Melia azedarach leaf-shrinking virus whole genome sequence and detection method thereof
阅读说明:本技术 苦楝树缩叶病毒全基因组序列及其检测方法 (Melia azedarach leaf-shrinking virus whole genome sequence and detection method thereof ) 是由 周昕 孙凯 俞晓平 叶子弘 张蓬军 尹传林 于 2021-07-20 设计创作,主要内容包括:本发明公开了苦楝树缩叶病毒全基因组序列及其检测方法。该病毒全基因组序列如序列表SEQNO:1所示;该病毒的全基因组序列包含编码gp1、gp2、gp3以及gpY四个蛋白的核苷酸序列,四个核苷酸序列分别如序列表SEQ NO:2-5所示,gp1、gp2、gp3以及gpY的氨基酸序列分别如SEQ NO:6-9所示。本发明还提供了检测所述苦楝树缩叶病毒的特异性检测引物,本发明设计的引物具有特异性强、结果可靠,在普通PCR检测中都有稳定可靠的表现。(The invention discloses a neem leaf-shrinking virus whole genome sequence and a detection method thereof. The whole genome sequence of the virus is shown as a sequence table SEQNO: 1; the whole genome sequence of the virus comprises nucleotide sequences of four proteins of gp1, gp2, gp3 and gpY, wherein the four nucleotide sequences are respectively shown as SEQ NO 2-5 in a sequence table, and the amino acid sequences of gp1, gp2, gp3 and gpY are respectively shown as SEQ NO 6-9. The invention also provides a specific detection primer for detecting the melia azedarach defoliation virus, and the primer designed by the invention has strong specificity and reliable result and has stable and reliable performance in common PCR detection.)
1. A neem tree defoliation virus obtained by artificial separation is characterized in that the whole genome sequence of the virus is shown as SEQ NO:1 in a sequence table; the whole genome sequence of the virus comprises nucleotide sequences of four proteins of gp1, gp2, gp3 and gpY, wherein the four nucleotide sequences are respectively shown as SEQ NO 2-5 in a sequence table, and the amino acid sequences of gp1, gp2, gp3 and gpY are respectively shown as SEQ NO 6-9.
2. An amplification primer for amplifying the whole genome sequence of the neem tree defoliating virus of claim 1, wherein the amplification primer comprises two pairs of extension primers, and the sequences are as follows:
CLSV-1-F:CTGCTAACTGGTTCTCCTTTCC;
CLSV-1-R:GATCCTGCTACGGGAACAAC;
CLSV-2-F:GGGTAAGTCTTGTTGATTACATTACTG;
CLSV-2-R:CCAAATCTCTGTATGCCTGATC。
3. the method for obtaining the whole genome sequence of Melia azedarach Leptospira virus of claim 1, wherein the amplification primer of claim 2 is used for amplification, comprising the following steps:
1) extracting total DNA of virus infected plant tissues;
2) performing PCR amplification by using the amplification primer and the total DNA as a template;
3) and recovering the DNA product obtained by PCR amplification, connecting the DNA product to pLB blunt-ended vectors, and carrying out DNA sequencing to obtain the whole genome sequence of the melia azedarach leaf-shrinking virus.
4. The method for obtaining the whole genome sequence of Melia azedarach Leptospira virus of claim 3, wherein the PCR amplification reaction system in step 2) is as follows:
the reaction cycles of the PCR were set as follows:
5. the method for obtaining the whole genome sequence of Melia azedarach Leptospira virus of claim 3, wherein in the step (3), DNA products with a length of 3223bp and 3931bp are recovered; pLB blunt-ended vector ligation reaction system is as follows:
6. a specific detection primer for detecting the neem defoliation virus of claim 1, wherein the specific detection primer comprises:
CLSV-d1-F:GAGAATGATGTATCCCACGG;
CLSV-d1-R:CCTGATCCTGAATATGTGTTGT。
7. a method of detecting the neem defoliation virus of claim 1, wherein the detection primer of claim 6 is used for PCR detection.
8. The detection method according to claim 7, comprising the steps of:
(1) extracting the total DNA of suspected infected chinaberry tree;
(2) diluting the final product plant total DNA in the step (1) to 100 ng/mu l, and carrying out common qualitative PCR amplification by using the specific detection primer;
(3) and (3) detecting, namely detecting a PCR product band by using 1% agarose gel electrophoresis, using 1kb DNAmarker as a fragment size control standard, and determining a detection result according to an electrophoresis pattern.
9. The detection method according to claim 8, wherein the PCR system in the step (2) is as follows:
the PCR reaction cycles were set as follows:
Technical Field
The invention relates to the technical field of sequencing and bioinformatics, in particular to a neem defoliation virus whole genome series and a detection method thereof
Background
Melia azedarach (Melia azedaeach L.) is a deciduous tree of the family Meliaceae. Native to australia and southeast asia, and is often distributed in the provinces of Sichuan, Yunnan, Guizhou, Jiangsu, Zhejiang and the like. The plant can grow rapidly on moist fertile soil, has low requirement on soil, can grow in acid soil, neutral soil and limestone areas, and is a good afforestation tree species in plains and low-altitude hilly areas. Melia azedarach is also a medicinal plant, and the whole plant or specific parts (leaves, stems, roots) can be used as a medicine, and is commonly used for treating diarrhea, diabetes, rheumatism, hypertension and other diseases. At present, the research on the chinaberry is mainly focused on the aspects of cultivation and medicinal activity, and no virus infecting the chinaberry is found in China. Recently, the diseases of the bead trees are commonly found to be in an outbreak trend, infected plants show symptoms of short plants and twisted leaves, and the prevention and treatment situation is not optimistic. If the disease is further spread, great influence is brought to the forestry in China.
Disclosure of Invention
The invention aims to solve the problems that no report of the virus diseases of the bead trees exists in the prior art and the detection means of the bead tree defoliating virus is deleted at the present stage, and provides a bead tree defoliating virus complete genome sequence, a detection method and related primers thereof.
The invention firstly provides a chinaberry trefoil-shrinking virus complete genome sequence, which is shown in a sequence table SEQNO 1; the whole genome sequence of the virus comprises nucleotide sequences of four proteins of gp1, gp2, gp3 and gpY, wherein the four nucleotide sequences are respectively shown as SEQ NO 2-5 in a sequence table, and the amino acid sequences of gp1, gp2, gp3 and gpY are respectively shown as SEQ NO 6-9.
In another aspect, the present invention provides an amplification primer for amplifying the whole genome sequence of the neem tree defoliation virus, wherein the amplification primer comprises two pairs of extension primers, and the sequences are as follows:
CLSV-1-F:CTGCTAACTGGTTCTCCTTTCC(SEQ NO:10);
CLSV-1-R:GATCCTGCTACGGGAACAAC(SEQ NO:11);
CLSV-2-F:GGGTAAGTCTTGTTGATTACATTACTG(SEQ NO:12);
CLSV-2-R:CCAAATCTCTGTATGCCTGATC(SEQ NO:13)。
the invention also provides a method for acquiring the whole genome sequence of the melia azedarach defoliating virus, which uses the amplification primer for amplification and comprises the following steps:
1) extracting total DNA of virus infected tissues;
2) performing PCR amplification by using the amplification primer and the total DNA as a template;
3) and recovering the DNA product obtained by PCR amplification, connecting the DNA product to pLB blunt-ended vectors, and carrying out DNA sequencing to obtain the whole genome sequence of the melia azedarach leaf-shrinking virus.
In the step (3), DNA products with the lengths of 3223bp and 3931bp are recovered.
On the other hand, the invention provides a specific detection primer for detecting the melia azedarach leaf-shrinking virus, which comprises the following steps:
CLSV-d1-F:GAGAATGATGTATCCCACGG(SEQ NO:14);
CLSV-d1-R:CCTGATCCTGAATATGTGTTGT(SEQ NO:15)。
the invention also provides a method for detecting the melia azedarach defoliation virus, which is characterized in that the specific detection primer is used for PCR detection.
Preferably, the detection method comprises the following steps:
(1) extracting the total DNA of suspected infected chinaberry tree;
(2) diluting the final product plant total DNA in the step (1) to 100 ng/mu l, and carrying out common qualitative PCR amplification by using the detection primer;
(3) and (3) detecting, namely detecting a PCR product band by using 1% agarose gel electrophoresis, using a 1kb DNA marker as a fragment size control standard, and determining a detection result according to an electrophoresis picture.
The invention utilizes siRNA sequencing and bioinformatics technology, definitely initiates the disease to be a new plant virus, belongs to cauliflower mosaic virus family, belongs to the baculovirus genus (named Chinaberry leaf shrinkage virus, CLSV) and takes the leaves of the virus-infected Chinaberry tree as a material to obtain the complete genome information of the virus by methods of DNA extraction, PCR cloning and the like. The bioinformatics software is used to determine the coding condition of the virus protein and the amino acid sequence, and the detection primer is designed according to the characteristics of the genome sequence of the virus, so that the detection primer can be used for detecting the existence of the virus in the chinaberry trees and other organisms. The primer designed by the method has strong specificity and reliable result, and has stable and reliable performance in common PCR detection.
Drawings
FIG. 1 shows symptoms of infection with Melia azedarach defoliating virus. The left is diseased leaves and the right is healthy leaves;
FIG. 2 is a schematic diagram of the genome structure of Melia azedarach Leptovirus;
FIG. 3 is a tree analysis of the evolution of the Toosendan leaf curl virus and other members of the baculovirus genus;
FIG. 4 shows the actual sample detection of the detection primer.
Detailed Description
The invention will be further illustrated and described with reference to specific embodiments. The technical features of the embodiments of the present invention can be combined correspondingly without mutual conflict.
1. Plant virus identification technology based on siRNA deep sequencing
(1) Sample collection and RNA extraction: cutting off the diseased parts of the chinaberry leaves with virus symptoms (such as flower leaves, leaf curl, yellowing, shrinkage and the like) in the field, putting the cut parts into a collection bag, and marking; after returning to the laboratory, grinding with liquid nitrogen immediately, extracting plant total RNA by Trizol method, or quick freezing with liquid nitrogen, and storing in-80 deg.C refrigerator immediately for use. Wherein, the symptoms of Melia azedarach defoliation virus infection are shown in figure 1.
Plant total RNA extraction
1) Taking 0.1g of plant leaves, and quickly grinding the plant leaves in liquid nitrogen to powder;
2) transferring the powder into a 1.5ml centrifuge tube, adding 1ml Trizol, shaking and uniformly mixing, and standing for 5min at room temperature;
3) adding 0.2mL of chloroform into the centrifugal tube, violently shaking for 15sec, and standing at room temperature for 3 min;
4) centrifuging at 4 ℃ at 12,000rpm for 15min, carefully sucking the supernatant and transferring to a new 1.5mL centrifuge tube, and repeating the steps 3 to 4 once to twice;
5) transferring the supernatant into a new 1.5mL centrifuge tube, adding isovolumic precooled isopropanol, reversing for several times, uniformly mixing, and standing at room temperature for 20-30 min;
6) centrifuging at 4 ℃ and 12,000rpm for 10min, discarding the supernatant, and washing the precipitate twice with 1mL of 70% alcohol;
7) centrifuging at 4 deg.C and 12,000rpm for 5min, removing supernatant, and drying at room temperature to obtain precipitate;
8) dissolving the precipitate with 50L of DEPC treated water;
9) taking a proper amount of sample to carry out agarose gel electrophoresis to detect the quality of the extracted RNA;
10) the samples were stored in a-80 ℃ freezer.
(2) Deep sequencing of siRNA: and (3) sending the extracted total RNA of the sample to Meiji biotechnology limited to Shanghai for siRNA library building and sequencing.
(3) siRNA deep sequencing data processing and analysis: performing original data filtration (removing linker information and low-quality sequences contained in the original data) on sequencing data by using bioinformatics software, performing sequence splicing (according to the characteristic that small RNA has overlap, performing sequence splicing on the small RNA by using Velvet software to obtain a plurality of contigs), and performing sequence comparison (performing BLASTn and BLASTx comparison on the contigs in an NCBI database to obtain the positions of the contigs on a virus genome).
2. Whole genome sequence determination of margosa trefoil virus
(1) Plant DNA extraction
The CTAB method is adopted to extract the total DNA of virus infected tissues, and the specific method comprises the following steps: grinding 0.2g of plant tissue leaves into powder in liquid nitrogen, transferring the powder into a 1.5ml centrifuge tube, adding 600 μ L of CTAB extract preheated at 65 deg.C, rapidly mixing, keeping the temperature at 65 deg.C for 30min, and mixing by turning upside down; cooling to room temperature, adding 500 μ L chloroform/isoamyl alcohol (24: 1), mixing by inversion, centrifuging at 12000rpm for 5 min; taking the supernatant, adding 600 mu L of precooled isopropanol, reversing, uniformly mixing, centrifuging at 12000rpm for 5 min; discarding the supernatant, washing the precipitate with 800 μ L70% ethanol twice; after slightly drying, the DNA precipitate was dissolved in 30. mu.L of sterilized double distilled water and stored at 4 ℃.
(2) Amplification and sequencing of viral sequences
Designing 2 pairs of specific virus full-length genome amplification primers according to virus-derived contigs, (CLSV-1-F: CTGCTAACTGGTTCTCCTTTCC and CLSV-1-R: GATCCTGCTACGGGAACAAC; and CLSV-2-F: GGGTAAGTCTTGTTGATTACATTACTG and CLSV-2-R: CCAAATCTCTGTATGCCTGATC), and obtaining a fragment 1:3223bp by using a PCR technology; fragment 2: 3931 bp. Splicing by using snapgene software to obtain a circular DNA virus genome with the total length of 7018 bp. The PCR reaction system is as follows: taking total DNA of diseased plants as a template, selecting KOD-Plus-Neo high-fidelity DNA polymerase to amplify the target fragment, wherein the reaction system is as follows:
setting of PCR reaction cycle:
DNA products of 3223bp and 3931bp in length were recovered and ligated into pLB blunt-ended vectors, which were sent to Youkang Biotech, Hangzhou for DNA sequencing.
pLB blunt end ligation reaction system is as follows:
the tube was gently flicked to mix the reaction solution, centrifuged for 3-5sec briefly, and the mixed reaction solution was left at room temperature (22 ℃) for 5 min. After the reaction, the centrifuge tube was placed on ice to perform the subsequent conversion reaction.
3. Bioinformatic analysis of viral genomes
(1) Structural analysis of viral genome: predicting a virus-encoding ORF using NCBI ORF finder software and SnapGene software; conserved domains on the viral genes were analyzed using NCBI conserved region analysis tools.
Nucleotide sequence analysis of the viral genome showed that the virus had 61.3% similarity to the genomic sequence of Coccomyga virus (CSSV).
Predictive analysis of the virus-encoding gene using Snapgene software showed that the viral chain of the virus encodes four proteins gp1, gp2, gp3 and gpY. Amino acid homology alignment finds that the similarity between virus-coded gp1, gp2 and gp3 amino acid sequences and CSSV-coded amino acid sequences is 51-67 percent; gpY has no significant similarity to the CSSV-encoded protein. A schematic representation of the genome structure of the Toosendan leaf curl virus is shown in FIG. 2, and a phylogenetic tree analysis of Toosendan leaf curl virus and other members of the baculovirus genus is shown in FIG. 3.
4. Method for detecting leaf-shrinking virus of melia azedarach
1. Total DNA from suspected infected Melia azedarach was extracted (as described above).
2. Diluting the final product to 100ng/ul, and detecting by using a common typing PCR, wherein the primers are CLSV-d 1-F: GAGAATGATGTATCCCACGG + CLSV-d 1-R: CCTGATCCTGAATATGTGTTGT (product 143 bp).
Taking 2xTaq PCR Mix as an example of a fuel-containing product (Nanjing Novovovovozan Green Taq Mix), the general PCR system is as follows:
setting of PCR reaction cycle
The detection method comprises the following steps: the PCR product bands were detected by 1% agarose gel electrophoresis using a 1kb DNA marker (ThermoFisher GeneRuler 1kb DNA Ladder) as a fragment size control.
This example performed 8 samples, where 1,4 and 8 are plant samples with leaf reduction symptoms, "+" indicates a positive control plasmid, and "-" indicates a negative control PCR reaction without template addition, which is asymptomatic leaf with the samples. The detection results are shown in FIG. 4, and it can be seen from the results that the specificity detection primer of the invention has strong specificity, reliable results, and stable and reliable performance in common PCR detection
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present invention should be subject to the appended claims.
Sequence listing
<110> China metering university
<120> Melia azedarach leaf-shrinking virus whole genome sequence and detection method thereof
<160> 15
<170> SIPOSequenceListing 1.0
<210> 1
<211> 7018
<212> DNA
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 1
tggtatcaga gcagccagat ttaagctttt tatctggttg ctttctatgt taaagaagac 60
aaccagaaga atcttcatat ctgtaagttt cgctcaacta cttttaaatt tcttagataa 120
tttgtgcaag tttgatgatg ttttattaat gtacaggctg taaaagttat ctagaggagg 180
attctctttt ctttgtcaga ggtgaataga aaataaagaa gaaaagaaga aggtttctga 240
aagaaatatt aatgtctgcg caagaagaga actcgatcag acagtggtct cacaagtctc 300
atacagctaa cttggaggtc atcgatttgg aagatacgag aaagatcctc aaccataccc 360
tcgcgcacaa cattgcggtt acggcagatc gtgtgtcctt gagtgaacag gtgtttatca 420
agaacctcaa acaaatacac gaggatatac tccaactgat aagagaagtg gagtctaagt 480
ctatgtcttt gaagcgttgc tctcagccct tgcgtatcaa caaacctctc accgaggatt 540
tgtgcaagat actggtcaag ctcttggcat cccagccgaa actcgttgag gaaagggctt 600
tgtcactgac gcaagaagtt gaatgtaagt tgaatcgtgt ggagcaactt ctccatgagt 660
tggaaatttg tgttggacaa tgactaaaca gcctatgtac ccaaaagctg tgcgtgctgc 720
gctgagagtt aagccgcaaa tgcttaagca cactgctatt ggtggaatta cggctattat 780
actattatta aacaaaataa tgtgcagata cgtccagatc cttctcctcg ctcttatcgc 840
taagaagctg gacgatgaaa gcgtcagagc actgacaccg aagtcaaaac acgtttacca 900
gaaaaactta tcgacaagct ttcacgtctt cagattcaga aaggggagca aaggtgaaca 960
gcaggatacc aaacaaagag agggtaaagg cacacttatc ggtgacaagg atccgtataa 1020
aatcctggaa gaagaacgcg caaaactcgg attgcagcag agccaaaagg atgaatcaaa 1080
ggggaagcga acagccgcag agacatagtg acaccaccac aggctccgaa cctgaaacag 1140
caagcgttca gactcttacc gaagataaca ttagtggtcc aacacaaccg caagaacgaa 1200
tccaaaaggt gcgcaggcgc aagcacagtc tgacccgata cttatcccat gagccaaaac 1260
cacactacag acacggaaga aggaaggata cactggaaga ggagaagggc caccaggcaa 1320
ccataaggct ttacatgcaa gaaagcccac agcttgtgct ctcagaagta ttacaactgt 1380
ccagagggga ttttgtaaaa ctttacgttt ataccccacc gtcagaagaa tcggttctag 1440
taactgacgg aaaccagctg gacaggacat tcatacagcc agaaagcctc gagcaattac 1500
aacgatctgg ctactcattc atccacgtgg gaatcctaca atttagggtt caaatactgc 1560
atagagctga agaagggacc atggcaatgg tcgtattcag agataacaga tggcaaggag 1620
atcaagccat ctttgcaacc atggagattg atttgacaaa aggatatctc atggtgtatg 1680
tcatccctga cacaatgatg acagttgggg actttgcccg aaatattggt atttcagtgc 1740
aaacgcgggg atacagcaat tggcagaacg gagaagccaa cttgctaata accaggggca 1800
tgacagggag attatcaaat actcccaacg tggcatttgc ttatcaggta gacggagcag 1860
ttgactacct aatcagccat ggagttaaag ccatagcagg aaagaaatac gaccctagca 1920
gattaagggg tcaacaatgg gtgatgcgac caccgagact ggacatcaca cccatgcagc 1980
cacaaacagc agaaacaaga accttaatag acggctctgt gtctattagg tttggagatt 2040
atcaggcatc aacatcaagg ccaccgagat acaatgaaga ggatgaagag gcagcttcaa 2100
cagaagaaga gattatacct gtctggatga ttggcccaga agagcagcct gatgatacag 2160
acagagtcaa agtctgggaa gagagttgca gtggcaatgg cagattctac agatactaca 2220
ctgcaccccc acagcatgtt ggcgaaatca tagccacagg atggggctca gatgatgatt 2280
ctgacgagct agaactggaa gtccaacagt ttcttgagac tctggagcat gaggatgatg 2340
ctgacatgca cccagaacat caagaatttc ttgatggact caccgatggg ctcactacat 2400
ggtccattga ttcctatacg gaaggtggtg gggaggaaca gttaatcgca acatttggcg 2460
aaatggaata cccaacactt agaagaatcg ttgaggaaaa taggaatcag gcccaagatg 2520
aaggcccaag cccaagttta aaaagggacc agcaggtgta ttcacactca gaagtggtgg 2580
actacaaccc accagcggat atagccatga caccagtagg ctacccacct gctacaaatt 2640
tggaaatacc agcccagcca cagtatgatg gagcaagacc cagaggctca tttaagggat 2700
ccaaatacaa tgaattgtgg caactacctt cggcccaaac caacactggg gccatatttg 2760
taatgccaag gcagattgaa ctattccatg acgtgtttga cagatgggag tctataacaa 2820
agaactatgt gaccatgcaa ggtattactg atgcaacaga gaaggtagaa tttattgaaa 2880
atctactggg agaaatggag aaacaaacgt ggatacagtg gagaatgatg tatcccacgg 2940
agtttgaaac aatcataaca agggctgagg gaagagaagg gacacagaat attctgtccc 3000
agataagaag agtgttctcg ctagaggatc ctgctacggg aacaacacat attcaggatc 3060
aggcatacag agatttggaa aggttgactt gcaataacgt aaaggacctt gtccaatatc 3120
taaatgattt tggaaggctt gcagcaaaaa caggaaggat gtttctgaac actgaattaa 3180
gtgataagct gtggttgaaa atgcctggcg atattggcca gagaatgaaa atggctttca 3240
atgccaaatt cccggggaac cagataggcg tcttcccgag aatcctttat gcttatcagt 3300
tcatggaaca ggaatgcaag aacgcagctt tccagagaag cttgaagaac ctggccttct 3360
gcaaagacat tccttttcca ggatattatt ctgagtcttc aaagagcaga tacggggcta 3420
gaaagtctac aacctacaaa gggaaggctc actccacaca cgccagaatt gaaaagaaaa 3480
agcacctggt cagaaacagg aggtgtaaat gttatctgtg tggtgatgaa ggccccttcg 3540
ctagagaatg ccctaatgaa agaaggaatg taaggagggt tgctgttttt gaaaaccttg 3600
ccttaccaga cgactatgag attgtatctg tgcaggacgg agaagaagaa tctgatgcca 3660
tatacagtct atcggaaaac gagcacgaga atggggtgga ccttgaacca gtggtgggag 3720
cagcaacaga agagacttgc ttcatgttca gggaagaaga caactcgtat tgggtaggaa 3780
aaggaggcta cttagcctat aaaagagtaa caaaggccca gtacgaatgc aagcacactt 3840
gggctcataa caaagaagtt gaggcccaat ggataaactg cagcttctgc aagaggccca 3900
ctaacagaaa atgtagggct cattgtccaa aatgcaggct tactacttgc gaaatgtgtg 3960
ctgacccatt ctgtgagatt aatgtagtca gagaaccaga gatttacaag ccttatgatc 4020
cacatggctt gatacaacaa caaagggact acatcgcgtg gtgtgaagga gagatgagta 4080
gactccggag ggaagtggag ttctacaaga aaaaggaaga agacaggctg gctaaagacc 4140
ttgaaaagga gagagcaaga caagaaaaaa ttgatgcaga gagagaagca tccagctcca 4200
aaggaaaaga agtgctagag gaaataaagg aagaatcaag tgatggagag atttccgcct 4260
attgggaatc tgaaagcact gtcaaggtca gaaccatagc agctgctgca ggagaatctg 4320
agcagaaagt caaagaagag aagccagtac gagagaacaa caatctctac aacatgaccg 4380
tggaagttga tattccagga gtgcctaaat tttcattaag ggcaatcctt gataccggag 4440
caacggtatg ttgtgtagat tcgaaagctc tgccaaagga agctattgaa gacaacacct 4500
ttgaagttca tttcagaggt atcaattcaa agcagagtgt gaacaaaaaa atgaaatatg 4560
ggaggatgtc agtaggaggg cataatttca gaatcccata tacgtatact ttccctatgg 4620
atcttggagg gaaaatacag tttattcttg gttgtaattt catcagaagc atgtacggag 4680
gagtaaggct agaaggtaac acagtaacct tctacaaaaa tattacagcc attgatacca 4740
agaccgtggc agttctggaa gaactagaag aagaagattt acagctgtat aatctagctg 4800
tactgccaca aaagggagga gaagcctttg aaagaaaaaa cagaaggctg atcgaggagt 4860
tgaaaaacca gggttacata ggcaatgagc ctatgaaata ttggattaaa aatcaagtta 4920
catgcaaact tgatatcaaa aaccctgaga tggtaataga agacaagcct ctgaaacatg 4980
tgacaccagc aatggaggaa caattcagaa gtcacatcaa ggctttgata gacctgaagg 5040
tgataaggcc aagtaaaagt cgtcacagaa caacggcttt tatggtaaat tcgggaacaa 5100
ccatcgaccc gattacaaag aaagtggtgc atggaaagga aagaatggta ttcaactata 5160
aaaggctgaa tgatctaacc cacaaggatc agtatagtct accaggaatc cacaccatca 5220
tgaggagaat tggccaagcc cagatatttt ccaagtttga tctgaaatcg ggctttcacc 5280
aagtagccat ggacccggag tctgtagaat ggacagcatt ttgggttcca gatgggcttt 5340
atgaatggct ggttattcca ttcgggttaa aaaatgctcc agctatattc caaagaaaga 5400
tggaccaatg cttcaaggga acagagaagt tcattgcggt ctacatagat gacatcttgg 5460
tcttttccaa gaacgaagag gagcatgcag gccatgtaag aaaaatgttg gaaatagtaa 5520
agtctaatgg actaatccta agcccaacaa agatgtgcct ggcccaacga tcggttgaat 5580
ttctaggggc aattatcaca ggaggaaagc tccaattaca gccccacatc atcaagaagg 5640
tggtccagtt cgataagccc agcttagaga ccactaaagg actaagagga tttcttgggc 5700
tcctcaacta tgcaagggcg tatatcccta atttgggccg actgctaagc ccattatacg 5760
ccaaaacaag cccaacagga gaaagaaggt tcagcaaaga agactggaag cttgtcagca 5820
acatccagac agaggtacag aagctaccgg acctgaacct accaccggag gagtgctgta 5880
taatcatcga aacagatggt tgtatagacg gatggggagc tgtctgcaaa tggaagaaga 5940
agagagcaga tagcagaaat acagaaatgg tctgcgccta tggtagtgga aagtttgaaa 6000
atcccaaatc caccatagat gctgaaataa cagccgtgat taaagcactg gagtctttta 6060
agatttatta tttagataaa cagtgtttag tcattagaac agattgtcag gccattgtat 6120
cgtttttcaa caagtcctgt aaccataaac cgtctagggt taggtgggta agtcttgttg 6180
attacattac tgggatggga ttagaagtca agttcgagca tattgatgga aaggagaacc 6240
agttagcaga cgtcctttca aggctaatct tccaaacatg gaaccaatct cctcaacaga 6300
caagtcagca gcttcttcaa gattgtctgc acagaaactc tttgatgtca attatccatg 6360
ttgctttacc tatgaaaaaa tatgtttcca acattcgtca gccggttccg gctgtaccag 6420
ttttgagcgc ccctacggct ccatttctaa tcaattccac tgggaagaaa atccaggagg 6480
agaaaagact ggagcttctt tacgctcact acaaagcatt atacggcatt ctgcgctacg 6540
cgtggtggga tctcacaacc tcagcggcca gcgactactg gaccaaacag ctttcagaaa 6600
gagttcctca aatatggacc ttcattcaac caccgagccc cctctaaaga cacagaagcc 6660
tatcgactaa ctcattggga tctgttcacc ttctccgtgt cttgttcaca taaacgtcat 6720
ctagccctca tctgccgaat cagaaaacaa ctaactcata agatcaataa cgcctccctt 6780
ttcatatttc tttcgtagaa agacatttgt acgccatttt caatattaac tgcgtgtagt 6840
ccaataaagc ttaaattgtt ttctaatgtg ctactgaccc tcaatcatat catacagaga 6900
gggttccaag ttagaacatt gaagcacccg gattatttac aatctatatt ggattaagtt 6960
ttgtgaacta agtctcgagt atagtcatat cccgcaaaat tttccacgac actaacaa 7018
<210> 2
<211> 432
<212> DNA
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 2
atgtctgcgc aagaagagaa ctcgatcaga cagtggtctc acaagtctca tacagctaac 60
ttggaggtca tcgatttgga agatacgaga aagatcctca accataccct cgcgcacaac 120
attgcggtta cggcagatcg tgtgtccttg agtgaacagg tgtttatcaa gaacctcaaa 180
caaatacacg aggatatact ccaactgata agagaagtgg agtctaagtc tatgtctttg 240
aagcgttgct ctcagccctt gcgtatcaac aaacctctca ccgaggattt gtgcaagata 300
ctggtcaagc tcttggcatc ccagccgaaa ctcgttgagg aaagggcttt gtcactgacg 360
caagaagttg aatgtaagtt gaatcgtgtg gagcaacttc tccatgagtt ggaaatttgt 420
gttggacaat ga 432
<210> 3
<211> 429
<212> DNA
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 3
atgactaaac agcctatgta cccaaaagct gtgcgtgctg cgctgagagt taagccgcaa 60
atgcttaagc acactgctat tggtggaatt acggctatta tactattatt aaacaaaata 120
atgtgcagat acgtccagat ccttctcctc gctcttatcg ctaagaagct ggacgatgaa 180
agcgtcagag cactgacacc gaagtcaaaa cacgtttacc agaaaaactt atcgacaagc 240
tttcacgtct tcagattcag aaaggggagc aaaggtgaac agcaggatac caaacaaaga 300
gagggtaaag gcacacttat cggtgacaag gatccgtata aaatcctgga agaagaacgc 360
gcaaaactcg gattgcagca gagccaaaag gatgaatcaa aggggaagcg aacagccgca 420
gagacatag 429
<210> 4
<211> 5577
<212> DNA
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 4
atgaatcaaa ggggaagcga acagccgcag agacatagtg acaccaccac aggctccgaa 60
cctgaaacag caagcgttca gactcttacc gaagataaca ttagtggtcc aacacaaccg 120
caagaacgaa tccaaaaggt gcgcaggcgc aagcacagtc tgacccgata cttatcccat 180
gagccaaaac cacactacag acacggaaga aggaaggata cactggaaga ggagaagggc 240
caccaggcaa ccataaggct ttacatgcaa gaaagcccac agcttgtgct ctcagaagta 300
ttacaactgt ccagagggga ttttgtaaaa ctttacgttt ataccccacc gtcagaagaa 360
tcggttctag taactgacgg aaaccagctg gacaggacat tcatacagcc agaaagcctc 420
gagcaattac aacgatctgg ctactcattc atccacgtgg gaatcctaca atttagggtt 480
caaatactgc atagagctga agaagggacc atggcaatgg tcgtattcag agataacaga 540
tggcaaggag atcaagccat ctttgcaacc atggagattg atttgacaaa aggatatctc 600
atggtgtatg tcatccctga cacaatgatg acagttgggg actttgcccg aaatattggt 660
atttcagtgc aaacgcgggg atacagcaat tggcagaacg gagaagccaa cttgctaata 720
accaggggca tgacagggag attatcaaat actcccaacg tggcatttgc ttatcaggta 780
gacggagcag ttgactacct aatcagccat ggagttaaag ccatagcagg aaagaaatac 840
gaccctagca gattaagggg tcaacaatgg gtgatgcgac caccgagact ggacatcaca 900
cccatgcagc cacaaacagc agaaacaaga accttaatag acggctctgt gtctattagg 960
tttggagatt atcaggcatc aacatcaagg ccaccgagat acaatgaaga ggatgaagag 1020
gcagcttcaa cagaagaaga gattatacct gtctggatga ttggcccaga agagcagcct 1080
gatgatacag acagagtcaa agtctgggaa gagagttgca gtggcaatgg cagattctac 1140
agatactaca ctgcaccccc acagcatgtt ggcgaaatca tagccacagg atggggctca 1200
gatgatgatt ctgacgagct agaactggaa gtccaacagt ttcttgagac tctggagcat 1260
gaggatgatg ctgacatgca cccagaacat caagaatttc ttgatggact caccgatggg 1320
ctcactacat ggtccattga ttcctatacg gaaggtggtg gggaggaaca gttaatcgca 1380
acatttggcg aaatggaata cccaacactt agaagaatcg ttgaggaaaa taggaatcag 1440
gcccaagatg aaggcccaag cccaagttta aaaagggacc agcaggtgta ttcacactca 1500
gaagtggtgg actacaaccc accagcggat atagccatga caccagtagg ctacccacct 1560
gctacaaatt tggaaatacc agcccagcca cagtatgatg gagcaagacc cagaggctca 1620
tttaagggat ccaaatacaa tgaattgtgg caactacctt cggcccaaac caacactggg 1680
gccatatttg taatgccaag gcagattgaa ctattccatg acgtgtttga cagatgggag 1740
tctataacaa agaactatgt gaccatgcaa ggtattactg atgcaacaga gaaggtagaa 1800
tttattgaaa atctactggg agaaatggag aaacaaacgt ggatacagtg gagaatgatg 1860
tatcccacgg agtttgaaac aatcataaca agggctgagg gaagagaagg gacacagaat 1920
attctgtccc agataagaag agtgttctcg ctagaggatc ctgctacggg aacaacacat 1980
attcaggatc aggcatacag agatttggaa aggttgactt gcaataacgt aaaggacctt 2040
gtccaatatc taaatgattt tggaaggctt gcagcaaaaa caggaaggat gtttctgaac 2100
actgaattaa gtgataagct gtggttgaaa atgcctggcg atattggcca gagaatgaaa 2160
atggctttca atgccaaatt cccggggaac cagataggcg tcttcccgag aatcctttat 2220
gcttatcagt tcatggaaca ggaatgcaag aacgcagctt tccagagaag cttgaagaac 2280
ctggccttct gcaaagacat tccttttcca ggatattatt ctgagtcttc aaagagcaga 2340
tacggggcta gaaagtctac aacctacaaa gggaaggctc actccacaca cgccagaatt 2400
gaaaagaaaa agcacctggt cagaaacagg aggtgtaaat gttatctgtg tggtgatgaa 2460
ggccccttcg ctagagaatg ccctaatgaa agaaggaatg taaggagggt tgctgttttt 2520
gaaaaccttg ccttaccaga cgactatgag attgtatctg tgcaggacgg agaagaagaa 2580
tctgatgcca tatacagtct atcggaaaac gagcacgaga atggggtgga ccttgaacca 2640
gtggtgggag cagcaacaga agagacttgc ttcatgttca gggaagaaga caactcgtat 2700
tgggtaggaa aaggaggcta cttagcctat aaaagagtaa caaaggccca gtacgaatgc 2760
aagcacactt gggctcataa caaagaagtt gaggcccaat ggataaactg cagcttctgc 2820
aagaggccca ctaacagaaa atgtagggct cattgtccaa aatgcaggct tactacttgc 2880
gaaatgtgtg ctgacccatt ctgtgagatt aatgtagtca gagaaccaga gatttacaag 2940
ccttatgatc cacatggctt gatacaacaa caaagggact acatcgcgtg gtgtgaagga 3000
gagatgagta gactccggag ggaagtggag ttctacaaga aaaaggaaga agacaggctg 3060
gctaaagacc ttgaaaagga gagagcaaga caagaaaaaa ttgatgcaga gagagaagca 3120
tccagctcca aaggaaaaga agtgctagag gaaataaagg aagaatcaag tgatggagag 3180
atttccgcct attgggaatc tgaaagcact gtcaaggtca gaaccatagc agctgctgca 3240
ggagaatctg agcagaaagt caaagaagag aagccagtac gagagaacaa caatctctac 3300
aacatgaccg tggaagttga tattccagga gtgcctaaat tttcattaag ggcaatcctt 3360
gataccggag caacggtatg ttgtgtagat tcgaaagctc tgccaaagga agctattgaa 3420
gacaacacct ttgaagttca tttcagaggt atcaattcaa agcagagtgt gaacaaaaaa 3480
atgaaatatg ggaggatgtc agtaggaggg cataatttca gaatcccata tacgtatact 3540
ttccctatgg atcttggagg gaaaatacag tttattcttg gttgtaattt catcagaagc 3600
atgtacggag gagtaaggct agaaggtaac acagtaacct tctacaaaaa tattacagcc 3660
attgatacca agaccgtggc agttctggaa gaactagaag aagaagattt acagctgtat 3720
aatctagctg tactgccaca aaagggagga gaagcctttg aaagaaaaaa cagaaggctg 3780
atcgaggagt tgaaaaacca gggttacata ggcaatgagc ctatgaaata ttggattaaa 3840
aatcaagtta catgcaaact tgatatcaaa aaccctgaga tggtaataga agacaagcct 3900
ctgaaacatg tgacaccagc aatggaggaa caattcagaa gtcacatcaa ggctttgata 3960
gacctgaagg tgataaggcc aagtaaaagt cgtcacagaa caacggcttt tatggtaaat 4020
tcgggaacaa ccatcgaccc gattacaaag aaagtggtgc atggaaagga aagaatggta 4080
ttcaactata aaaggctgaa tgatctaacc cacaaggatc agtatagtct accaggaatc 4140
cacaccatca tgaggagaat tggccaagcc cagatatttt ccaagtttga tctgaaatcg 4200
ggctttcacc aagtagccat ggacccggag tctgtagaat ggacagcatt ttgggttcca 4260
gatgggcttt atgaatggct ggttattcca ttcgggttaa aaaatgctcc agctatattc 4320
caaagaaaga tggaccaatg cttcaaggga acagagaagt tcattgcggt ctacatagat 4380
gacatcttgg tcttttccaa gaacgaagag gagcatgcag gccatgtaag aaaaatgttg 4440
gaaatagtaa agtctaatgg actaatccta agcccaacaa agatgtgcct ggcccaacga 4500
tcggttgaat ttctaggggc aattatcaca ggaggaaagc tccaattaca gccccacatc 4560
atcaagaagg tggtccagtt cgataagccc agcttagaga ccactaaagg actaagagga 4620
tttcttgggc tcctcaacta tgcaagggcg tatatcccta atttgggccg actgctaagc 4680
ccattatacg ccaaaacaag cccaacagga gaaagaaggt tcagcaaaga agactggaag 4740
cttgtcagca acatccagac agaggtacag aagctaccgg acctgaacct accaccggag 4800
gagtgctgta taatcatcga aacagatggt tgtatagacg gatggggagc tgtctgcaaa 4860
tggaagaaga agagagcaga tagcagaaat acagaaatgg tctgcgccta tggtagtgga 4920
aagtttgaaa atcccaaatc caccatagat gctgaaataa cagccgtgat taaagcactg 4980
gagtctttta agatttatta tttagataaa cagtgtttag tcattagaac agattgtcag 5040
gccattgtat cgtttttcaa caagtcctgt aaccataaac cgtctagggt taggtgggta 5100
agtcttgttg attacattac tgggatggga ttagaagtca agttcgagca tattgatgga 5160
aaggagaacc agttagcaga cgtcctttca aggctaatct tccaaacatg gaaccaatct 5220
cctcaacaga caagtcagca gcttcttcaa gattgtctgc acagaaactc tttgatgtca 5280
attatccatg ttgctttacc tatgaaaaaa tatgtttcca acattcgtca gccggttccg 5340
gctgtaccag ttttgagcgc ccctacggct ccatttctaa tcaattccac tgggaagaaa 5400
atccaggagg agaaaagact ggagcttctt tacgctcact acaaagcatt atacggcatt 5460
ctgcgctacg cgtggtggga tctcacaacc tcagcggcca gcgactactg gaccaaacag 5520
ctttcagaaa gagttcctca aatatggacc ttcattcaac caccgagccc cctctaa 5577
<210> 5
<211> 393
<212> DNA
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 5
atggaaccaa tctcctcaac agacaagtca gcagcttctt caagattgtc tgcacagaaa 60
ctctttgatg tcaattatcc atgttgcttt acctatgaaa aaatatgttt ccaacattcg 120
tcagccggtt ccggctgtac cagttttgag cgcccctacg gctccatttc taatcaattc 180
cactgggaag aaaatccagg aggagaaaag actggagctt ctttacgctc actacaaagc 240
attatacggc attctgcgct acgcgtggtg ggatctcaca acctcagcgg ccagcgacta 300
ctggaccaaa cagctttcag aaagagttcc tcaaatatgg accttcattc aaccaccgag 360
ccccctctaa agacacagaa gcctatcgac taa 393
<210> 6
<211> 143
<212> PRT
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 6
Met Ser Ala Gln Glu Glu Asn Ser Ile Arg Gln Trp Ser His Lys Ser
1 5 10 15
His Thr Ala Asn Leu Glu Val Ile Asp Leu Glu Asp Thr Arg Lys Ile
20 25 30
Leu Asn His Thr Leu Ala His Asn Ile Ala Val Thr Ala Asp Arg Val
35 40 45
Ser Leu Ser Glu Gln Val Phe Ile Lys Asn Leu Lys Gln Ile His Glu
50 55 60
Asp Ile Leu Gln Leu Ile Arg Glu Val Glu Ser Lys Ser Met Ser Leu
65 70 75 80
Lys Arg Cys Ser Gln Pro Leu Arg Ile Asn Lys Pro Leu Thr Glu Asp
85 90 95
Leu Cys Lys Ile Leu Val Lys Leu Leu Ala Ser Gln Pro Lys Leu Val
100 105 110
Glu Glu Arg Ala Leu Ser Leu Thr Gln Glu Val Glu Cys Lys Leu Asn
115 120 125
Arg Val Glu Gln Leu Leu His Glu Leu Glu Ile Cys Val Gly Gln
130 135 140
<210> 7
<211> 142
<212> PRT
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 7
Met Thr Lys Gln Pro Met Tyr Pro Lys Ala Val Arg Ala Ala Leu Arg
1 5 10 15
Val Lys Pro Gln Met Leu Lys His Thr Ala Ile Gly Gly Ile Thr Ala
20 25 30
Ile Ile Leu Leu Leu Asn Lys Ile Met Cys Arg Tyr Val Gln Ile Leu
35 40 45
Leu Leu Ala Leu Ile Ala Lys Lys Leu Asp Asp Glu Ser Val Arg Ala
50 55 60
Leu Thr Pro Lys Ser Lys His Val Tyr Gln Lys Asn Leu Ser Thr Ser
65 70 75 80
Phe His Val Phe Arg Phe Arg Lys Gly Ser Lys Gly Glu Gln Gln Asp
85 90 95
Thr Lys Gln Arg Glu Gly Lys Gly Thr Leu Ile Gly Asp Lys Asp Pro
100 105 110
Tyr Lys Ile Leu Glu Glu Glu Arg Ala Lys Leu Gly Leu Gln Gln Ser
115 120 125
Gln Lys Asp Glu Ser Lys Gly Lys Arg Thr Ala Ala Glu Thr
130 135 140
<210> 8
<211> 1858
<212> PRT
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 8
Met Asn Gln Arg Gly Ser Glu Gln Pro Gln Arg His Ser Asp Thr Thr
1 5 10 15
Thr Gly Ser Glu Pro Glu Thr Ala Ser Val Gln Thr Leu Thr Glu Asp
20 25 30
Asn Ile Ser Gly Pro Thr Gln Pro Gln Glu Arg Ile Gln Lys Val Arg
35 40 45
Arg Arg Lys His Ser Leu Thr Arg Tyr Leu Ser His Glu Pro Lys Pro
50 55 60
His Tyr Arg His Gly Arg Arg Lys Asp Thr Leu Glu Glu Glu Lys Gly
65 70 75 80
His Gln Ala Thr Ile Arg Leu Tyr Met Gln Glu Ser Pro Gln Leu Val
85 90 95
Leu Ser Glu Val Leu Gln Leu Ser Arg Gly Asp Phe Val Lys Leu Tyr
100 105 110
Val Tyr Thr Pro Pro Ser Glu Glu Ser Val Leu Val Thr Asp Gly Asn
115 120 125
Gln Leu Asp Arg Thr Phe Ile Gln Pro Glu Ser Leu Glu Gln Leu Gln
130 135 140
Arg Ser Gly Tyr Ser Phe Ile His Val Gly Ile Leu Gln Phe Arg Val
145 150 155 160
Gln Ile Leu His Arg Ala Glu Glu Gly Thr Met Ala Met Val Val Phe
165 170 175
Arg Asp Asn Arg Trp Gln Gly Asp Gln Ala Ile Phe Ala Thr Met Glu
180 185 190
Ile Asp Leu Thr Lys Gly Tyr Leu Met Val Tyr Val Ile Pro Asp Thr
195 200 205
Met Met Thr Val Gly Asp Phe Ala Arg Asn Ile Gly Ile Ser Val Gln
210 215 220
Thr Arg Gly Tyr Ser Asn Trp Gln Asn Gly Glu Ala Asn Leu Leu Ile
225 230 235 240
Thr Arg Gly Met Thr Gly Arg Leu Ser Asn Thr Pro Asn Val Ala Phe
245 250 255
Ala Tyr Gln Val Asp Gly Ala Val Asp Tyr Leu Ile Ser His Gly Val
260 265 270
Lys Ala Ile Ala Gly Lys Lys Tyr Asp Pro Ser Arg Leu Arg Gly Gln
275 280 285
Gln Trp Val Met Arg Pro Pro Arg Leu Asp Ile Thr Pro Met Gln Pro
290 295 300
Gln Thr Ala Glu Thr Arg Thr Leu Ile Asp Gly Ser Val Ser Ile Arg
305 310 315 320
Phe Gly Asp Tyr Gln Ala Ser Thr Ser Arg Pro Pro Arg Tyr Asn Glu
325 330 335
Glu Asp Glu Glu Ala Ala Ser Thr Glu Glu Glu Ile Ile Pro Val Trp
340 345 350
Met Ile Gly Pro Glu Glu Gln Pro Asp Asp Thr Asp Arg Val Lys Val
355 360 365
Trp Glu Glu Ser Cys Ser Gly Asn Gly Arg Phe Tyr Arg Tyr Tyr Thr
370 375 380
Ala Pro Pro Gln His Val Gly Glu Ile Ile Ala Thr Gly Trp Gly Ser
385 390 395 400
Asp Asp Asp Ser Asp Glu Leu Glu Leu Glu Val Gln Gln Phe Leu Glu
405 410 415
Thr Leu Glu His Glu Asp Asp Ala Asp Met His Pro Glu His Gln Glu
420 425 430
Phe Leu Asp Gly Leu Thr Asp Gly Leu Thr Thr Trp Ser Ile Asp Ser
435 440 445
Tyr Thr Glu Gly Gly Gly Glu Glu Gln Leu Ile Ala Thr Phe Gly Glu
450 455 460
Met Glu Tyr Pro Thr Leu Arg Arg Ile Val Glu Glu Asn Arg Asn Gln
465 470 475 480
Ala Gln Asp Glu Gly Pro Ser Pro Ser Leu Lys Arg Asp Gln Gln Val
485 490 495
Tyr Ser His Ser Glu Val Val Asp Tyr Asn Pro Pro Ala Asp Ile Ala
500 505 510
Met Thr Pro Val Gly Tyr Pro Pro Ala Thr Asn Leu Glu Ile Pro Ala
515 520 525
Gln Pro Gln Tyr Asp Gly Ala Arg Pro Arg Gly Ser Phe Lys Gly Ser
530 535 540
Lys Tyr Asn Glu Leu Trp Gln Leu Pro Ser Ala Gln Thr Asn Thr Gly
545 550 555 560
Ala Ile Phe Val Met Pro Arg Gln Ile Glu Leu Phe His Asp Val Phe
565 570 575
Asp Arg Trp Glu Ser Ile Thr Lys Asn Tyr Val Thr Met Gln Gly Ile
580 585 590
Thr Asp Ala Thr Glu Lys Val Glu Phe Ile Glu Asn Leu Leu Gly Glu
595 600 605
Met Glu Lys Gln Thr Trp Ile Gln Trp Arg Met Met Tyr Pro Thr Glu
610 615 620
Phe Glu Thr Ile Ile Thr Arg Ala Glu Gly Arg Glu Gly Thr Gln Asn
625 630 635 640
Ile Leu Ser Gln Ile Arg Arg Val Phe Ser Leu Glu Asp Pro Ala Thr
645 650 655
Gly Thr Thr His Ile Gln Asp Gln Ala Tyr Arg Asp Leu Glu Arg Leu
660 665 670
Thr Cys Asn Asn Val Lys Asp Leu Val Gln Tyr Leu Asn Asp Phe Gly
675 680 685
Arg Leu Ala Ala Lys Thr Gly Arg Met Phe Leu Asn Thr Glu Leu Ser
690 695 700
Asp Lys Leu Trp Leu Lys Met Pro Gly Asp Ile Gly Gln Arg Met Lys
705 710 715 720
Met Ala Phe Asn Ala Lys Phe Pro Gly Asn Gln Ile Gly Val Phe Pro
725 730 735
Arg Ile Leu Tyr Ala Tyr Gln Phe Met Glu Gln Glu Cys Lys Asn Ala
740 745 750
Ala Phe Gln Arg Ser Leu Lys Asn Leu Ala Phe Cys Lys Asp Ile Pro
755 760 765
Phe Pro Gly Tyr Tyr Ser Glu Ser Ser Lys Ser Arg Tyr Gly Ala Arg
770 775 780
Lys Ser Thr Thr Tyr Lys Gly Lys Ala His Ser Thr His Ala Arg Ile
785 790 795 800
Glu Lys Lys Lys His Leu Val Arg Asn Arg Arg Cys Lys Cys Tyr Leu
805 810 815
Cys Gly Asp Glu Gly Pro Phe Ala Arg Glu Cys Pro Asn Glu Arg Arg
820 825 830
Asn Val Arg Arg Val Ala Val Phe Glu Asn Leu Ala Leu Pro Asp Asp
835 840 845
Tyr Glu Ile Val Ser Val Gln Asp Gly Glu Glu Glu Ser Asp Ala Ile
850 855 860
Tyr Ser Leu Ser Glu Asn Glu His Glu Asn Gly Val Asp Leu Glu Pro
865 870 875 880
Val Val Gly Ala Ala Thr Glu Glu Thr Cys Phe Met Phe Arg Glu Glu
885 890 895
Asp Asn Ser Tyr Trp Val Gly Lys Gly Gly Tyr Leu Ala Tyr Lys Arg
900 905 910
Val Thr Lys Ala Gln Tyr Glu Cys Lys His Thr Trp Ala His Asn Lys
915 920 925
Glu Val Glu Ala Gln Trp Ile Asn Cys Ser Phe Cys Lys Arg Pro Thr
930 935 940
Asn Arg Lys Cys Arg Ala His Cys Pro Lys Cys Arg Leu Thr Thr Cys
945 950 955 960
Glu Met Cys Ala Asp Pro Phe Cys Glu Ile Asn Val Val Arg Glu Pro
965 970 975
Glu Ile Tyr Lys Pro Tyr Asp Pro His Gly Leu Ile Gln Gln Gln Arg
980 985 990
Asp Tyr Ile Ala Trp Cys Glu Gly Glu Met Ser Arg Leu Arg Arg Glu
995 1000 1005
Val Glu Phe Tyr Lys Lys Lys Glu Glu Asp Arg Leu Ala Lys Asp Leu
1010 1015 1020
Glu Lys Glu Arg Ala Arg Gln Glu Lys Ile Asp Ala Glu Arg Glu Ala
1025 1030 1035 1040
Ser Ser Ser Lys Gly Lys Glu Val Leu Glu Glu Ile Lys Glu Glu Ser
1045 1050 1055
Ser Asp Gly Glu Ile Ser Ala Tyr Trp Glu Ser Glu Ser Thr Val Lys
1060 1065 1070
Val Arg Thr Ile Ala Ala Ala Ala Gly Glu Ser Glu Gln Lys Val Lys
1075 1080 1085
Glu Glu Lys Pro Val Arg Glu Asn Asn Asn Leu Tyr Asn Met Thr Val
1090 1095 1100
Glu Val Asp Ile Pro Gly Val Pro Lys Phe Ser Leu Arg Ala Ile Leu
1105 1110 1115 1120
Asp Thr Gly Ala Thr Val Cys Cys Val Asp Ser Lys Ala Leu Pro Lys
1125 1130 1135
Glu Ala Ile Glu Asp Asn Thr Phe Glu Val His Phe Arg Gly Ile Asn
1140 1145 1150
Ser Lys Gln Ser Val Asn Lys Lys Met Lys Tyr Gly Arg Met Ser Val
1155 1160 1165
Gly Gly His Asn Phe Arg Ile Pro Tyr Thr Tyr Thr Phe Pro Met Asp
1170 1175 1180
Leu Gly Gly Lys Ile Gln Phe Ile Leu Gly Cys Asn Phe Ile Arg Ser
1185 1190 1195 1200
Met Tyr Gly Gly Val Arg Leu Glu Gly Asn Thr Val Thr Phe Tyr Lys
1205 1210 1215
Asn Ile Thr Ala Ile Asp Thr Lys Thr Val Ala Val Leu Glu Glu Leu
1220 1225 1230
Glu Glu Glu Asp Leu Gln Leu Tyr Asn Leu Ala Val Leu Pro Gln Lys
1235 1240 1245
Gly Gly Glu Ala Phe Glu Arg Lys Asn Arg Arg Leu Ile Glu Glu Leu
1250 1255 1260
Lys Asn Gln Gly Tyr Ile Gly Asn Glu Pro Met Lys Tyr Trp Ile Lys
1265 1270 1275 1280
Asn Gln Val Thr Cys Lys Leu Asp Ile Lys Asn Pro Glu Met Val Ile
1285 1290 1295
Glu Asp Lys Pro Leu Lys His Val Thr Pro Ala Met Glu Glu Gln Phe
1300 1305 1310
Arg Ser His Ile Lys Ala Leu Ile Asp Leu Lys Val Ile Arg Pro Ser
1315 1320 1325
Lys Ser Arg His Arg Thr Thr Ala Phe Met Val Asn Ser Gly Thr Thr
1330 1335 1340
Ile Asp Pro Ile Thr Lys Lys Val Val His Gly Lys Glu Arg Met Val
1345 1350 1355 1360
Phe Asn Tyr Lys Arg Leu Asn Asp Leu Thr His Lys Asp Gln Tyr Ser
1365 1370 1375
Leu Pro Gly Ile His Thr Ile Met Arg Arg Ile Gly Gln Ala Gln Ile
1380 1385 1390
Phe Ser Lys Phe Asp Leu Lys Ser Gly Phe His Gln Val Ala Met Asp
1395 1400 1405
Pro Glu Ser Val Glu Trp Thr Ala Phe Trp Val Pro Asp Gly Leu Tyr
1410 1415 1420
Glu Trp Leu Val Ile Pro Phe Gly Leu Lys Asn Ala Pro Ala Ile Phe
1425 1430 1435 1440
Gln Arg Lys Met Asp Gln Cys Phe Lys Gly Thr Glu Lys Phe Ile Ala
1445 1450 1455
Val Tyr Ile Asp Asp Ile Leu Val Phe Ser Lys Asn Glu Glu Glu His
1460 1465 1470
Ala Gly His Val Arg Lys Met Leu Glu Ile Val Lys Ser Asn Gly Leu
1475 1480 1485
Ile Leu Ser Pro Thr Lys Met Cys Leu Ala Gln Arg Ser Val Glu Phe
1490 1495 1500
Leu Gly Ala Ile Ile Thr Gly Gly Lys Leu Gln Leu Gln Pro His Ile
1505 1510 1515 1520
Ile Lys Lys Val Val Gln Phe Asp Lys Pro Ser Leu Glu Thr Thr Lys
1525 1530 1535
Gly Leu Arg Gly Phe Leu Gly Leu Leu Asn Tyr Ala Arg Ala Tyr Ile
1540 1545 1550
Pro Asn Leu Gly Arg Leu Leu Ser Pro Leu Tyr Ala Lys Thr Ser Pro
1555 1560 1565
Thr Gly Glu Arg Arg Phe Ser Lys Glu Asp Trp Lys Leu Val Ser Asn
1570 1575 1580
Ile Gln Thr Glu Val Gln Lys Leu Pro Asp Leu Asn Leu Pro Pro Glu
1585 1590 1595 1600
Glu Cys Cys Ile Ile Ile Glu Thr Asp Gly Cys Ile Asp Gly Trp Gly
1605 1610 1615
Ala Val Cys Lys Trp Lys Lys Lys Arg Ala Asp Ser Arg Asn Thr Glu
1620 1625 1630
Met Val Cys Ala Tyr Gly Ser Gly Lys Phe Glu Asn Pro Lys Ser Thr
1635 1640 1645
Ile Asp Ala Glu Ile Thr Ala Val Ile Lys Ala Leu Glu Ser Phe Lys
1650 1655 1660
Ile Tyr Tyr Leu Asp Lys Gln Cys Leu Val Ile Arg Thr Asp Cys Gln
1665 1670 1675 1680
Ala Ile Val Ser Phe Phe Asn Lys Ser Cys Asn His Lys Pro Ser Arg
1685 1690 1695
Val Arg Trp Val Ser Leu Val Asp Tyr Ile Thr Gly Met Gly Leu Glu
1700 1705 1710
Val Lys Phe Glu His Ile Asp Gly Lys Glu Asn Gln Leu Ala Asp Val
1715 1720 1725
Leu Ser Arg Leu Ile Phe Gln Thr Trp Asn Gln Ser Pro Gln Gln Thr
1730 1735 1740
Ser Gln Gln Leu Leu Gln Asp Cys Leu His Arg Asn Ser Leu Met Ser
1745 1750 1755 1760
Ile Ile His Val Ala Leu Pro Met Lys Lys Tyr Val Ser Asn Ile Arg
1765 1770 1775
Gln Pro Val Pro Ala Val Pro Val Leu Ser Ala Pro Thr Ala Pro Phe
1780 1785 1790
Leu Ile Asn Ser Thr Gly Lys Lys Ile Gln Glu Glu Lys Arg Leu Glu
1795 1800 1805
Leu Leu Tyr Ala His Tyr Lys Ala Leu Tyr Gly Ile Leu Arg Tyr Ala
1810 1815 1820
Trp Trp Asp Leu Thr Thr Ser Ala Ala Ser Asp Tyr Trp Thr Lys Gln
1825 1830 1835 1840
Leu Ser Glu Arg Val Pro Gln Ile Trp Thr Phe Ile Gln Pro Pro Ser
1845 1850 1855
Pro Leu
<210> 9
<211> 130
<212> PRT
<213> Melia azedarach defoliating virus (Chinaberry leaf virus)
<400> 9
Met Glu Pro Ile Ser Ser Thr Asp Lys Ser Ala Ala Ser Ser Arg Leu
1 5 10 15
Ser Ala Gln Lys Leu Phe Asp Val Asn Tyr Pro Cys Cys Phe Thr Tyr
20 25 30
Glu Lys Ile Cys Phe Gln His Ser Ser Ala Gly Ser Gly Cys Thr Ser
35 40 45
Phe Glu Arg Pro Tyr Gly Ser Ile Ser Asn Gln Phe His Trp Glu Glu
50 55 60
Asn Pro Gly Gly Glu Lys Thr Gly Ala Ser Leu Arg Ser Leu Gln Ser
65 70 75 80
Ile Ile Arg His Ser Ala Leu Arg Val Val Gly Ser His Asn Leu Ser
85 90 95
Gly Gln Arg Leu Leu Asp Gln Thr Ala Phe Arg Lys Ser Ser Ser Asn
100 105 110
Met Asp Leu His Ser Thr Thr Glu Pro Pro Leu Lys Thr Gln Lys Pro
115 120 125
Ile Asp
130
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ctgctaactg gttctccttt cc 22
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gatcctgcta cgggaacaac 20
<210> 12
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gggtaagtct tgttgattac attactg 27
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ccaaatctct gtatgcctga tc 22
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gagaatgatg tatcccacgg 20
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
cctgatcctg aatatgtgtt gt 22