clade F vector or AAV vector variant as described herein to the individual. Also provided herein are kits for genome editing a cell comprising one or more of the clade F vector or AAV vector variants described herein.

Homologous recombination using various AAV vectors (e.g., AAV2, AAV6, and AAV8) has been previously reported; however, the reported efficiencies are extremely low, approximately 1 in one million cells. As shown in examples 1 and 2 below, AAV clade F vectors (or AAV vector variants) were used to reproducibly target gene insertions into designated chromosomal locations with significantly greater frequency than previously seen. For example, targeted genome editing is achieved by: transducing primary cells with an AAV clade F vector (or AAV vector variant) to cause insertion of a transgene into the genome of said primary cells with an unexpectedly high frequency of occurrence, wherein approximately 10% of the primary cells exhibit transgene insertion six weeks after transduction. The efficiency of this frequency of occurrence is 1,000 to 100,000 times that previously reported (see, e.g., Khan, 2011). As shown in examples 1 and 2 below, high level genome editing was achieved using primary human CD34+ hematopoietic stem cells (K562) and CD34+ primary peripheral blood-derived human hematopoietic stem cells (PBSC). Targeted gene insertion was observed in both short-term (one day) and long-term (up to almost six weeks) CD34+ cultures and was confirmed by transgene expression and sequence analysis. Furthermore, targeted recombination of clade F vectors or AAV vector variants as described herein allows for specific genomic engineering without associated toxicity. As shown in example 3 below, intravenous injection of AAV vectors pseudotyped with AAVF7 or AAVF17 resulted in the transduction of human CD34+ hematopoietic stem and progenitor cells in vivo. As shown in example 4 below, genome editing was achieved for both small (about 10bps) and large insertions (about 800bps) in cell culture and in vivo, and demonstrated by sequencing to integrate precisely into the target locus. As shown in example 5 below, genome editing of various human cell lines (e.g., fibroblasts, hepatocellular carcinoma cells, breast cancer cells, retinoblastoma cells, leukemia cells, and B cells) was achieved, revealing that the clade F vector can be used to edit the genomes of several different cell type species, such as fibroblasts, hepatocytes, breast cells, retinal cells, and B cells. Thus, this technology has great potential for targeted genome editing in cells ex vivo as well as in specific organs in vivo.

Provided herein are clade F vectors (e.g., replication-defective AAV comprising a correction genome encapsulated in a clade F capsid) or AAV vector variants (e.g., replication-defective AAV comprising a capsid variant relative to an AAV9 capsid) and methods thereof (via recombination, and preferably without the use of exogenous nucleases) for editing the genome of a cell. In certain embodiments, genome editing may include, but is not limited to, correcting or inserting one or more mutations in the genome, deleting one or more nucleotides in the genome, altering the genome sequence including regulatory sequences, inserting one or more nucleotides including a transgene at a safe harbor site or other specific location in the genome, or any combination thereof. In certain embodiments, genome editing and methods thereof using clade F vectors or AAV vector variants as described herein can induce precise changes in one or more genomic sequences without insertion of exogenous viral sequences or other footprints.

In some aspects, the invention provides a replication-defective adeno-associated virus (AAV) comprising a correction genome encapsulated in a capsid as described herein (e.g., an AAV clade F capsid). In some embodiments, a "calibration genome" is a genome that contains editing elements as described herein and other elements sufficient for encapsidation within a capsid as described herein (e.g., a 5 'inverted terminal repeat (5' ITR) nucleotide sequence or fragment thereof, and a 3 'inverted terminal repeat (3' ITR) nucleotide sequence or fragment thereof). It is to be understood that the term "calibration genome" does not necessarily require that editing elements contained within the calibration genome will "calibrate" a locus of interest upon integration into the locus of interest in the genome (e.g., by calibrating a locus of interest containing a mutation by replacing it with a wild-type sequence). Thus, in some embodiments, the calibration genome can contain editing elements that can comprise nucleotide sequences that are added to the target locus (e.g., the target locus is 3' of a first open reading frame, and the editing elements are a second open reading frame that, when integrated into the target locus, will form a gene encoding a fusion protein).

In some embodiments, a replication-defective adeno-associated virus (AAV) comprises a correction genome comprising (a) an editing element selected from an internucleotide linkage or a nucleotide sequence for integration into a target locus of a mammalian chromosome, (b) a 5 'homology arm nucleotide sequence located 5' of the editing element, the nucleotide sequence having homology to a 5 'region in the mammalian chromosome relative to the target locus, and (c) a 3' homology arm nucleotide sequence located 3 'of the editing element, the nucleotide sequence having homology to a 3' region in the mammalian chromosome relative to the target locus. In some embodiments, the replication-defective AAV comprises a correction genome comprising an editing element nucleotide sequence for integration into a target locus of a mammalian chromosome, the correction genome being substantially absent of a promoter operably linked to the editing element nucleotide sequence. In some embodiments, the replication-defective AAV comprises a correction genome comprising an editing element selected from an internucleotide linkage or a nucleotide sequence for integration into a target locus of a mammalian chromosome in a cell; the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome in the cell of at least about 1% (e.g., at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%). In some embodiments, the replication-defective AAV comprises a correction genome comprising an editing element selected from an internucleotide linkage or a nucleotide sequence for integration into a target locus of a mammalian chromosome in a cell; the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome in the cell in the absence of an exogenous nuclease of at least about 1% (e.g., at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%). In some embodiments of any of the calibration genomes, the calibration genome is substantially absent of a promoter operably linked to an editing element nucleotide sequence. In some embodiments of any of the calibration genomes, the calibration genome further comprises an exogenous promoter operably linked to the editing element. In some embodiments of any of the replication defective AAV, the AAV has a chromosomal integration efficiency for integrating the editing elements into a target locus of a mammalian chromosome in a cell of at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%.

Other aspects of the invention relate to a gene editing vector comprising a replication-defective adeno-associated virus (AAV) comprising a correction genome encapsulated in an AAV capsid, the correction genome being as described herein (e.g., comprising editing elements selected from an internucleotide linkage or a nucleotide sequence for integration into a target locus of a chromosome of a mammalian cell; a 5 'homology arm nucleotide sequence 5' to the editing elements, the nucleotide sequence having homology to a 5 'region in the chromosome relative to the target locus; a 3' homology arm nucleotide sequence 3 'to the editing elements, the nucleotide sequence having homology to a 3' region in the chromosome relative to the target locus); wherein the AAV has a chromosomal integration efficiency for integrating an editing element as described herein into a locus of interest as described herein of at least 10% (e.g., at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%). In some embodiments, the efficiency of chromosomal integration for integrating an editing element as described herein into a locus of interest as described herein in the absence of an exogenous nuclease is at least 10% (e.g., at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%).

The correction as described herein may comprise a 5 'inverted terminal repeat (5' ITR) located 5 'to the 5' end of the 5 'homology arm nucleotide sequence and a 3' inverted terminal repeat (3'ITR) located 3' to the 3 'end of the 3' homology arm nucleotide sequence. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially identical (e.g., at least 90%, at least 95%, at least 98%, at least 99% identical, or 100% identical) to the AAV2 virus 5'ITR and AAV2 virus 3' ITR, respectively. In some embodiments, the 5'ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID No. 36 and the 3' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID No. 37. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially identical (e.g., at least 90%, at least 95%, at least 98%, at least 99% identical, or 100% identical) to the AAV5 virus 5'ITR and AAV5 virus 3' ITR, respectively. In some embodiments, the 5'ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID No. 38 and the 3' ITR nucleotide sequence has at least 95% (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID No. 39. In some embodiments, the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially d-mirror images of each other (e.g., mirror images of each other except at 1, 2, 3, 4, or 5 nucleotide positions in the 5 'or 3' ITR).

Exemplary AAV 25' ITR (SEQ ID NO:36) -

ttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct

Exemplary AAV 23' ITR (SEQ ID NO:37) -

aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaa

Exemplary AAV 55' ITR (SEQ ID NO:38) -

ctctcccccctgtcgcgttcgctcgctcgctggctcgtttgggggggtggcagctcaaagagctgccagacgacggccctctggccgtcgcccccccaaacgagccagcgagcgagcgaacgcgacaggggggagagtgccacactctcaagcaagggggttttgta exemplary AAV 53' ITR (SEQ ID NO:39) -

tacaaaacctccttgcttgagagtgtggcactctcccccctgtcgcgttcgctcgctcgctggctcgtttgggggggtggcagctcaaagagctgccagacgacggccctctggccgtcgcccccccaaacgagccagcgagcgagcgaacgcgacaggggggagag

In some embodiments, the corrected genome as described herein is no more than 7kb (kilobases), no more than 6kb, no more than 5kb, or no more than 4kb in size. In some embodiments, the calibration genome as described herein is between 4kb and 7kb, 4kb and 6kb, 4kb and 5kb, or 4.1kb and 4.9 kb.

In certain embodiments, the AAV clade F vector or AAV vector variant used to edit the genome of a cell comprises one or more clade F capsids or capsid variants (relative to AAV9 capsid variants). In certain embodiments, the AAV clade F vector or AAV vector variant used to edit the genome of a cell comprises one or more AAV clade F capsids. In certain embodiments, the donor vector can be packaged into a clade F capsid or capsid variant described herein according to standard AAV packaging methods, resulting in the formation of an AAV clade F vector or AAV vector variant (see, e.g., Chatterjee, 1992). In certain embodiments, one or more clade F capsids or capsid variants affect the tropism of an AAV clade F vector or AAV vector variant for a particular cell.

According to certain embodiments, one or more clade F capsids or capsid variants may be derived from human stem cell-derived AAV. It has been previously shown that cytokine-primed peripheral blood CD34 from healthy donors⁺Stem cells have endogenous native AAV sequences in their genomes (see, e.g., U.S. patent publication nos. US20130096182a1 and US20110294218a 1). The efficacy of AAV isolate variants (relative to variants of AAV 9) has been previously demonstrated, including the efficacy of individual capsid nucleotides and proteins for use in cell transduction (see, e.g., U.S. patent publication nos. US20130096182a1 and US20110294218a 1).

The full length AAV capsid variant gene (variant relative to AAV 9) was isolated from donors with endogenous native AAV sequences in their genomes and sequenced. The polynucleotide and polypeptide sequences of capsid variants are provided in fig. 1, and in U.S. patent application No. 13/668,120, published as U.S. patent publication No. US20130096182a1, filed on day 11, month 2, 2012, and U.S. patent application No. 13/097,046, filed on day 4, month 28, 2011, U.S. patent publication No. US20130096182a1, US20110294218a1, granted on day 1, month 14, 2014, U.S. patent No. 8,628,966, which are all incorporated herein by reference in their entirety as if fully set forth herein. In certain embodiments, an AAV clade F vector or AAV vector variant described herein may comprise one or more clade F capsid or capsid variants comprising a polynucleotide sequence selected from the group consisting of: AAVF1(SEQ ID NO:20), AAVF2(SEQ ID NO:21), AAVF3(SEQ ID NO:22), AAVF4(SEQ ID NO:23), AAVF5(SEQ ID NO:25), AAVF11(SEQ ID NO:26), AAVF7(SEQ ID NO:27), AAVF8(SEQ ID NO:28), AAVF9(SEQ ID NO:29), AAVF12(SEQ ID NO:30), AAVF13(SEQ ID NO:31), AAVF14(SEQ ID NO:32), AAVF15(SEQ ID NO:33), AAVF16(SEQ ID NO:34), AAVF17(SEQ ID NO:35), variants, fragments, mutants, and any combination thereof. In certain embodiments, an AAV clade F vector or AAV vector variant described herein may comprise one or more clade F capsid or capsid variants comprising a polypeptide sequence selected from the group consisting of: AAVF1(SEQ ID NO:2), AAVF2(SEQ ID NO:3), AAVF11(SEQ ID NO:4), AAVF3(SEQ ID NO:5), AAVF4(SEQ ID NO:6), AAVF6(SEQ ID NO:7), AAVF7(SEQ ID NO:8), AAVF8(SEQ ID NO:9), AAVF9(SEQ ID NO:10), AAVF5(SEQ ID NO:11), AAVF12(SEQ ID NO:12), AA 17(SEQ ID NO:13), AAVF13(SEQ ID NO:14), AAVF14(SEQ ID NO:15), AAVF15(SEQ ID NO:16), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof (see, for example, FIG. 1).

According to certain embodiments, the polynucleotide or polypeptide sequence of clade F capsid or capsid variant may have at least about 95%, 96%, 97%, more preferably about 98%, and most preferably about 99% sequence identity to the sequences taught in the present specification. Percent identity can be calculated using any of a variety of sequence comparison programs or methods, such as Pearson and Lipman, Proc. Natl.Acad.Sci.USA, 85:2444(1988), and programs that implement comparison algorithms such as GAP, BESTFIT, FASTA or TFASTA (from Wisconsin Genetics Software Package, Genetics Computer Group,575Science Drive, Madison, Wis.) or BLAST available from the National Center for Biotechnology Information website.

Clade F capsid or capsid variant sequences may be modified at one or more of the V1 and/or V3 cap genes, which genes or functional portions of said genes may be used separately or together in the AAV clade F vectors or AAV vector variants and methods described herein. Cap genes V1, V2, and V3 can be substituted from multiple mutated sequences, and are typically used in a collinear fashion V1-V2-V3. However, the sequence may be truncated, such as the portion V1-V2-V3 or V1-V3 or V1-V1-V2-V3. For example, one sequence may be V2 of V1- (AAVF4) of (AAVF8) -V3 of AAVF 14. Preferably, the clade F capsid or capsid variant transduces the target cell at a level equal to or higher than AAV 2.

In certain embodiments, the one or more capsid variants may comprise a combination of one or more V1, V2 and V3 polynucleotide sequences of a capsid variant (e.g., SEQ ID NO:20-35, variant relative to AAV9 capsid), AAV9 capsid (SEQ ID NO:18), AAV2 capsid (SEQ ID NO:19), variants, fragments or mutants thereof. In certain embodiments, one or more or the capsid variants may comprise a combination of one or more V1, V2 and V3 polynucleotide sequences of a capsid variant (SEQ ID NOs: 20-35, variant relative to AAV9 capsid), any other known AAV capsid, variant, fragment or mutant thereof.

In certain embodiments, one or more clade F capsids or capsid variants may comprise a combination of V1, V2 and V3 polypeptide sequences of a capsid variant (SEQ ID NOs: 2-17, variant relative to an AAV9 capsid), an AAV9 capsid (SEQ ID NO:1), a variant, fragment or mutant thereof. In certain embodiments, one or more capsid variants may comprise a combination of V1, V2, and V3 polypeptide sequences of clade F capsid variants (SEQ ID NOs: 2-17, variants relative to AAV 9), any other known AAV capsid, variants, fragments, or mutants thereof.

In some embodiments, the AAV clade F vector or AAV vector variant used to edit the genome of a cell comprises an AAV clade F capsid. In some embodiments, an "AAV clade F capsid" refers to a capsid having at least 86% (e.g., at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to AAV VP1, VP2, and/or VP3 sequences, respectively, to AAV VP1, VP2, and/or VP3 sequences of AAV 9. Exemplary clade F capsids include AAVF1-17 (also referred to herein as AAVHSC1-17), AAV9, AAVHU31, AAVHU32, and AAVAnc110 (see, e.g., In Silico Reconstruction of the Viral Evolutionary Lineage of Zinn et al to generate a Potent Gene Therapy Vector (2015) Cell Reports (vol. 12, p. 1056-1068).

In some embodiments, the AAV clade F capsid comprises at least one or at least two proteins selected from clade F VP1, clade F VP2, and clade F VP 3. In some embodiments, the AAV clade F capsid comprises clade F VP1, clade F VP2, and clade F VP3 proteins.

Exemplary AAV VP1, VP2, and VP3 protein sequences for AAV clade F capsid are provided in the table below.

In some embodiments, the AAV clade F capsid comprises a VP1, VP2, or VP3 protein having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of SEQ ID NO:1, respectively, corresponding to the amino acid sequences of AAV9 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736 and amino acids 138 to 736 of SEQ ID NO:1, respectively, which correspond to the amino acid sequences of AAV9 capsid proteins VP1 and VP2, respectively; VP1 and VP3 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736 and amino acids 203 to 736, respectively, of SEQ ID No. 1, which correspond to the amino acid sequences of AAV9 capsid proteins VP1 and VP3, respectively; or VP2 and VP3 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) amino acid sequence identity to amino acids 138 to 736 and amino acids 203 to 736, respectively, of SEQ ID NO 1, which correspond to the amino acid sequences of AAV9 capsid proteins VP2 and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736 of SEQ ID NO:1, respectively, corresponding to the amino acid sequences of AAV9 capsid proteins VP1, VP2, and VP3, respectively.

In some embodiments, the AAV clade F capsid comprises VP1, VP2, or VP3 protein having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736 and amino acids 138 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1 and VP2, respectively; VP1 and VP3 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736 and amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1 and VP3, respectively; or VP2 and VP3 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 138 to 736 or amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP2 and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins having at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) amino acid sequence identity to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively.

In some embodiments, the AAV clade F capsid comprises a VP1, VP2, or VP3 protein encoded by a nucleotide sequence comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to SEQ ID NO:18, said nucleotide sequence corresponding to the nucleotide sequence encoding AAV9 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins encoded by a nucleotide sequence comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to SEQ ID NO:18, said nucleotide sequence corresponding to the nucleotide sequence encoding AAV9 capsid proteins VP1, VP2, and VP 3; VP1 and VP3 proteins encoded by nucleotide sequences that comprise at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to SEQ ID No. 18; or VP2 and VP3 proteins encoded by nucleotide sequences comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to SEQ ID NO. 18. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins encoded by a nucleotide sequence comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to SEQ ID NO:18, which corresponds to the nucleotide sequence encoding AAV9 capsid proteins VP1, VP2, and VP 3.

In some embodiments, the AAV clade F capsid comprises a VP1, VP2, or VP3 protein encoded by a nucleotide sequence comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to any one of SEQ ID NOs 20, 21, 22, 23, 25, 24, 27, 28, 29, 26, 30, 31, 32, 33, 34, or 35, which nucleotide sequence corresponds to the nucleotide sequence encoding AAVF1 through AAVF17 capsid proteins VP1, VP2, and VP3, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 proteins encoded by a nucleotide sequence comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to any one of SEQ ID NOs 20-35; VP1 and VP3 proteins encoded by nucleotide sequences that comprise at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to any one of SEQ ID NOS 20-35; or VP2 and VP3 proteins encoded by nucleotide sequences comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to any one of SEQ ID NOS 20-35. In some embodiments, the AAV clade F capsid comprises VP1, VP2, and VP3 proteins encoded by nucleotide sequences comprising at least 85% (e.g., at least 86%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) nucleotide sequence identity to any one of SEQ ID NOs 20, 21, 22, 23, 25, 24, 27, 28, 29, 26, 30, 31, 32, 33, 34, or 35 that correspond to the nucleotide sequences encoding AAVF1 through AAVF17 capsid proteins VP1, VP2, and VP3, respectively.

In some embodiments, the AAV clade F capsid comprises AAV9 VP1, VP2, or VP3 capsid proteins corresponding to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID No. 1. In some embodiments, the AAV clade F capsid comprises AAV9 VP1 and VP2 capsid proteins corresponding to amino acids 1 to 736 and amino acids 138 to 736, respectively, as set forth in SEQ ID No. 1; AAV9 VP1 and VP3 capsid proteins corresponding to amino acids 1 to 736 and amino acids 203 to 736 as set forth in SEQ ID NO:1, respectively; or the AAV9 VP2 and VP3 capsid proteins corresponding to amino acids 138 to 736 and amino acids 203 to 736, respectively, as set forth in SEQ ID NO: 1. In some embodiments, the AAV clade F capsid comprises AAV9 VP1, VP2, and VP3 capsid proteins corresponding to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID No. 1.

In some embodiments, the AAV clade F capsid comprises VP1 capsid protein selected from VP1 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17 corresponding to amino acids 1 to 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively. In some embodiments, the AAV clade F capsid comprises VP1 and VP2 capsid proteins independently selected from VP1 and VP2 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17, which correspond to amino acids 1 to 736 and amino acids 138 to 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively. In some embodiments, the AAV clade F capsid comprises VP2 and VP3 capsid proteins independently selected from VP2 and VP3 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17, which correspond to amino acids 138 to 736 and amino acids 203 to 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively. In some embodiments, the AAV clade F capsid comprises each of VP1, VP2, and VP3 capsid proteins of any one of AAVF1 through AAVF9 and AAVF11 through AAVF17 corresponding to amino acids 1 through 736, amino acids 138 through 736, and amino acids 203 through 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively.

As used herein, a fragment of a polynucleotide sequence can be a portion of a polynucleotide encoding a polypeptide that provides substantially the same function as the polypeptide encoded by the full-length polynucleotide sequence. As used herein, a mutant of a polynucleotide sequence may be obtained by deletion, substitution, addition and/or insertion of one or more nucleotides to the particular polynucleotide sequence. It is understood that such fragments and/or mutants of the polynucleotide sequences encode polypeptides having substantially the same function as the polypeptide encoded by the full-length polynucleotide sequence.

As used herein, a polypeptide sequence may include fragments and/or mutants of the polypeptide sequence while still providing substantially the same function as the full-length polypeptide sequence. By fragment of a polypeptide sequence is meant a portion of the polypeptide sequence that provides substantially the same function as the full-length polypeptide sequence. Examples of polypeptide sequence mutants include deletions, substitutions, additions and/or insertions of one or more amino acids to the polypeptide sequence.

In certain embodiments, the polynucleotide sequence may be a recombinant or non-naturally occurring polynucleotide. In certain embodiments, the polynucleotide sequence may be a cDNA.

In certain embodiments, an AAV clade F vector or AAV vector variant provided herein may comprise any of the AAVF (or AAVHSC) or any other AAV clade F vector described herein. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise any of the AAVF (or AAVHSC) vectors described herein, such as AAVF1, AAVF2, AAVF3, AAVF4, AAVF5, AAVF6, AAVF7, AAVF8, AAVF9, AAVF10, AAVF11, AAVF12, AAVF13, AAVF14, AAVF15, AAVF16, AAVF17, variants, fragments, mutants, or any combination thereof. In certain embodiments, the clade F vector or AAV vector variant may comprise any of AAV9, AAVF1, AAVF2, AAVF3, AAVF4, AAVF5, AAVF6, AAVF7, AAVF8, AAVF9, AAVF10, AAVF11, AAVF12, AAVF13, AAVF14, AAVF15, AAVF16, AAVF17, AAVHU31, AAVHU32, variants, fragments, mutants, or any combination thereof.

In certain embodiments, an AAV clade F vector or AAV vector variant provided herein may comprise an editing element (also referred to herein as a targeting cassette, meaning the terms "editing element" and "targeting cassette" are used interchangeably herein) comprising one or more nucleotide sequences or internucleotide linkages in a target locus (also referred to herein as a target site, meaning the terms are used interchangeably herein) to be integrated into a genome; a 5 'homology arm nucleotide sequence located 5' of the editing element, the nucleotide sequence having homology with a 5 'region in a mammalian chromosome relative to the target locus (e.g., a 5' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology with a region located upstream of the target locus (target site)), and a 3 'homology arm nucleotide sequence located 3' of the editing element, the nucleotide sequence having homology with a 3 'region in the mammalian chromosome relative to the target locus (e.g., a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology with a region located downstream of the target locus (target site)).

In certain embodiments, the one or more nucleotide sequences to be integrated into the target site of the genome can be one or more therapeutic nucleotide sequences. The term "therapeutic" as used herein refers to a substance or method that causes treatment of a disease or condition. A "therapeutic nucleotide sequence" is a nucleotide sequence that provides a therapeutic effect. The therapeutic effect can be direct (e.g., substitution of the nucleic acid for a gene expressed as a protein or insertion of a cDNA into an intron for expression) or indirect (e.g., correction of a regulatory element, such as a promoter). In certain embodiments, the therapeutic nucleotide sequence may comprise one or more nucleotides. In certain embodiments, the therapeutic nucleotide sequence may be a gene, a variant, fragment or mutant thereof. In certain embodiments, when gene therapy is desired, the therapeutic nucleotide sequence can be any nucleotide sequence that encodes a therapeutically effective protein (including a therapeutic antibody). Clade F vectors or AAV vectors comprising therapeutic nucleotide sequences are preferably administered in therapeutically effective amounts via a suitable route of administration, such as injection, inhalation, absorption, ingestion, or other means.

In some embodiments, an editing element as described herein consists of one nucleotide. In some embodiments, an editing element as described herein consists of one nucleotide and a target locus as described herein is a nucleotide sequence consisting of one nucleotide, the target locus representing a point mutation. In some embodiments, an editing element as described herein comprises at least 1, 2, 10, 100, 200, 500, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, an editing element as described herein comprises or consists of: 1 to 5500, 1 to 5000, 1 to 4500, 1 to 4000, 1 to 3000, 1 to 2000, 1 to 1000, 1 to 500, 1 to 200 or 1 to 100 nucleotides, or 2 to 5500, 2 to 5000, 2 to 4500, 2 to 4000, 2 to 3000, 2 to 2000, 2 to 1000, 2 to 500, 2 to 200 or 2 to 100 nucleotides, or 10 to 5500, 10 to 5000, 10 to 4500, 10 to 4000, 10 to 3000, 10 to 2000, 10 to 1000, 10 to 500, 10 to 200 or 10 to 100 nucleotides. In some embodiments, an editing element as described herein comprises or consists of: an exon, an intron, a 5 'untranslated region (UTR), a 3' UTR, a promoter, a splice donor, a splice acceptor, a sequence of coding or non-coding RNA, an insulator, a gene, or a combination thereof. In some embodiments, an editing element as described herein is a fragment of a coding sequence of a gene within or spanning a locus of interest as described herein (e.g., no more than 2kb, no more than 1kb, no more than 500bp, no more than 250bp, no more than 100bp, no more than 50bp, or no more than 25 bp). In some embodiments, an editing element as described herein is an internucleotide linkage (e.g., a phosphodiester linkage connecting two adjacent nucleotides). In some embodiments, an editing element as described herein is an internucleotide linkage, a locus of interest in a chromosome as described herein is a nucleotide sequence comprising one or more nucleotides, and the editing element comprises a deletion of the locus of interest in the chromosome.

In certain embodiments, the editing element (or targeting cassette) of an AAV clade F vector or AAV vector variant may comprise one or more regulatory element polynucleotide sequences. For example, in certain embodiments, one or more regulatory element polynucleotide sequences may be selected from a 2A sequence, a splice acceptor sequence, a polyadenylation sequence, and any combination thereof. In certain embodiments, the targeting cassette may comprise one or more AAV Inverted Terminal Repeat (ITR) polynucleotide sequences flanked by 5 'and 3' homology arm polynucleotide sequences. In certain embodiments, the editing element (or targeting cassette) does not contain a promoter that drives expression of one or more nucleotide sequences. In certain embodiments, if the editing element (or targeting cassette) does not contain a promoter, expression of one or more nucleotide sequences after integration into the genome of a cell may be controlled by one or more regulatory elements of the cell. In certain embodiments, expression of the promoterless one or more nucleotide sequences exhibits correct integration into the cell.

In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more homology arm polynucleotide sequences. In certain embodiments, one or more homology arm polynucleotide sequences may be homologous to a region of a target locus (target site) of a genome. In certain embodiments, the one or more homology arm polynucleotide sequences can be a 5' homology arm polynucleotide sequence. In certain embodiments, the 5 'homology arm polynucleotide sequence may flank the 5' end of the editing element (or targeting cassette). In certain embodiments, the 5' homology arm polynucleotide sequences flanking the editing element (or targeting cassette) may be homologous to a region located upstream of the genomic target locus (target site). In certain embodiments, the one or more homology arm polynucleotide sequences can be a 3' homology arm polynucleotide sequence. In certain embodiments, the 3 'homology arm polynucleotide sequence may flank the 3' end of the editing element (or targeting cassette). In certain embodiments, the 3' homology arm polynucleotide sequences flanking the editing element (or targeting cassette) may be homologous to a region located downstream of the genomic target locus (target site). In certain embodiments, a homologous polynucleotide sequence may be approximately 500 to 1,000 nucleotides in length. For example, in certain embodiments, the homology arm polynucleotide sequence can be approximately 800 nucleotides in length. In certain embodiments, the homology arm polynucleotide sequence can be up to approximately 3,000 nucleotides in length. In some embodiments, the nucleotide length of each of the 5 'and 3' homology arm nucleotide sequences is independently between about 50 and 2000 nucleotides, such as between about 500-1000, about 600-1000, or about 700-900 nucleotides. In some embodiments, the nucleotide length of each of the 5 'and 3' homology arm nucleotide sequences is independently between about 600, about 800, or about 1000 nucleotides.

In some embodiments, the 5 'and 3' homology arm nucleotide sequences have substantially equal nucleotide lengths. In some embodiments, the 5 'and 3' homology arm nucleotide sequences have asymmetric nucleotide lengths. In some embodiments, the asymmetry in nucleotide length is defined by: the difference between the 5 'and 3' homology arm nucleotide sequences length is at most 50% of the length, such as at most 40%, 30%, 20% or 10% of the length. In some embodiments, the asymmetry in nucleotide length is defined by: one arm of the 5 'and 3' homology arms is about 600 nucleotides in length, and the other arm of the 5 'and 3' homology arms is about 800 or about 900 nucleotides in length.

In some embodiments, the 5 'homology arm nucleotide sequence has at least about 90% (e.g., at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5%) nucleotide sequence identity to the 5' region in the mammalian chromosome relative to the target locus. In some embodiments, the 3 'homology arm nucleotide sequence has at least about 90% (e.g., at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5%) nucleotide sequence identity to the 3' region in the mammalian chromosome relative to the target locus. In some embodiments, the nucleotide sequence difference of the 5 'homology arm or the 3' homology arm with the corresponding 5 'region or 3' region, respectively, of the mammalian chromosome may comprise, consist essentially of, or consist of a non-coding difference in nucleotide sequence. In some embodiments, the nucleotide sequence difference of the 5 'homology arm or the 3' homology arm with the corresponding 5 'region or 3' region, respectively, of the mammalian chromosome may comprise, consist essentially of, or consist of a nucleotide sequence difference that causes a conservative amino acid change (e.g., a basic amino acid to a different basic amino acid). In some embodiments, the 5 'homology arm nucleotide sequence has 100% identity to a 5' region in the mammalian chromosome relative to the target locus, and the 3 'homology arm nucleotide sequence has 100% identity to a 3' region in the mammalian chromosome relative to the target locus. In some embodiments, the 5 'and 3' homology arm nucleotide sequences are considered homologous to the 5 'and 3' regions, respectively, in the mammalian chromosome relative to the target locus, even if the target locus contains one or more mutations, such as one or more naturally occurring SNPs, as compared to the 5 'or 3' homology arm.

In certain embodiments, a locus of interest (target site) of a cellular genome may be any region of the genome in which editing of the cellular genome is desired. For example, a locus of interest (target site) of a genome of a cell may comprise a locus of a chromosome in the cell (e.g., a region of a mammalian chromosome). In certain embodiments, the chromosomal locus may be a safe harbor locus. A safe harbor site is a location in the genome where nucleotide sequences can integrate and function in a predictable manner without disrupting the activity of endogenous genes. In certain embodiments, the safe harbor site can be the AAVS1 locus (also referred to as the PPP1R12C locus) in human chromosome 19. In certain embodiments, the safe harbor site can be the first intron of PPP1R12C in the AAVS1 locus in chromosome 19. The AAVS1 locus qter13.3-13.4 on chromosome 19 was previously shown to be a "safe harbor" site for insertion of transgenes because the genes inserted therein are expressed without pathogenic consequences, similar to wild-type AAV integrated at this locus without pathogenic consequences (Giraud 1994; Linden, 1996A; Linden 1996B). In some embodiments, a target locus (target site) is a locus associated with a disease condition as described herein.

In certain embodiments, the target locus is a mutant target locus in a mammalian chromosome that comprises one or more mutant nucleotides relative to a corresponding wild-type mammalian chromosome. In some embodiments, the mutant target locus comprises a point mutation, a missense mutation, a nonsense mutation, an insertion of one or more nucleotides, a deletion of one or more nucleotides, or a combination thereof. In some embodiments, the mutant target locus comprises a null mutation, a neogenetic mutation, or a counter mutation. In some embodiments, the mutant target locus comprises an autosomal dominant mutation, an autosomal recessive mutation, a heterozygote mutation, a homozygote mutation, or a combination thereof. In some embodiments of any of the mutant target loci described herein, the mutant target locus is selected from the group consisting of a promoter, an enhancer, a signal sequence, an intron, an exon, a splice donor site, a splice acceptor site, an internal ribosome entry site, an inverted exon, an insulator, a gene, a chromosomal inversion, and a chromosomal translocation within a mammalian chromosome.

In some embodiments, a target locus in a chromosome as described herein is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 1 (e.g., 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 500, 1000, 2000, 3000, 4000, 5000, or any integer therebetween), an editing element as described herein comprises m nucleotides, wherein m is an integer equal to n, and the editing element represents a substitution of the chromosome target locus. In some embodiments, a target locus in a chromosome as described herein is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 1 (e.g., 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 500, 1000, 2000, 3000, 4000, 5000, or any integer therebetween), an editing element as described herein comprises m nucleotides, wherein m is an integer greater than n, and the editing element represents a substitution addition to the chromosome target locus. In some embodiments, a locus of interest in a chromosome as described herein is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 2 (e.g., 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 500, 1000, 2000, 3000, 4000, 5000, or any integer therebetween), an editing element as described herein comprises m nucleotides, wherein m is an integer less than n; and the editing element represents a substitutional deletion to a chromosome target locus. In some embodiments, a locus of interest in a chromosome as described herein is an internucleotide linkage, an editing element as described herein comprises m nucleotides, wherein m is an integer greater than or equal to 1 (e.g., 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 500, 1000, 2000, 3000, 4000, 5000, or any integer therebetween); and the editing element represents an addition to a chromosome target locus.

In some embodiments, the locus of interest in a chromosome is a locus of interest in a mammalian chromosome (e.g., a human, mouse, bovine, equine, canine, feline, rat, or rabbit chromosome). In some embodiments, the locus of interest may comprise an intron of a mammalian chromosome. In some embodiments, the locus of interest may comprise an exon of a mammalian chromosome. In some embodiments, the locus of interest may comprise a non-coding region of a mammalian chromosome. In some embodiments, the locus of interest may comprise a regulatory region of a mammalian chromosome. In some embodiments, the mammalian chromosome is selected from human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, and Y. In some embodiments, the mammalian chromosome is selected from mouse chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, X, and Y. In some embodiments, the mammalian chromosome is not human chromosome 19. In some embodiments, the mammalian chromosome is a somatic chromosome. Exemplary somatic cells are further described herein.

In certain embodiments, one or more nucleotide sequences or editing elements may be integrated into the genome via homologous recombination without requiring DNA cleavage prior to integration. In certain embodiments, one or more nucleotide sequences or editing elements can be integrated into the genome via homologous recombination without the need for addition of an exogenous nuclease, such as a Zinc Finger Nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), or an RNA-guided nuclease (CRISPR/Cas).

In certain embodiments, the cell edited by an AAV clade F vector or AAV vector variant described herein can be any type of cell. In certain embodiments, the cells can be a variety of mammalian cells, such as cells of the liver, lung, cartilage and other connective tissues, eye, central and peripheral nervous system, lymphatic system, bone, muscle, blood, brain, skin, heart and digestive tract. Where the cell to be edited by an AAV clade F vector or AAV vector variant is, for example, a liver cell, the inserted nucleotide sequence is relevant for treating a condition (ameliorating or curing the disorder or halting further progression of the disease or disorder) or preventing a condition. When the cell to be edited by an AAV clade F vector or AAV vector variant is a liver cell, the liver conditions treated or prevented include hemophilia, enzyme delivery, cirrhosis, cancer or atherosclerosis, and other liver conditions. In certain embodiments, the cell can be a somatic cell (e.g., a mammalian somatic cell). In certain embodiments, the cell (e.g., a somatic cell, such as a mammalian somatic cell) may be from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, and epithelial tissue. In certain embodiments, the cell (e.g., a somatic cell, such as a mammalian somatic cell) may be from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage. In some embodiments, the cell is a CD34+ cell (e.g., a CD34+ somatic cell). In some embodiments, the cell (e.g., a somatic cell, such as a mammalian somatic cell) is a liver cell, a fibroblast, a breast cell, a lymphocyte, or a retinal cell.

As shown herein, AAV packaged with clade F capsids or capsid variants described herein exhibit specific tropism for certain target tissues, such as blood stem cells, liver, heart, eye, breast and joint tissues, and can be used to transduce stem cells for introduction of a gene of interest into a target tissue. Certain of the vectors are capable of crossing tightly controlled biological junctions (such as the blood-brain barrier), which opens up other novel uses for vectors and target organs, providing a means of gene therapy via genome editing. Thus, a clade F vector or AAV vector variant may exhibit tropism for a particular cell based on its clade F capsid or capsid variant. For example, a) for muscle tissue or cells, an AAV clade F vector or AAV vector variant may be selected from the group: AAVF5, AAVF7, AAVF13, AAVF15, and AAVF 17; b) for cardiac or pulmonary tissue or cells, the vector may be selected from the group: AAVF13, AAVF15, and AAVF 17; c) for liver or CNS tissue or cells, the vector may be selected from AAVF5, AAVF13, AAVF17, AAVF7 or AAVF 15; d) for stem cells, the vector may be AAVF 17; e) for B cell progenitors, the vector can be AAVF 5; f) for bone marrow and erythrocyte progenitors, the vector may be AAVF 12; and g) for lymph node, kidney, spleen, cartilage and bone tissue or cells, the vector may be selected from the group of vectors selected from the group of: AAVF7, AAVF13, AAVF15, and AAVF 17.

Alternatively, clade F vectors or AAV vector variants may have tropism for cells containing various tags, such as a His-tag or affinity tag; or a monoclonal antibody that is tropic for an interferon response, such as elicitation or introduction by a naturally occurring antibody administered in response to a pathogen or tumor cell.

In certain embodiments, the cell can be a stem cell (e.g., a mammalian stem cell). In certain embodiments, the stem cells may be any type of stem cell, including hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, or mesenchymal stem cells. In certain embodiments, the stem cells (e.g., mammalian stem cells) can be hematopoietic stem cells, umbilical cord blood stem cells, bone marrow stem cells, fetal liver stem cells, or peripheral blood stem cells. In some embodiments, the stem cell may be a CD34+ stem cell. In certain embodiments, the stem cells (e.g., mammalian stem cells) can be hematopoietic stem cells or peripheral blood stem cells. Transduction of stem cells can be transient or permanent (also referred to as persistent). If transient, one embodiment allows the length of time that the therapeutic nucleotide is used or expressed to be controlled by the carrier, by a substance attached to the carrier, or by an external factor or force.

In certain embodiments, the cell may be selected from the group consisting of: CD34+ hematopoietic stem cell line (HSC), K562 CD34+ leukemia cell line, HepG2 human liver cell line, peripheral blood stem cell, cord blood stem cell, CD34+ peripheral blood stem cell, WI-38 human diploid fibroblast cell line, MCF7 human breast cancer cell line, Y79 human retinoblastoma cell line, SCID-X1 LBL human EBV immortalized B cell line, primary human hepatocytes, primary hepatic sinusoid endothelial cells, and primary skeletal myoblasts.

Also provided herein are methods of editing the genome of a cell of an individual ex vivo comprising transducing the cell with clade F or an AAV vector variant as described herein. In certain embodiments, transduction of cells with a clade F vector or AAV vector variant can be performed without other exogenous nucleases, such as Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or RNA guide nucleases (CRISPR/Cas). In certain embodiments, the cells may be any type of cell. In certain embodiments, the cell may be a stem cell as described herein. For example, in certain embodiments, a method of editing the genome of a stem cell may comprise transducing the stem cell with one or more clade F vectors or AAV vector variants. In certain embodiments, transduction of stem cells can be performed without the need for additional exogenous nucleases. In certain embodiments, the cell may be a somatic cell as described herein. For example, in certain embodiments, a method of editing a somatic cell genome can comprise transducing the somatic cell with one or more clade F vectors or AAV vector variants. In certain embodiments, transduction of somatic cells can be performed without the need for additional exogenous nucleases. In certain embodiments, the clade F vector or AAV vector variant comprises one or more clade F capsids or capsid variants (variants relative to AAV 9), an editing element (targeting cassette) selected from an internucleotide linkage or nucleotide sequence for integration into a target locus of a mammalian chromosome or comprising one or more therapeutic nucleotide sequences to be integrated into a target locus of a genome (target locus), a 5 'homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region located upstream of the target locus (target locus), and a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region located downstream of the target locus (target locus). In certain embodiments, the internucleotide linkage or nucleotide sequence or one or more therapeutic nucleotide sequences may be integrated into the genome without the need for additional exogenous nucleases for DNA cleavage prior to integration.

Also provided herein are methods of treating a disease or disorder in an individual by editing the genome of cells of the individual ex vivo, comprising transducing the cells with a clade F vector or AAV vector variant and further transplanting the transduced cells into the individual to treat the disease or disorder. In certain embodiments, the methods may comprise transducing cells of the subject with a clade F vector or AAV vector variant described herein. In certain embodiments, the cell can be transduced without other exogenous nucleases. In certain embodiments, transduction of cells with clade F vectors or AAV vector variants can be performed as provided herein or by any transduction method known to one of ordinary skill in the art. In certain embodiments, the cells may be treated with clade F vector or AAV vector variants at 50,000; 100,000; 150,000; 200,000; 250,000; 300,000; 350,000; 400,000; 450,000; or a multiplicity of infection (MOI) of 500,000 or any MOI that provides optimal cell transduction. In certain embodiments, the transduced cells are further transplanted into an individual, wherein the transduced cells treat a disease or disorder. In certain embodiments, the cell can be any type of cell described herein.

Also provided herein are methods of editing a locus of interest in a mammalian genome as described herein. In some embodiments, the method comprises transducing a cell comprising a mammalian genome (e.g., a human, mouse, bovine, equine, canine, feline, rat, or rabbit cell) with an AAV (e.g., a replication-defective AAV comprising a corrected genome encapsulated in a capsid) as described herein. In some embodiments, the method comprises (a) obtaining mammalian cells from a mammal (e.g., a human, mouse, bovine, equine, canine, feline, rat, or rabbit); (b) culturing the mammalian cell ex vivo to form an ex vivo culture; (c) transducing the mammalian cell with an AAV as described herein (e.g., a replication defective AAV comprising a corrected genome encapsulated in a capsid) in the ex vivo culture to form a transduced mammalian cell; and (d) administering the transduced mammalian cells to the mammal. In some embodiments, the method comprises (a) obtaining mammalian cells from a first mammal; (b) culturing the mammalian cell ex vivo to form an ex vivo culture; (c) transducing the mammalian cell with an AAV as described herein (e.g., a replication defective AAV comprising a corrected genome encapsulated in a capsid) in the ex vivo culture to form a transduced mammalian cell; and (d) administering the transduced mammalian cell to a second mammal. In some embodiments, the first mammal and the second mammal are of different species (e.g., the first mammal is a human, mouse, bovine, equine, canine, feline, rat, or rabbit, and the second mammal is a different species). In some embodiments, the first mammal and the second mammal are of the same species (e.g., both are human, mouse, bovine, equine, canine, feline, rat, or rabbit). In some embodiments, the methods comprise administering an AAV (e.g., a replication-defective AAV comprising a corrected genome encapsulated in a capsid) as described herein to a mammal (e.g., a human, mouse, bovine, equine, canine, feline, rat, or rabbit) in an amount effective to transduce mammalian cells in vivo with the AAV.

In some embodiments of any of the methods, the mammalian cell is from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, and epithelial tissue. In some embodiments of any of the methods, the mammalian cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage. In some embodiments of any of the methods, the mammalian cell is a stem cell. In some embodiments, the stem cells are hematopoietic stem cells or peripheral blood stem cells. In some embodiments of any of the methods, the mammalian cell is a CD34+ cell.

In some embodiments of any of the methods, the AAV (e.g., clade F AAV) is transduced or administered without co-transduction or co-administration of an exogenous nuclease or a nucleotide sequence encoding an exogenous nuclease. Exemplary exogenous nucleases include Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or RNA guide nucleases (CRISPR/Cas). In some embodiments of any of the methods, the AAV is transduced or administered without co-transduction or co-administration of an exogenous zinc finger nuclease or a nucleotide sequence encoding an exogenous zinc finger nuclease. In some embodiments, the zinc finger nuclease is a zinc finger nuclease comprising a DNA binding domain that targets the AAVS1 locus (e.g., a DNA binding domain that targets the PPP1R12C first intron in the AAVS1 locus).

In some embodiments of any of the methods, the efficiency of chromosomal integration of an AAV (e.g., a clade F AAV) for integrating editing elements into a target locus of a mammalian chromosome is at least about 1% (e.g., at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or about 100%). In some embodiments of any of the methods, the efficiency of chromosomal integration of an AAV (e.g., a clade F AAV) for integrating an editing element into a target locus of a mammalian chromosome in the absence of an exogenous nuclease is at least about 1% (e.g., at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or about 100%). In some embodiments of any of the methods, the genome-corrected editing elements are integrated into the target locus of the mammalian chromosome with a chromosomal integration efficiency ranging from 10% to 70%, 20% to 70%, 40% to 70%, 50% to 70%, 10% to 80%, 20% to 80%, 40% to 80%, 50% to 80%, 10% to 90%, 20% to 90%, 40% to 90%, 50% to 90%, 10% to 100%, 20% to 100%, 40% to 100%, or 50% to 100% in the mammalian cell. In some embodiments of any of the methods, the genome-corrected editing elements integrate into the target locus of the mammalian chromosome in the absence of an exogenous nuclease with a chromosomal integration efficiency ranging from 10% to 70%, 20% to 70%, 40% to 70%, 50% to 70%, 10% to 80%, 20% to 80%, 40% to 80%, 50% to 80%, 10% to 90%, 20% to 90%, 40% to 90%, 50% to 90%, 10% to 100%, 20% to 100%, 40% to 100%, or 50% to 100% in the mammalian cell.

In some embodiments of any of the methods, the efficiency of chromosomal integration of an AAV (e.g., a clade F AAV) is further characterized by an allele frequency in the population of cells of at least about 10% (e.g., at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 75%, at least about 85%, at least about 90%, or at least about 95%) for an allele comprising an editing element integrated into a target locus of a mammalian chromosome. In some embodiments, the frequency of allele occurrence in the cell population is the frequency of allele occurrence in a cell population in vitro, such as a cell type population provided herein in vitro (e.g., CD34+ hematopoietic stem cell line (HSC), K562 CD34+ leukemia cell line, HepG2 human liver cell line, peripheral blood stem cell, cord blood stem cell, CD34+ peripheral blood stem cell, WI-38 human diploid fibroblast cell line, MCF7 human breast cancer cell line, Y79 human retinoblastoma cell line, SCID-X1 LBL human EBV immortalized B cell line, primary human hepatic cell, primary hepatic sinusoid endothelial cell, and primary skeletal myoblast cell).

According to certain embodiments, there is provided a method of treating a disease or disorder in an individual by: editing the genome of the stem cells of the individual ex vivo and further transplanting the edited cells into the individual to treat the disease or disorder. In certain embodiments, a method of treating a disease or disorder in an individual by editing the genome of the individual's stem cells can comprise the steps of: transducing the stem cells of the subject with an AAV clade F vector or AAV vector variant as described herein and transplanting the transduced stem cells into the subject, wherein the transduced stem cells treat the disease or disorder. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants, a 5 'homology arm polynucleotide sequence comprising one or more editing elements (targeting cassettes) to be integrated into a target locus (target site) of a stem cell genome, flanking said editing elements (targeting cassettes) and having homology to a region located upstream of said target locus (target site), and a 3' homology arm polynucleotide sequence flanking said editing elements (targeting cassettes) and having homology to a region located downstream of said target locus (target site). In certain embodiments, transducing stem cells can be performed in the absence of other exogenous nucleases. In certain embodiments, one or more therapeutic nucleotide sequences may be integrated into the genome without the need for additional exogenous nucleases for DNA cleavage prior to integration.

In certain embodiments, when the cell is a stem cell, the disease or disorder treated may be any disease or disorder caused by one or more mutations in the genome. In certain embodiments, the disease or disorder treated is selected from the group consisting of inherited metabolic diseases, lysosomal storage diseases, mucopolysaccharidosis, immunodeficiency diseases, and hemoglobinopathies and infections. In certain embodiments, when the cell to be edited is a stem cell, the AAV clade F vector or AAV vector variant may be selected from the group of: AAVF7 AAVF12, AAVF15, AAVF17, variants, mutants, and combinations thereof. In certain embodiments, when the cell to be edited is a stem cell, the clade F vector or AAV vector variant may be selected from the group of: AAVF5, AAVF7, AAVF12, AAVF15, AAVF17, variants, mutants, and combinations thereof. In certain embodiments, the clade F vector or AAV vector variant may comprise one or more clade F capsid or capsid variants comprising a polynucleotide sequence selected from the group consisting of: AAVF7(SEQ ID NO:27), AAVF12(SEQ ID NO:30), AAVF15(SEQ ID NO:33), AAVF17(SEQ ID NO:35), variants, fragments, mutants, and combinations thereof. In certain embodiments, the clade F vector or AAV vector variant may comprise one or more clade F capsid or capsid variants comprising a polynucleotide sequence selected from the group consisting of: AAVF5(SEQ ID NO:25), AAVF7(SEQ ID NO:27), AAVF12(SEQ ID NO:30), AAVF15(SEQ ID NO:33), AAVF17(SEQ ID NO:35), variants, fragments, mutants, and combinations thereof. In certain embodiments, the AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants comprising a polypeptide sequence selected from the group consisting of: AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and combinations thereof. In certain embodiments, the AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants comprising a polypeptide sequence selected from the group consisting of: AAVF5(SEQ ID NO:11), AAVF7(SEQ ID NO:8), AAVF12(SEQ ID NO:12), AAVF15(SEQ ID NO:16), AAVF17(SEQ ID NO:13), variants, fragments, mutants, and combinations thereof.

In another embodiment, from CD34⁺HSC or AAV clade F vector or AAV vector variants from another source capable of genome editing can be used to efficiently transduce stem cells (including HSCs and ipscs) as well as other cells such as those of the heart, joints, central nervous system (including brain), muscle and liver. If AAV clade F vectors or AAV vector variants are used in vitro, they can be used for research and investigation purposes or to prepare cells or tissues to be implanted later into an individual. Preferably, the subject is a mammal, such as a human, but can be any other animal whose tissues can be transduced by the vectors of the invention and methods using those vectors. The AAV clade F vectors or AAV vector variants of the invention are well suited for both human and veterinary use. AAV clade F vectors or AAV vector variants can also be used in vitro for transient transduction of stem cells, such as HSCs. The length of transduction can be controlled by the culture conditions. If an AAV clade F vector or AAV vector variant is used in vivo, it can be administered directly to the subject receiving therapy for uptake or use in the target cells (e.g., liver or chondrocytes). If an AAV clade F vector or AAV vector variant is used to transduce cells of the central nervous system, it is preferably capable of crossing the blood-brain barrier and maintaining its efficacy.

Also provided herein are methods of treating a disease or disorder in a subject by in vivo genome editing of cells of the subject by administering an AAV clade F vector or AAV vector variant directly to the subject. In certain embodiments, the AAV clade F vector or AAV vector variant may be any of the AAV clade F vectors or AAV vector variants described herein. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants, a 5 'homology arm polynucleotide sequence comprising one or more editing elements (targeting cassettes) to be integrated into a target locus (target site) of a stem cell genome, flanking said editing elements (targeting cassettes) and having homology to a region located upstream of said target locus (target site), and a 3' homology arm polynucleotide sequence flanking said editing elements (targeting cassettes) and having homology to a region located downstream of said target locus (target site). In certain embodiments, the administered AAV clade F vector or AAV vector variant treats a disease or disorder by genome editing of cells of the individual. In certain embodiments, in vivo genome editing can be performed in the absence of other exogenous nucleases. In certain embodiments, one or more clade F capsids or capsid variants comprise a polynucleotide or polypeptide sequence as provided herein. In certain embodiments, the polynucleotide or polypeptide sequence may be selected from the sequences provided in figure 1 of U.S. patent publication No. 20130096182a1 or figure 1 herein, variants, fragments, mutants, and combinations thereof. In certain embodiments, the AAV clade F vector or AAV vector variant is preferably administered in a therapeutically effective amount via a suitable route of administration, such as injection, inhalation, absorption, ingestion, or other means.

Previous studies, including Xu et al, Wang et al, and Carbonaro et al, have demonstrated HSC transduction following in vivo delivery of viral vectors (see Xu 2004; Wang 2014; and Carbonaro 2006). However, all three of these studies involved retroviruses (Xu 2004) or lentiviruses (Wang 2014 and carboparo 2006). Furthermore, injections in Xu et al and Carbonaro et al were performed in neonatal mice, and rapamycin (rapamycin) and intrafemoral injections were required for efficient transduction in Wang et al. However, none of these papers report the transduction of HSCs by in vivo transduction of clade F vectors or AAV vector variants into adult mice. The novel results provided in example 3 initially demonstrate AAV vector transduction of HSCs by intravenous injection.

As shown in example 3 below, intravenous injection of clade F vectors (or AAV vector variants) pseudotyped with AAVF7 or AAVF17 resulted in vivo transduction of human CD34+ hematopoietic stem and progenitor cells. The intravenous injection of clade F vectors or AAV vectors is delivered to the site of human hematopoiesis and to the transduced human cells. Intravenous injection of clade F vector or AAV vector variants resulted in Venus expression in human CD34+ stem progenitors and their CD45+ progeny. These data demonstrate that intravenous injection of clade F vectors or AAV vector variants can be used for in vivo genome engineering without the need for stem cell harvesting, ex vivo transduction, recipient adaptation, and subsequent transplantation of transduced cells. This approach makes stem cell gene therapy significantly safer, more available to patients worldwide, less expensive, and avoids the need for hospitalization.

In certain embodiments, methods of treating a disease or disorder in a subject by in vivo genome editing of cells of the subject by administering an AAV clade F vector or AAV vector variant directly to the subject are disclosed. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsids or capsid variants, an editing element (targeting cassette) comprising one or more therapeutic nucleotide sequences to be integrated into a target locus (target site) of a genome, a 5 'homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region located upstream of the target locus (target site), and a 3' homology arm polynucleotide sequence flanking the editing element (targeting cassette) and having homology to a region located downstream of the target locus (target site), wherein the vector transduces a cell of an individual and integrates the one or more therapeutic nucleotide sequences into the genome of the cell. In certain embodiments, one or more clade F capsids or capsid variants may comprise a polypeptide sequence selected from the group consisting of seq id no: AAVF1(SEQ ID NO:2), AAVF2(SEQ ID NO:3), AAVF11(SEQ ID NO:4), AAVF3(SEQ ID NO:5), AAVF4(SEQ ID NO:6), AAVF6(SEQ ID NO:7), AAVF7(SEQ ID NO:8), AAVF8(SEQ ID NO:9), AAVF9(SEQ ID NO:10), AAVF5(SEQ ID NO:11), AAVF12(SEQ ID NO:12), AA 17(SEQ ID NO:13), AAVF13(SEQ ID NO:14), AAVF14(SEQ ID NO:15), AAVF15(SEQ ID NO:16), AAVF16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof. In certain embodiments, one or more clade F capsids or capsid variants can comprise the polypeptide sequence of AAVF7(SEQ ID NO:8) or AAVF17(SEQ ID NO: 13). In certain embodiments, one or more clade F capsids or capsid variants can comprise the polypeptide sequence of AAVF5(SEQ ID NO:11), AAVF (SEQ ID NO:8), or AAVF17(SEQ ID NO: 13). In certain embodiments, the AAV clade F vector or AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences. In certain embodiments, the target locus (target site) may be a safe harbor site. In certain embodiments, the safe harbor site can be the AAVS1 locus on chromosome 19. In certain embodiments, the cell may be a stem cell. In certain embodiments, the stem cell can be a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell. In certain embodiments, the disease or disorder may be caused by one or more mutations in the genome of the cell. In certain embodiments, the disease or disorder may be selected from inherited metabolic diseases, lysosomal storage diseases, mucopolysaccharidosis, immunodeficiency diseases, and hemoglobinopathies and infections.

Further demonstrating the efficacy of in vivo applications, the transplantation of transduced cells into immunodeficient mice with isolate variants (relative to AAV9) resulted in long-term and sustained transgene expression and could be used for gene therapy. In certain embodiments, when delivered systemically, these vectors exhibit tropism for liver and cartilage, and implicate therapy for genetic, acquired, infectious, and oncological diseases. With respect to liver transduction, the liver transduction levels of the AAV isolates of the invention are up to approximately 10-fold higher than the highest criteria for systemic gene delivery to the liver, AAV8, which is currently available. This property can be used in gene-based enzyme replacement therapy by the liver for diseases such as hemophilia, enzyme deficient diseases and atherosclerosis. The additional tropism of the AAV isolates of the invention for cartilage tissue in joints may be used to treat skeletal disorders such as arthritis, osteoporosis or other cartilage/bone based diseases. Thus, the variant sequences and methods can be used for transient transduction without the need for long-term integration.

Members of the AAV clade F capsid family or AAV capsid variant family transduce HSCs (e.g., AAVF15 and AAVF 17) resulting in long-term engraftment with persistent gene expression and are therefore strong candidates for stem cell gene therapy vectors. AAVF17 and AAVF15 (also referred to in abbreviated form as "HSC 17" and "HSC 15") supported the highest levels of long-term in vivo transduction up to 22 weeks after transplantation. Serial bioluminescence imaging after intravenous injection of AAV variants revealed that AAVF15 generally supported the highest level of long-term transgene expression in vivo. Other AAV variants, including AAVF13 and 17, also support strong in vivo transduction.

AAVF15 was found to have a high degree of hepatic tropism, approximately 5-10 times that of AAV 9. The transduction of heart and skeletal muscle by AAVF13 and AAVF15 is also at least 10-fold higher than that of AAV 9. In vitro neutralization titers revealed that antibodies directed against AAVF 1-9 capsids were similar in prevalence in pooled human IVIG to AAV9, while antibodies directed against AAVF13, AAVF15, AAVF16, and AAVF17 were somewhat less prevalent. In vivo neutralization analysis confirmed that after IVIG administration with AAVF15, more than 100 copies/cell of the vector genome were found in liver and muscle compared to AAV9, indicating that pre-existing antibodies did not completely neutralize AAVF 15. A muscle disease or disorder can comprise any cell, tissue, organ, or system containing muscle cells, including the heart, such as coronary heart disease or cardiomyopathy, having the disease or disorder.

In addition, site-specific mutagenesis experiments indicated that the R505G mutation in AAVF15 caused an increase in liver tropism. AAV clade F vectors or AAV vector variants can be used throughout the host for the treatment of genetic diseases such as hemophilia, atherosclerosis, and various congenital metabolic errors. In one example, AAVF15 is effective in treating hemophilia B. Some members of this family also target joints following systemic injection, which can be used to treat joint and cartilage diseases, such as arthritis. Other members of the family target the heart after intravenous injection. Yet other members of the family target the brain. In some embodiments, as a result of the display of AAVF5 transduction of multiple cell types, vectors comprising AAVF5 capsid protein are provided as part of the methods, kits, or compositions provided herein (see fig. 4).

In certain embodiments, a method of treating a neurological disease or disorder in an individual by genome editing may comprise administering an AAV clade F vector or AAV vector variant capable of crossing the blood-brain barrier, blood-eye barrier or blood-nerve barrier. Certain of the AAV clade F vectors or AAV vector variants disclosed herein have the following unique capabilities: the modified viral vectors are used to traverse biological junctions previously unknown accessible by any vector for gene therapy or other diagnostic or therapeutic purposes. These junctions have common features. The blood-brain barrier is the separation between the blood circulating in the body and the brain extracellular fluid in the central nervous system, and is created by tight junctions around capillaries. The blood-brain barrier generally allows only smaller hydrophobic molecules to diffuse through. The blood-brain barrier is the isolation between local blood vessels and the majority of the eye and is produced by the endothelium of the capillaries of the retina and iris. The blood-nerve barrier is the physiological space in which axons, Schwann cells (Schwann cells) and other related cells of the peripheral nerve function and is produced by endoneurial microvessels within the nerve fascicles and the membranating perineurium. As with three of these barriers, permeability is limited to protect against drastic concentration changes in blood vessels and other extracellular spaces in the internal environment (here nerves). Vectors that cross any of these barriers have the following unique capabilities: delivering one or more therapeutic nucleotide sequences for use in treating a neurological disease or disorder or acting as a marker and or diagnostic agent. Some of the AAV clade F vectors or AAV vector variants that have been experimentally verified to be particularly suitable for crossing these biological barriers include AAVF15, AAVF15 a346T, and AAVF 15R 505G.

There are many neurological diseases or disorders well known to those skilled in the art, which can be generally classified as cell-type or organ-type, such as diseases or disorders of the brain, spinal cord, ganglia, motor nerves, sensory nerves, autonomic nerves, optic nerves, retinal nerves, and auditory nerves. By way of example, a brain Disease or disorder may include cancer or other brain tumors, inflammation, bacterial infection, viral infection (including rabies), amoeba or parasitic infection, stroke, paralysis, neurodegenerative disorders (such as Alzheimer's Disease, Parkinson's Disease or other dementias or reduced cognitive function), plaque, encephalopathy, Huntington's Disease, aneurysm, genetic or acquired malformations, acquired brain injury, Tourette Syndrome (Tourette Syndrome), narcolepsy, muscular dystrophy, tremor, cerebral palsy, autism, Down Syndrome (Down Syndrome), attention deficit and attention deficit hyperactivity disorder, chronic inflammation, epilepsy, coma, meningitis, multiple sclerosis, myasthenia gravis, various neuropathies, restless leg Syndrome, and Tay-Sachs disease.

By way of example only, muscle diseases or disorders include myopathy, chronic fatigue syndrome, fibromyalgia, muscular dystrophy, multiple sclerosis, atrophy, cramps, spasticity, stiffness, various inflammations (such as dermatomyositis), rhabdomyolysis, myofascial pain syndrome, swelling, compartment syndrome, eosinophilia-myalgia syndrome, mitochondrial myopathy, muscular tension disorder, paralysis, tendonitis, rheumatic polymyalgia, cancer, and tendon disorders (such as tendonitis and tenosynovitis).

Cardiac diseases or conditions include, by way of example only, coronary artery disease, coronary heart disease, congestive heart failure, cardiomyopathy, myocarditis, pericardial disease, congenital heart disease, cancer, endocarditis, and valve disease.

By way of example only, lung diseases or conditions include asthma, allergy, chronic obstructive pulmonary disease, bronchitis, emphysema, cystic fibrosis, pneumonia, tuberculosis, pulmonary edema, cancer, acute respiratory distress syndrome, pneumoconiosis, and interstitial lung disease.

By way of example only, liver diseases or conditions include cancer, hepatitis a, B and C, cirrhosis, jaundice, and liver disease. By way of example only, kidney diseases or conditions include cancer, diabetes, nephrotic syndrome, kidney stones, acquired kidney disease, congenital diseases, polycystic kidney disease, nephritis, primary hyperoxaluria, and cystinuria. By way of example only, spleen diseases or disorders include cancer, spleen infarction, sarcoidosis, and Gaucher's disease. By way of example only, skeletal diseases or disorders include osteoporosis, cancer, low bone density, Paget's disease, and infection.

For any of these diseases or conditions that are treated with a therapeutic nucleotide sequence delivered by or with an AAV clade F vector or AAV vector variant, or even a small molecule, by way of example, the therapeutic nucleotide sequence may be a nucleic acid encoding a protein therapeutic (e.g., for cancer, an apoptotic protein), miRNA, shRNA, siRNA, other RNA subtypes, or a combination thereof. In some embodiments, the carrier is isolated and purified as described herein. Isolation and purification are preferred modes of in vivo administration to increase efficacy and reduce contamination. The vector may transduce a transgene, either permanently or transiently, that is a gene or other genetic material that has been isolated from one organism and introduced into another. Here, the other organism may be the individual receiving the vector.

In certain embodiments, AAV clade F vectors or AAV vector variants for genome editing may be selected based on experimental results having the highest efficacy in a given target cell or tissue for a given disease or disorder as shown herein. For example, a) for a muscle disease or disorder and for antibody gene or other vaccine therapy administered to a subject via muscle, an AAV clade F vector or AAV vector variant is selected from the group of: AAVF5, AAVF7, AAVF13, AAVF15, and AAVF 17; b) for cardiac and pulmonary diseases or disorders, the carrier is selected from the group consisting of: AAVF13, AAVF15, and AAVF 17; c) for a liver or neurological disease or disorder, the vector is selected from AAVF5 and AAVF 15; d) for conditions treated by engraftment of stem cells, the vector AAVF 17; e) for conditions treated by transduction of B cell progenitors, the vector AAVF 5; f) for conditions treated by transduction of bone marrow and erythrocyte progenitors, the vector AAVF 12; and g) for lymph node, kidney, spleen, cartilage and bone diseases or conditions, the vector is selected from the group of vectors selected from the group of: AAVF7, AAVF13, AAVF15, and AAVF 17; wherein the AAV clade F vector or AAV vector variant transduces a cell or tissue and one or more therapeutic nucleotide sequences integrate into the genome of the cell and treat the disease or disorder. In certain embodiments, an AAV clade F vector or AAV vector variant may comprise one or more clade F capsid or capsid variants (relative to AAV9) that exhibit tropism for cells as described herein.

The subject is any animal on which the method works, but is preferably a mammal, which may be a human. If the vector contains an antibody gene or other vaccine therapy, it can be administered via intramuscular injection and can provide immunoprophylaxis against diseases including HIV, influenza, malaria, tetanus, measles, mumps, rubella, HPV, pertussis, or any other vaccine. The vector may be packaged, isolated and purified, and any type of stem cell may be transduced with the at least one therapeutic nucleotide sequence. The vector may also transduce a transgene or carry an endogenous calibration gene to the individual and/or other individuals of the same species.

An "AAV" is an adeno-associated virus. Unless otherwise indicated, the term may be used to refer to viruses or derivatives thereof, viral subtypes, and naturally occurring and recombinant forms. AAV has more than 100 distinct subtypes, which are referred to as AAV-1, AAV-2, and the like, and includes both human and non-human derived AAV. There are about twelve AAV serotypes. Various subtypes of AAV can be used as recombinant gene transfer viruses to transduce many different cell types.

"recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction, and/or ligation steps, as well as other procedures that produce different constructs than a naturally occurring polynucleotide. Recombinant viruses comprise viral particles of recombinant polynucleotides, including replicas of the original polynucleotide constructs and progeny of the original virus constructs. By "rAAV vector" is meant a recombinant AAV vector comprising a polynucleotide sequence of non-AAV origin (i.e., a polynucleotide heterologous to AAV), which is typically a sequence of interest for genetic transformation of a cell.

As used herein, a "helper virus" for AAV is a virus that allows AAV to replicate and package by mammalian cells. Helper viruses for AAV are known in the art and include, for example, adenoviruses (e.g., adenovirus type 5 of subgroup C), herpesviruses (e.g., herpes simplex virus, ebutan-barvirus (Epstein-Bar virus), and cytomegalovirus), and poxviruses.

"articular tissue" encompasses a variety of tissues including cartilage, synovial fluid, and mature, progenitor, and stem cells that produce or are themselves the following cells: (i) cartilage producing cells; (ii) type I synovial cells; (iii) type II synovial cells; (iv) colonisation (residual) or circulating leukocytes; (v) a fibroblast cell; (vi) vascular endothelial cells; and (vii) pericytes.

"replication-competent" virus refers to a virus that is infectious and capable of replicating in infected cells. In the case of AAV, replication capacity generally requires the presence of functional AAV packaging genes as well as helper viral genes, such as adenovirus and herpes simplex virus. Generally, rAAV vectors are not replication competent (also referred to herein as replication defective) because they lack one or more AAV packaging genes. In some embodiments, an AAV may be considered replication-defective (or replication-incompetent) if the AAV is substantially absent of an AAV rep gene and/or an AAV cap gene. In some embodiments, an AAV may be considered replication-defective (or replication-incompetent) if the AAV lacks an AAV rep gene and/or an AAV cap gene. In some embodiments, the composition comprising an AAV clade F vector or AAV variant isolate is a cell-free composition. The composition is generally free of cellular proteins and/or other contaminants, and may comprise other elements, such as buffers (e.g., phosphate buffer, Tris buffer), salts (e.g., NaCl, MgCl2), ions (e.g., magnesium ions, manganese ions, zinc ions), preservatives, solubilizers, or detergents (e.g., nonionic detergents; dimethyl sulfoxide).

In another embodiment, the expression cassette comprises a polynucleotide sequence encoding a polypeptide comprising one or more of a clade F capsid or an AAV variant isolate, wherein said polynucleotide sequence encoding said polypeptide comprises a sequence having at least about 95%, 96%, 97%, more preferably about 98%, and most preferably about 99% sequence identity to a sequence taught in the present specification. Percent identity can be calculated using any of a variety of sequence comparison programs or methods, such as Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444(1988), and programs that implement comparison algorithms, such as GAP, BESTFIT, FASTA or TFASTA (from Wisconsin Genetics Software Package, Genetics Computer Group,575Science Drive, Madison, Wis.) or BLAST available from the National Center for Biotechnology Information website.

In another aspect, the expression cassette comprises a polynucleotide sequence encoding a polypeptide comprising one or more of a clade F capsid or an AAV variant isolate, wherein said sequence comprises portions V1-V3 (also referred to as VP1-VP3) of three genes comprising capsid proteins. For example, the cassette may comprise V1 from capsid AAVF1, standard V2 compared to AAV9 hu.14, and V3 from AAVF17 capsid. In yet another embodiment, the capsid may comprise each of more than one capsid gene components. For example, clade F capsid or capsid variant may be selected from any of VP1-VP3(V1-V3) for capsid sequences set forth herein, and may be combined in any order and in any combination, so long as the desired transduction enhancing properties are achieved. The capsid sequences may be, for example, VP1A-VP1B-VP2-VP3(V1A-V1B-V2-V3), P3-VP1-VP2(V3-V1-V2) or VP1-VP2-VP3A-VP3B (V1-V2-V3A-V3B).

Another embodiment includes a method of immunizing an individual. Compositions comprising clade F capsids or capsid variants can be introduced into an individual in a manner that elicits an immune response that produces immunity in the individual. The clade F capsid or capsid variant may be in composition alone or as part of an expression cassette. In one embodiment, the expression cassette (or polynucleotide) can be introduced using a gene delivery vector. The gene delivery vector may, for example, be a non-viral vector or a viral vector. Exemplary viral vectors include, but are not limited to, Sindbis virus (Sindbis-virus) derived vectors, retroviral vectors, and lentiviral vectors. Compositions suitable for generating an immune response may also be delivered using a particulate carrier. In addition, such compositions can be coated on, for example, gold or tungsten particles, and the coated particles delivered to an individual using, for example, a gene gun. The compositions may also be formulated as liposomes. In one embodiment of this method, the subject is a mammal, and may be, for example, a human.

The term "affinity tag" is used herein to indicate a polypeptide segment that can be attached to a second polypeptide to provide purification or detection of the second polypeptide or to provide a site for attachment of the second polypeptide to a substrate. In principle, any peptide or protein for which an antibody or other specific binding agent is available can be used as an affinity tag. Affinity tags include polyhistidine fascin A (Nilsson et al, EMBO J.4:1075,1985; Nilsson et al, Methods in enzymology (Methods Enzymol.) 198:3,1991), glutathione S-transferase (Smith and Johnson, Gene 67:31,1988), Glu-Glu affinity tag (Grussenyer et al, Proc. Natl. Acad. Sci. USA 82: 7952. minus 4,1985), substance P, flag. TM. peptide (Hopp et al, Biotechnology 6: 1204. minus 10,1988), streptavidin binding peptides or epitopes or binding domains of other antigens. Generally, DNA encoding affinity tags is available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, N.J.)) as described in Ford et al, Protein Expression and Purification (Protein Expression and Purification) 2:95-107,1991.

Among the many available affinity tag purification systems, the most commonly employed systems utilize either a polyhistidine (His) or glutathione S-transferase (GST) tag. His binds with good selectivity to a substrate incorporating Ni +2 ions, which is typically immobilized with iminodiacetic acid or nitrilotriacetic acid chelating groups. The technique is called immobilized metal affinity chromatography. The adsorption of the His-tagged protein is performed at neutral to slightly basic pH to prevent protonation of the weakly basic histidine imidazole groups and loss of binding capacity. Elution of bound protein is caused by displacement with imidazole or low pH conditions.

Methods of generating induced pluripotent stem cells from somatic cells without permanent introduction of foreign DNA are also described. The methods involve transiently transducing stem cells with a vector comprising a nucleotide sequence encoding a polypeptide sequence or a VP1(V1) or VP3(V3) portion thereof, or a capsid variant thereof, as described herein.

For these and other experiments, one skilled in the art knows how to modify and propagate AAV. For example, AAV-2 can be propagated both as a lytic virus and as a provirus. For lytic growth, AAV needs to be co-infected with a helper virus. Adenovirus or herpes simplex may provide helper functions. When no helper is available, the AAV may remain an integrated provirus, which involves recombination between the AAV terminus and the host sequences, and most of the AAV sequences remain intact in the provirus. The ability of AAV to integrate into host DNA allows propagation in the absence of helper virus. When cells carrying AAV provirus are subsequently infected with a helper, the integrated AAV genome is repaired and a productive lytic cycle is performed. Construction of vectors carrying specific modifications of rAAV and production of rAAV particles, e.g., using modified capsids, is described, e.g., in Shi et al (2001), Human Gene Therapy (Human Gene Therapy) 12: 1697-1711; rabinowitz et al (1999), Virology (Virology) 265: 274-285; nicklin et al (2001), Molecular Therapy (Molecular Therapy) 4: 174-181; wu et al (2000), J, virology 74: 8635-; and Grifman et al (2001) molecular therapy 3:964 and 974.

Yet another aspect relates to a pharmaceutical composition comprising an AAV clade F vector or AAV vector variant or AAV particle as described herein. The pharmaceutical composition comprising an AAV clade F vector or AAV vector variant or particle preferably comprises a pharmaceutically acceptable excipient, adjuvant, diluent, vehicle or carrier, or a combination thereof. A "pharmaceutically acceptable carrier" includes any material that, when combined with the active ingredients of a composition, allows the ingredients to retain biological activity and not elicit a destructive physiological response, such as an unwanted immune response. Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions (such as oil/water emulsions), and wetting agents. Compositions comprising such carriers are formulated by well-known conventional methods, such as those set forth in the following: remington's Pharmaceutical Sciences, current edition, Mack Publishing co., Easton pa.18042, USA; gennaro (2000) Remington: in The Science and Practice of medicine (Remington: The Science and Practice of Pharmacy, 20 th edition, Lippincott, Williams, & Wilkins; pharmaceutical Dosage Forms and Drug Delivery Systems (Pharmaceutical Dosage Forms and Drug Delivery Systems) (1999) h.c. ansel et al, 7 th edition, Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H.Kibbe et al, 3 rd edition of Amerer. Pharmaceutical Assoc. Such carriers can be formulated by conventional methods and can be administered to an individual at an appropriate dosage. Administration of a suitable composition can be achieved in different ways, for example by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. In some embodiments, the composition is formulated for administration to a mammal. In some embodiments, the composition is formulated for administration to a mammal via intravenous injection, subcutaneous injection, intramuscular injection, autologous cell transfer, or allogeneic cell transfer. The route of administration will, of course, depend, inter alia, on the type of carrier contained in the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, the dosage for any one patient depends on many factors, including the size of the patient, the body surface area, the age, sex, the particular compound to be administered, the time and route of administration, the type and stage of infection or disease, general health, and other drugs being administered concurrently.

Some of the AAV clade F vectors or capsid variants are capable of supporting long-term stable in vivo transgene expression after transplantation of transduced hematopoietic stem cells or after direct systemic delivery of rAAV.

In certain embodiments, a nucleic acid comprising a clade F capsid or AAV capsid isolate variant can be inserted into the genome of a new virus, wherein in addition to the clade F capsid or capsid isolate variant, the gene will be transmitted into the new virus with the same or similar tissue or organ tropism as the clade F capsid or AAV capsid isolate. Such gene therapy can be achieved using in vivo and ex vivo gene therapy procedures; see, e.g., U.S. patent No. 5,474,935; okada, Gene therapy (Gene Ther.) 3: 957-. Gene therapy using AAV clade F capsid or AAV capsid variant genes typically involves the in vitro introduction of a gene of interest into a new virus, either alone or together with another gene intended for therapeutic purposes. If a tropism gene is introduced together with one or more other genes, the resulting polypeptide is preferably administered for therapeutic purposes in the tissue to which the clade F capsid or AAV isolate has tropism. The virus may then be administered to a patient in need of such therapy, or may be administered ex vivo, e.g., to an organ awaiting transplantation. The virus may be a retrovirus, an RNA virus, a DNA virus, such as an adenoviral vector, an adeno-associated viral vector, a vaccinia viral vector, a herpes viral vector, and the like. Also encompassed are transfection methods using viral vectors using liposomes in which the novel viral vector is encapsulated for administration.

According to certain embodiments provided herein, a kit is provided comprising one or more AAV clade F vectors or AAV vector variants described herein, or a composition or formulation thereof. In certain embodiments, one or more AAV clade F vectors or AAV vector variants in the kit can be used for genome editing of a cell. In certain embodiments, the kit can be used as a research tool to investigate the effect of genome editing by one or more AAV clade F vectors or AAV vector variants.

Other aspects of the invention relate to a packaging system for recombinantly producing an AAV (e.g., an AAV clade F vector or an AAV variant vector) as described herein and methods of use thereof. In some embodiments, the packaging system comprises a Rep nucleotide sequence encoding one or more AAV Rep proteins of an AAV clade F capsid as described herein; a Cap nucleotide sequence encoding one or more AAV Cap proteins thereof; and a calibration genome as described herein, wherein the packaging system is operable in a cell for encapsulating the calibration genome in a capsid to form an adeno-associated virus.

In some embodiments, the packaging system comprises a first vector comprising Rep nucleotide sequences and Cap nucleotide sequences and a second vector comprising a corrected genome. As used in the context of a packaging system as described herein, "vector" refers to a nucleic acid molecule (e.g., a plastid, virus, cosmid, artificial chromosome, etc.) that is itself a vehicle for introducing nucleic acids into a cell.

In some embodiments of the packaging system, the AAV clade F capsid comprises at least one or at least two proteins selected from clade F VP1, clade F VP2 and clade F VP 3. In some embodiments of the packaging system, the AAV clade F capsid comprises clade F VP1, clade F VP2, and clade F VP 3. In some embodiments of the packaging system, the AAV clade F capsid is selected from the group consisting of: AAV9, AAVHSC1, AAVHSC2, AAVHSC3, AAVHSC4, AAVHSC5, AAVHSC6, AAVHSC7, AAVHSC8, AAVHSC9, AAVHSC10, AAVHSC11, AAVHSC12, AAVHSC13, AAVHSC14, AAVHSC15, AAVHSC16, AAVHSC17, AAVHU31 and AAVHU 32.

In some embodiments of the packaging system, the Rep nucleotide sequence encodes an AAV2 Rep protein. In some embodiments of the packaging system, the encoded AAV2 Rep protein is at least one of Rep 78/68 or Rep 68/52. In some embodiments of the packaging system, the nucleotide sequence encoding the AAV2 Rep protein comprises a nucleotide sequence encoding a protein having a minimum percentage of sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO:40, wherein the minimum percentage of sequence identity is at least 70% (e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%) across the length of the amino acid sequence of the AAV2 Rep protein.

Exemplary AAV2 Rep amino acid sequence (SEQ ID NO:40) -

mpgfyeivikvpsdldehlpgisdsfvnwvaekewelppdsdmdlnlieqapltvaeklqrdfltewrrvskapealffvqfekgesyfhmhvlvettgvksmvlgrflsqirekliqriyrgieptlpnwfavtktrngagggnkvvdecyipnyllpktqpelqwawtnmeqylsaclnlterkrlvaqhlthvsqtqeqnkenqnpnsdapvirsktsarymelvgwlvdkgitsekqwiqedqasyisfnaasnsrsqikaaldnagkimsltktapdylvgqqpvedissnriykilelngydpqyaasvflgwatkkfgkrntiwlfgpattgktniaeaiahtvpfygcvnwtnenfpfndcvdkmviwweegkmtakvvesakailggskvrvdqkckssaqidptpvivtsntnmcavidgnsttfehqqplqdrmfkfeltrrldhdfgkvtkqevkdffrwakdhvvevehefyvkkggakkrpapsdadisepkrvresvaqpstsdaeasinyadryqnkcsrhvgmnlmlfpcrqcermnqnsnicfthgqkdclecfpvsesqpvsvvkkayqklcyihhimgkvpdactacdlvnvdlddcifeq

In some embodiments of the packaging system, the packaging system further comprises a third vector, such as a helper viral vector. The third vector may be a separate third vector, integral with the first vector, or integral with the second vector. In some embodiments, the third vector comprises a gene encoding a helper viral protein.

In some embodiments of the packaging system, the helper virus is selected from the group consisting of: adenovirus, herpes virus (including Herpes Simplex Virus (HSV)), poxvirus (e.g., vaccinia virus), Cytomegalovirus (CMV), and baculovirus. In some embodiments of the packaging system wherein the helper virus is an adenovirus, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of: e1, E2, E4 and VA. In some embodiments of the packaging system wherein the helper virus is HSV, the HSV genome comprises one or more of the HSV genes selected from the group consisting of: UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL 42.

In some embodiments of the packaging system, the first, second, and/or third vectors are contained within one or more transfectants. In some embodiments, the first vector and the third vector are contained within a first transfection entity. In some embodiments, the second vector and the third vector are contained within a second transfectant.

In some embodiments of the packaging system, the first, second and/or third vector is contained within one or more recombinant helper viruses. In some embodiments, the first vector and the third vector are contained within a recombinant helper virus. In some embodiments, the second vector and the third vector are contained within a recombinant helper virus.

In some aspects, the invention provides a method for recombinantly producing an AAV (e.g., an AAV clade F vector or an AAV variant vector) as described herein, wherein the method comprises transfecting or transducing a cell with a packaging system as described under conditions operable for encapsulating a calibration genome in a capsid to form an AAV (e.g., an AAV clade F vector or an AAV variant vector) as described herein. Exemplary methods for recombinant production of AAV include transient transfection (e.g., with one or more transfection plasmids containing first and second vectors as described herein and optionally a third vector), viral infection (e.g., with one or more recombinant helper viruses, such as adenovirus, poxvirus (e.g., vaccinia virus), herpesvirus (including Herpes Simplex Virus (HSV), cytomegalovirus, or baculovirus containing first and second vectors as described herein and optionally a third vector), and stable production cell lines (e.g., with stable production cells, such as mammalian or insect cells, containing Rep nucleotide sequences encoding one or more AAV Rep proteins of an AAV clade F capsid as described herein and/or Cap nucleotide sequences encoding one or more AAV Cap proteins thereof, and wherein the calibration genome as described herein is delivered in the form of a transfected plasmid or a recombinant helper virus).

For purposes of example only, the present invention includes, but is not limited to, the following:

1. a replication-defective adeno-associated virus (AAV) comprising a calibration genome encapsulated in a capsid,

the capsid is an AAV clade F capsid; and is

The correction genome comprises (a) an editing element selected from an internucleotide linkage or a nucleotide sequence for integration into a locus of interest of a mammalian chromosome, (b) 5' to the 5' end of the editing element '

A homology arm nucleotide sequence, said nucleotide sequence having homology to a 5 'region in said mammalian chromosome relative to said target locus, and (c) a 3' homology arm nucleotide sequence located 3 'of said editing element, said nucleotide sequence having homology to a 3' region in said mammalian chromosome relative to said target locus.

2. A replication-defective adeno-associated virus (AAV) comprising a calibration genome encapsulated in a capsid,

the capsid is an AAV clade F capsid; and is

The calibration genome comprises an editing element nucleotide sequence for integration into a target locus of a mammalian chromosome, and the calibration genome is substantially absent of a promoter operably linked to the editing element nucleotide sequence.

3. A replication-defective adeno-associated virus (AAV) comprising a correction genome enclosed in a capsid, wherein the capsid is an AAV clade F capsid;

the calibration genome comprises editing elements selected from the group consisting of internucleotide linkages or nucleotide sequences for integration into a target locus of a mammalian chromosome in a cell; and is

The AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome in the cell of at least about 1%.

4. The AAV of claim 3, wherein the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the chromosome of the mammalian cell of at least about 1% in the absence of an exogenous nuclease.

5. The AAV of any of claims 1-4, wherein the calibration genome comprises

A 5 'inverted terminal repeat (5' ITR) nucleotide sequence located 5 'to the 5' end of the 5 'homology arm nucleotide sequence and a 3' inverted terminal repeat (3'ITR) nucleotide sequence located 3' to the 3 'end of the 3' homology arm nucleotide sequence.

6. The AAV of claim 5, wherein the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially identical to an AAV2 virus 5'ITR and an AAV2 virus 3' ITR, respectively.

7. The AAV of any one of claims 5 or 6, wherein the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially mirror images of each other.

8. The AAV of any one of claims 5 to 7, wherein the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO:36 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 37.

9. The AAV of claim 4, wherein the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially identical to an AAV5 virus 5'ITR and an AAV5 virus 3' ITR, respectively.

10. The AAV of claim 9, wherein the 5'ITR nucleotide sequence and the 3' ITR nucleotide sequence are substantially mirror images of each other.

11. The AAV of any one of claims 5, 9, or 10, wherein the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID No. 38 and the 3' ITR nucleotide sequence has at least 95% sequence identity to SEQ ID No. 39.

12. The AAV of any one of claims 1 or 3-11, wherein the correction genome is substantially absent of a promoter operably linked to the editing element nucleotide sequence.

13. The AAV of any one of claims 1 or 3-11, wherein the correction genome further comprises an exogenous promoter operably linked to the editing element.

14. The AAV of any one of the preceding claims, wherein the replication-defective AAV genome comprises a substantial absence of an AAV rep gene and an AAV cap gene.

15. The AAV of any one of the preceding claims, wherein each of the 5 'and 3' homology arm nucleotide sequences independently has a nucleotide length of between about 500 to 1000 nucleotides or between about 600 to 1000 nucleotides.

16. The AAV of any one of the preceding claims, wherein the 5 'and 3' homology arm nucleotide sequences have substantially equal nucleotide lengths.

17. The AAV of any one of the preceding claims, wherein the 5 'and 3' homology arm nucleotide sequences have asymmetric nucleotide lengths.

18. The AAV of any one of the preceding claims, wherein the 5 'homology arm nucleotide sequence has at least about 95% nucleotide sequence identity to the 5' region in the mammalian chromosome relative to the target locus.

19. The AAV of any one of the preceding claims, wherein the 3 'homology arm nucleotide sequence has at least about 95% nucleotide sequence identity to the 3' region in the mammalian chromosome relative to the target locus.

20. The AAV of any one of claims 1-19, wherein the 5 'homology arm nucleotide sequence has 100% sequence identity to the 5' region in the mammalian chromosome relative to the target locus, and the 3 'homology arm nucleotide sequence has 100% sequence identity to the 3' region in the mammalian chromosome relative to the target locus.

21. The AAV of any one of the preceding claims, wherein the editing element consists of one nucleotide.

22. The AAV of claim 21, wherein the target locus is a nucleotide sequence consisting of one nucleotide and the target locus represents a point mutation of the mammalian chromosome.

23. The AAV of any one of claims 1-20, wherein the editing element comprises at least 1, 2, 10, 100, 200, 500, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides.

24. The AAV of any one of claims 1-20, wherein the editing element comprises 1 to 5500, 1 to 5000, 1 to 4500, 1 to 4000, 1 to 3000, 1 to 2000, 1 to 1000, 1 to 500, 1 to 200, or 1 to 100 nucleotides, or 2 to 5500, 2 to 5000, 2 to 4500, 2 to 4000, 2 to 3000, 2 to 2000, 2 to 1000, 2 to 500, 2 to 200, or 2 to 100 nucleotides, or 10 to 5500, 10 to 5000, 10 to 4500, 10 to 4000, 10 to 3000, 10 to 2000, 10 to 1000, 10 to 500, 10 to 200, or 10 to 100 nucleotides.

25. The AAV of any one of claims 1-24, wherein the editing element comprises an exon, an intron, a 5 'untranslated region (UTR), a 3' UTR, a promoter, a splice donor, a splice acceptor, a sequence encoding or non-encoding an RNA, an insulator, a gene, or a combination thereof.

26. The AAV of claim 25, wherein the editing element is a fragment of a coding sequence of a gene within or across the locus of interest.

27. The AAV of any one of the preceding claims, wherein

The target locus is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 1;

The editing element comprises m nucleotides, wherein m is an integer equal to n; and is

The editing element represents a substitution of the target locus of the mammalian chromosome.

28. The AAV of any one of the preceding claims, wherein

The target locus is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 1;

the editing element comprises m nucleotides, wherein m is an integer greater than n; and is

The editing element represents a substitutional addition to the target locus of the mammalian chromosome.

29. The AAV of any one of the preceding claims, wherein

The target locus is a nucleotide sequence comprising n nucleotides, wherein n is an integer greater than or equal to 2;

the editing element comprises m nucleotides, wherein m is an integer less than n; and is

The editing element represents a substitutional deletion to the target locus of the mammalian chromosome.

30. The AAV of any one of the preceding claims, wherein

The target locus is an internucleotide linkage;

the editing element comprises m nucleotides, wherein m is an integer greater than or equal to 1; and is

The editing element represents an addition to the target locus of the mammalian chromosome.

31. The AAV of any one of claims 1 or 3-26, wherein the editing element is an internucleotide linkage.

32. The AAV of claim 31, wherein the target locus is a nucleotide sequence comprising one or more nucleotides and the editing element comprises a deletion of the target locus to the mammalian chromosome.

33. The AAV of any one of the preceding claims, wherein the target locus of the mammalian chromosome is a mutant target locus comprising one or more mutant nucleotides relative to a corresponding wild type mammalian chromosome.

34. The AAV of claim 33, wherein the mutant target locus comprises a point mutation, a missense mutation, a nonsense mutation, an insertion of one or more nucleotides, a deletion of one or more nucleotides, or a combination thereof.

35. The AAV of claims 33 or 34, wherein the mutant target locus comprises a null (amorphic) mutation, a neogenic (neomorphic) mutation, or an anti-genic (antimorphic) mutation.

36. The AAV of any one of claims 33-35, wherein the mutant target locus comprises an autosomal dominant mutation, an autosomal recessive mutation, a heterozygote mutation, a homozygote mutation, or a combination thereof.

37. The AAV of claim 33 or 34, wherein the mutant target locus is selected from the group consisting of a promoter, an enhancer, a signal sequence, an intron, an exon, a splice donor site, a splice acceptor site, an internal ribosome entry site, an inverted exon, an insulator, a gene, a chromosome inversion, and a chromosomal translocation within the mammalian chromosome.

38. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises at least one protein selected from clade F VP1, clade F VP2 and clade F VP 3.

39. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises at least two proteins selected from clade F VP1, clade F VP2 and clade F VP 3.

40. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises clade F VP1, clade F VP2 and clade F VP3 proteins.

41. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises VP1, VP2 or VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736 or amino acids 203 to 736 of SEQ ID No. 1, respectively, which correspond to the amino acid sequences of AAV9 capsid proteins VP1, VP2 and VP3, respectively.

42. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises:

VP1 and VP2 proteins having at least 90% amino acid sequence identity to amino acids 1 to 736 and amino acids 138 to 736, respectively, of SEQ ID No. 1, which correspond to the amino acid sequences of AAV9 capsid proteins VP1 and VP2, respectively;

VP1 and VP3 proteins having at least 90% amino acid sequence identity to amino acids 1 to 736 and amino acids 203 to 736, respectively, of SEQ ID No. 1, which correspond to the amino acid sequences of AAV9 capsid proteins VP1 and VP3, respectively; or

VP2 and VP3 proteins having at least 90% amino acid sequence identity with amino acids 138 to 736 and amino acids 203 to 736, respectively, of SEQ ID NO. 1, which correspond to the amino acid sequences of AAV9 capsid proteins VP2 and VP3, respectively.

43. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises VP1, VP2, and VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of SEQ ID No. 1, respectively, which correspond to the amino acid sequences of AAV9 capsid proteins VP1, VP2, and VP3, respectively.

44. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises VP1, VP2, or VP3 protein having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, or amino acids 203 to 736 of any one of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively.

45. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises:

VP1 and VP2 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736 and amino acids 138 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17 or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1 and VP2, respectively;

VP1 and VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736 and amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17 or 13, respectively, which correspond to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1 and VP3, respectively; or

VP2 and VP3 proteins having at least 90% amino acid sequence identity with amino acids 138 to 736 and amino acids 203 to 736 of any of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17 or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP2 and VP3, respectively.

46. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises VP1, VP2, and VP3 proteins having at least 90% amino acid sequence identity with amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736 of any one of SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively, corresponding to the amino acid sequences of AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively.

47. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises VP1, VP2 or VP3 proteins encoded by nucleotide sequences comprising at least 90% nucleotide sequence identity with SEQ ID NO:18, respectively, corresponding to the nucleotide sequences encoding AAV9 capsid proteins VP1, VP2 and VP3, respectively.

48. The AAV of any one of claims 1-37, wherein the AAV clade F capsid comprises:

VP1 and VP2 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to SEQ ID No. 18;

VP1 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to SEQ ID No. 18; or

VP2 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to SEQ ID NO. 18.

49. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises VP1, VP2 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity with SEQ ID No. 18, which nucleotide sequence corresponds to the nucleotide sequence encoding AAV9 capsid proteins VP1, VP2 and VP 3.

50. The AAV according to any one of claims 1 to 40, wherein the AAV clade F capsid comprises VP1, VP2 or VP3 protein encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOs 20, 21, 22, 23, 25, 24, 27, 28, 29, 26, 30, 31, 32, 33, 34 or 35, respectively, which corresponds to the nucleotide sequences encoding AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2 and VP3, respectively.

51. The AAV of any one of claims 1-37, wherein the AAV clade F capsid comprises:

VP1 and VP2 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOS 20-35;

VP1 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOS 20-35; or

VP2 and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOS 20-35.

52. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises VP1, VP2, and VP3 proteins encoded by a nucleotide sequence comprising at least 90% nucleotide sequence identity to any one of SEQ ID NOs 20, 21, 22, 23, 25, 24, 27, 28, 29, 26, 30, 31, 32, 33, 34, or 35, which corresponds to the nucleotide sequences encoding AAVF1 to AAVF9 and AAVF11 to AAVF17 capsid proteins VP1, VP2, and VP3, respectively.

53. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises AAV9 VP1, VP2, or VP3 capsid proteins corresponding to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID NO: 1.

54. The AAV of any one of claims 1-40, wherein the AAV clade F capsid comprises:

AAV9 VP1 and VP2 capsid proteins corresponding to amino acids 1 to 736 and amino acids 138 to 736, respectively, as set forth in SEQ ID NO: 1;

AAV9 VP1 and VP3 capsid proteins corresponding to amino acids 1 to 736 and amino acids 203 to 736 as set forth in SEQ ID NO:1, respectively; or

AAV9 VP2 and VP3 capsid proteins corresponding to amino acids 138 to 736 and amino acids 203 to 736, respectively, as set forth in SEQ ID NO: 1.

55. The AAV of any one of the preceding claims, wherein the AAV clade F capsid comprises AAV9 capsid proteins VP1, VP2, and VP3, which correspond to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736 as set forth in SEQ ID NO:1, respectively.

56. The AAV of any one of claims 1-52, wherein the AAV clade F capsid comprises VP1 capsid protein of VP1 capsid protein selected from any one of AAVF1 to AAVF9 and AAVF11 to AAVF17, which capsid protein corresponds to amino acids 1 to 736 as set forth in SEQ ID No. 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively.

57. The AAV of any one of claims 1-52, wherein the AAV clade F capsid comprises VP1 and VP2 capsid proteins independently selected from VP1 and VP2 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17, corresponding to amino acids 1 to 736 and amino acids 138 to 736, respectively, as set forth in SEQ ID NO:2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13.

58. The AAV of any one of claims 1-52, wherein the AAV clade F capsid comprises VP1, VP2, and VP3 capsid proteins independently selected from VP1, VP2, and VP3 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17, which capsid proteins correspond to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736, respectively, as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13.

59. The AAV of any one of claims 1-52, wherein the AAV clade F capsid comprises each of VP1, VP2, and VP3 capsid proteins of any one of AAVF1 to AAVF9 and AAVF11 to AAVF17 corresponding to amino acids 1 to 736, amino acids 138 to 736, and amino acids 203 to 736 as set forth in SEQ ID NOs 2, 3, 5, 6, 11, 7, 8, 9, 10, 4, 12, 14, 15, 16, 17, or 13, respectively.

60. The AAV of any one of claims 1-4, wherein the mammalian chromosome is selected from human chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, and Y.

61. The AAV of any one of claims 1-4, wherein the mammalian chromosome is selected from mouse chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, X, and Y.

62. The AAV of any one of claims 1-4, wherein the mammalian chromosome is not human chromosome 19.

63. The AAV of any one of claims 60-62, wherein the mammalian chromosome is a somatic chromosome.

64. The AAV of claim 63, wherein the somatic cells are from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue.

65. The AAV of claim 63, wherein the somatic cells are from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage.

66. The AAV of any one of claims 63-65, wherein the somatic cells are CD34+ cells.

67. The AAV of any one of claims 60-62, wherein the cell is a stem cell.

68. The AAV of claim 67, wherein the stem cell is a hematopoietic stem cell, an umbilical cord blood stem cell, a bone marrow stem cell, a fetal liver stem cell, or a peripheral blood stem cell.

69. The AAV of any one of claims 60-62, wherein the cell is selected from the group consisting of: CD34+ hematopoietic stem cell line (HSC), K562 CD34+ leukemia cell line, HepG2 human liver cell line, peripheral blood stem cell, cord blood stem cell, CD34+ peripheral blood stem cell, WI-38 human diploid fibroblast cell line, MCF7 human breast cancer cell line, Y79 human retinoblastoma cell line, SCID-X1LBL human EBV immortalized B cell line, primary human hepatocytes, primary hepatic sinusoid endothelial cells, and primary skeletal myoblasts.

70. The AAV of any one of the preceding claims, wherein the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome in the cell of at least about 5%.

71. The AAV of any one of the preceding claims, wherein the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome in the cell of at least about 10%.

72. A composition comprising an adeno-associated virus (AAV) according to any of the preceding claims, wherein the composition is in a pharmaceutically acceptable formulation.

73. The composition of claim 72, wherein the formulation is configured for administration to a mammal.

74. The composition of claim 73, wherein the formulation is configured for administration to a mammal via intravenous injection, subcutaneous injection, intramuscular injection, autologous cell transfer, or allogeneic cell transfer.

75. The composition of claim 72, wherein the pharmaceutically acceptable formulation comprises an excipient.

76. The composition of claim 75, wherein the excipient is selected from a carrier, an adjuvant, and a vehicle, or a combination thereof.

77. A packaging system for recombinant production of adeno-associated virus (AAV), wherein the packaging system comprises

A Rep nucleotide sequence encoding one or more AAV Rep proteins of an AAV clade F capsid;

a Cap nucleotide sequence encoding one or more AAV Cap proteins thereof; and

a corrected genome according to any one of claims 1 to 71;

wherein the packaging system is operable in a cell to encapsulate the calibration genome in the capsid to form the adeno-associated virus.

78. The packaging system of claim 77, wherein the packaging system comprises a first vector comprising the Rep nucleotide sequences and the Cap nucleotide sequences and a second vector comprising the calibration genome.

79. The packaging system of claim 77 or 78, wherein the AAV clade F capsid comprises at least one protein selected from clade F VP1, clade F VP2 and clade F VP 3.

80. The packaging system of claim 77 or 78, wherein the AAV clade F capsid comprises at least two proteins selected from clade F VP1, clade F VP2 and clade F VP 3.

81. The packaging system of claim 77 or 78, wherein the AAV clade F capsid comprises clade F VP1, clade F VP2 and clade F VP3 proteins.

82. The packaging system of claim 77 or 78, wherein the AAV clade F capsid is an AAV clade F capsid according to any one of claims 38-59.

83. The packaging system of any one of claims 77-82, wherein the Rep nucleotide sequence encodes an AAV2 Rep protein.

84. The packaging system of claim 83, wherein the encoded AAV2 Rep protein is at least one of Rep78/68 or Rep 68/52.

85. The packaging system of claim 83 or 84, wherein the nucleotide sequence encoding the AAV2 Rep protein comprises a nucleotide sequence having a minimum percentage of sequence identity with the AAV2 Rep nucleotide sequence of SEQ ID NO:40, wherein the minimum percentage of sequence identity is at least 70% across the length of the nucleotide sequence encoding the AAV2 Rep protein.

86. The packaging system of any one of claims 77-85, further comprising a third vector, wherein the third vector is a helper viral vector.

87. The packaging system of claim 86, wherein the helper viral vector is a separate third vector.

88. The packaging system of claim 86, wherein the helper viral vector is integrated with the first vector.

89. The packaging system of claim 86, wherein the helper viral vector is integrated with the second vector.

90. The packaging system of any one of claims 86-89, wherein the third vector comprises a gene encoding a helper viral protein.

91. The packaging system of any one of claims 89-90, wherein the helper virus is selected from the group consisting of: adenovirus, herpes virus (including Herpes Simplex Virus (HSV)), vaccinia virus, and Cytomegalovirus (CMV).

92. The packaging system of claim 91, wherein the helper virus is an adenovirus.

93. The packaging system of claim 92, wherein the adenoviral genome comprises one or more adenoviral RNA genes selected from the group consisting of: e1, E2, E4 and VA.

94. The packaging system of claim 91, wherein the helper virus is HSV.

95. The packaging system of claim 94, wherein the HSV genome comprises one or more of the HSV genes selected from the group consisting of: UL5/8/52, ICPO, ICP4, ICP22 and UL30/UL 42.

96. The packaging system of any of claims 86-95, wherein the first vector and the third vector are contained within a first transfection plasmid.

97. The packaging system of any one of claims 86-95, wherein the nucleotides of the second vector and the third vector are contained within a second transfectant.

98. The packaging system of any one of claims 86-95, wherein the nucleotides of the first vector and the third vector are cloned into a recombinant helper virus.

99. The packaging system of any one of claims 86-95, wherein the nucleotides of the second vector and the third vector are cloned into a recombinant helper virus.

100. The packaging system of any one of claims 77-99, wherein the AAV capsid is a capsid of a clade F AAV selected from the group consisting of: AAV9, AAVF1, AAVF2, AAVF3, AAVF4, AAVF5, AAVF6, AAVF7, AAVF8, AAVF9, AAVF11, AAVF12, AAVF13, AAVF14, AAVF15, AAVF16, AAVF17, AAVHU31, and AAVHU 32.

101. A gene editing vector comprising a replication-defective adeno-associated virus (AAV) comprising a calibration genome enclosed in an AAV capsid, the calibration genome comprising

An editing element selected from an internucleotide linkage or a nucleotide sequence for integration into a target locus of a chromosome of a mammalian cell;

a 5' homology arm nucleotide sequence located 5' to said editing element, said nucleotide sequence having homology to a 5' region in said chromosome relative to said target locus;

a 3' homology arm nucleotide sequence located 3' of said editing element, said nucleotide sequence having homology with a 3' region in said chromosome relative to said target locus; and is

Wherein the AAV is used for chromosomal integration efficiency of at least about 10% for integration of the editing element into the target locus of the chromosome of the mammalian cell in the absence of an exogenous nuclease.

102. The gene editing vector of claim 101, wherein the calibration genome is as defined in any one of claims 5 to 71.

103. A method for recombinantly producing an adeno-associated virus (AAV), wherein the method comprises transfecting a cell with a packaging system according to any one of claims 77-97 under conditions operable for encapsulating a calibration genome in a capsid to form the AAV.

104. A method for recombinantly producing an adeno-associated virus (AAV), wherein the method comprises transducing cells with a packaging system according to any one of claims 77-96, 98 or 99 under conditions operable to encapsulate a calibration genome in a capsid to form the AAV.

105. A method for editing a target locus of a mammalian genome, wherein the method comprises transducing a cell comprising the mammalian genome with an adeno-associated virus (AAV) according to any one of claims 1 to 71.

106. The method of claim 105, wherein the cell is a mammalian cell.

107. The method of claim 106, wherein the mammalian cells are from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue.

108. The method of claim 106 or 107, wherein the mammalian cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage.

109. The method of claim 106 or 107, wherein the mammalian cell is a stem cell.

110. The method of claim 109, wherein the stem cells are hematopoietic stem cells, umbilical cord blood stem cells, or peripheral blood stem cells.

111. The method of claim 106, wherein the mammalian cell is a myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte, or retinal cell.

112. A method for editing a target locus of a mammalian genome, wherein the method comprises:

(a) obtaining mammalian cells from a mammal;

(b) culturing the mammalian cell ex vivo to form an ex vivo culture;

(c) transducing said mammalian cells with an adeno-associated virus (AAV) according to any one of claims 1 to 71 in said ex vivo culture to form transduced mammalian cells; and

(d) administering the transduced mammalian cells to the mammal.

113. A method for editing a target locus of a mammalian genome, wherein the method comprises:

(a) obtaining mammalian cells from a first mammal;

(b) culturing the mammalian cell ex vivo to form an ex vivo culture;

(c) transducing said mammalian cells with an adeno-associated virus (AAV) according to any one of claims 1 to 71 in said ex vivo culture to form transduced mammalian cells; and

(d) Administering the transduced mammalian cells to a second mammal.

114. The method of claim 113, wherein the first mammal and the second mammal are the same species.

115. The method of claim 113 or 114, wherein the mammalian cells are from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue.

116. The method of claim 113 or 114, wherein the mammalian cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage.

117. The method of claim 113 or 114, wherein the mammalian cell is a stem cell.

118. The method of claim 117, wherein the stem cells are hematopoietic stem cells, umbilical cord blood stem cells, or peripheral blood stem cells.

119. The method of any one of claims 113-118, wherein the mammalian cells are CD34+ cells.

120. The method of any one of claims 113-119, wherein the mammalian cell is a myoblast, endothelial cell, liver cell, fibroblast, breast cell, lymphocyte, or retinal cell.

121. A method for editing a target locus of a mammalian genome, wherein the method comprises:

administering to the mammal an adeno-associated virus (AAV) according to any of claims 1-71 or a composition according to any of claims 72-76 in an amount effective to transduce mammalian cells in vivo with the adeno-associated virus (AAV).

122. The method of any one of claims 105-121, wherein the AAV is transduced or administered without co-transduction or co-administration of an exogenous nuclease or a nucleotide sequence encoding an exogenous nuclease.

123. The method of any one of claims 105-122, wherein the AAV has a chromosomal integration efficiency for integrating the editing element into the target locus of the mammalian chromosome of at least about 1%.

124. The method of any one of claims 105-122, wherein the chromosomal integration efficiency of the AAV for integrating the editing element into the target locus of the mammalian chromosome is at least about 2%, 3%, 4%, or 5%.

125. The method of any one of claims 105-122, wherein the genome-corrected editing elements are integrated into the target locus of the mammalian chromosome with a chromosomal integration efficiency of the mammalian cell of at least 10%, 20%, 40%, or 50%.

126. The method of any one of claims 105-122, wherein the editing elements of the calibration genome integrate into the target locus of the mammalian chromosome with a chromosomal integration efficiency ranging from 10% to 70%, 20% to 70%, 40% to 70%, or 50% to 70% in the mammalian cell.

127. The method of any one of claims 105-122, wherein the AAV has a chromosomal integration efficiency that is further characterized by an allele frequency in a population of cells of at least about 10% for an allele comprising the editing element integrated into the target locus of the mammalian chromosome.

128. The method of any one of claims 105-122, wherein the AAV has a chromosomal integration efficiency that is further characterized by an allele frequency in a population of cells of at least about 50% for an allele comprising the editing element integrated into the target locus of the mammalian chromosome.

129. The method of any one of claims 105-122, wherein the AAV has a chromosomal integration efficiency that is further characterized by an allele frequency in a population of cells of at least about 75% for an allele comprising the editing element integrated into the target locus of the mammalian chromosome.

130. The method of any one of claims 127-129, wherein the allele frequency in the cell population is the allele frequency in an in vitro cell population.

131. A method for producing a transgenic non-human animal, the method comprising:

administering to a non-human animal an adeno-associated virus (AAV) according to any of claims 1-71 or a composition according to any of claims 72-76; or

Transducing a non-human animal cell with an AAV according to any of claims 1 to 71 or a composition according to any of claims 72 to 76, and implanting the cell into a host non-human animal under conditions sufficient to produce a transgenic non-human animal from the host non-human animal.

132. The method of claim 131, wherein the non-human animal cell is derived from a zygote or embryo of a non-human animal.

133. The method of claim 131 or 132, wherein the non-human animal is a mouse, rat, rabbit, pig, cow, sheep, goat, chicken, cat, dog, ferret, or primate.

134. A transgenic non-human animal obtainable by a method according to any one of claims 131 to 133.

135. A tissue derived from the transgenic non-human animal of claim 134.

136. The organization of claim 135, wherein the organization is selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue.

137. The tissue of claim 135, wherein the tissue is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage.

138. A cell derived from the transgenic non-human animal according to claim 134.

139. The cell of claim 138, wherein the cell is a primary cell.

140. The cell of claim 138, wherein the cell is a CD34+ cell, a hepatocyte, a myoblast, an endothelial cell, a liver cell, a fibroblast, a breast cell, a lymphocyte, or a retinal cell.

141. The cell of claim 138, wherein the cell is an Induced Pluripotent Stem (iPS) cell.

142. The cell of claim 138, wherein the cell is from a tissue selected from the group consisting of: connective tissue (including blood), muscle tissue, nerve tissue, endothelial tissue, and epithelial tissue.

143. The cell of claim 138, wherein the cell is from an organ selected from the group consisting of: lung, heart, liver, kidney, muscle, brain, eye, breast, bone and cartilage.

144. The cell of claim 138, wherein the cell is a stem cell.

145. The cell of claim 144, wherein the stem cell is a hematopoietic stem cell, an umbilical cord blood stem cell, or a peripheral blood stem cell.

146. A cell obtainable by a method according to any one of claims 105 to 111.

Other exemplary, non-limiting embodiments of the invention are provided below.

Example 1. an adeno-associated virus (AAV) vector variant for editing the genome of a stem cell, comprising one or more capsid variants; a targeting cassette comprising one or more therapeutic nucleotide sequences to be integrated into a target site of the genome; a 5' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region upstream of the target site; and a 3' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region located downstream of the target site.

Example 2. the AAV vector variant of example 1, wherein the one or more capsid variants comprise a polypeptide sequence selected from the group consisting of: HSC7(SEQ ID NO:8), HSC12(SEQ ID NO:12), HSC15(SEQ ID NO:16), HSC17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof.

Example 3. the AAV vector variant of example 2, wherein the one or more capsid variants comprise a polypeptide sequence having a percent of at least 95% sequence identity to a polypeptide sequence selected from the group consisting of: HSC7(SEQ ID NO:8), HSC12(SEQ ID NO:12), HSC15(SEQ ID NO:16), HSC17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof.

Example 4. the AAV vector variant according to example 1, wherein the target site is a safe harbor site.

Example 5. the AAV vector variant of example 4, wherein the safe harbor site is the AAVs1 locus on chromosome 19.

Example 6. the AAV vector variant of example 1, wherein the stem cell is a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell.

Example 7 a method of editing the genome of a stem cell, comprising transducing the stem cell with one or more adeno-associated virus (AAV) vector variants in the absence of other exogenous nucleases, the vector variants comprising one or more capsid variants; a targeting cassette comprising one or more therapeutic nucleotide sequences to be integrated into a target site of the genome; a 5' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region upstream of the target site; and a 3' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region located downstream of the target site.

Embodiment 8 the method of embodiment 7, wherein the one or more capsid variants comprise a polypeptide sequence selected from the group consisting of: HSC7(SEQ ID NO:8), HSC12(SEQ ID NO:12), HSC15(SEQ ID NO:16), HSC17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof.

Example 9. the method of example 7, wherein the AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences.

Embodiment 10. the method of embodiment 7, wherein the target site is a safe harbor site.

Example 11. the method of example 10, wherein the safe harbor site is the AAVS1 locus on chromosome 19.

Embodiment 12 the method of embodiment 7, wherein the stem cells are hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, or mesenchymal stem cells.

Example 13 a method of treating a disease or disorder in an individual by editing the genome of the individual's stem cells, comprising transducing the individual's stem cells with an adeno-associated virus (AAV) vector variant in the absence of other exogenous nucleases, the vector variant comprising one or more capsid variants; a targeting cassette comprising one or more therapeutic nucleotide sequences to be integrated into a target site in the genome of the stem cell; a 5' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region upstream of the target site; a 3' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region located downstream of the target site; and transplanting the transduced stem cells into the individual, wherein the transduced stem cells treat the disease or disorder.

Example 14. the method of example 13, wherein the one or more capsid variants comprise a polypeptide sequence from the group consisting of seq id no: HSC7(SEQ ID NO:8), HSC12(SEQ ID NO:12), HSC15(SEQ ID NO:16), HSC17(SEQ ID NO:13), variants, fragments, mutants, and any combination thereof.

Example 15 the method of example 13, wherein the AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences.

Embodiment 16 the method of embodiment 13, wherein the target site is a safe harbor site.

Example 17. the method of example 16, wherein the safe harbor site is the AAVS1 locus on chromosome 19.

Embodiment 18 the method of embodiment 13, wherein the stem cells are hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, or mesenchymal stem cells.

The method of embodiment 13, wherein the disease or disorder is caused by one or more mutations in the genome of the cell.

The method of embodiment 19, wherein the disease or disorder is selected from the group consisting of inherited metabolic diseases, lysosomal storage diseases, mucopolysaccharidosis, immunodeficiency diseases, and hemoglobinopathies and infections.

Example 21 a method of treating a disease or disorder in an individual by genome editing in vivo on cells of the individual by administering directly to the individual an AAV vector variant, the vector comprising one or more capsid variants; a targeting cassette comprising one or more therapeutic nucleotide sequences to be integrated into a target site in the genome; a 5' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region upstream of the target site; and a 3' homology arm polynucleotide sequence flanking the targeting cassette and having homology to a region located downstream of the target site, wherein the vector transduces the cells of the individual and integrates the one or more therapeutic nucleotide sequences into the genome of the cells.

Embodiment 22. the method of embodiment 21, wherein the one or more capsid variants comprise a polypeptide sequence selected from the group consisting of: HSC1(SEQ ID NO:2), HSC2(SEQ ID NO:3), HSC11(SEQ ID NO:4), HSC3(SEQ ID NO:5), HSC4(SEQ ID NO:6), HSC6(SEQ ID NO:7), HSC7(SEQ ID NO:8), HSC8(SEQ ID NO:9), HSC9(SEQ ID NO:10), HSC5(SEQ ID NO:11), HSC12(SEQ ID NO:12), HSC17(SEQ ID NO:13), HSC13(SEQ ID NO:14), HSC14(SEQ ID NO:15), HSC15(SEQ ID NO:16), HSC16(SEQ ID NO:17), variants, fragments, mutants, and any combination thereof.

Embodiment 23. the method of embodiment 21, wherein the cell is a stem cell.

Embodiment 24. the method of embodiment 23, wherein the stem cell is a hematopoietic stem cell, a pluripotent stem cell, an embryonic stem cell, or a mesenchymal stem cell.

The method of embodiment 24, wherein the disease or disorder is caused by one or more mutations in the genome of the cell.

Embodiment 26 the method of embodiment 25, wherein the disease or disorder is selected from the group consisting of inherited metabolic diseases, lysosomal storage diseases, mucopolysaccharidosis, immunodeficiency diseases, and hemoglobinopathies and infections.

Example 27 the method of example 21, wherein the AAV vector variant does not contain a promoter for one or more therapeutic nucleotide sequences.

Embodiment 28 the method of embodiment 22, wherein the target site is a safe harbor site.

Example 29. the method of example 23, wherein the safe harbor locus is the AAVS1 locus on chromosome 19.

The following examples are intended to illustrate various embodiments of the present invention. Accordingly, the specific embodiments discussed should not be construed as limiting the scope of the invention. It will be apparent to those skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the invention, and it is to be understood that such equivalent embodiments are to be included herein. In addition, all references cited in this disclosure are incorporated herein by reference in their entirety as if fully set forth herein.

Examples of the invention

Example 1: AAV clade F vector variants mediated genome editing in CD34+ human hematopoietic stem cell lines or K562 cell lines

Genome editing using aavf (aavhsc) vectors via site-specific insertion or targeted integration of specific DNA sequences without the use of exogenous nucleases was performed in either a CD34+ hematopoietic cell line or a K562 cell line from a healthy donor human, which is a CD34+ erythroleukemia cell line. A set of donor recombinant AAV vector ITR-AAVS1-FP vectors was constructed and used to integrate the transgene into the AAVS1 locus (the native wild type AAV integration site) on chromosome 19 (Kotin, 1992; Giraud, 1994). The AAVS1 locus qter13.3-13.4 on chromosome 19 was previously shown to be a "safe harbor" site for insertion of transgenes because the genes inserted therein are expressed without pathogenic consequences, similar to wild-type AAV integrated at this locus without pathogenic consequences (Giraud, 1994; Linden, 1996A; Linden 1996B). The transgene to be integrated is the Venus yellow fluorescent protein ("YFP" or "FP") gene flanked on each side by approximately 800 nucleotides with homology to the AAVS1 locus on human chromosome 19 (see schematic in fig. 3). The donor AAV vector is designed such that the transgene is promoterless and will only be expressed if it integrates at a correction locus that is located downstream of the chromosomally encoded regulatory sequences (see fig. 4). Thus, any Venus YFP transgene expression performed was under the control of a chromosomal promoter located in AAVS1 or close to AAVS 1.

The donor vector ITR-AAVS1-FP was packaged into AAVHSC capsids according to standard AAV packaging methods described in Chatterjee et al, 1992. Specifically, the ITR-AAVS1-FP is packaged into AAVHSC7, AAVHSC15, or AAVHSC17 capsids to form pseudotyped AAVHSC-AAVS1-FP vectors (i.e., AAV vector variants). Cells human CD34+ hematopoietic stem cell lines or K562 cells were transduced with pseudotyped AAVHSC-AAVS1-FP at different multiplicity of infection (MOI) (i.e., 50,000 MOI; 100,000 MOI; 200,000 MOI; 300,000 MOI; and 400,000 MOI).

Integration of YFP transgene into the AAVS1 locus by homologous recombination was initially analyzed by cytofluorimetric analysis of YFP expression in transduced K562 cells. Targeted integration using the AAVHSC7 FP vector resulted in expression of the YFP transgene at 24 hours post-transduction (fig. 5 and 7A) and 72 hours post-transduction (fig. 6 and 7B). Furthermore, as the MOI of the AAVHSC7 FP vector increased, the average YFP expression percentage also increased (fig. 7A and B).

Targeted integration of the YFP transgene was further confirmed by PCR amplification of the edited genome using primers located outside the homologous regions. Briefly, DNA was extracted from K562 cells transduced with the AAVHSC7 FP vector at an MOI of 100,000 vector genomes/cell. PCR amplification was performed using the "outer forward primer region" and "outer reverse primer region" primers (see FIG. 4). Integration of the YFP transgene caused the size of the AAVS1 locus to increase from a wild-type size of about 1.9kb to an about 3.1kb fragment containing the YFP transgene (see fig. 4, compare line labeled "fragment 1" to line labeled "fragment 2"). Amplification of an approximately 3.1kb fragment containing the YFP transgene within the chromosomal 19AAVS1 locus indicated that the YFP transgene efficiently integrated into the AAVS1 locus in cells transduced with the AAVHSC7 FP vector (see fig. 8A and 8B, band 4).

Example 2: AAV vector variants mediated genome editing in primary human CD34+ peripheral blood stem cells

Genome editing via site-specific insertion or targeted integration of specific DNA sequences using AAVHSC vectors without the use of exogenous nucleases was also performed in human CD34+ primary peripheral blood derived human hematopoietic stem cells (PBSCs). Briefly, the vector ITR-AAVS1-FP was packaged into AAVHSC capsids (including AAVHSC7, AAVHSC12, AAVHSC15, and AAVHSC17) (see Chatterjee,1992 for standard AAV packaging methods). Primary CD34+ cells were transduced with pseudotyped AAVHSC-AAVS1-FP vectors (i.e., AAV vector variants) at MOIs of 100,000 and 150,000.

Integration of YFP transgene into the AAVS1 locus by homologous recombination was analyzed by cytofluorimetric analysis of YFP expression. Targeted integration in primary CD34+ cells using the AAVHSC7 FP and AAVHSC17 FP vectors resulted in expression of the YFP transgene at 1 day after transduction at an MOI of 150,000 (fig. 9), 4 days after transduction at an MOI of 100,000 (fig. 10), and 18 days after transduction at an MOI of 100,000 (fig. 11). At 5.5 weeks (39 days) after transduction at an MOI of 100,000, the percentage of YFP-expressing positive cells did not decay (see fig. 12A and B, comparing the 20 day results to the 39 day results). This long term expression of the promoterless YFP transgene in a population of dividing cells indicates precise integration of the transgene.

Targeted integration of the YFP transgene was further confirmed by PCR analysis. The edited genome is amplified using primers that amplify the 5 'junction region between the inserted transgene sequence and the native chromosome 5' homology arm sequence (see figure 4, see line labeled "fragment 3"). Briefly, DNA was extracted from primary CD34+ cells transduced with AAVHSC7 FP vector at an MOI of 150,000 vector genomes/cell. PCR amplification was performed using the "outer forward primer region" and the "inner reverse primer" primers (see figure 4). Amplification of the approximately 1.7kb fragment in the 5' junction region for transduced primary CD34+ cells indicated successful integration of the YFP transgene into the AAVS1 locus (see fig. 13, band 5). However, those cells not transduced with the AAVHSC7 FP vector did not present amplified product (see figure 13, band 3).

Targeted integration of the YFP transgene was further confirmed by sequence analysis of different portions of the edited AAVS1 locus. Sequencing was started near the "outer forward primer region" (see FIG. 14), near the 5 'homology arm (see FIG. 15), near the 5' region of the regulatory element (see FIG. 16), near the 3 'region of the regulatory element (see FIG. 17), near the 5' region of the transgene (see FIG. 18) and near the "inner reverse primer" region (see FIG. 19). Sequencing results indicated the presence of the YFP gene and its successful integration into the AAVS1 locus.

As provided in examples 1 and 2, AAVHSC vectors successfully mediate highly targeted genome editing in human CD34+ hematopoietic cell lines and CD34+ PBSC without the need for addition of exogenous endonucleases. The AAVHSC vector is capable of directing the integration of the YFP transgene into the AAVS1 locus on chromosome 19 based on flanking homology arms corresponding to the AAVS1 locus. AAV-mediated gene transfer has been previously reported; however, the reported frequency of occurrence has been low, typically on the order of one of 1e6 cells to one of 1e4 cells. As shown herein, targeted genome editing using AAVHSC vectors was performed long term with an approximately 10% frequency of appearance of primary cells, with an efficiency of 1,000 to 100,000 fold as previously reported (see, e.g., Khan, 2011). Expression of the YFP transgene in the human CD34+ hematopoietic cell line was observed as early as the first day after transduction and confirmed on the third day. Expression of the YFP transgene in PBSC was observed from the first day and persisted long (up to almost 6 weeks), with 6 weeks being the latest time point analyzed. No significant toxicity due to AAVHSC vector transduction was observed. Based on the high frequency of insertion, ease of use, and lack of toxicity observed, therapies based on targeted genome editing using AAVHSC vectors are practical and feasible.

Example 3: in vivo genome engineering using AAV vector variants

AAVHSC vectors encoding luciferase and AAVHSC vectors encoding Venus were injected into adult immunodeficient mice previously xenografted with human cord blood CD34+ HSCs. As shown below, intravenous injection of the AAVHSC vector results in vivo transduction of human CD34+ hematopoietic stem and progenitor cells, and the intravenously injected AAVHSC vector is transported to the site of human hematopoiesis and to the transduced human cells.

Briefly, the method is first performed¹³⁷A350 cGy sublethal dose of Cs source was used to irradiate immunodeficient NOD/SCID adult mice. Next, one million human cord blood CD34+ cells were injected into sub-lethal dose-irradiated immunodeficient NOD/SCID mice. Next, at two hours after CD34+ HSC transplantation, mice were injected intravenously with approximately 1E11-5E11 AAVHSC-luciferase vector (AAVHSC 7-luciferase vector or AAVHSC 17-luciferase vector) particles. These vectors are used in the absence of exogenous nucleases. The AAVHSC-luciferase vector encodes a single-chain firefly luciferase gene (ssLuc) under the control of the ubiquitous CBA promoter to allow continuous in vivo bioluminescence monitoring of transgene expression. Such vectors are described in particular in U.S. application No. 13/668,120 (published as U.S. patent publication No. 20130096182a 1) and are incorporated herein by reference in their entirety as if fully set forth herein in Smith et al (see Smith, 2014). AAVHSC-luciferase vectors were pseudotyped to form AAVHSC 7-luciferase vectors and AAVHSC 17-luciferase vectors (see Smith,2014) as described in U.S. application No. US 13/668,120 (published as U.S. patent publication No. 20130096182a 1) and Smith et al (see Chatterjee,1992) in HSC7 capsid variant (the polynucleotide sequence of HSC7 capsid is provided as SEQ ID NO:27 and the polypeptide sequence of HSC7 capsid is provided as SEQ ID NO:8 (see fig. 1)) or in HSC17 capsid variant (the polynucleotide sequence of HSC17 capsid is provided as SEQ ID NO:35 and the polypeptide sequence of HSC17 capsid is provided as SEQ ID NO:13 (see fig. 1)). It should be noted that the AAVHSC-luciferase vector can transduce mice And human cells. However, luciferase will not integrate into AAVS1, compared to Venus encoded in the AAVHSC-Venus vector described below. In contrast, luciferases can be randomly integrated or remain free.

Two to seven days after injection with the AAVHSC-luciferase vector, mice were injected with approximately 1E11-5E11 AAVHSC-Venus vector particles. Specifically, mice first injected with AAVHSC 7-luciferase vector were injected with AAVHSC7-Venus vector, and mice first injected with AAVHSC 17-luciferase vector were injected with AAVHSC17-Venus vector. The Venus donor vector used is specifically described in examples 1 and 2 above. The donor AAV vector was designed such that the Venus transgene was promoterless and would only be expressed if it integrated at the proofreading AAVs1 locus, which is located downstream of the chromosomally encoded regulatory sequences (see fig. 3 and 4). Thus, any Venus transgene expression performed is under the control of a chromosomal promoter located in AAVS1 or close to AAVS 1. Importantly, vectors containing the Venus gene do not contain promoters to drive expression. The Venus gene will only be expressed if it is properly integrated into AAVS1 in human cells, which AAVS1 is located downstream of the endogenous chromosomal promoter. The donor vector ITR-AAVS1-Venus (see FIG. 3) was packaged into AAVHSC capsids according to standard AAV packaging methods described by Chatterjee et al, 1992. The vectors were pseudotyped in either HSC7 capsid variant (the polynucleotide sequence for HSC7 capsid is provided as SEQ ID NO:27 and the polypeptide sequence for HSC7 capsid is provided as SEQ ID NO:8 (see fig. 1)) or in HSC17 capsid variant (the polynucleotide sequence for HSC17 capsid is provided as SEQ ID NO:35 and the polypeptide sequence for HSC17 capsid is provided as SEQ ID NO:13 (see fig. 1)) to form AAVHSC7-Venus and AAVHSC17-Venus vectors.

Finally, luciferase expression in vivo was measured at 4 weeks post-injection. At six weeks post-injection, engraftment of human CD34+ and CD45+ cells was measured and Venus expression was quantified. The overall schematic of the experiment carried out in this example is shown in figure 20.

In vivo imaging was performed on xenograft and non-xenograft mice receiving intravenous injection of AAVHSC-luciferase vector four weeks after injection. The results showed specific luciferase expression in the spine, spleen, hip and long bone, all of which were sites of hematopoiesis after transplantation (see fig. 21A). However, specific luciferase expression in hematopoietic organs was not observed in mice that had not previously been xenografted with human cord blood CD34+ HSCs (see fig. 21B). These results indicate that intravenously injected AAVHSC vectors are transported to the site of human hematopoiesis in the body and preferentially transduce stem and progenitor cells.

Human CD34+ and CD45+ cells were analyzed using flow cytometry at six weeks after injection with AAVHSC-Venus vector. The results indicated that the injected human cord blood CD34+ cells were implanted into mice and more mature blood cells were obtained. Specifically, primitive human blood progenitor cells (i.e., CD34+ cells) were observed in bone marrow (see table 1, CD34+ cells and femoral bone marrow). Furthermore, as shown in table 1, human mononuclear blood cells (i.e., CD45+ cells) were evident in the femoral bone marrow, vertebral bone marrow, and spleen.

Table 1: implantation of human blood cells in immunodeficient mice

At six weeks post-injection, human HSC expression in human HSCs of xenograft mice receiving intravenous injections of AAVHSC7-Venus or AAVHSC17-Venus vectors was analyzed using flow cytometry. The results revealed that AAVHSC transduction was readily observed in CD45+ human HSCs from femoral and vertebral bone marrow as well as CD34+ human HSCs (see table 2 and fig. 22A-F).

Table 2: percentage of implanted human hematopoietic cells expressing Venus

Furthermore, since Venus is expressed in human CD45+ cells in the spleen, these cells readily display evidence of transduction (see table 2 and fig. 22G and H). This demonstrates Venus expression by CD45+ cells generated by transplanted human cord blood CD34+ cells. These results indicate that intravenous injection of the AAVHSC vector in vivo results in transduction of human hematopoietic cells.

Example 4: insertion of larger and smaller editing elements into the genome using AAV clade F vectors

rAAV production, purification and titration all targeted genomes were cloned into the AAV2 backbone using the New England Biolabs Gibson Assembly cloning kit with primers designed using NEBuilder v.1.6.2 (Ipswich, MA). All targeted genomes were sequenced and restriction digestion and sequencing were used to confirm AAV2 ITR integrity. The single stranded targeted genome is packaged into an AAVF capsid of Herpes Simplex Virus (HSV) -infected 293 cells. The resulting recombinant AAV vectors were purified via two rounds of CsCl2 density centrifugation gradients and titers were determined using qPCR with transgene-specific primers and probes.

Chronic Myelogenous Leukemia (CML) cell line K562 and hepatocellular carcinoma cell line HepG2 were obtained from the American Type Culture Collection (ATCC) (Manassas, VA), and cultured according to ATCC guidelines. Peripheral Blood Stem Cells (PBSC) were purified from monocytes from a cytokine-primed healthy donor PB using a CD34+ indirect isolation kit (Miltenyi Biotech) and transduced immediately after isolation. PBSC were cultured in Islands 'Modified Dulbecco's Medium (IMDM) (Irvine Scientific) containing 20% FCS, 100. mu.g/mL streptomycin, 100U/mL penicillin, 2mmol/L L-glutamine, IL-3(10 ng/mL; R & D Systems), IL-6(10 ng/mL; R & D Systems) and stem cell factor (1 ng/mL; R & D Systems). HepG2 cells were split and seeded approximately 24 hours before transduction. K562 cells were seeded just before transduction. K562, HepG2 or PBSC were transduced with AAVF-targeting vectors at MOI ranging from 5E4 to 4E 5. Cells are transduced and homologous recombination is achieved in the absence of exogenous nucleases. Cells were collected at time points between 1 and 39 days post transduction for flow and molecular analysis. BrdU labeling of in vitro transduction was performed prior to collection using the APC BrdU flow kit (BD Biosciences) as indicated.

TI PCR and sequencing high molecular weight DNA was isolated from K562, HepG2 or PBSC transduced with AAVF-targeted vectors. TI-specific PCR was performed using primers that bound to the outside chromosomal region of the homology arms, i.e., Sigma AAVS1 forward primer (5'-GGC CCT GGC CAT TGT CAC TT-3') and primers that bound to the inserted cassette, i.e., Venus reverse primer (5'-AAC GAG AAG CGC GAT CAC A-3') or RFLP HindIII reverse primer (5'-CCAATCCTGTCCCTAGTAAAGCTT-3'). The expanded Hifidelity PCR system (Indianapolis, Ind.) was used and cycling conditions were as follows: 1 cycle, 5 minutes-95 ℃; 15 cycles, 30 seconds-95 ℃, 30 seconds-starting at 62 ℃ and decreasing by 0.5 ℃, 2 minutes-68 ℃ per cycle; 20 cycles of 30 seconds-95 deg.C, 30 seconds-53 deg.C, 2 minutes-68 deg.C; 1 cycle, 5 min-68 ℃. PCR products were PCR purified for direct Sequencing using the Qiaquick PCR purification kit (Qiagen), or cloned using the cloning kit for TOPO TA Sequencing and clone Sequencing by Sanger Sequencing (Life Technologies).

All Animal Care and experiments were performed under protocols approved by the Institutional Animal Care and Use Committee. Male NOD.CB17-Prkdcscid/NCrCrl (NOD/SCID) mice were maintained at 6-8 weeks of age in a facility free of specific pathogens. Prior to transplantation, mice were orally administered a pediatric antibiotic (Hi-Tech Pharmacal (Amityville, NY)), 10ml/500ml H2O, using sulfamethoxazole (sulfamethoxazole) and trimethoprim (trimethoprim) for at least 48 hours. Mice were irradiated with a 350cGy sublethal dose of 137Cs source and allowed to recover for a minimum of 4 hours prior to transplantation. Cord Blood (CB) CD34+ cells were isolated using CD34+ indirect isolation kit (american and whirlpool biotechnology). Will be 1 × 10 ⁶Individual CB CD34+ cells were resuspended in approximately 200 μ L and transplanted by tail vein injection. At 1 or 7 weeks post-CB CD34+ transplantation, 2.4E11 to 6.0E11 particles of AAVF-targeting vector were injected intravenously via the tail vein. Femoral Bone Marrow (BM), vertebral BM and spleen were harvested at 6, 7 or 19 weeks post-transplantation.

Analysis of AAVF-targeting vector-mediated integration in vitro transduction as well as BrdU and 7-AAD were analyzed using a Cyan ADP flow cytometer (Dako). The fluorescence was quantified by comparison after subtraction of the autofluorescence. In vivo expression of the integrated fluorescent cassette in CD34+ cells and erythrocytes was analyzed in vertebral BM, femoral BM and spleen of harvested xenograft mice by staining with human specific antibodies, APC-bound anti-CD 34 and PE-bound anti-glycophorin a, and PE and APC-bound IgG controls (BD Biosciences) on FACS Aria SORP (BD Biosciences). FlowJo software (Treestar) was used to analyze flow cytometry data.

As a result, it was revealed that the stem cell-derived AAV was mapped to AAV clade F based on the nucleotide sequence homology of the capsid gene (FIG. 23, Smith et al, molecular therapeutics 2014 9 months; 22(9): 1625-34). These stem cell derived AAV are referred to as AAVHSC 1-17. These AAV are also referred to herein as AAVF1-17, respectively.

Single-stranded AAV vector genomes were used to design a calibration genome containing homology arms and a larger insert (fig. 24). The insert contains a promoterless Venus Open Reading Frame (ORF) downstream of the Splice Acceptor (SA) and 2A sequences (2A) to allow for independent protein expression. Venus is a yellow fluorescent protein variant (see, e.g., Nagai et al, Nature Biotechnol, 2002,20(1): 87-90). The left and right Homology Arms (HA) are each 800bp long and complementary to the sequence of human PPP1R12C intron 1 located in the AAVS1 locus on chromosome 19 (fig. 25). A similar single-stranded AAV vector genome was designed with a 10bp insert between the two homology arms (fig. 35). The AAVS1 locus was considered as a safe harbor site for heterologous transgene insertion.

The homology arms, open reading frames and regulatory sequences were cloned between the Inverted Terminal Repeats (ITRs) of AAV 2. This corrected genome is then packaged (pseudotyped) in different AAV capsids, including AAVHSC, AAV8, 9, 6, and 2. The edited genome is then delivered into the nucleus of the target cell using a recombinant virus. The target cells tested included the CD34+ erythroleukemia cell line, the liver cell line, and primary human CD34+ hematopoietic stem/progenitor cells and their hematopoietic progeny.

AAVF vector containing Venus ORF preceded and flanked by homology arms complementary to intron 1 of the human PPP1R12C gene was used to deliver edited genomes into primary human CD34+ cytokine primed peripheral blood stem cells (fig. 26A), human CD34+ erythroleukemia cell line K562 (fig. 26B), and human liver cell line HepG2 (fig. 26C). Primary CD34+ cells supported the highest level of editing, up to 60% (fig. 26A-F). Immortalized cell lines (including K562 and HepG2) also showed significant editing levels. In all cases, the level of editing achieved was consistently significantly higher than that achieved with non-differentiated body F viruses (including AAV6 and AAV8) (fig. 26A-F and fig. 36).

In another experiment, DNA extracted from CD34+ Peripheral Blood Stem Cells (PBSC) primed with cytokines transduced with AAVF7, AAVF15, or AAVF17 vectors was amplified with chromosome-specific primers and insert-specific primers. The vectors include a larger insert (Venus) or a shorter insert (10bp, RFLP). The gel shows the amplification of correctly sized amplicons from edited CD34 cells (fig. 27, 35, and 36). The presence of the 1.7kb and 1kb bands reflects the correct targeted integration of the larger and smaller inserts, respectively. Targeted integration at both short and long time points was shown after editing with AAVF vector (fig. 27).

In another experiment, the single-stranded AAV vector genome was designed for insertion of a 10bp insert into intron 1 of the human PPP1R12C gene (fig. 28A). These vectors include a wild-type left homology arm (HA-L) containing a Nhe1 restriction enzyme recognition site (GCTAGC). The NS mut vector is designed to change the TA sequence in the left homology arm on chromosome 19 to AT. This change caused the conversion of the Nhe1 site to the Sph1 site, changing the sequence from GCTAGC to GCATGC. Figure 28B shows the relative sizes of the expected fragments generated by cleavage with Nhe1 or Sph1 when editing genomic DNA from K562 cells using wild-type or NS Mut AAVF vectors. As predicted, the actual amplicons in genomic DNA derived from K562 cells edited with the wild-type AAVF vector were digested with Nhe1 instead of Sph1 (fig. 28C). The results of the amplified K562 DNA after editing with AAVF7 or AAVF17 vectors encoding wild type or NS Mut genomes showed that digestion with Nhe1 no longer caused amplicon cleavage, similar to amplicons from unedited cells. Digestion with Sph1 resulted in cleavage, revealing that the Nhe1 site in the left homology arm of the chromosome was replaced by the Sph1 site (fig. 28D). Electrophoresis of amplified DNA from the hepatocellular carcinoma cell line HepG2 after editing with either AAVF7 or AAVF17 vectors encoding wild-type or NS Mut genomes showed that digestion with Nhe1 no longer caused amplicon cleavage, similar to amplicons from unedited cells (fig. 28E). Digestion with Sph1 resulted in cleavage, revealing the substitution of the Nhe1 site in the left homology arm of the chromosome by the Sph1 site. Sequence analysis confirmed editing using AAVF7 and AAVF17 wild-type or NS Mut vectors (fig. 29). These results demonstrate that both AAVF7 and AAVF17 successfully mediate 2 nucleotide substitutions in chromosomal sequences in two different cell lines. These results also demonstrate the ability of the AAVF vector to mediate 2 ge base pair substitutions in the genomic DNA of human cells, suggesting its use for correcting mutations caused by disease or inducing new mutations in the genome.

In another experiment, healthy human CD34+ PBSC were tested for the potential requirement of cell division for editing ability of AAVF vectors. BrdU was incorporated into transduced human CD34+ PBSC via pulsing with 10 μ M BrdU for 2 hours. Prior to dnase treatment, AAVF-transduced CD34+ cells were harvested, permeabilized and fixed. After dnase treatment, the treated cells were stained with anti-BrdU APC antibody for 20 minutes. BrdU labeling of in vitro edited cells as indicated was performed prior to collection using the APC BrdU flow kit (BD Biosciences). Cells were then analyzed by flow cytometry for Venus expression and BrdU labeling. The results revealed that Venus expression appeared at similar frequency in both BrdU positive and negative populations, indicating that cell division was not required for AAVF-mediated editing (fig. 30).

In another experiment, in vivo editing of implanted human hematopoietic stem cells was tested by systemic delivery of AAVF vector to immunodeficient NOD/SCID mice implanted with human cord blood CD34+ hematopoietic stem cells (fig. 31A and B). In bone marrow as well as spleen, most human cells were found to express Venus, while Venus expression was not observed in mouse cells (fig. 31C, 37 and 38). These findings exhibit specificity of gene targeting because the mouse genome does not contain the AAVS1 locus complementary to the homology arm. Among the human cells analyzed, Venus expression was observed in the original CD34+ progenitor cells as well as mature glycophorin a + erythrocytes in both bone marrow and spleen.

In another experiment, mice were implanted with human cord blood CD34+ cells and injected with AAVF-Venus by intravenous route after 1 or 7 weeks. Vertebral or femoral bone marrow or spleen was harvested 5, 6 or 13 weeks after intravenous Venus injection. These represent 6, 7 or 20 weeks of post-transplant cumulative time. The results revealed that intravenous injection of AAVF-Venus resulted in the compilation of both primitive (CD34+) and more mature (CD45+) human hematopoietic cells implanted in vivo. After transplantation and injection, cells of the human erythroid lineage exhibited extremely efficient long-term editing (fig. 32). AAVF-mediated editing was found to be stable long-term and stably inherited by differentiated progeny of in vivo implanted human CD34+ cells (fig. 32). Differentiated progeny of edited CD34+ cells expressed Venus chronically (fig. 32).

In another experiment, the promoterless SA/2A venus ORF was sequenced for targeted chromosomal insertion in K562 erythroleukemia cell lines, primary human cytokine primed peripheral blood CD34+ cells, and HepG2 human liver cell lines (fig. 33). The site-specific integrated sequences are amplified using chromosome-specific primers and insert-specific primers. The results revealed the precise insertion of SA/2AVenus in each case at the junction between the left and right homology arms (fig. 33).

In another experiment, sequence analysis was performed for targeted chromosomal insertions of 10bp inserts in primary human cytokine-primed peripheral blood CD34+ cells and HepG2 human liver cell line (fig. 34). The site-specific integrated sequences are amplified using chromosome-specific primers and insert-specific primers. The results revealed the precise insertion of the 10bp insert in each case at the junction between the left and right homology arms (FIG. 34).

These data show that both larger and shorter inserts can be successfully edited into the genome using AAV clade F vectors, and that integration into the genome is precise. These data also demonstrate that AAV clade F vectors can be used for efficient genome editing in the absence of exogenous nucleases.

Example 5: editing the PPP1R12c locus in a human cell line

Method

To assess the editing of human cell types by AAVF vectors, the following human cell lines were used:

cell lines	Tissue type
		WI-38	Normal human diploid fibroblast
MCF7	Human breast cancer cell line
		Hep-G2	Human hepatoma cell line
K562	CD34+ erythroleukemia cell line
		Y79	Human retinoblastoma cell line
SCID-X1 LBL	Human EBV immortalized B cell line from SCID-X1 patient

The AAVF vectors used each contained a vector genome containing editing elements encoding a promoterless Venus reporter. Promoterless Venus contains a Venus Open Reading Frame (ORF) downstream of the Splice Acceptor (SA) and 2A sequences (2A) to allow independent protein expression. The left and right Homology Arms (HA) are each 800bp long and are complementary to the sequence of human PPP1R12C intron 1 located in the AAVS1 locus on chromosome 19. The AAVS1 locus was considered as a safe harbor site for heterologous transgene insertion. Editing elements containing homology arms, Venus ORF and regulatory sequences were cloned between AAV2 Inverted Terminal Repeats (ITRs).

All cell lines were grown in a humidified atmosphere of 5% CO2 at 37 ℃ and cultured as follows: SCID-X1 lymphoblastoid cells (Coriell) were cultured in RPMI1640(Gibco, Cat. No. 21875) supplemented with 15% Fetal Bovine Serum (FBS) (Gibco, Cat. No. 26140); k562 cells (ATCC) were cultured in DMEM (Corning, Cat. No. 15-017-CVR) supplemented with 10% FBS (Gibco, Cat. No. 26140) and 1% L-glutamine (Gibco, Cat. No. 25030); HepG2 cells (ATCC) were cultured in EMEM (ATCC, catalog No. 30-2003) supplemented with 10% FBS (Gibco, catalog No. 26140); MCF-7 cells (ATCC) were cultured in MEM (Gibco, Cat. No. 11095) supplemented with 10% FBS (Gibco, Cat. No. 26140), 1% MEM non-essential amino acids (Gibco, Cat. No. 11140), 1% sodium pyruvate (Gibco, Cat. No. 11360) and 10. mu.g/ml human recombinant insulin (Gibco, Cat. No. 12585-014); WI-38 fibroblasts (ATCC) and HEK293 cells (ATCC) were cultured in MEM (Gibco, Cat. No. 11095) supplemented with 10% FBS (Gibco, Cat. No. 26140), 1% MEM non-essential amino acids (Gibco, Cat. No. 11140) and 1% sodium pyruvate (Gibco, Cat. No. 11360); and Y79 cells (ATCC) were cultured in RPMI1640(Gibco, catalog No. a10491) supplemented with 20% FBS (Gibco, catalog No. 26140).

On day 0, adherent cells were seeded at 20,000 cells/0.1 ml for 96-well format or 20,000 cells/0.5 ml for 24-well format. After 24 hours (on day 1), cell counts were measured before addition of the AAVF vector. On day 1, the 96-well format was seeded with 20,000 cells/0.1 ml or the 24-well format with 20,000 cells/0.5 ml. AAVF was added to cells on day 1 using 150,000 Vector Genomes (VG) per multiplicity of infection (MOI) of cells. Prior to AAVF addition, pipette tips for transfer were coated with protamine sulfate (10 mg/ml). Immediately prior to transduction, the AAVF was fully suspended on a vortex mixer at full speed for 30 seconds. The volume of AAVF added to the cells does not exceed 5% of the total volume in the wells. On day 3, cells were harvested (adherent cells were lightly trypsinized to remove them from the tissue culture plate), washed, and analyzed for Venus expression by flow cytometry using an Intellicyt flow cytometer equipped with a Hypercyt autosampler. The percentage of total cell population expressed as Venus positive minus background fluorescence observed in untransduced cells (typically less than 1% Venus positive cells) was compiled. AAVF editing experiments were performed without the use of exogenous nucleases.

Results

Editing of the human PPP1R12c locus was observed for all AAVFs tested and exhibited cell type selectivity (table 3). Generally, AAVF5 produced the highest level of editing in each cell line, 12% -45% of the total cell population, 48 hours after infection. AAVF9 also produced high levels of gene editing in B lymphoblast cell lines (SCID-X1 LBL and K562). AAVF17 produced the highest level of gene editing in normal human diploid fibroblasts (WI-38 cells) under these conditions. The editing levels produced by the AAVF1, AAVF4, AAVF7 vectors were consistently greater than the maximum levels seen in untransduced cells but generally lower than that observed with AAVF5, AAVF9, and AAVF 17. These data demonstrate that AAVF has a broad tropism for human tissues and may be particularly useful for gene editing in the liver, CNS (e.g., retina), tissue fibroblasts, breast, and lymphocytes.

TABLE 3 human cell lines by AAVF editing

Example 6: AAVF editing in primary human cells

To assess the editing of primary human cells by AAVF vectors, primary cultures of human hepatocytes, hepatic sinusoid endothelial cells, and skeletal myoblasts were used.

The AAVF and AAV vectors used were each packaged with a vector genome encoding a promoterless Venus reporter. The insert contains a Venus Open Reading Frame (ORF) downstream of the Splice Acceptor (SA) and 2A sequences (2A) to allow independent protein expression. The left and right Homology Arms (HA) are each 800bp long and are complementary to the sequence of human PPP1R12C intron 1 located in the AAVS1 locus on chromosome 19. The AAVS1 locus was considered as a safe harbor site for heterologous transgene insertion. The calibration genome, consisting of homology arms, open reading frames and regulatory sequences, was cloned between AAV2 Inverted Terminal Repeats (ITRs).

Method

All primary human cells were cultured in a tissue culture incubator at 37 ℃ under 5% humidified CO 2. Unless otherwise specified, all materials and media components were obtained from Life Technologies.

Primary cultures of human hepatocytes were obtained from Invitrogen and cultured on collagen type I coated plates as suggested by the manufacturer. Cells were recovered from a stock in liquid nitrogen in thaw/inoculation Medium [ 32.5mL William's E Medium (# A12176), 1.6mL fetal bovine serum, 3.2 μ L of 10mM dexamethasone (Dexamethazone) and 0.9mL inoculum mix A per 35.0mL volume of mL. The inoculation mix a consisted of: in each 1.8mL final volume, 0.5mL penicillin (10,000U/mL)/streptomycin (10,000. mu.g/mL) solution (cat # 15140), 0.05mL 4.0mg human recombinant insulin/mL (cat # 12585-014), 0.5mL 200mM GlutaMAXTM solution (cat # 35050), and 0.75mL 1.0M Hepes, pH7.4 (cat # 15630). Human hepatocytes were maintained in maintenance medium containing 100mL of williams E medium, 0.001mL of dexamethasone, and 3.6mL of maintenance cocktail B (catalog No. a13448) per 103.6mL final volume.

Primary cultures of human skeletal muscle myoblasts were obtained from Lonza and were described at SkGM by the manufacturer^TMCulturing in a culture medium.

SkGM^TM-2 Bullit^TMKit (Lonza, Cat. No. CC-3245) contains 0.5mL human epidermal growth factor [ hEGF ] in 500mL SkGM-2 medium (#0000482653)](#0000482653), 0.5mL dexamethasone (#0000474738), 10 mLL-glutamine (#0000474740), 50mL fetal bovine serum (#0000474741), 0.5mL Gentamicin (Gentamicin)/Amphotericin-B (Amphotericin-B) [ GA ]](#0000474736)。

Primary cultures of human liver sinusoidal endothelial cells were purchased from Creative Bioarray and described by the manufacturer inEndothelial cells were cultured in medium and grown on gelatin-based coatings.Endothelial cell culture Medium supplement Kit (Cat. Ex. ECM-500Kit) contains 0.5mL VEGF (#15206), 0.5mL heparin (#15250), 0.5mL EGF (#15217), 0.5mL FGF (#15204), 0.5mL hydrocortisone (#15318), 5.0mL antibiotic-antimycotic solution (#15179), 5.0mL L-glutamine (#15409), 10.0mL endothelial cell supplement (#15604), 50.0mL FBS (# 10), and 500.0mL FBS (# 10)Endothelial cell culture medium (# 15517).

AAVF mediated editing of primary human cells on day 0, 2X 10 for 96 well format⁴Cells/0.1 ml or 2X 10 in 24-well format ⁴Each cell/05 ml were inoculated with human primary hepatocytes. After 48 hours, viral vectors were added on day 2 as described below. On day 1, the 96-well format was run at 2X 10⁴Cells/0.1 ml or 2X 10 in 24-well format⁴Each cell was seeded at 0.5 ml with human skeletal myoblasts and human hepatic sinusoidal endothelial cells. On day 2, viral vectors (5X 10 for AAVF5, using) were added to the cells at 150,000VG (vector genome)/multiplicity of infection (MOI) of the cells⁴VG/MOI of cells, and for AAVF17, 2.5X 10⁴VG/MOI of cells). All pipette tips used for carrier transfer were coated with protamine sulfate (10mg/mL) before adding the carrier to the cells, and the carrier was thoroughly mixed by vortexing for 30 seconds immediately before transduction. The volume of carrier added to the cells does not exceed 5% of the total volume in the wells.

The medium for human primary hepatocytes was refreshed on day 3. On day 4, cells were harvested (adherent cells trypsinized) and analyzed for Venus expression by flow cytometry using an intellicyty flow cytometer equipped with a Hypercyt autosampler. The percentage of total cell population expressed as Venus positive minus background fluorescence observed in untransduced cells (typically less than 1% Venus positive cells) was compiled.

Results

Editing of the human PPP1R12c locus was observed for all AAVFs tested and exhibited cell type selectivity (table 4). Generally, AAVF5 produced the highest level of editing in each primary cell population 48 hours after infection, lower 2% in human hepatocytes and 24% to 35% in primary skeletal myoblasts and hepatic sinusoidal endothelial cells, respectively. AAVF7 and AAVF17 also produced high levels of gene editing in primary liver sinusoidal endothelial cells and skeletal myoblasts. The level of editing using AAVF vectors in these cells was 10 to 50 fold greater than that observed with AAV2 or AAV 6. The level of editing produced by the AAVF vector was consistently greater than that seen in untransduced cells or in cells transduced with AAV2 or AAV6 packaging the promoterless Venus vector genome. Little or no editing was observed in AAV2 or AAV6 in these cells. These data in primary human cells demonstrate that AAVF5, AAVF7, and AAVF17 have a broad tropism for human tissues and may be particularly useful for gene therapy applications against liver, skeletal muscle, and endothelial cell populations.

For comparison, each of the primary human cell populations was also transduced with the AAVF gene transfer vector packaging mCherry under the control of the chicken β actin (CBA) promoter. The protein expression ratio of Venus/mCherry was then used to estimate the edit ratio for AAV6, AAVF5, and AAVF7, which reflects the ratio of the number of cells with protein expression detectable using the experimental gene editing vector (Venus) versus the number of cells with protein expression detectable using the gene transfer vector (mCherry) described above in various cell types. As shown in table 5, AAVF-mediated gene editing was generally more effective for protein expression in primary human cells studied than the corresponding AAVF-mediated gene transfer pathway, whereas AAV 6-mediated gene editing was substantially the same or slightly less effective in such cells as AAV 6-mediated gene transfer. Notably, as also shown in table 5, for the primary human cells studied, AAVF-mediated gene editing was higher than that observed for AAV 6-mediated gene editing. These data demonstrate that AAVF-mediated gene editing is more efficient in a variety of primary human cells than AAV6, and that AAVF-mediated gene editing is favored over corresponding gene transfer in such cells.

The AAVF vector packaging the mCherry reporter was also effective in transducing primary human cells and displayed cell type specificity (table 6). For Human Umbilical Vein Endothelial Cells (HUVEC) and Hepatic Sinusoid Endothelial Cells (HSEC), transduction with AAVF9 yielded 38% -50% mCherry positive cells 48 hours after infection. AAVF9 also transduced human skeletal muscle myoblasts efficiently, and to a lesser extent, all AAVFs tested were effective in transducing HSECs under these conditions (table 6). Without being bound by theory, most if not all of mCherry expression in these studies is likely to represent episomal expression from the reporter, since no homology arms are present in the mCherry vector genome and expression is driven by the CBA promoter.

TABLE 4 AAVF mediated editing of primary human cells

TABLE 5 edit ratio of AAVF in primary human cells

HSEC ═ liver sinusoidal endothelial cells

SMM-skeletal myoblasts

TABLE 6 transduction of primary human cells with mCherry-packaged AAVF vectors

HSEC ═ liver sinusoidal endothelial cells

SMM-skeletal myoblasts

HUVEC (human umbilical vein endothelial cells)

Example 7: study of AAVF relative Gene editing (HDR) versus Gene transfer (transduction) efficiency

Two types of AAV-based vectors (CBA-mCherry gene transfer vector and AAVs1-Venus gene editing vector, fig. 39) were used to assess the relative gene editing efficiency versus gene transfer transduction efficiency of AAVF vector and AAV2 and AAV6 as measured by relative protein expression. For gene transfer vectors, the CBA-mCherry construct includes the mCherry gene under the control of the chicken β actin (CBA) promoter, and utilizes a polyadenylation signal, but does not contain any homology arms. For gene editing vectors, the AAVS1-Venus construct includes a promoterless Venus Open Reading Frame (ORF) in which the (HA-L) and right (HA-R) homology arms target the Venus ORF to intron 1 of the PPP1R12C gene in the region of chromosome 19AAVS 1. There are also Splice Acceptor (SA) and 2A sequences located upstream of the Venus ORF that allow the Venus transcript to be spliced out and expressed independent of the PPP1R12C gene.

AAVF, AAV2 and AAV6 vectors were compared for their ability to mediate gene editing versus gene transfer in primary human cord blood CD34+ hematopoietic stem/progenitor cells. The cells used were pooled from multiple donors. Purified CD34+ cells were transduced with gene transfer vectors (AAV x-CBA-mCherry) or gene editing vectors (AAV x-Venus) at a multiplicity of 150,000 Vector Genomes (VG) per cell. Forty-eight hours later, cells were harvested and analyzed by flow cytometry (fig. 40A and 40B). Data shown included background subtraction (untransduced cells).

It is assumed that mCherry expression will indicate transduction efficiency, while Venus expression will indicate gene editing efficiency. Without being bound by theory, the following is a summary of the potential mechanisms of AAV transduction versus editing. Following infection, AAV binds to cell surface receptors and internalizes, followed by nuclear translocation and entry. In the nucleus, AAV uncoats and releases the vector genome. Regardless of the vector genome, these processes are likely to proceed at the same rate for each given capsid in the same cell population. After uncoating, the single-stranded CBA-mCherry genome undergoes second strand synthesis, followed by mCherry expression. On the other hand, the promoterless Venus editing vector is directed to a complementary genomic region on chromosome 19. The SA/2A-Venus cassette bound by the homology arms can then be recombined into the chromosome at the internal junction of the homology arms via a homology-dependent repair (HDR) mechanism. Following this recombination event, Venus was expressed in successfully edited cells.

For all vectors except AAVF9, the proportion of cells expressing Venus was much higher than that expressing mCherry (fig. 40A and 40C). Venus expression was particularly high after transduction with AAVF1, AAVF5, AAVF7, AAVF16, and AAVF 17. The same capsid resulted in much lower levels of mCherry expression (fig. 40A and 40C). Minimal mCherry and Venus expression was observed after transduction with AAV2 and AAV 6. Comparison of relative expression of Venus and mCherry was also performed. Specifically, the edit ratio was determined, which reflects the ratio of the number of cells having protein expression detectable using the experimental gene editing vector (Venus) to the number of cells having protein expression detectable using the above-described gene transfer vector (mCherry) in various cell types. After normalization against the process of virus entry into the nucleus via uncoating, the edit ratio provides an estimate of the relative efficiency of each AAV capsid-mediated editing. With the exception of AAVF9, all AAV vectors tested exhibited more efficient gene editing (Venus) than gene transfer/transgene expression (mCherry) (fig. 40D and table 7). AAVF5 and AAVF7 showed the highest edit rates (fig. 40D and table 7). AAVF-mediated gene editing (Venus) was also compared against AAV2 and AAV 6-mediated gene editing (Venus) (table 7, which shows the Venus: mCherry ratio of AAVF divided by the same ratio of AAV2 or AAV 6). The gene editing effectiveness of the AAVF gene editing constructs is advantageous over AAV2 and AAV6 gene editing constructs. The edit ratios of AAVF5 and AAVF7 were the highest of the compared vectors, indicating that these vectors mediate particularly efficient editing.

TABLE 7 editing and transduction ratio in CD34+ CB cells

The scope of the invention is not to be limited by the specific embodiments disclosed in the examples, which are intended as illustrations of several aspects of the invention, and any embodiments that are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to be within the scope of the appended claims.

Reference to the literature

BAINBRIDGE, J.W., SMITH, A.J., BARKER, S.S., ROBBIE, S.S., HENDERSON, R.S., BALGAGAN, K. VISWANATHAN, A.S., HOLDER, G.E., STOCKMAN, A.S., TYLER, N.S., PETERSEN-JONES, S.S., BHATTACARYA, S.S., THRASHER, A.J., FITTZKE, F.W., CARTER, B.J., RUBIN, G.S., MOORE, A.T., and ALI, R.R. (2008. gene therapy) has an Effect on the visual function in Leber's adjuster's journal of medicine 2239, ENGAGINK.1, JUN, S.

BATCHU, R.B., SHAMAS, M.A., WANG, J.Y., FREEMAN, J., ROSEN, N, and MUNSHI, N.C. (2002). Adeno-associated viruses protect the retinoblastoma protein family from adenovirus-induced functional inactivation (adenovirus-induced protein technologies of tumor family of proteins). Cancer research (Cancer Res) 62, 2982-.

Molecular therapeutics (Mol Ther) 12, 299-.

BERNS, K.I. and GIRAUD, C. (1996) Biology of adeno-associated virus (Biology of adeno-associated virus), Current Top microbial Immunol 218,1-23.

Human hematopoietic stem cells in BIFFI, a. and CESANI, m. (2008.) gene therapy: preclinical and clinical problems (Human hematopoietic stem cells in Gene therapy: preclinical and clinical issues). today, Gene therapy (Current Gene Ther) 8,135- "146.

BRANTLY, M.L., CHULAY, J.D., WANG, L., MUELLER, C., HUMPHRIES, M., SPENCER, L.T., ROUHANI, F., CONLON, T.J., CALCODO, R., BETTS, M.R., SPENCER, C., BYRNE, B.J., WILSON, J.M., and TTFLO, T.R. (2009). in a clinical trial of rAAV1-AAT gene therapy, transgene T lymphocyte responses in a clinical trial of rAAV1-AAT gene therapy, the national academy of sciences (Proc Natl Acad science A).

CHATTERJEE, S., JOHNSON, P.R. and WONG, K.K., JR. (1992) in vitro HIV-1 binocular inhibition by means of adeno-associated virus antisense vectors (Dual-target inhibition of HIV-1in vitro by means of an ad-assisted virus antigen vector), Science (Science) 258,1485-1488.

Transduction of primitive human bone marrow and cord Blood-derived hematopoietic progenitor cells with adeno-associated viral vectors (Transduction of primary human marrow and cord Blood-derived hematopoietic promoter cells with Blood (Blood) 93,1882 + 1894).

adenovirus-Associated Viral Vectors for Antisense RNA Delivery (Adeno-Associated Viral Vectors for the Delivery of Antisense RNA) method-London-enzymatic METHODS IN conjunction with publication (METHODS-bind-A Complex TO METHODS IN ENZYMOLOGY) -5,1.

10, CIDECIYAN, A.V., HAUSWIRTH, W.W., ALEMAN, T.S., KAUSHAL, s., SCHWARTZ, s.b., BOYE, s.l., WINDSOR, e.a., CONLON, t.j., SUMAROKA, a., ping, j.j., ROMAN, a.j., BYRNE, b.j., and JACOBSON, s.g. (2009). human RPE65 gene therapy for leber's congenital amaurosis: early vision improvement and persistence of safety at 1year (Human RPE65 Gene therapy for Leber genetic amaurosis: persistence of early visual improvements and safety at 1year) < Human Gene therapy (Hum Gene Ther) < 20,999 >.

11.EINERHAND, M.P., ANTONIOU, M., ZOLOTUKHIN, S., MUZYCZKA, N., BERNS, K.I., GROSVELD, F. and VALERIO, D. (1995) high level human β -globin gene expression Regulated in erythrocytes following recombinant adeno-associated virus-mediated gene transfer (Regulated high-level human beta-globin gene expression in erythroid cells) -Gene therapy 2,336-343.

Integration of adeno-associated viral vectors in CD34+ human hematopoietic progenitor cells after transduction (Integration of adono-associated viral vectors in CD34+ human hematopoietic promoter cells) blood 88,492-504, FISPEHER-ADAMS, G., WONG, K.K., JR., PODSKOFF, G., FORMAN, S.J., and CHATTERJEE, S. (1996).

FLOTTE, T.R., BRANTLY, M.L., SPECTER, L.T., BYRNE, B.J., SPECER, C.T., BAKER, D.J., and HUMPHRIES, M. (2004). Phase I of intramuscular injection of recombinant adeno-associated virus alpha 1-antitrypsin (rAAV2-CB-hAAT) gene vectors into AAT-deficient adults in Phase I trials (rAAV2-CB-hAAT) gene vector to AAT-deficient addends 15,93-128.

The human tissues in which the Clades of Adeno-associated virus are widely disseminated (clases of Adeno-associated virus with modified human tissue) J virology (J Virol) 78,6381 @636388, GAO, G.

HACEIN-BEY-ABINA, S., VON KALLE, C., SCHMIDT, M.E., LE DESIT, F.E., WULFRAAT, N.E., MCINTYRE, E.E., RADFORD, I.E., VILLEVAL, J.L., FRASER, C.C., CAVAZZANA-CALVO, M.E., and FISCHER, A. (2003.) Severe adverse events following successful gene therapy for X-linked severe comprehensive immunodeficiency (A series after viral therapy gene therapy for X-linked severe combined immune deficiency.). J.Immunodence 348,255 E.C. 256.

HAN, Z, ZHONG, L, MAINA, N, HU, Z, LI, X, CHOUTHAI, N.S., BISCHOF, D, WEIGEL-VAN AKEN, K.A., SLAYTON, W.B., YIDER, M.C., and SRIVASTAVA, A. (2008). Stable integration of recombinant adeno-associated viral vector genomes after murine hematopoietic stem cell transduction (Stable integration of recombinant adsorbed-associated viral vector vectors transfer of human hematopoietic cells) & human Gene therapy 19,267-278.

JAYANDHANA, G.R., ZHONG, L., LI, B., KACHNIARZ, B, and SRIVASTAVA, A. (2008). strategy for improving the transduction efficiency of single-stranded adeno-associated virus vectors in vitro and in vivo (Strategies for improving the transduction efficiency of single-stranded adeno-associated virus vectors in vitro and in vivo.). 15, 1287-gene therapy 1293.

Kaplit, m.g., feign, a., TANG, c., fitzsmimons, h.l., matis, p.s., LAWLOR, p.a., BLAND, r.j., you ng, d.s., STRYBING, k.s., eideberg, d.s., and DURING, m.j. (2007). the safety and tolerability of gene therapy for parkinson's disease using GAD genes carried by adeno-associated virus (AAV): open label phase I test (Safety and portability of gene therapy with an adeno-associated virus (AAV) borne GAD gene for Parkinson's disease an open label, Lancet (Lancet) 369, 2097-.

KELLS, a.p., HADACZEK, p., YIN, d., BRINGAS, j, VARENIKA, v., forsayyeth, j, and BANKIEWICZ, k.s. (2009) a method for delivering a therapeutic agent to the cortex of a primate based on high-efficiency gene therapy (effective gene therapy-based method for the delivery of therapeutics to the cortex), american national academy of sciences, 106, 2407-.

Kesseler, p.d., PODSAKOFF, g.m., CHEN, x, MCQUISTON, s.a., COLOSI, p.c., MATELIS, l.a., KURTZMAN, g.j., and BYRNE, b.j. (1996) Gene delivery to skeletal muscle results in sustained expression and systemic delivery of therapeutic proteins (Gene delivery to skin tissue in sustained expression and systemic delivery of a therapeutic protein)., american national academy of sciences 93,14082 14087.

MANNO, c.s., CHEW, a.j., HUTCHISON, s., LARSON, p.j., HERZOG, r.w., ARRUDA, v.r., TAI, s.j., RAGNI, m.v., THOMPSON, a, OZELO, m.o., COUTO, l.b., LEONARD, d.g., JOHNSON, f.a., mccleland, a, scalan, c. SKARSGARD, e.g., flag, a.w., KAY, m.a., HIGH, k.a., and gler, B. (2003) mediated transfer of factor IX genes into skeletal muscle of AAV (AAV-mediated transfer gene ex vivo) in patients with severe hemophilia type 2972, p.h.2972, et al.

MCCORMACK, M.P. and RABBITTS, T.H. (2004). Activation of the T-cell oncogene LMO2 following gene therapy for X-linked severe complex immunodeficiency (Activation of the T-cell oncogene LMO2 after gene therapy for X-linked segment combined immunological diagnosis). N.Indoneland journal of medicine 350,913-922.

MILLER, D.G., ADAM, M.A. and MILLER, A.D. (1990) Gene transfer by retroviral vectors in Cell active replication at the time of infection only (Gene transfer by cells active replication at the time of infection) molecular and cellular biology (Mol Cell Biol) 10, 4239-.

A Quiescent subset of human CD34 positive hematopoietic stem cells is a preferred target for stable recombinant type 2 adeno-associated virus transduction (human sub-compartments of human CD34-positive hematopoietic stem cells predicted targets for stable recombinant adenovirus-associated virus transduction: 18,614-626 human gene therapy, 626, LI, W, SANTAT, L, WONG, K.K., and CHATTERJEE, S. (2007).

PETRS-SILVA, H., DINCULESCU, A., LI, Q., MIN, S.H., CHIODO, V., PANG, J.J., ZHONG, L., ZOLOTUKHIN, S., SRIVASTAVA, A., LEWIN, A.S., and HAUSWIRTH, W.W. (2009) High efficiency transduction of the mouse retina by tyrosine mutant AAV serotype vectors [ molecular therapeutics 17,463-471 ].

Efficient gene transfer of adeno-associated virus-based vectors into non-dividing cells (Efficient gene transfer vectors by ado-associated viruses-based vectors) J.Virol.68, 5656-doped 5666.

The murine hematopoietic cell transduction mediated by Adeno-associated virus type 2-mediated transduction with long-term regeneration capability and sustained expression of the human hemoglobin gene in vivo (Adeno-associated virus type 2-mediated transduction of human hematopoietic cells with long-term expression of the human hemoglobin gene and maintained expression of a human hemoglobin gene in vivo), J.Virol 71,3098 and 3104.

RAJ, K., OGSTON, P, and BEARD, P. (2001) Virus-mediated killing of cells without P53 activity (Virus-mediated killing of cell lack P53 activity.) Nature (Nature) 412,914-917.

SANTAT, L., PAZ, H., WONG, C., LI, L., MACER, J., FORMAN, S., WONG, K.K., and CHATTERJEE, S. (2005). Recombinant AAV2 transduction of primary human hematopoietic stem cells capable of continuous implantation into immunodeficient mice (Recombinant AAV2 transduction of primary human hematopoietic stem cells of clinical hematopoietic stem cells of animal genetic in-vivo-specific mice) & USA national academy of sciences 102,11053-11058.

30, SRIVASTAVA, A. (2004). AAV2 vectors for Gene delivery into human and murine primitive hematopoietic stem and progenitor cells (Gene delivery to human and muscle diagnostic and promoter cells by AAV2 vectors.) molecular biology methods (molecular biology methods) 246, 245-.

TOWNE, c., SCHNEIDER, B.L., KIERAN, d., REDMOND, d.e., jr., and aescher, p. (2009) non-human primate motor neurons efficiently transduce after intramuscular delivery of recombinant AAV of serological type 6 (Efficient transduction of non-human primate motor neurons) gene therapy.

ZHONG, L, CHEN, L, LI, Y, QING, K, WEIGEL-KELLEY, K.A., CHAN, R.J., YODER, M.C. and SRIVASTAVA, A. (2004a) Self-complementing adeno-associated virus 2(AAV) -T-cell protein tyrosine phosphatase vectors as helper viruses to improve the in vitro and in vivo transduction efficiency of conventional single-stranded AAV vectors (Self-complementary antigen-associated virus 2(AAV) -T-cell protein tyrosine phosphatase vectors of dominant-stranded AAV in vitro and in vivo transduction efficiencies 10, 950. 957.

ZHONG, l., LI, b., JAYANDHARAN, g., MAH, c.s., govindasam, l., AGBANDJEMCKENNA, m., HERZOG, r.w., WEIGEL-VAN AKEN, k.a., HOBBS, j.a., zoluthiin, s., muzyzka, n.and SRIVASTAVA, a. (2008 a.) tyrphostins of AAV2 vector and its effect on viral intracellular trafficking and transgene expression (tyrosination of AAV2 vectors and events on viral intracellular trafficking and transgene expression) (Virology 381,194 202).

ZHONG, l., LI, b., MAH, c.s., govindasay, l., AGBANDJE-MCKENNA, m., COOPER, m., herozog, r.w., zolotukin, i.e., farrington, k.h., jr., WEIGEL-VAN ake, k.a., HOBBS, j.a., zolotukin, s.a., muzycza, n.and SRIVASTAVA, a. (2008) next generation adeno-associated virus 2 vector: point mutations in tyrosine cause high transduction at lower doses (Next generation of amplified virus 2vectors: point mutations in tyrosine leads to high-efficiency transduction at low doses) & Proc. Natl.Acad.Sci.USA 105,7827-7832.

Primary murine hematopoietic cell transduction mediated by nuclear transport and uncoating restricted adeno-associated virus 2vector (infected nuclear transport and uncoating restricted viral vector addition) 2vector-mediated transduction of primary hematopoietic cells 1201218, human 1201218, published, k.a., m.a., HANSEN, j.a., LI, y.a., CHEN, l.a., CHAN, r.j., bisschof d.a., MAINA, n.a., WEIGEL-key, k.a., ZHAO, w.a., LARSEN, s.h., YODER, m.c., SHOU, w.and SRIVASTAVA, a.a. (2004b).

ZHONG, L., ZHAO, W., WU, J., LI, B., ZOLOTUKHIN, S., GOVIDEA AMY, L., AGBANDJEMCKENNA, M., and SRIVASTAVA, A. (2007). EGFR protein tyrosine kinase signaling in the dual role of AAV2 capsid ubiquitination and viral second strand DNA synthesis (A dual role of EGFR protein tyrosine kinase signaling in ubiquitination of AAV2 capsids and viral second strand DNA synthesis.) molecular therapeutics 15, 1323.

ZHOU, S.Z., BROXMEYER, H.E., COOPER, S., HARINGTON, M.A. and SRIVASTAVA, A. (1993). Adeno-associated virus 2 mediated gene transfer in murine hematopoietic progenitor cells (Adeno-associated virus 2-mediated gene transfer in human hematopoietic promoter cells) & Experimental hematology (Exp Hematol) 21,928-933.

KHAN, i.g., HIRATA, r.k., RUSSELL, d.w. (2011) AAV-mediated gene targeting methods for human cells (AAV-mediated gene targeting methods for human cells), nature protocol (Nat Protoc) 4,482-501.

KHOTIN, R.M., LINDEN, R.M., and BERNS, K.I. (1992) Characterization of preferred sites of human chromosome 19q for integration of adeno-associated viral DNA by non-homologous recombination (Characterization of a preferred site on human chromosome 19q for integration of an adenovirus-associated virus DNA by non-homologous recombination), EMBO 13,5071-8.

GIRAUD, c., WINOCOUR, e., and BERNS, k.i. (1994.) Site-specific integration of adeno-associated viruses is guided by cellular DNA sequences (Site-specific integration by ado-associated virus is directed by a cellular DNA sequence) & american college of sciences america 21,10039-43.

LINDEN, r.m., WARD, p., GIRAUD, c, WINOCOUR, e, and BERNS, k.i. (1996A.) Site-specific integration of adeno-associated virus (Site-specific integration by ado-associated virus).: journal of the national academy of sciences, usa 21,11288-94.

LinDEN, R.M., WINOCOUR, E, and BERNS, K.I. (1996B.) recombination signals for adeno-associated virus site-specific integration 15,7966-72.

XU, l., O' MALLEY, t., sants, m.s., WANG, b., MEYERROSE, t., HASKINS, m.e., and punder, k.p. (2004) In Vivo Transduction of Hematopoietic Stem Cells following Neonatal Intravenous Injection of an ampholytic Retroviral Vector In Mice (In Vivo Transduction of hepatogenic Stem Cells After animal oral Intravenous Injection of an amphotropic Retroviral Vector In rice.) "molecular therapeutics" 7 months; 10(1):37-44.

WANG, c.x., SATHER, b.d., WANG, x, ADAIR, j., KHAN, i., SINGH, s., LANG, s., ADAMS, a, curra, g., KIEM, H-p., MIAO, c.h., ravlings, d.j., and TORBETT, b.e. (2014.) Rapamycin alleviates lenticular vector transduction resistance in human and mouse hematopoietic stem cells [ blood ] 8 months; 124(6):913-23.

45.CARBONARO, D.A., JIN, X., PETERSEN, D.A., WANG, X.D., DOREY, F.D., KIL, K.S., ALDRICH, M.D., BLACKBURN, M.R., KELLEMS, R.E., and KOHN, D.B. (2006) by intravenous injection of a lenticular vector expressing human ADA into neonatal ADA knockout mice: a Novel Form of Enzyme Replacement Therapy for ADA Deficiency (In Vivo Transduction by Intravenous Injection of a Lentiviral Vector Expressing Human ADA intraneural ADA Gene knock out Mice: A Novel Form of Enzyme Replacement Therapy for ADA Deficiency) 6 months molecular therapeutics; 13(6):1110-20.

SMITH, L.J., UL-HASAN, T.A., CARVAINES, S.K., VAN VLIET, K.A., YANG, E.A., WONG, JR, K.K., AGBANDJE-MCKENNA, M. and CHATTERJEE, S. (2014) Gene Transfer characteristics and Structural Modeling of Human Stem Cell-derived AAV, molecular therapeutics 9 months; 22(9):1625-1634.

236页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：基于人TRPV1受体过表达细胞株的评价方法

Adeno-associated virus vector variants for efficient genome editing and methods thereof

相关技术

网友询问留言