One-step gene therapy for duchenne muscular dystrophy by gene replacement and anti-inflammation

文档序号：1894714 发布日期：2021-11-26 浏览：12次中文

阅读说明：本技术 通过基因置换和抗炎的针对杜氏肌营养不良的一步基因疗法 (One-step gene therapy for duchenne muscular dystrophy by gene replacement and anti-inflammation ) 是由王冰傅浩强于 2020-02-03 设计创作，主要内容包括：在一个实施方式中,本发明提供了一种双重表达盒基因载体,其包含用于在心肌组织和骨骼肌组织中表达迷你肌营养不良蛋白基因和NF-κB/p65-shRNA基因两者的表达盒,其是腺相关病毒(AAV)载体,其中所述迷你肌营养不良蛋白基因与包含肌肉特异性第一启动子和经修饰的Mcken(MCK)增强子的构建体可操作地连接,并且其中所述NF-κB/p65-shRNA基因是在第二启动子的控制下。还提供了包含此类基因载体的药物组合物和使用此类基因递送载体和药物组合物改善杜氏肌营养不良症(DMD)的方法。(In one embodiment, the invention provides a dual expression cassette gene vector comprising an expression cassette for expressing both a mini-dystrophin gene and an NF- κ B/p65-shRNA gene in cardiac and skeletal muscle tissue, which is an adeno-associated virus (AAV) vector, wherein the mini-dystrophin gene is operably linked to a construct comprising a muscle-specific first promoter and a modified mcken (mck) enhancer, and wherein the NF- κ B/p65-shRNA gene is under the control of a second promoter. Also provided are pharmaceutical compositions comprising such gene vectors and methods of using such gene delivery vectors and pharmaceutical compositions to ameliorate Duchenne Muscular Dystrophy (DMD).)

1. A dual expression cassette gene vector comprising an expression cassette for expressing both a mini-dystrophin gene and an NF- κ B/p65-shRNA gene in cardiac and skeletal muscle tissue, which is an adeno-associated virus (AAV) vector, wherein the mini-dystrophin gene is operably linked to a construct comprising a muscle-specific first promoter and a modified mcken (mck) enhancer, and wherein the NF- κ B/p65-shRNA gene is under the control of a second promoter.

2. The genetic vector of claim 1 comprising the sequence of SEQ ID NO 1 or SEQ ID NO 23.

3. The genetic vector of claim 1 or claim 2, wherein the mini-dystrophin gene comprises the sequence of any one of SEQ ID NOs 2-13 or a functional variant thereof.

4. The genetic vector of claim 1 comprising the sequence of SEQ ID NO 25 or SEQ ID NO 26.

5. The genetic vector of claim 1 or claim 4, wherein the mini-dystrophin gene comprises the sequence of any one of SEQ ID NOs 3-6, 8-13 and 27 or a functional variant thereof.

6. The genetic vector of any one of claims 1-5, wherein the modified MCK promoter enhancer comprises the sequence of SEQ ID NO 14 or a functional variant thereof.

7. A gene vector according to any one of claims 1-5, wherein the muscle-specific first promoter is Syn.

8. The genetic vector of any one of claims 1-7, wherein the muscle-specific first promoter comprises the sequence of SEQ ID NO 15 or a functional variant thereof.

9. The genetic vector of any one of claims 1-8, wherein the second promoter is a U6 promoter.

10. The genetic vector of any one of claims 1-9, wherein the second promoter comprises the sequence of SEQ ID No. 18 or a functional variant thereof.

11. A genetic vector as in any one of claims 1-10 wherein the NF- κ B/p65-shRNA comprises the sequence of SEQ ID NO 17, SEQ ID NO 22 or SEQ ID NO 24.

12. A pharmaceutical composition comprising the gene vector of any one of claims 1-11 and a pharmaceutically acceptable carrier.

13. The pharmaceutical composition of claim 12, formulated for injection.

14. A method for ameliorating Duchenne Muscular Dystrophy (DMD) comprising administering the gene vector of any one of claims 1-11 or the pharmaceutical composition of claim 12 or 13 to a patient or subject having or at risk of developing DMD in an amount and location that ameliorates DMD.

15. The method of claim 14, wherein the gene vector or the pharmaceutical composition is administered by intraperitoneal injection.

16. The method of claim 14 or claim 15, wherein the patient has DMD.

Background

Duchenne Muscular Dystrophy (DMD) is a fatal X-linked genetic disease caused by mutations in the dystrophin gene. It is the most common inherited muscle disorder. Heart failure is the leading cause of premature death in DMA patients. Inflammation is a secondary pathological mechanism of DMD in progressive muscle degeneration, while inhibition of NF-kappaB (NF- κ B) may reduce muscle inflammation, improve muscle pathology and improve muscle physiology in DMD mice (Yang,2012 and Yin, 2017).

Gene replacement based on gene therapy is a potential treatment for DMD (Wang,2000), but there is no cure for DMD. Chronic inflammation caused by upregulation of NF- κ B signaling poses a challenge to gene therapy for DMD (Mendell JR,2010 The NEJM). Universal promoters such as the CMV promoter often cause undesirable toxicity and immune responses in muscle gene therapy. Therefore, a specific muscle-targeted gene delivery system is important for the safety of DMD clinical trials (Wang, 2008). Furthermore, given that congestive heart failure is a major complication caused by DMD, muscle-specific expression of mini-dystrophin for DMD therapy should result in strong expression of mini-dystrophin in skeletal and cardiac muscle.

It has been demonstrated that reduction of NF- κ B by shRNA technology can improve this pathological process in mdx mice (Yang, 2012). Other preliminary results also indicate that when two recombinant adeno-associated virus (AAV) vectors carrying mini-dystrophin and NF- κ B/p65-shRNA, respectively, were injected simultaneously into a DMD mouse model, expression of mini-dystrophin was significantly increased by decreasing NF- κ B. However, both AAV injections are too complex to be clinically useful in many applications.

Therefore, there is a need for a more practical vector for introducing both the mini-dystrophin gene and the NF-. kappa.B/p 65-shRNA in skeletal and cardiac muscle.

Disclosure of Invention

In one embodiment, the invention provides a dual expression cassette gene vector comprising an expression cassette for expressing both a mini-dystrophin gene and an NF- κ B/p65-shRNA gene in cardiac and skeletal muscle tissue, which is an adeno-associated virus (AAV) vector, wherein the mini-dystrophin gene is operably linked to a construct comprising a muscle-specific first promoter and a modified mcken (mck) enhancer, and wherein the NF- κ B/p65-shRNA gene is under the control of a second promoter. Also provided are pharmaceutical compositions comprising such gene vectors and methods of using such gene delivery vectors and pharmaceutical compositions to ameliorate Duchenne Muscular Dystrophy (DMD).

Similar techniques do not exist. The NF-kB pathway, upregulated in DMD, not only plays a critical role in downstream pathogenesis (achrya 2007J Clin Invest), but also significantly affects the efficiency of dystrophin gene replacement (Jayandharan,2011 PNAS). The dual therapeutic gene therapy strategy is innovative and should benefit more than a single mini-dystrophin replacement.

Drawings

Figure 1A depicts a schematic of single and dual expression cassette AAV constructs. FIG. 1B depicts a Western blot of dystrophin protein detected in cardiac tissue. FIG. 1C depicts muscular nutrition in heart and liver tissueImmunofluorescence (IF) staining of undesirable proteins. FIG. 1D depicts mdx/utrn in systemic therapy from treatment with dual and single expression cassette AAV^-/-IF staining of mini-dystrophin in heart tissue, skeletal muscle tissue (DIA is diaphragm, GAS is gastrocnemius, TA is tibialis anterior) and liver tissue in mice. Mini-dystrophin was successfully expressed in both single and dual homo groups of heart, diaphragm, GAS and TA muscles. Furthermore, no mini-dystrophin protein was expressed in liver tissue, indicating that it is tissue specific. Fig. 1E is a graph showing the ratio of mini-dystrophin positive cells in different types of tissues. There was no difference in cardiac and DIA tissues between the single and dual homo groups. However, the dual homo group had much higher mini-dystrophin proteins in GAS and TA muscles. (average value p)<0.0001)

FIG. 2A depicts IF staining of CD68, CD4, CD8, and P-P65 in gastrocnemius. FIG. 2B depicts IF staining of P-P65 in cardiac and gastrocnemius muscles. WT: wild type, dual homology: double expression cassette AAV-treated dKO-homo, single homo: single expression cassette AAV-treated dKO-homo, Ct-homo: untreated dKO-homo. Magnification: 200 x. (average p <0.05, average p <0.01, average p <0.001, average p <0.0001)

Figure 3A represents the characteristics of the transgenic and knockdown mice discussed in example 2. FIG. 3B depicts a Western blot of dystrophin and P-P65 expression in GAS muscle at 2 months of age. Figure 3C depicts hematoxylin and eosin (H & E) staining of dystrophin and β -myoglycan, as well as IF staining, in GAS muscle of the same age of the month.

Figure 4A depicts Masson trichrome and IF staining of mIgG, CD68, CD4, and CD8 in gastrocnemius of 2-month old transgenic and knockdown mice. The statistical analysis shown in FIG. 4B shows that CD68, CD4, and CD8 show significant differences between the groups of different transgenic and knockdown mice. P <0.01, p <0.001 and p < 0.0001. Fig. 4C depicts IF staining of CD8, CD4, and CD68 in rAAV treated myocardium and/or gastrocnemius (little CD8 positive in cardiac tissue). In the lower panel, the Y-axis is the number of positive cells per visual frame. Single homo had less immune cell infiltration than Ct homo group, and dual homo had less immune cell infiltration than single homo group. (n-3, mean p <0.05, mean p <0.01, mean p <0.001, mean p < 0.0001). Fig. 4D depicts the overall health of AAV-treated mice, where (1) represents WT, (2) represents dual homo, (3) represents single homo, and (4) represents Ct homo. The upper panel shows muscle function at 1 and 2 months of age, with frequencies from 0 to 200 HZ. The lower graph shows body weight at different groups of 1 and 2 months of age (. sup. sup. <0.05,. sup. 0.01,. sup. sup.

FIG. 5A is a schematic carrier diagram representing an embodiment of the present invention: vectors pAAV-M1p65EnsynOpti3978(SEQ ID NO:1) and pAAV-M2p65EnsynOpti3978(SEQ ID NO: 23). FIG. 5B shows graphically the location of certain genetic elements within the pAAV-M1p65EnsynOpti3978 and pAAV-M2p65EnsynOpti3978 vectors.

FIG. 6A is a schematic carrier diagram representing an embodiment of the present invention: vectors pAAV-M1p65EnsynOpti3837(SEQ ID NO:25) and pAAV-M2p65EnsynOpti3837(SEQ ID NO: 26). FIG. 6B shows graphically the location of certain genetic elements within the pAAV-M1p65EnsynOpti3837 and pAAV-M2p65EnsynOpti3837 vectors.

Detailed Description

The AAV vector may be derived from any AAV strain suitable for use as a gene therapy vector, as is well known to those of ordinary skill in the art. Purely by way of example, the parental AAV strain may be AAV1, AAV2, AAV6 or AAV9, although other strains may also be used.

Exemplary AAV vectors (or plasmids used to generate encoding vectors from which viral sequences may be understood by those of skill in the art) in the context of the present invention are described herein as AAV-M1p65EnsynOpti3978 or AAV-M2p65EnsynOpti3978 (including plasmids used to generate such vectors). The sequences of these exemplary AAVs used in the context of the present invention include the sequence of SEQ ID NO:1, which is AAV-M1p65 encynopti 3978; 23, which is AAV-M2p65EnsynOpti 3978; 25, which is AAV-M1p65EnsynOpti 3837; and the sequence of SEQ ID NO 26, which is AAV-M2p65EnsynOpti 3837.

AAV-M2p65EnsynOpti3978 differs from AAV-M1p65EnsynOpti3978 in that it comprises the sequence agtccctgtctgcacctgtctcgagacaggtgcagacagggactttttttt (encoding M2p65shRNA, SEQ ID NO:22 at bp1701 and 1751 in place of the sequence encoding M1p65 present in SEQ ID NO:1 (tgtgtccattgtctcactcctcgaggagtgagacaatggacacattttttt (SEQ ID NO: 17)).

Similarly, AAV-M2p65EnsynOpti3837 differs from AAV-M1p65EnsynOpti3837 in that it comprises the sequence agtccctgtctgcacctgtctcgagacaggtgcagacagggactttttttt (encoding M2p65shRNA, SEQ ID NO:22 at bp1701-1751 in place of the sequence encoding M1p65 (tgtgtccattgtctcactcctcgaggagtgagacaatggacacattttttt (SEQ ID NO:17)) present in SEQ ID NO: 25).

As indicated, AAV as used in the context of the present invention comprises an expression cassette for expression of the mini-dystrophin gene in cardiac muscle and in skeletal muscle. Preferably, the mini-dystrophin gene is human codon optimized. For example, a human optimized mini-dystrophin gene comprising 5 Rod-like domains (Rod) (1, 2, 22, 23, 24) and 3 Hinge domains (Hinge) (1, 3, 4), and a CR domain, can be used for the treatment of DMD animal models and for human clinical trials and ultimately for the treatment of CDM. See, e.g., Kornegay JN et al, Molecular therapy.2010,18(8):1501-1508, PMID:20517298 (the entire contents of which are incorporated herein by reference). One such human optimized mini-dystrophin protein (also known as mini-dystrophin) sequence is opti-Dys Δ 3978 (comprising 3978 base pairs) and is shown as sequence ID NO: 2:

atggtgtggtgggaggaagtggaggactgctacgagagagaggacgtgcagaagaaaaccttcaccaagtgggtgaacgcccagttcagcaagttcggcaagcagcacatcgagaacctgttcagcgacctgcaggatggcaggagactgctggacctgctggagggcctgaccggccagaagctgcccaaggagaagggcagcaccagagtgcacgccctgaacaacgtgaacaaggccctgagagtgctgcagaacaacaacgtggacctggtgaacatcggcagcaccgacatcgtggacggcaaccacaagctgaccctgggcctgatctggaacatcatcctgcactggcaggtgaagaacgtgatgaagaacatcatggccggcctgcagcagaccaacagcgagaagatcctgctgagctgggtgaggcagagcaccagaaactacccccaggtgaacgtgatcaacttcaccacctcctggagcgacggcctggccctgaacgccctgatccacagccacagacccgacctgttcgactggaacagcgtggtgtgtcagcagagcgccacccagagactggagcacgccttcaacatcgccagataccagctgggcatcgagaagctgctggaccccgaggacgtggacaccacctaccccgacaagaaaagcatcctcatgtacattaccagcctgttccaggtgctgccccagcaggtgtccatcgaggccatccaggaagtggaaatgctgcccaggccccccaaagtgaccaaggaggagcacttccagctgcaccaccagatgcactacagccagcagatcacagtgagcctggcccagggctatgagagaaccagcagccccaagcccagattcaagagctacgcctacacccaggccgcctacgtgaccacctccgaccccaccagaagccccttccccagccagcacctggaggcccccgaggacaagagcttcggcagcagcctgatggagagcgaagtgaacctggacagataccagaccgccctggaggaagtgctgtcctggctgctgagcgccgaggacaccctgcaggcccagggcgagatcagcaacgacgtggaagtggtgaaggaccagttccacacccacgagggctacatgatggatctgaccgcccaccagggcagagtgggcaatatcctgcagctgggcagcaagctgatcggcaccggcaagctgagcgaggacgaggagaccgaagtgcaggagcagatgaacctgctgaacagcagatgggagtgcctgagagtggccagcatggagaagcagagcaacctgcacagagtgctgatggacctgcagaaccagaagctgaaggagctgaacgactggctgaccaagaccgaggagcggaccagaaagatggaggaggagcccctgggccccgacctggaggacctgaagagacaggtgcagcagcacaaagtgctgcaggaggacctggagcaggagcaggtgcgcgtgaacagcctgacccacatggtggtggtcgtggacgagagcagcggcgaccacgccacagccgccctggaagagcagctgaaagtgctgggcgacagatgggccaatatttgtaggtggaccgaggacagatgggtgctgctgcaggaccagcccgacctggcccctggcctgaccaccatcggcgccagccccacccagaccgtgaccctggtgacccagcccgtggtgacaaaggagaccgccatcagcaagctggagatgcccagctccctgatgctggaagtgcccacccaccgcctgctccagcagttccccctggacctggagaagttcctggcctggctgaccgaggccgaaaccaccgccaatgtgctccaggacgccactagaaaggagaggctgctggaggacagcaagggcgtgaaagagctgatgaagcagtggcaggatctgcagggcgaaatcgaggcccacaccgacgtgtaccacaacctggacgagaacagccagaagattctgaggagcctggagggcagcgacgacgccgtcctgctccagaggaggctggacaacatgaacttcaagtggagcgagctgcggaagaagagcctgaacatccggagccacctggaagccagcagcgaccagtggaagagactgcacctgagcctgcaggagctgctggtgtggctgcagctgaaggacgacgagctgagcagacaggcccccatcggcggcgacttccccgccgtgcagaagcagaacgacgtgcaccgggccttcaagagggagctgaaaaccaaggaacccgtgatcatgagcaccctggagacagtgcggatcttcctgaccgagcagcccctggagggactggagaagctgtaccaggagcccagagagctgccccccgaggagagagcccagaacgtgaccaggctgctgagaaagcaggccgaggaagtgaataccgagtgggagaagctgaatctgcacagcgccgactggcagagaaagatcgacgagaccctggagagactccaggaactgcaggaagccaccgacgagctggacctgaagctgagacaggccgaagtgatcaagggcagctggcagcctgtgggcgatctgctgatcgactccctgcaggatcacctggagaaagtgaaggccctgcggggcgagatcgcccccctgaaggagaatgtgagccacgtgaacgacctggccagacagctgaccaccctgggcatccagctgagcccctacaacctgagcacactggaggatctgaacacccggtggaaactgctgcaggtggccgtggaggatagagtgaggcagctgcacgaagcccacagagacttcggccctgcctcccagcacttcctgagcaccagcgtgcagggcccctgggagagagccatctcccccaacaaagtgccctactacatcaaccacgagacccagaccacctgctgggaccaccctaagatgaccgagctgtatcagagcctggccgacctgaacaatgtgcggttcagcgcctacagaaccgccatgaagctgcggagactgcagaaggccctgtgcctggatctgctgagcctgagcgccgcctgcgacgccctggaccagcacaacctgaagcagaatgaccagcccatggacatcctgcagatcatcaactgcctgaccacaatctacgaccggctggaacaggagcacaacaacctggtgaatgtgcccctgtgcgtggacatgtgcctgaattggctgctgaacgtgtacgacaccggcaggaccggcagaatccgcgtgctgagcttcaagaccggcatcatcagcctgtgcaaggcccacctggaggataagtaccgctacctgttcaagcaggtggccagcagcaccggcttctgcgatcagaggagactgggcctgctgctgcacgatagcatccagatccctaggcagctgggcgaagtggccagctttggcggcagcaacatcgagccctctgtgaggagctgcttccagttcgccaacaacaagcccgagatcgaggccgccctgttcctggactggatgaggctggagcctcagagcatggtgtggctgcctgtgctgcacagagtggccgccgccgagaccgccaagcaccaggccaagtgcaatatctgcaaggagtgccccatcatcggcttccggtacaggagcctgaagcacttcaactacgacatctgccagagctgctttttcagcggcagagtggccaagggccacaaaatgcactaccccatggtggagtactgcacccccaccacctccggcgaggatgtgagagacttcgccaaagtgctgaagaataagttccggaccaagcggtactttgccaagcaccccaggatgggctacctgcccgtgcagaccgtgctggaaggcgacaacatggagacctga are provided. This sequence is contained as base pairs 2365-6342 in SEQ ID NO 1 and SEQ ID NO 23.

Within SEQ ID NO 2, the following domains of the human optimized mini-dystrophin protein can be identified. Its nucleotide positions within the coding sequence of the mini-dystrophin gene optimized for human are as shown in figure 5B:

the N-terminus (756 base pairs) of human dystrophin; 3, SEQ ID NO:

hinge domain 1(225 base pairs); 4, SEQ ID NO:

atgctgcccaggccccccaaagtgaccaaggaggagcacttccagctgcaccaccagatgcactacagccagcagatcacagtgagcctggcccagggctatgagagaaccagcagccccaagcccagattcaagagctacgcctacacccaggccgcctacgtgaccacctccgaccccaccagaagccccttccccagccagcacctggaggcccccgaggac；

rod-like domain 1(333 base pairs); 5, SEQ ID NO:

agcgaagtgaacctggacagataccagaccgccctggaggaagtgctgtcctggctgctgagcgccgaggacaccctgcaggcccagggcgagatcagcaacgacgtggaagtggtgaaggaccagttccacacccacgagggctacatgatggatctgaccgcccaccagggcagagtgggcaatatcctgcagctgggcagcaagctgatcggcaccggcaagctgagcgaggacgaggagaccgaagtgcaggagcagatgaacctgctgaacagcagatgggagtgcctgagagtggccagcatggagaagcagagcaacctgcacaga；

rod-like domain 2(327 base pairs); 6 of SEQ ID NO:

gtgctgatggacctgcagaaccagaagctgaaggagctgaacgactggctgaccaagaccgaggagcggaccagaaagatggaggaggagcccctgggccccgacctggaggacctgaagagacaggtgcagcagcacaaagtgctgcaggaggacctggagcaggagcaggtgcgcgtgaacagcctgacccacatggtggtggtcgtggacgagagcagcggcgaccacgccacagccgccctggaagagcagctgaaagtgctgggcgacagatgggccaatatttgtaggtggaccgaggacagatgggtgctgctgcaggac；

hinge domain 3(141 base pairs); 7, SEQ ID NO:

cagcccgacctggcccctggcctgaccaccatcggcgccagccccacccagaccgtgaccctggtgacccagcccgtggtgacaaaggagaccgccatcagcaagctggagatgcccagctccctgatgctggaagtgccc；

a rod-like domain 22(348 base pairs); 8, SEQ ID NO:

acccaccgcctgctccagcagttccccctggacctggagaagttcctggcctggctgaccgaggccgaaaccaccgccaatgtgctccaggacgccactagaaaggagaggctgctggaggacagcaagggcgtgaaagagctgatgaagcagtggcaggatctgcagggcgaaatcgaggcccacaccgacgtgtaccacaacctggacgagaacagccagaagattctgaggagcctggagggcagcgacgacgccgtcctgctccagaggaggctggacaacatgaacttcaagtggagcgagctgcggaagaagagcctgaacatccggagccacctggaagcc；

rod-like domain 23(387 base pairs); 9 of SEQ ID NO:

agcagcgaccagtggaagagactgcacctgagcctgcaggagctgctggtgtggctgcagctgaaggacgacgagctgagcagacaggcccccatcggcggcgacttccccgccgtgcagaagcagaacgacgtgcaccgggccttcaagagggagctgaaaaccaaggaacccgtgatcatgagcaccctggagacagtgcggatcttcctgaccgagcagcccctggagggactggagaagctgtaccaggagcccagagagctgccccccgaggagagagcccagaacgtgaccaggctgctgagaaagcaggccgaggaagtgaataccgagtgggagaagctgaatctgcacagcgccgactggcagagaaagatcgacgag；

rod-like domain 24(327 base pairs); 10, SEQ ID NO:

accctggagagactccaggaactgcaggaagccaccgacgagctggacctgaagctgagacaggccgaagtgatcaagggcagctggcagcctgtgggcgatctgctgatcgactccctgcaggatcacctggagaaagtgaaggccctgcggggcgagatcgcccccctgaaggagaatgtgagccacgtgaacgacctggccagacagctgaccaccctgggcatccagctgagcccctacaacctgagcacactggaggatctgaacacccggtggaaactgctgcaggtggccgtggaggatagagtgaggcagctgcacgaa；

hinge domain 4(216 base pairs); 11, SEQ ID NO:

gcccacagagacttcggccctgcctcccagcacttcctgagcaccagcgtgcagggcccctgggagagagccatctcccccaacaaagtgccctactacatcaaccacgagacccagaccacctgctgggaccaccctaagatgaccgagctgtatcagagcctggccgacctgaacaatgtgcggttcagcgcctacagaaccgccatgaagctg；

a Cysteine (CR) -rich domain (888 base pairs); 12, SEQ ID NO:

cggagactgcagaaggccctgtgcctggatctgctgagcctgagcgccgcctgcgacgccctggaccagcacaacctgaagcagaatgaccagcccatggacatcctgcagatcatcaactgcctgaccacaatctacgaccggctggaacaggagcacaacaacctggtgaatgtgcccctgtgcgtggacatgtgcctgaattggctgctgaacgtgtacgacaccggcaggaccggcagaatccgcgtgctgagcttcaagaccggcatcatcagcctgtgcaaggcccacctggaggataagtaccgctacctgttcaagcaggtggccagcagcaccggcttctgcgatcagaggagactgggcctgctgctgcacgatagcatccagatccctaggcagctgggcgaagtggccagctttggcggcagcaacatcgagccctctgtgaggagctgcttccagttcgccaacaacaagcccgagatcgaggccgccctgttcctggactggatgaggctggagcctcagagcatggtgtggctgcctgtgctgcacagagtggccgccgccgagaccgccaagcaccaggccaagtgcaatatctgcaaggagtgccccatcatcggcttccggtacaggagcctgaagcacttcaactacgacatctgccagagctgctttttcagcggcagagtggccaagggccacaaaatgcactaccccatggtggagtactgcacccccaccacctccggcgaggatgtgagagacttcgccaaagtgctgaagaataagttccggaccaagcggtactttgccaagcaccccaggatgggctacctgcccgtgcagaccgtgctggaaggcgacaacatggagacc；and

stop codon (3 base pairs); 13 tga SEQ ID NO

Thus, a suitable human-optimized mini-dystrophin gene for use in the context of the present invention may comprise, consist essentially of, or consist of SEQ ID NO:2, and may comprise a domain represented by a sequence selected from the group consisting of SEQ ID NO:3-13, although one or more such domains may comprise, consist essentially of, or consist of such sequences. Of course, it is clear that the human optimized mini-dystrophin gene may comprise functional variants of SEQ ID NO 2-13. In this context, functional variants mean variants of a given sequence which can be used as long as the encoded gene product retains the function of the reference coding molecule. Thus, in the context of the present invention, sequence variants from any of SEQ ID NOs: 2-13 can be used to encode suitable human optimized mini-dystrophin proteins. Such variants may differ from the exemplary sequences set forth herein by retaining from about 75% to about 99% sequence identity to one or more of SEQ ID nos. 2-13, such as at least about 75%, such as at least about 80%, or at least about 90%, at least about 95%, or at least about 99% sequence identity to one or more of SEQ ID nos. 2-13.

Other mini-dystrophin proteins (mini-dystrophin) with smaller size for use in the present invention comprise a mini-dystrophin gene (human or canine) comprising an N-terminal, 5 Rod-like domains (Rod 1, 2, 22, 23, 24), 2 hinge domains (hinges 1 and 4) and cysteine rich domains, such as h Δ Dys3849 and hi Δ Dys 3837. The hOpti Δ Dys3837 differs from h Δ Dys3849 in that (i) the hOpti Δ Dys3837 was codon optimized and (ii) 12 bases of the full exon 79 had been removed. The basic functional domains are identical. The sequence of hOpti Δ Dys3837 (also known as opti-Dys Δ 3837), which comprises 3837 base pairs, is shown in SEQ ID NO: 27. The sequence is contained within SEQ ID NO 25 and 26 as base pairs 2365-6201 (FIG. 6B). Exemplary Mini-dystrophin proteins are described in Wang et al, PNAS USA,97(25): 13714-; wang et al, Gene Therapy,15(15):1099-1106(2008), PMID 18432277; wang et al, Gene Therapy,15(22), 1489-1499(2008), PMID 18563184; romesh et al, Journal of Muscle Research and CellMotility,27(1) 53-67(2006), PMID 16496225; and Koppantai et al, Gene Therapy,17(11): 1355-.

Thus, a suitable human-optimized mini-dystrophin gene for use in the context of the present invention may comprise, consist essentially of, or consist of SEQ ID NO:27 and may comprise a domain represented by a sequence selected from the group consisting of SEQ ID NO:3-6 and 8-13, although one or more such domains may comprise, consist essentially of, or consist of such sequences. Of course, it is apparent that the human optimized mini-dystrophin gene may comprise functional variants of SEQ ID NOs 3-6, 8-13 and 27. Such variants may differ from the exemplary sequences set forth herein by retaining from about 75% to about 99% sequence identity to one or more of SEQ ID NOs 3-6, 8-13, and 27, such as at least about 75%, such as at least about 80%, or at least about 90%, at least about 95%, or at least about 99% sequence identity to one or more of SEQ ID NOs 3-6, 8-13, and 27.

As mentioned above, within the AAV used in the context of the present invention, the expression cassette for expression of the mini-dystrophin gene in cardiac muscle and in skeletal muscle comprises a muscle-specific first promoter and a modified MCK promoter enhancer. Within this expression cassette, the mini-dystrophin gene is operably linked to the muscle-specific first promoter and the modified MCK promoter enhancer such that expression of the mini-dystrophin protein is under the control of the muscle-specific first promoter and the modified MCK promoter enhancer.

For use in the context of the present invention, a modified muscle MCK promoter enhancer, which allows muscle-specific expression. Preferably, the modified muscle MCK promoter enhancer is a truncated modification of the MCK promoter, which is useful in view of the size limitations of the AAV genome. For a modified muscle MCK promoter enhancer provided, mef-2, the Right e-box (mef1), and the a/t rich element can be retained in the enhancer region, including two Right e-boxes and one s5 modified region, for tissue specificity in different muscles in addition to the muscle-specific cis-element. See Bing Wang et al, Gene ther.,2008,15:1489-1499.PMID:18563184 (the entire contents of which are incorporated herein by reference). A preferred modified muscle MCK promoter enhancer sequence (comprising 216 base pairs) is shown as SEQ ID NO:1 (FIG. 5B), SEQ ID NO:23 (FIG. 5B), SEQ ID NO:25 (FIG. 6B) and SEQ ID NO:26 (FIG. 6B) at nucleotide 1757-:

ccactacgggtctaggctgcccatgtaaggaggcaaggcctggggacacccgagatgcctggttataattaaccccaacacctgctgcccccccccccccaacacctgctgcctgagcctgagcggttaccccaccccggtgcctgggtcttaggctctgtacaccatggaggagaagctcgctctaaaaataaccctgtccctggtggatcccct, respectively.

Thus, a suitable modified muscle MCK promoter enhancer for use in the context of the present invention may comprise, consist essentially of or consist of SEQ ID NO 14. Of course, it is clear that the modified muscle MCK promoter may comprise a functional variant of SEQ ID NO 14. In this context, a functional variant means a variant of a given sequence that can be employed, as long as the variant retains the function of the reference sequence. Thus, in the context of the present invention, the sequence variant from SEQ ID NO. 14 can be used as a modified muscle MCK promoter enhancer. Such variants may differ from the exemplary sequences set forth herein by retaining from about 75% to about 99% sequence identity to SEQ ID No. 14, such as at least about 75%, such as at least about 80%, or at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID No. 14.

For use in the context of the present invention, the muscle-specific first promoter allows muscle-specific expression. A preferred modified muscle-specific first promoter is a synthetic promoter (Syn) which comprises, in addition to the muscle-specific cis-elements, MEF-2 and the right e-box. See Bing Wang et al, Gene ther.,2008,15:1489-1499.PMID:18563184 (the entire contents of which are incorporated herein by reference). A preferred muscle-specific first promoter has the sequence (comprising 317 base pairs) shown as nucleotides 1973-2289 of SEQ ID NO:1 (FIG. 5B), SEQ ID NO:23 (FIG. 5B), SEQ ID NO:25 (FIG. 6B) and SEQ ID NO:26 (FIG. 6B) and is represented by the sequence ID NO: 15:

gcatgcggccgtccgccctcggcaccattcctcacgacaccgaaatatggcgacgggtgaggaatggtggggagttatttttagagcggtgaggaatggtgggcaggcagcaggtgttgggggagttatttttagagcggggagttatttttagagcggtgaggaatggtggacaccgaaatatggcgacgggtgaggaatggtgccgtcgccatatttgggtgtcccgtccgccctcggccggggccgcattcctgggggccgggcggtgctcccgcccgcctcgataaaaggctccggggccggcggcggcccac, respectively.

Thus, a suitable muscle-specific first promoter for use in the context of the present invention may comprise, consist essentially of, or consist of SEQ ID NO: 15. Of course, it is clear that the muscle-specific first promoter may comprise a functional variant of SEQ ID NO. 15. In this context, a functional variant means a variant of a given sequence that can be employed, as long as the variant retains the function of the reference sequence. Thus, in the context of the present invention, the sequence variant from SEQ ID NO. 15 can be used as a muscle-specific first promoter. Such variants may differ from the exemplary sequences set forth herein by retaining from about 75% to about 99% sequence identity to SEQ ID No. 15, such as at least about 75%, such as at least about 80%, or at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID No. 15.

The expression cassette for mini-dystrophin gene expression in cardiac muscle and in skeletal muscle may also comprise other required elements for enhancing mini-dystrophin gene expression. For example, the exemplary AAV sequence shown in SEQ ID NO:1 comprises a Kozak consensus sequence (GCCACC (SEQ ID NO:16)) that acts as an enhancer for mini-dystrophin gene translation. See, Bing Wang et al, Journal of Orthopaedic Research,2009,27:4,421-42,. PMID:18973234 (the entire contents of which are incorporated herein by reference).

As described above, the AAV used in the context of the present invention comprises an expression cassette in which the NF-. kappa.B/p 65-shRNA gene is operably linked to a second promoter. Mouse NF-. kappa.B/p 65-shRNA expression cassette specifically silences subunit 65 of NF-. kappa.B/p 65. See Qing Yang et al, Gene ther.2012,19: 1196-. Without being bound by theory, it is believed that specific silencing of subunit 65 of NF-. kappa.B/p 65 reduces inflammation, which can result in greater expression of the mini-dystrophin gene. The mouse-specific NF-. kappa.B/p 65-shRNA comprises 51 base pairs and is contained at nucleotide 1701 and 1751 of SEQ ID NO:1 (FIG. 5B) and SEQ ID NO:25 (FIG. 6B). The sequence is tgtgtccattgtctcactcctcgaggagtgagacaatggacacattttttt (SEQ ID NO: 17). Another mouse-specific NF-. kappa.B/p 65-shRNA comprises 51 base pairs and is contained at nucleotide 1701-1751 of SEQ ID NO:23 (FIG. 5B) and SEQ ID NO:26 (FIG. 6B). The sequence is agtccctgtctgcacctgtctcgagacaggtgcagacagggactttttttt (SEQ ID NO: 22). Furthermore, for use in human clinical trials or in the treatment of DMD, it is preferred to use shRNA sequences based on human NF-. kappa.B sequences. The human siRNA oligonucleotide sequence, designated (REL1096(gattgaggagaaacgtaaatt SEQ ID NO:24)) to inhibit NF-kB induction of inflammatory factors in human synovial cells (Lee, Ui Jin et al, MolBiolRep (2008)35: 291-298 (the entire contents of which are incorporated herein by reference)) and which inhibits constitutive or tumor necrosis factor-induced NF-kB in cancer cells (Juutoru, Indira et al, J.biol.chem. (2010),285: 25332-25344 (the entire contents of which are incorporated herein by reference)) is well known to the ordinarily skilled artisan.

Thus, a suitable NF-. kappa.B/p 65-shRNA for use in the context of the present invention may comprise, consist essentially of or consist of SEQ ID NO 17, SEQ ID NO 22 or SEQ ID NO 24. Of course, it is apparent that the NF-. kappa.B/p 65-shRNA may comprise a functional variant of SEQ ID NO. 17 or SEQ ID NO. 22. In this context, a functional variant means a variant of a given sequence that can be employed, as long as the variant retains the function of the reference sequence. Thus, sequence variants from SEQ ID NO 17, SEQ ID NO 22 or SEQ ID NO 24 can be used, which are inhibited in the context of the present invention. Such variants may differ from the exemplary sequences set forth herein by retaining from about 75% to about 99% sequence identity to SEQ ID No. 17, such as at least about 75%, such as at least about 80%, or at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID No. 17, SEQ ID No. 22, or SEQ ID No. 24.

As described above, the NF-. kappa.B/p 65-shRNA is operably linked (under transcriptional control) to a second promoter. The preferred promoter for this purpose is the U6 promoter, most preferably the human U6 promoter. See, Qing Yang et al, Gene ther.2012,19: 1196-. The sequence of the human U6 promoter comprises 241 base pairs and is contained at nucleotides 1452-1692 of SEQ ID NO:1 (FIG. 5B), SEQ ID NO:23 (FIG. 5B), SEQ ID NO:25 (FIG. 6B) and SEQ ID NO:26 (FIG. 6B). The sequence (SEQ ID NO:18) is:

gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggac。

thus, a suitable second promoter for use in the context of the present invention may comprise, consist essentially of, or consist of SEQ ID NO. 18. Of course, it is clear that functional variants of the second promoter SEQ ID NO 18. In this context, a functional variant means a variant of a given sequence that can be employed, as long as the variant retains the function of the reference sequence. Thus, a sequence variant from SEQ ID NO 18 can be used as a second promoter in the context of the present invention. Such variants may differ from the exemplary sequences set forth herein by retaining from about 75% to about 99% sequence identity to SEQ ID No. 18, such as at least about 75%, such as at least about 80%, or at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID No. 18.

In addition, although the U6 promoter may be used to drive expression of NF-. kappa.B/p 65-shRNA, other promoters may also be suitably used as the second promoter. Many promoters are known to those of ordinary skill in the art. Preferably, a promoter operably linked to drive the expression of κ B/p65-shRNA should be active in both immune cells and dystrophic muscle cells. Examples of some suitable promoters are polymerase III promoters, such as human H1 and U6.

In addition to the dual expression cassette for expressing both the mini-dystrophin gene and the NF- κ B/p65-shRNA gene in cardiac and skeletal tissue, the AAV used in the context of the present invention may contain other elements. For example, 5 'and 3' Inverted Terminal Repeats (ITRs) facilitate packaging of the genome into vector packages. See, Xiao et al, j.virol.1998; 72(3) 2224-32.PubMedPMID:9499080 (the entire contents of which are incorporated herein by reference). The sequences of such 3 'and 5' ITRs are well known to those of ordinary skill in the art, but include, for example:

ttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct (SEQ ID NO: 19-5' ITR and)

aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaa(SEQ ID NO:20–3’ITR)。

In addition, the inclusion of a poly (A) signal sequence may enhance gene expression of the vector. See, Bing Wang et al, Proc. Natl. Acad. Sci. USA.,2000,97(25): 13714-. PolyA sequences are well known to those of ordinary skill in the art, but a non-limiting example of a suitable poly (A) is tcgaggcctaataaagagctcagatgcatcgatcagagtgtgttggttttttgtgtgaga (SEQ ID NO: 21). The positions of these sequences within SEQ ID NO 1, 23, 25 and 26 are depicted in FIGS. 5B and 6B. Other useful genetic elements that are included include genes that confer antibiotic resistance, such as ampicillin, which is commonly used to select for infected cells during culture of viral packaging cells to increase viral titer.

In the context of the present invention, AAV used as a dual expression cassette gene vector comprising expression cassettes for expressing both the mini dystrophin gene and the NF-kb/p 65-shRNA gene in myocardial and skeletal muscle tissue can be produced by standard molecular and cellular techniques well known to those of ordinary skill in the art. For example, plasmids comprising the dual expression cassettes and other AAV sequences can be engineered by standard molecular techniques. The plasmid can then be used to generate a viral vector, for example, by transfecting it into a suitable packaging cell line (e.g., HEK293 cells or HEK 293T cells, although other cell lines can be used). Transformants can be selected from the population, for example, by exposing the culture to a compound that confers resistance to its AAV vector genome (e.g., ampicillin). Once the cells produce AAV packaging, they can be purified (e.g., using CsCl gradients or by other methods known to those of ordinary skill in the art). It can then be stored (e.g., frozen) or formulated for use.

In one embodiment, the invention provides a pharmaceutical composition comprising a gene vector of the invention (AAV described herein) comprising an expression cassette for expressing both the mini-dystrophin gene and the NF-kb/p 65-shRNA gene in myocardial and skeletal muscle tissue, and a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include any carrier known to those of ordinary skill in the art. The carrier of the composition can be any suitable carrier for a carrier. The carrier will typically be a liquid and be formulated for injection, but may also be a solid, or a combination of liquid and solid components. Desirably, the carrier is a pharmaceutically acceptable (e.g., physiologically or pharmaceutically acceptable) carrier (e.g., excipient or diluent). Pharmaceutically acceptable carriers are well known and readily available. The choice of carrier will be determined, at least in part, by the particular carrier and the particular method used to administer the composition.

The composition may also comprise any other suitable component, in particular for enhancing the stability of the composition and/or its end use. Thus, there are a variety of suitable formulations for the compositions of the present invention. The following formulations and methods are merely exemplary and are in no way limiting.

Formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood or other tissue of the intended recipient, and aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. The formulations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example water for injections, immediately prior to use.

In addition, the composition may comprise additional therapeutic or bioactive agents. For example, there may be therapeutic factors for treating a particular indication. Factors that control inflammation, such as ibuprofen or steroids, may be part of the composition to reduce swelling and inflammation associated with in vivo administration of the vehicle and physiological discomfort. An immune system inhibitor may be administered with the combination method to reduce any immune response to the vector itself or associated with the condition. Alternatively, immune enhancers may be included in the composition to up-regulate the body's natural defenses against the disease. Antibiotics (i.e., microbicides and fungicides) can be present to reduce the risk of infection associated with gene transfer procedures and other conditions.

In one embodiment, the invention also provides a method for ameliorating Duchenne Muscular Dystrophy (DMD) comprising administering a genetic vector (AAV) or a pharmaceutical composition as described herein to a patient or subject suffering from or at risk of developing DMD in an amount and location that can ameliorate DMD. In this case, the patient or subject is typically a human (e.g., a patient suffering from and receiving DMD therapy or a subject in a clinical trial). However, the method can also be applied to gene expression evaluation of non-human animals or evaluation of DMD animal models. Such non-human animals are typically animals commonly used in laboratory studies (e.g., mice, rats, dogs, non-human primates, etc.).

In practicing the method, the gene vector or pharmaceutical composition is typically administered by parenteral (e.g., intraperitoneal, intravenous, intramuscular, etc.) injection. However, other routes of delivery may be appropriate and employed by the treating physician or clinical trial protocol.

The amount of viral particles delivered in performing the methods of the invention may be determined by a physician or laboratory researcher and may depend on the size of the subject or the species of the subject or patient. However, sufficient gene vector (AAV) should be delivered to infect the heart and skeletal muscle to result in expression of the dual expression cassette from the gene vector of the invention. For laboratory studies, intraperitoneal injection 10, as reported in the examples below¹¹An AAV genome, although less than this may be sufficient. However, for a human patient or subject, a higher number of AAV genomes may be necessary or desirable. For example, at least 10 may be used in practicing the methods of the invention⁸An AAV genome, or at least 10⁹An AAV genome, or at least 10¹⁰An AAV genome, or at least 10¹¹An AAV genome, or at least 10¹²An AAV genome, or at least 10¹³An AAV genome, or at least 10¹⁴An AAV genome (or at least "about" such number of AAV genomes). Although the upper limit of the AAV genome administered to the patient or subject may beCan depend in part on the concentration at which the pharmaceutical composition is formulated, but can be administered up to 10²⁰An AAV genome, or up to 10¹⁹An AAV genome, or up to 10¹⁸An AAV genome, or up to 10¹⁷An AAV genome, or up to 10¹⁶An AAV genome, or up to 10²⁰Individual AAV genomes (or up to "about" such number of AAV genomes) may be suitable. A greater or lesser number of AAV genomes can be used; the dosage will ultimately be determined by a physician, laboratory researcher or clinical trial protocol. The usual dose is 2 × 10¹⁰-1x10¹¹Individual viral genomes/kg (patient body) (see, DS, mol. ther.2018,26: 2337-.

The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.

Examples

In the examples described below, one such dual expression cassette AAV vector was generated with a modified MCK enhancer (Mcken) and a muscle-specific synthetic promoter (Syn) driving the human codon-optimized mini-dystrophin Gene (Wang,2008 Gene Therapy, and Kornegay,2010 Molecular Therapy). This ensured efficient and specific expression of the mini-dystrophin gene in the whole body muscle of a severe DMD mouse model, a dystrophin/dystrophin-related protein double knockout (dys-/-: utro-/-, dKO-homo) mouse, as demonstrated by high levels of expression in the myocardium. This dual treatment approach also results in effective inhibition of chronic inflammation, particularly in skeletal muscle in this severe DMD model.

Next, by hybridization of the Tg.dKO-het (dys-/-: utro +/-) p65 +/-mouse, both Tg.dKO-homo.p65+/+ and Tg.dKO-homo.p65 +/-mice were obtained. It was also observed that genetic ablation of the p65 subunit of NF-. kappa.B (p65+/-) was beneficial in combination with a synergistic therapeutic effect of the transgenic human mini-dystrophin gene in a severe mouse model of DMD without toxicity.

In summary, novel AAV vectors with dual expression cassettes comprising compact promoters for muscle-specific dystrophin gene expression and specific shRNA for NF- κ B for anti-inflammation may improve the therapeutic efficacy and safety of DMD gene therapy.

Example 1

This example demonstrates optimization of a dual expression cassette AAV vector (Wang,2008 and Kornegay,2010) by designing a modified MCK enhancer (Mcken) and a muscle-specific synthetic promoter (Syn) that drives the human codon-optimized mini-dystrophin gene. This ensured efficient and specific expression of the mini-dystrophin gene in the systemic muscles, in particular in the cardiac muscle, of the severe DMD mouse model. This dual treatment approach also results in effective inhibition of chronic inflammation, particularly in skeletal muscle.

Method

In this study, the IACUC protocol was approved for all mouse strains. Wild type (WT, C57/BL10) mice were purchased from Jackson Laboratory. Dystrophin/dystrophin-related protein double knockout (dys-/-: utro-/-, dKO-homo) mice are from an internal population crossed by a heterozygote dystrophin/dystrophin-related protein double knockout mouse (dys-/-: utro +/-). As shown in fig. 1A, the generation of a single expression cassette for mini-dystrophin AAV vector, i.e. a mini-dystrophin gene optimized by computer codons, including N-terminal, 5 rod-like domains (1, 2, 22, 23, 24), 3 hinge domains (1, 3, 4) and CR-terminal, was cloned into a single AAV vector and driven by a muscle synthesis promoter regulated by MCK modified enhancer. Based on the published functional mouse NF- κ B/p65 mRNA sequence (Yang,2012), two forms (m1 and m2) of mouse p65/shRNA driven by the U6 promoter were designed and cloned into a single expression cassette pAAV (ss) -Mcken-Syn-hOptiDys3978(Kornegay,2010), respectively. The plasmid was purified by CsCl gradient ultracentrifugation. One such plasmid, pAAV-M1p65EnsynOpti3978, is depicted schematically in FIGS. 5A and 5B, and its sequence is shown in SEQ ID NO: 1.

AAV9 vector was packaged in 293 cells by co-transfection and purified by two CsCl gradient ultracentrifugation according to Yang, 2012. To 5 daysAged dKO-homo pups were used in 50. mu.l (1X 10)¹¹Individual viral genomic particles) single intraperitoneal injection of virus and frozen sections of cardiac and skeletal muscle and liver tissue were analyzed at 8 weeks of age. The slice for use against human muscular dystrophy protein (rod-like domain 1)&2) Immunofluorescence (IF) staining of phosphorylated NF-. kappa.B/p 65(#8242, Cell Signaling), CD4(BD550280, BD Biosciences), CD8(ab22378, Abcam), CD68(#9936, Cell Signaling), ColIV (ab6586, Abcam) antibodies. Nuclei were also stained with DAPI (blue). Images were taken at 200X magnification.

Results

As shown in fig. 1B, myocardium was examined by western blot assay, and efficient expression of full-length dystrophin (450kDa) in WT mice and mini-dystrophin (150kDa) in dKO-homo mice treated with single or dual expression cassette vectors was observed. IF staining for dystrophin also demonstrated the specificity of muscle-targeted gene delivery in cardiac and skeletal muscle tissues (diaphragm, gastrocnemius, and tibialis), as demonstrated by the absence of dystrophin expression in liver tissues (fig. 1C and 1D). There was no difference in the proportion of dystrophin positive cells in heart and diaphragm tissue between mice treated with single or dual expression cassette vectors (fig. 1E). However, mice treated with the dual expression cassette vector had much higher expression of mini-dystrophin in gastrocnemius and tibialis anterior (fig. 1E).

The results indicate that skeletal muscle inflammation treated with the dual expression cassette AAV vector is reduced, which indicates that a synergistic effect can be achieved by combining anti-dystrophin gene replacement with anti-inflammation with a single AAV vector.

Gastrocnemius muscle (GAS) was IF stained by P-P65 to determine the levels of active NF- κ B, CD4and CD8 to assess immune cell infiltration, and CD68 to detect inflammatory macrophages. As shown in figure 2A, GAS muscles treated with dual expression cassette AAV showed fewer inflammatory markers, such as CD4, CD8, and CD68, by reducing NF- κ B compared to treatment with single expression cassette AAV. WT GAS showed no inflammation in muscle. However, GAS from untreated dKO-homo has significant inflammation. FIG. 2B shows IF staining of P-P65 in myocardium and GAS. In cardiac tissue, there were almost no positive cells in all groups. However, in GAS muscle, the dual-homo group showed much lower P-P65 compared to the mono-homo and untreated homo mouse (Ct-homo) groups.

These results indicate that a significant reduction in active NF- κ B (P-P65) was observed in skeletal muscle treated with dual expression cassette AAV compared to single expression cassette AAV treatment or no treatment. Unlike in skeletal muscle in mdx/utrn-/-mice, there was no significant difference in activity of NF-. kappa.B (P-P65) in myocardial tissue, whether treated with dual or single expression cassette AAV or untreated mice.

Discussion of the related Art

The systemic effects of combining muscle-targeted gene replacement with NF- κ B inhibition by a single AAV vector were investigated, ensuring adequate expression of computer codon-optimized human mini-dystrophin in systemic muscles and reduction of inflammation. These results indicate that novel AAV vectors with dual expression cassettes comprising compact promoters for muscle-specific dystrophin gene expression and specific shRNA for anti-inflammatory NF- κ B may enhance the therapeutic efficacy and safety of DMD gene therapy in clinical trials or otherwise.

Example 2

This example shows that gene ablation of the p65 subunit of NF-. kappa.B (p65+/-) in a severe DMD mouse model (dys-/-: utro-/-, dKO-homo) may be beneficial in conjunction with the therapeutic synergy of the transgenic human mini-dystrophin gene.

Method

In this study, the IACUC protocol was approved for all mouse strains. Wild type (WT, C57/BL10) and mdx (dys-/-) mice were purchased from Jackson Laboratory. mdx.p65 +/-and human mini-dystrophin (Dys Δ 3990), mdx (tg.mdx) mice (Yin,2017 and Wang,2000) were from the internal population. Tg.dKO-het (dys-: utro +/-) p65 +/-mice crossed, giving both Tg.dKO-homo.p65+/+ and Tg.dKO-homo.p65 +/-mice (FIG. 3A).

Frozen sections were prepared using gastrocnemius muscle (GAS) from 2-month-old mice. Sections were used for hematoxylin and eosin (H & E) and Masson trichrome staining. Sections were also Immunofluorescent (IF) stained with antibodies against human dystrophin (rodlike domains 1&2), β -SARC (NCL-a-SARC, Leica), phosphorylated NF- κ B/p65(#8242, Cell Signaling), CD68(#9936, Cell Signaling), CD4(BD550280, BD Biosciences), CD8(ab22378, Abcam), ColIV (ab6586, Abcam) and mouse IgG (mIgG) (C2181, Sigma). Nuclei were stained with DAPI. Images were acquired at 200X magnification. Protein expression was detected by Western blot analysis using an antibody to GAPDH as an internal control. Statistical analysis was performed using graphpad Prism 7 software. All results are expressed as mean. + -. SD (n.gtoreq.4 per group). Differences were considered statistically significant when P-value < 0.05.

Results

As shown in fig. 3B, high levels of expression of full-length dystrophin (450kDa) in WT or mini-dystrophin (150kDa) in Tg mice were detected. A significant reduction in phosphorylated NF-. kappa.B (65kDa) was found in the p65 knock-out background (Tg. dKO-homo.p65+/+ vs Tg. dKO-homo.p65 +/-; dKO-homo.p65+/+ vs. dKO-homo.p65 +/-). In fig. 3C, high levels of dystrophin or dystrophin-related protein (β -myoglycan) were also found in the mini-dystrophin transgenic DMD mice, as well as improvement in myocyte morphology during H & E staining.

In addition, Masson trichrome and IF staining of mIgG, CD68, CD4and CD8 was applied to analyze muscle fibrosis, necrosis and inflammation. The results in FIG. 4A indicate improved cell morphology in the context of p65 knockdown (particularly Tg. dKO-homo. p65+/-vs Tg. dKO-homo. p65+/+) and reduced fibrosis, necrosis and inflammation, indicating that gene ablation of NF-. kappa.B/p 65 subunits is capable of reducing the level of inflammation.

As shown in FIG. 4B, statistical analysis of IF staining of CD68, CD4and CD8 in GAS muscle (Tg.dKO-homo.p65+/+ vs Tg.dKO-homo.p65 +/-; dKO-homo.p65+/+ vs dKO-homo.p65+/-) at 2 months of age showed that a gene depletion of the p65 subunit could significantly reduce the level of fibrosis, necrosis and infiltration of immune cells, calculated from a total of 200 cells per group. No inflammation was observed in WT mice, and the untreated dKO-homo GAS muscle showed a higher level of inflammation compared to mdx mice (fig. 4A and 4B), consistent with the results observed before (Mu, 2015).

As shown in FIG. 4C, with the relationship at mdx/utrn^-/-Skeletal muscle in mice differs in that there was no significant difference in CD68+ macrophages in the myocardium, whether the mice were treated or untreated with dual expression cassette AAV or single expression cassette AAV. . In contrast, a significant reduction of CD4+ and CD8+ immune cells and CD68+ macrophages was observed in skeletal muscle treated with dual expression cassette AAV compared to single expression cassette AAV.

FIG. 4D shows systemic treatment of mdx/utrn by dual and single expression cassette AAV treatment^-/-Comparison of overall health and muscle function in mice. When muscle function was tested at 1 and 2 months of age using a frequency of 0 to 200Hz, both treatment groups showed significant improvement at 200Hz at 1 month of age, but no difference between dual and single expression cassette AAV treatment. However, dual expression cassette AAV treatment at 200Hz at late age (e.g. 2 months) showed synergy compared to single expression cassette AAV.

Furthermore, early-onset (at 1 month of age) weight improvement was observed in the dual expression cassette AAV treated group, and weight improvement was observed in mdx/utrn-/-mice treated with dual expression cassette AAV and single expression cassette AAV at 2 months of age.

Discussion of the related Art

This example demonstrates the effectiveness of transgene and NF-. kappa.B/p 65 knockdown gene replacement and anti-inflammatory effects in a severe mouse model of DMD. These results reveal that mini-dystrophin expression together with NF-kB/p65 knockdown in the context of dKO-homo mice can improve muscle morphology, reducing fibrosis, chemical compounds and inflammation. These results suggest that the genetic reduction of NF- κ B may enhance its effectiveness in mini-dystrophin gene therapy in large animals and clinical trials, underlining that it can be used for gene therapy of DMD patients by dystrophin gene replacement in combination with anti-inflammation.

All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. Including but not limited to the following references:

·Acharyya,et al.J.Clin.Invest.,2007,Apr.；117(4):889-901

·Bing Wang,et al.,Journal of Orthopaedic Research,2009,27:4,421-42,.PMID:18973234

·Bing Wang,et al.,Gene Ther.,2008,15:1489-1499,PMID:18563184,

·Bing Wang,et al.,Proc.Natl.Acad.Sci.U S A.,2000,97(25):13714-13719,PMID:11095710,

·Duan,DS,Mol.Ther.2018,26:2337-2356,

·Lee,Ui Jin et al,.Mol Biol Rep(2008)35:291–298

·Jayandharan,et al.,PNAS(USA),2011,Mar.1；108(9):3743-8,

·Jutooru,Indira et al..J.Biol.Chem.(2010),285:25332–25344

·Kornegay JN,et al..Molecular Therapy.2010,18(8):1501-1508,PMID:20517298,

·Mendell,et al.,N.Engl.J.Med.2010 Oct 7；363(15):1429-37,

·Qing Yang,et al.Gene Ther.2012,19:1196-1204,PubMedPMID:22278411,

·Ying Tang,et al.Gene Ther.2010,17:1476-1483,PubMed PMID:20720575,

·Xi Yin,et al.Muscle Nerve.2017,56:759-767,

xiao, et al, j.virol.1998; 72(3) 2224-32.PubMed PMID 9499080, and

·Xiaodong Mu,et al.Human Mol.Genet.2015,24:2923-2937。

the use of the terms "a" and "an" and "the" and "at least one" and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the following: singular and plural, unless otherwise indicated herein or clearly contradicted by context. The use of the term "at least one" followed by a list of one or more items (e.g., "at least one of a and B") should be construed to mean one item selected from the listed items (a or B) or any combination of two or more of the listed items (a and B), unless otherwise indicated herein or clearly contradicted by context. Unless otherwise indicated, the terms "comprising", "having", "including" and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to"). Unless otherwise indicated herein, references to ranges of values herein are intended merely to serve as shorthand methods of referring individually to each separate value falling within the range, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Sequence listing

<110> Federal higher education System-university of Pittsburgh

<120> one-step gene therapy for duchenne muscular dystrophy by gene replacement and anti-inflammation

<130> 747154

<160> 27

<170> PatentIn 3.5 edition

<210> 1

<211> 9249

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 1

aattcccatc atcaataata taccttattt tggattgaag ccaatatgat aatgaggggg 60

tggagtttgt gacgtggcgc ggggcgtggg aacggggcgg gtgacgtagt agtctctaga 120

ggtccccagc gaccttgacg ggcatctgcc cggcatttct gacagctttg tgaactgggt 180

ggccgagaag gaatgggagt tgccgccaga ttctgacatg gatctgaatc tgattgagca 240

ggcacccctg accgtggccg agaagctgca tcgctggcgt aatagcgaag aggcccgcac 300

cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tggaattcca gacgattgag 360

cgtcaaaatg taggtatttc catgagcgtt tttcctgttg caatggctgg cggtaatatt 420

gttctggata ttaccagcaa ggccgatagt ttgagttctt ctactcaggc aagtgatgtt 480

attactaatc aaagaagtat tgcgacaacg gttaatttgc gtgatggaca gactctttta 540

ctcggtggcc tcactgatta taaaaacact tctcaggatt ctggcgtacc gttcctgtct 600

aaaatccctt taatcggcct cctgtttagc tcccgctctg attctaacga ggaaagcacg 660

ttatacgtgc tcgtcaaagc aaccatagta cgcgccctgt agcggcgcat taagcgcggc 720

gggtgtggtg gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc 780

tttcgctttc ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa 840

tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact 900

tgattagggt gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt 960

gacgttggag tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa 1020

ccctatctcg gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt 1080

aaaaaatgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgtttac 1140

aatttaaata tttgcttata caatcttcct gtttttgggg cttttctgat tatcaaccgg 1200

ggtacatatg attgacatgc tagttttacg attaccgttc atcgcctgca gggggggggg 1260

ggggggggtt ggccactccc tctctgcgcg ctcgctcgct cactgaggcc gggcgaccaa 1320

aggtcgcccg acgcccgggc tttgcccggg cggcctcagt gagcgagcga gcgcgcagag 1380

agggagtggc caactccatc actaggggtt cctagatctg aattcgagct tgccacgcat 1440

gcgggcagga agagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 1500

ctgttagaga gataattaga attaatttga ctgtaaacac aaagatatta gtacaaaata 1560

cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 1620

tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 1680

tgtggaaagg acgaggatcc tgtgtccatt gtctcactcc tcgaggagtg agacaatgga 1740

cacatttttt tgaattccac tacgggtcta ggctgcccat gtaaggaggc aaggcctggg 1800

gacacccgag atgcctggtt ataattaacc ccaacacctg ctgccccccc ccccccaaca 1860

cctgctgcct gagcctgagc ggttacccca ccccggtgcc tgggtcttag gctctgtaca 1920

ccatggagga gaagctcgct ctaaaaataa ccctgtccct ggtggatccc ctgcatgcgg 1980

ccgtccgccc tcggcaccat tcctcacgac accgaaatat ggcgacgggt gaggaatggt 2040

ggggagttat ttttagagcg gtgaggaatg gtgggcaggc agcaggtgtt gggggagtta 2100

tttttagagc ggggagttat ttttagagcg gtgaggaatg gtggacaccg aaatatggcg 2160

acgggtgagg aatggtgccg tcgccatatt tgggtgtccc gtccgccctc ggccggggcc 2220

gcattcctgg gggccgggcg gtgctcccgc ccgcctcgat aaaaggctcc ggggccggcg 2280

gcggcccact cgagacgttg taaaacgacg gccagtgagc gcgcgtaata cgactcacta 2340

tagggcgaat tgggtaccgc caccatggtg tggtgggagg aagtggagga ctgctacgag 2400

agagaggacg tgcagaagaa aaccttcacc aagtgggtga acgcccagtt cagcaagttc 2460

ggcaagcagc acatcgagaa cctgttcagc gacctgcagg atggcaggag actgctggac 2520

ctgctggagg gcctgaccgg ccagaagctg cccaaggaga agggcagcac cagagtgcac 2580

gccctgaaca acgtgaacaa ggccctgaga gtgctgcaga acaacaacgt ggacctggtg 2640

aacatcggca gcaccgacat cgtggacggc aaccacaagc tgaccctggg cctgatctgg 2700

aacatcatcc tgcactggca ggtgaagaac gtgatgaaga acatcatggc cggcctgcag 2760

cagaccaaca gcgagaagat cctgctgagc tgggtgaggc agagcaccag aaactacccc 2820

caggtgaacg tgatcaactt caccacctcc tggagcgacg gcctggccct gaacgccctg 2880

atccacagcc acagacccga cctgttcgac tggaacagcg tggtgtgtca gcagagcgcc 2940

acccagagac tggagcacgc cttcaacatc gccagatacc agctgggcat cgagaagctg 3000

ctggaccccg aggacgtgga caccacctac cccgacaaga aaagcatcct catgtacatt 3060

accagcctgt tccaggtgct gccccagcag gtgtccatcg aggccatcca ggaagtggaa 3120

atgctgccca ggccccccaa agtgaccaag gaggagcact tccagctgca ccaccagatg 3180

cactacagcc agcagatcac agtgagcctg gcccagggct atgagagaac cagcagcccc 3240

aagcccagat tcaagagcta cgcctacacc caggccgcct acgtgaccac ctccgacccc 3300

accagaagcc ccttccccag ccagcacctg gaggcccccg aggacaagag cttcggcagc 3360

agcctgatgg agagcgaagt gaacctggac agataccaga ccgccctgga ggaagtgctg 3420

tcctggctgc tgagcgccga ggacaccctg caggcccagg gcgagatcag caacgacgtg 3480

gaagtggtga aggaccagtt ccacacccac gagggctaca tgatggatct gaccgcccac 3540

cagggcagag tgggcaatat cctgcagctg ggcagcaagc tgatcggcac cggcaagctg 3600

agcgaggacg aggagaccga agtgcaggag cagatgaacc tgctgaacag cagatgggag 3660

tgcctgagag tggccagcat ggagaagcag agcaacctgc acagagtgct gatggacctg 3720

cagaaccaga agctgaagga gctgaacgac tggctgacca agaccgagga gcggaccaga 3780

aagatggagg aggagcccct gggccccgac ctggaggacc tgaagagaca ggtgcagcag 3840

cacaaagtgc tgcaggagga cctggagcag gagcaggtgc gcgtgaacag cctgacccac 3900

atggtggtgg tcgtggacga gagcagcggc gaccacgcca cagccgccct ggaagagcag 3960

ctgaaagtgc tgggcgacag atgggccaat atttgtaggt ggaccgagga cagatgggtg 4020

ctgctgcagg accagcccga cctggcccct ggcctgacca ccatcggcgc cagccccacc 4080

cagaccgtga ccctggtgac ccagcccgtg gtgacaaagg agaccgccat cagcaagctg 4140

gagatgccca gctccctgat gctggaagtg cccacccacc gcctgctcca gcagttcccc 4200

ctggacctgg agaagttcct ggcctggctg accgaggccg aaaccaccgc caatgtgctc 4260

caggacgcca ctagaaagga gaggctgctg gaggacagca agggcgtgaa agagctgatg 4320

aagcagtggc aggatctgca gggcgaaatc gaggcccaca ccgacgtgta ccacaacctg 4380

gacgagaaca gccagaagat tctgaggagc ctggagggca gcgacgacgc cgtcctgctc 4440

cagaggaggc tggacaacat gaacttcaag tggagcgagc tgcggaagaa gagcctgaac 4500

atccggagcc acctggaagc cagcagcgac cagtggaaga gactgcacct gagcctgcag 4560

gagctgctgg tgtggctgca gctgaaggac gacgagctga gcagacaggc ccccatcggc 4620

ggcgacttcc ccgccgtgca gaagcagaac gacgtgcacc gggccttcaa gagggagctg 4680

aaaaccaagg aacccgtgat catgagcacc ctggagacag tgcggatctt cctgaccgag 4740

cagcccctgg agggactgga gaagctgtac caggagccca gagagctgcc ccccgaggag 4800

agagcccaga acgtgaccag gctgctgaga aagcaggccg aggaagtgaa taccgagtgg 4860

gagaagctga atctgcacag cgccgactgg cagagaaaga tcgacgagac cctggagaga 4920

ctccaggaac tgcaggaagc caccgacgag ctggacctga agctgagaca ggccgaagtg 4980

atcaagggca gctggcagcc tgtgggcgat ctgctgatcg actccctgca ggatcacctg 5040

gagaaagtga aggccctgcg gggcgagatc gcccccctga aggagaatgt gagccacgtg 5100

aacgacctgg ccagacagct gaccaccctg ggcatccagc tgagccccta caacctgagc 5160

acactggagg atctgaacac ccggtggaaa ctgctgcagg tggccgtgga ggatagagtg 5220

aggcagctgc acgaagccca cagagacttc ggccctgcct cccagcactt cctgagcacc 5280

agcgtgcagg gcccctggga gagagccatc tcccccaaca aagtgcccta ctacatcaac 5340

cacgagaccc agaccacctg ctgggaccac cctaagatga ccgagctgta tcagagcctg 5400

gccgacctga acaatgtgcg gttcagcgcc tacagaaccg ccatgaagct gcggagactg 5460

cagaaggccc tgtgcctgga tctgctgagc ctgagcgccg cctgcgacgc cctggaccag 5520

cacaacctga agcagaatga ccagcccatg gacatcctgc agatcatcaa ctgcctgacc 5580

acaatctacg accggctgga acaggagcac aacaacctgg tgaatgtgcc cctgtgcgtg 5640

gacatgtgcc tgaattggct gctgaacgtg tacgacaccg gcaggaccgg cagaatccgc 5700

gtgctgagct tcaagaccgg catcatcagc ctgtgcaagg cccacctgga ggataagtac 5760

cgctacctgt tcaagcaggt ggccagcagc accggcttct gcgatcagag gagactgggc 5820

ctgctgctgc acgatagcat ccagatccct aggcagctgg gcgaagtggc cagctttggc 5880

ggcagcaaca tcgagccctc tgtgaggagc tgcttccagt tcgccaacaa caagcccgag 5940

atcgaggccg ccctgttcct ggactggatg aggctggagc ctcagagcat ggtgtggctg 6000

cctgtgctgc acagagtggc cgccgccgag accgccaagc accaggccaa gtgcaatatc 6060

tgcaaggagt gccccatcat cggcttccgg tacaggagcc tgaagcactt caactacgac 6120

atctgccaga gctgcttttt cagcggcaga gtggccaagg gccacaaaat gcactacccc 6180

atggtggagt actgcacccc caccacctcc ggcgaggatg tgagagactt cgccaaagtg 6240

ctgaagaata agttccggac caagcggtac tttgccaagc accccaggat gggctacctg 6300

cccgtgcaga ccgtgctgga aggcgacaac atggagacct gatgaggagc tcgaggccta 6360

ataaagagct cagatgcatc gatcagagtg tgttggtttt ttgtgtgaga tctaggaacc 6420

cctagtgatg gagttggcca ctccctctct gcgcgctcgc tcgctcactg aggccgcccg 6480

ggcaaagccc gggcgtcggg cgacctttgg tcgcccggcc tcagtgagcg agcgagcgcg 6540

cagagaggga gtggccaacc cccccccccc cccccctgca ggcgattctc ttgtttgctc 6600

cagactctca ggcaatgacc tgatagcctt tgtagagacc tctcaaaaat agctaccctc 6660

tccggcatga atttatcagc tagaacggtt gaatatcata ttgatggtga tttgactgtc 6720

tccggccttt ctcacccgtt tgaatcttta cctacacatt actcaggcat tgcatttaaa 6780

atatatgagg gttctaaaaa tttttatcct tgcgttgaaa taaaggcttc tcccgcaaaa 6840

gtattacagg gtcataatgt ttttggtaca accgatttag ctttatgctc tgaggcttta 6900

ttgcttaatt ttgctaattc tttgccttgc ctgtatgatt tattggatgt tggaattcct 6960

gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatat ggtgcactct 7020

cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc caacacccgc 7080

tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag ctgtgaccgt 7140

ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg cgagacgaaa 7200

gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg tttcttagac 7260

gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat ttttctaaat 7320

acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc aataatattg 7380

aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct tttttgcggc 7440

attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag atgctgaaga 7500

tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta agatccttga 7560

gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc tgctatgtgg 7620

cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca tacactattc 7680

tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg atggcatgac 7740

agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg ccaacttact 7800

tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca tgggggatca 7860

tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa acgacgagcg 7920

tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa ctggcgaact 7980

acttactcta gcttcccggc aacaattaat agactggatg gaggcggata aagttgcagg 8040

accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat ctggagccgg 8100

tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc cctcccgtat 8160

cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata gacagatcgc 8220

tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt actcatatat 8280

actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga agatcctttt 8340

tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag cgtcagaccc 8400

cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt 8460

gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag agctaccaac 8520

tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg tccttctagt 8580

gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat acctcgctct 8640

gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta ccgggttgga 8700

ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac 8760

acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc gtgagctatg 8820

agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa gcggcagggt 8880

cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc tttatagtcc 8940

tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt caggggggcg 9000

gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct tttgctggcc 9060

ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc gtattaccgc 9120

ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag 9180

cgaggaagcg gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt ggccgattca 9240

ttaatgcag 9249

<210> 2

<211> 3978

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 2

atggtgtggt gggaggaagt ggaggactgc tacgagagag aggacgtgca gaagaaaacc 60

ttcaccaagt gggtgaacgc ccagttcagc aagttcggca agcagcacat cgagaacctg 120

ttcagcgacc tgcaggatgg caggagactg ctggacctgc tggagggcct gaccggccag 180

aagctgccca aggagaaggg cagcaccaga gtgcacgccc tgaacaacgt gaacaaggcc 240

ctgagagtgc tgcagaacaa caacgtggac ctggtgaaca tcggcagcac cgacatcgtg 300

gacggcaacc acaagctgac cctgggcctg atctggaaca tcatcctgca ctggcaggtg 360

aagaacgtga tgaagaacat catggccggc ctgcagcaga ccaacagcga gaagatcctg 420

ctgagctggg tgaggcagag caccagaaac tacccccagg tgaacgtgat caacttcacc 480

acctcctgga gcgacggcct ggccctgaac gccctgatcc acagccacag acccgacctg 540

ttcgactgga acagcgtggt gtgtcagcag agcgccaccc agagactgga gcacgccttc 600

aacatcgcca gataccagct gggcatcgag aagctgctgg accccgagga cgtggacacc 660

acctaccccg acaagaaaag catcctcatg tacattacca gcctgttcca ggtgctgccc 720

cagcaggtgt ccatcgaggc catccaggaa gtggaaatgc tgcccaggcc ccccaaagtg 780

accaaggagg agcacttcca gctgcaccac cagatgcact acagccagca gatcacagtg 840

agcctggccc agggctatga gagaaccagc agccccaagc ccagattcaa gagctacgcc 900

tacacccagg ccgcctacgt gaccacctcc gaccccacca gaagcccctt ccccagccag 960

cacctggagg cccccgagga caagagcttc ggcagcagcc tgatggagag cgaagtgaac 1020

ctggacagat accagaccgc cctggaggaa gtgctgtcct ggctgctgag cgccgaggac 1080

accctgcagg cccagggcga gatcagcaac gacgtggaag tggtgaagga ccagttccac 1140

acccacgagg gctacatgat ggatctgacc gcccaccagg gcagagtggg caatatcctg 1200

cagctgggca gcaagctgat cggcaccggc aagctgagcg aggacgagga gaccgaagtg 1260

caggagcaga tgaacctgct gaacagcaga tgggagtgcc tgagagtggc cagcatggag 1320

aagcagagca acctgcacag agtgctgatg gacctgcaga accagaagct gaaggagctg 1380

aacgactggc tgaccaagac cgaggagcgg accagaaaga tggaggagga gcccctgggc 1440

cccgacctgg aggacctgaa gagacaggtg cagcagcaca aagtgctgca ggaggacctg 1500

gagcaggagc aggtgcgcgt gaacagcctg acccacatgg tggtggtcgt ggacgagagc 1560

agcggcgacc acgccacagc cgccctggaa gagcagctga aagtgctggg cgacagatgg 1620

gccaatattt gtaggtggac cgaggacaga tgggtgctgc tgcaggacca gcccgacctg 1680

gcccctggcc tgaccaccat cggcgccagc cccacccaga ccgtgaccct ggtgacccag 1740

cccgtggtga caaaggagac cgccatcagc aagctggaga tgcccagctc cctgatgctg 1800

gaagtgccca cccaccgcct gctccagcag ttccccctgg acctggagaa gttcctggcc 1860

tggctgaccg aggccgaaac caccgccaat gtgctccagg acgccactag aaaggagagg 1920

ctgctggagg acagcaaggg cgtgaaagag ctgatgaagc agtggcagga tctgcagggc 1980

gaaatcgagg cccacaccga cgtgtaccac aacctggacg agaacagcca gaagattctg 2040

aggagcctgg agggcagcga cgacgccgtc ctgctccaga ggaggctgga caacatgaac 2100

ttcaagtgga gcgagctgcg gaagaagagc ctgaacatcc ggagccacct ggaagccagc 2160

agcgaccagt ggaagagact gcacctgagc ctgcaggagc tgctggtgtg gctgcagctg 2220

aaggacgacg agctgagcag acaggccccc atcggcggcg acttccccgc cgtgcagaag 2280

cagaacgacg tgcaccgggc cttcaagagg gagctgaaaa ccaaggaacc cgtgatcatg 2340

agcaccctgg agacagtgcg gatcttcctg accgagcagc ccctggaggg actggagaag 2400

ctgtaccagg agcccagaga gctgcccccc gaggagagag cccagaacgt gaccaggctg 2460

ctgagaaagc aggccgagga agtgaatacc gagtgggaga agctgaatct gcacagcgcc 2520

gactggcaga gaaagatcga cgagaccctg gagagactcc aggaactgca ggaagccacc 2580

gacgagctgg acctgaagct gagacaggcc gaagtgatca agggcagctg gcagcctgtg 2640

ggcgatctgc tgatcgactc cctgcaggat cacctggaga aagtgaaggc cctgcggggc 2700

gagatcgccc ccctgaagga gaatgtgagc cacgtgaacg acctggccag acagctgacc 2760

accctgggca tccagctgag cccctacaac ctgagcacac tggaggatct gaacacccgg 2820

tggaaactgc tgcaggtggc cgtggaggat agagtgaggc agctgcacga agcccacaga 2880

gacttcggcc ctgcctccca gcacttcctg agcaccagcg tgcagggccc ctgggagaga 2940

gccatctccc ccaacaaagt gccctactac atcaaccacg agacccagac cacctgctgg 3000

gaccacccta agatgaccga gctgtatcag agcctggccg acctgaacaa tgtgcggttc 3060

agcgcctaca gaaccgccat gaagctgcgg agactgcaga aggccctgtg cctggatctg 3120

ctgagcctga gcgccgcctg cgacgccctg gaccagcaca acctgaagca gaatgaccag 3180

cccatggaca tcctgcagat catcaactgc ctgaccacaa tctacgaccg gctggaacag 3240

gagcacaaca acctggtgaa tgtgcccctg tgcgtggaca tgtgcctgaa ttggctgctg 3300

aacgtgtacg acaccggcag gaccggcaga atccgcgtgc tgagcttcaa gaccggcatc 3360

atcagcctgt gcaaggccca cctggaggat aagtaccgct acctgttcaa gcaggtggcc 3420

agcagcaccg gcttctgcga tcagaggaga ctgggcctgc tgctgcacga tagcatccag 3480

atccctaggc agctgggcga agtggccagc tttggcggca gcaacatcga gccctctgtg 3540

aggagctgct tccagttcgc caacaacaag cccgagatcg aggccgccct gttcctggac 3600

tggatgaggc tggagcctca gagcatggtg tggctgcctg tgctgcacag agtggccgcc 3660

gccgagaccg ccaagcacca ggccaagtgc aatatctgca aggagtgccc catcatcggc 3720

ttccggtaca ggagcctgaa gcacttcaac tacgacatct gccagagctg ctttttcagc 3780

ggcagagtgg ccaagggcca caaaatgcac taccccatgg tggagtactg cacccccacc 3840

acctccggcg aggatgtgag agacttcgcc aaagtgctga agaataagtt ccggaccaag 3900

cggtactttg ccaagcaccc caggatgggc tacctgcccg tgcagaccgt gctggaaggc 3960

gacaacatgg agacctga 3978

<210> 3

<211> 756

<212> DNA

<213> Artificial sequence

<220>

<223> synthetic

<400> 3