阅读说明：本技术 用于治疗脊髓性肌萎缩的腺相关病毒载体及其用途 (Adeno-associated virus vector for treating spinal muscular atrophy and application thereof ) 是由 张磊 蒋立新 于 2021-06-02 设计创作，主要内容包括：本发明公开了一种重组核酸分子,其包含可操作的依次连接的启动子、杂合内含子和编码功能性运动神经元存活蛋白的核酸序列。本发明还公开了一种重组腺相关病毒,其包含AAV衣壳和载体基因组,所述载体基因组包含编码功能性运动神经元存活蛋白的核酸序列和引导运动神经元存活蛋白的核酸序列在宿主细胞中表达的表达控制序列。本发明还公开了所述重组腺相关病毒用于更有效地、起效快地治疗脊髓性肌萎缩的用途。(The present invention discloses a recombinant nucleic acid molecule comprising, operably linked in sequence, a promoter, a hybrid intron, and a nucleic acid sequence encoding a functional survival motor neuron protein. The invention also discloses a recombinant adeno-associated virus comprising an AAV capsid and a vector genome comprising a nucleic acid sequence encoding a functional motor neuron survivin and an expression control sequence directing expression of the nucleic acid sequence of the motor neuron survivin in a host cell. The invention also discloses the application of the recombinant adeno-associated virus in more effective and quick-acting treatment of spinal muscular atrophy.)

1. A recombinant nucleic acid molecule comprising, operably linked in sequence, a promoter, a hybrid intron, and a nucleic acid sequence encoding a functional survival motor neuron.

2. The recombinant nucleic acid molecule of claim 1, wherein the promoter is a CAG promoter comprising a cytomegalovirus early enhancer element and a chicken β -actin promoter; the sequence of the hybrid intron is shown in SEQ ID NO 3.

3. The recombinant nucleic acid molecule of claim 2, wherein the cytomegalovirus early enhancer element has a polynucleotide sequence selected from the group consisting of:

1) 1, or a polynucleotide sequence shown in SEQ ID NO;

2) 1, a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 1, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity;

preferably, the chicken β -actin promoter has a polynucleotide sequence selected from the group consisting of:

1) 2, or a polynucleotide sequence shown in SEQ ID NO;

2) 2, a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 2, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity.

4. The recombinant nucleic acid molecule of any one of claims 1-3, wherein the nucleic acid sequence encoding functional motoneuron survivin has a polynucleotide sequence selected from the group consisting of:

1) a polynucleotide sequence shown as SEQ ID NO. 6 or SEQ ID NO. 8;

2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO. 6 or SEQ ID NO. 8; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 6 or SEQ ID NO. 8, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity;

more preferably, the polynucleotide sequence is a codon optimized sequence.

5. The recombinant nucleic acid molecule of any one of claims 1-4, wherein the recombinant nucleic acid molecule further comprises one or more of a polyadenylation, Kozak sequence, WPRE, and post-transcriptional regulatory elements; wherein the polyadenylic acid has a polynucleotide sequence selected from the group consisting of:

1) the polynucleotide sequence shown in SEQ ID NO. 7;

2) the nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO. 7; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 7, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity.

6. The recombinant nucleic acid molecule of any one of claims 1-5, wherein said recombinant nucleic acid molecule comprises the polynucleotide sequence set forth in SEQ ID NO 4; preferably, the recombinant nucleic acid molecule has a polynucleotide sequence selected from the group consisting of:

1) a polynucleotide sequence shown as SEQ ID NO. 9 or SEQ ID NO. 10;

2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO. 9 or SEQ ID NO. 10; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 9 or SEQ ID NO. 10, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity.

7. The recombinant nucleic acid molecule of any one of claims 1-6, wherein said recombinant nucleic acid molecule further comprises an AAV inverted terminal repeat; preferably, the AAV inverted terminal repeats are selected from AAV of different serotypes; preferably, the AAV inverted terminal repeat is selected from any one of AAV or AAV1 type, AAV2 type, AAV3 type, AAV4 type, AAV5 type, AAV6 type, AAV7 type, AAV8 type, AAV9 type, or hybrid/chimeric types thereof of any serotype in clades a-F; more preferably, the AAV inverted terminal repeat is from AAV2 type.

8. A recombinant vector comprising the recombinant nucleic acid molecule of any one of claims 1-7, wherein said vector is selected from the group consisting of plasmid vectors, phage vectors, and viral vectors, wherein the viral vectors are selected from the group consisting of adeno-associated viral vectors, adenoviral vectors, lentiviral vectors, and hybrid viral vectors.

9. A recombinant adeno-associated virus comprising an AAV capsid and a vector genome comprising the recombinant nucleic acid molecule of any of claims 1-7 comprising an AAV inverted terminal repeat, a nucleic acid sequence encoding a motor neuron survivin and expression control sequences that direct expression of SMN in a host cell; preferably, the capsid of the recombinant adeno-associated virus is preferably AAV9, more preferably, the recombinant adeno-associated virus is a self-complementary adeno-associated virus.

10. An isolated host cell comprising the recombinant nucleic acid molecule of any one of claims 1-7, the recombinant vector of claim 8, or the recombinant adeno-associated virus of claim 9.

11. A pharmaceutical composition comprising the recombinant nucleic acid molecule of any one of claims 1-7, the recombinant vector of claim 8, the recombinant adeno-associated virus of claim 9, and/or the host cell of claim 10, and a pharmaceutically acceptable excipient; preferably, it is formulated for intravenous administration.

12. Use of the recombinant nucleic acid molecule of any one of claims 1-7, the recombinant vector of claim 8, the recombinant adeno-associated virus of claim 9, the host cell of claim 10, and/or the pharmaceutical composition of claim 11 in the manufacture of a medicament for preventing or treating spinal muscular atrophy.

13. The use of claim 12, wherein the recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and/or pharmaceutical composition can be administered in conjunction with another therapy.

14. The use of claim 12 or 13, wherein the recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and/or pharmaceutical composition can be at about 1 x 10¹⁰vg/kg to about 1X 10¹⁶A dose of vg/kg; preferably, the recombinant adeno-associated virus can be at about 5 × 10¹³A dose of vg/kg; preferably, the recombinant adeno-associated virus or composition can be present at about 2.5 × 10¹²A dose of vg/kg; preferably, the vector or composition may be administered more than once.

15. A method of treating spinal muscular atrophy in a subject, the method comprising administering to a subject in need thereof the recombinant nucleic acid molecule of any one of claims 1-7, the recombinant vector of claim 8, the recombinant adeno-associated virus of claim 9, the host cell of claim 10, and/or the pharmaceutical composition of claim 11; preferably, the composition is administered intrathecally; preferably, the subject is a mammal; more preferably, the subject is a human.

Technical Field

The invention relates to the field of gene therapy, in particular to an adeno-associated virus vector for treating spinal muscular atrophy and application thereof.

Background

Spinal Muscular Atrophy (SMA) is a rare disease of motor neuron degeneration characterized by degeneration of anterior horn motor neurons, sometimes also involving brain stem motor neurons. Clinically, it is mainly manifested as progressive, symmetrical myasthenia and atrophy of motor neurons, with the proximal end heavier than the distal end and the lower limbs heavier than the upper limbs. Due to muscle weakness, there is an effect on breathing, movement, swallowing, etc. In the United states, the incidence rate of newborn infants is 1/6000-10000, and the carrying rate of people is 1/40-60. The domestic morbidity has no official statistics, and 3-5 ten thousand patients are presumed to be commonly seen in China due to the fact that the morbidity of the disease has no ethnic specificity, and 1500-2500 patients are newly added every year.

SMA pathogenesis is associated with mutations in the SMN gene in chromosome 5, SMN encodes the full length SMN (SMN-fl), which encodes a protein comprising 294 amino acids in full length and having a molecular weight of 38 kD. SMN molecules are expressed in the cytoplasm and nucleus and are primarily involved in the regulation of molecular transcription. SMN and Gemins and other molecules form protein complexes, and the protein complexes and snRNP complexes are combined with each other to enter cell nucleus to form gem body (GB for short) and regulate the transcription of genes in cells. The lack of SMN molecules in cells, reduced transcription levels, especially in motor neurons, results in reduced motor neuron activity, which leads to reduced synapse connections and reduced muscle activity. There are two SMN alleles in humans, SMNl near the telomere and SMN2 near the centromere. Both are highly homologous, with differences within the coding region being only synonymous mutations for exon 7, and other differences being located in non-coding regions. SMNl gene expression products are 90% functional SMN proteins, whereas SMN2 gene transcripts are 90% missing exon 7, with only 10% of transcripts containing exon 7 expressing only around 10% functional SMN proteins. The SMA patient had a deletion of the SMN1 gene and a mutation in exon 7 of the SMN2 gene resulting in a decrease in SMN protein levels. Patients can be divided into 4 types based on the mutant copy number of the 7 th exon in the SMN2 gene. The SMAI type patient generally attacks the disease within 2 weeks to 3 months after birth, the muscle tension is seriously exhausted, the sick child is difficult to sit up, and the disease is died due to respiratory failure after about 2 years old; the type II patient generally attacks the disease within 6-18 months, can sit up, but is difficult to walk independently, and generally dies after the adult; type III patients lose ambulation slowly with age, but have a normal lifespan; patients with type IV usually develop the disease in teenagers, have slight dyskinesia and do not affect the life span. Since SMA has not been incorporated by the country into the screening system for neonatal disease, it is speculated that the number of SMA patients in the country will steadily increase 10-20 years in the future.

The first SMA drug approved by the FDA for marketing is the antisense oligonucleotide drug developed by Biogen corporation (ISIS-SMNRx), which is used primarily to treat type II SMA patients by modifying the pre-messenger RNA splicing of the SMN2 gene, thereby producing normal SMN protein. However, the medicine is easy to cause urinary system toxicity after being taken, and is easy to reduce blood platelets of patients and cause adverse reactions such as blood coagulation disorder and the like. The research and development of a medicament which has safer curative effect on patients and wider indications is the future research and development direction. In 5 months of 2019, the FDA approved a gene therapy drug Zolgensma of noval, which uses non-replicative adeno-associated virus as a delivery vehicle of a functional gene of human SMN to treat SMA patients, but has a certain therapeutic effect, but is expensive and cannot be consumed by general patients. Therefore, for SMA diseases, a widely accepted medicine and a method for treating SMA more effectively are still urgently needed in China.

Disclosure of Invention

The invention is based on the pathogenesis that single gene mutation leads to SMN molecule deletion in a patient, and the SMN gene is directly supplemented in the patient through a gene therapy method. The candidate drug uses double-chain AAV adeno-associated virus vector to carry normal SMN gene into spinal cord, and generates normal SMN protein adapting to in vivo environment through transcription and translation.

In one aspect, the invention provides a recombinant nucleic acid molecule comprising, operably linked in sequence, a promoter, a hybrid intron, and a nucleic acid sequence encoding a functional survival motor neuron.

In one aspect, the invention provides a recombinant vector comprising a recombinant nucleic acid molecule described herein.

In another aspect, the invention provides a recombinant adeno-associated virus (rAAV) comprising an AAV capsid and a vector genome comprising an AAV Inverted Terminal Repeat (ITR), a nucleic acid sequence encoding a motor neuron Survivin (SMN), and an expression control sequence that directs expression of the SMN in a host cell.

In certain embodiments, the recombinant adeno-associated virus (rAAV) is a self-complementary adeno-associated virus (scAAV).

In certain embodiments, the recombinant adeno-associated virus (rAAV) is a recombinant AAV2/9 adeno-associated virus.

In another aspect, the invention relates to a recombinant adeno-associated virus (rAAV) having an AAV capsid comprising AAV ITRs (inverted terminal repeats) and a nucleic acid encoding SMN under the control of a regulatory element that directs expression of SMN in a host cell ("rAAV. SMN is replication-deficient and advantageously useful for delivering SMN to the CNS of a subject diagnosed with SMN deficiency; in particular, a human subject diagnosed with SMA. In a preferred embodiment, the raav.smn transduces neurons, and in particular motor neurons, in the brain and spinal cord. In another preferred embodiment, the raav.smn of the invention is not neutralized by antisera to the AAV9 capsid that may be present in the subject to be treated. In certain embodiments, the nucleic acid sequence encodes SEQ ID No. 9 or 10 or a sequence sharing at least 95% identity therewith.

In certain embodiments, the nucleic acid sequence encoding the human SMN protein ("hSMN") may be codon optimized. See, for example, that the nucleic acid sequence encoding the SMN protein is the SMN sequence of SEQ ID No. 6, or a sequence sharing at least 70% identity therewith.

In another aspect, the invention provides an isolated host cell comprising a recombinant vector or a recombinant adeno-associated virus (rAAV) as described herein.

In another aspect, the invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a recombinant adeno-associated virus (rAAV) as described herein.

In another aspect, the present invention provides the use of a recombinant nucleic acid molecule, a recombinant vector, a recombinant adeno-associated virus (rAAV), a host cell and/or a pharmaceutical composition as described herein in the preparation of a medicament for the prevention or treatment of spinal muscular atrophy.

In yet another aspect, the invention provides a method of treating spinal muscular atrophy in a subject. The method comprises administering to a subject in need thereof a pharmaceutical composition as described herein.

The present invention provides a recombinant adeno-associated virus (rAAV) for use in the treatment of spinal muscular atrophy with improved efficacy and rapid onset of action.

The present disclosure is further described with reference to the following drawings and detailed description, but is not intended to be limiting. All technical equivalents which may be substituted for elements thereof according to the disclosure are intended to be encompassed by the present patent.

Drawings

FIG. 1 shows a plasmid map of pSC-CMV.

FIG. 2 shows two different structures of the intervening fragments between ITRs.

FIG. 3 shows the plasmid map of pSNAV2.0-CAG-EGFP.

FIG. 4A shows the transfection efficiency of the L-G1 and L-G2 recombinant plasmids in 293 cells (24 h). Wherein F represents fluorescence and L represents white light. FIG. 4B shows the transfection efficiency of the L-G1 and L-G2 recombinant plasmids in PC12 cells (24 h). Wherein F represents fluorescence and L represents white light. Fig. 4C shows a comparison of the efficiency of infection of different recombinant viruses in PC12 cells. Wherein F represents fluorescence and L represents white light.

FIG. 5 shows a block diagram of an element containing different mini introns.

FIG. 6 shows the expression of recombinant vectors containing different mini intron elements after transfection of cells, where NC represents an untransfected control group. Among them, FIG. 6A represents PC12 cells, and FIG. 6B represents 293 cells.

FIG. 7A shows the effect of recombinant vectors containing different mini intron elements on the proliferative activity of 293 cells after transfection. Where PC refers to the positive control and is the multiple of the OD value of CCK8 activity in the uninfected samples to which serum was added versus the uninfected samples from which serum was withdrawn during the experiment. FIG. 7B shows the effect of recombinant viruses containing different mini intron elements on the proliferative activity of fibroblasts after infection. Where PC refers to the positive control and is the multiple of the OD value of CCK8 activity in the uninfected samples to which serum was added versus the uninfected samples from which serum was withdrawn during the experiment.

Figure 8 shows SMN RNA expression levels of drug candidates in patient fibroblasts, where Ctrl represents an uninfected viral control. SMN Δ 7 indicates deletion of exon 7.

Fig. 9 shows SMN protein expression levels of drug candidates in patient fibroblasts, where Ctrl represents an uninfected virus control.

Figure 10 shows that the drug candidate promotes GB formation. Wherein DAPI refers to 4',6-diamidino-2-phenylindole (4',6-diamidino-2-phenylindole), DIC refers to differential interference contrast, M refers to an overlay picture, and a picture obtained by overlaying two channels of red and blue together.

Both fig. 11A and fig. 11B show that the drug candidate promotes GB formation in a dose-dependent manner.

Figure 12 shows that drug candidates promote patient fibroblast survival.

Figure 13 shows that the drug candidates inhibited apoptosis of PC12 cells.

Figure 14 shows that drug candidates inhibit apoptosis of patient fibroblasts.

FIG. 15 shows that the recombinant virus scAAV2/9-L-G1 infects spinal motoneurons. Wherein, M refers to an overlay picture, which is a picture obtained by overlaying three channels, GFP, ChAT and DAPI.

FIG. 16 shows a comparison of drug candidate (L-orS1) and recombinant virus (L-orS4) in improving survival in mice.

Figure 17 shows that the drug candidate promotes rod-grasping time in a rotarod experiment in a dose-dependent manner in mice. Wherein NG represents a normal control group, MG represents a model control group, LDG represents a low dose administration group, MDG represents a medium dose administration group, and HDG represents a high dose administration group.

Figure 18 shows that the drug candidate promotes an increase in mouse muscle strength (muscle force value) in a dose-dependent manner. Wherein NG represents a normal control group, MG represents a model control group, LDG represents a low dose administration group, MDG represents a medium dose administration group, and HDG represents a high dose administration group.

FIGS. 19-21 show that the drug candidate (L-orS1) ameliorates skeletal muscle atrophy in mice. Wherein FIG. 19 is a normal control group, FIG. 20 is a model control group, and FIG. 21 is a test sample high dose administration group. Magnification factor under microscope 200 x.

FIGS. 22-24 show that the drug candidate (L-orS1) ameliorates spinal cord atrophy in mice. Wherein FIG. 22 is a normal control group, FIG. 23 is a model control group, and FIG. 24 is a test sample high dose administration group. Magnification factor under microscope 100 x.

FIGS. 25-27 show that the drug candidate (L-orS1) ameliorates brain tissue atrophy in mice. Wherein FIG. 25 is a normal control group, FIG. 26 is a model control group, and FIG. 27 is a test sample high dose administration group. Magnification factor under microscope 100 x.

Detailed Description

I. Definition of

The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, recombinant DNA techniques and immunology, which are within the skill of the art. Such techniques are explained fully In the literature (see, e.g., fundamentals virology, second edition, vol. I & II (compiled by B.N. fields and D.M. Knipe); Handbook of Experimental immunology, Vois. I-FV (compiled by D.M.Weir and CC. Blackwell; Blackwell scientific publications), T.E.Creighton, Proteins, Structures and Molecular Properties (compiled by W.H. Freeman and Company, 1993); A.L.Lehner, Biochemistry (world publications, Inc., secure edition), Sambrook, et al, Molecular Cloning: Aluor (2 In, 1989); method, and sample, edition, Inc.

To facilitate understanding of various embodiments of the present disclosure, the following explanation of specific terms is provided:

adeno-associated virus (AAV): small replication-defective non-enveloped viruses that infect humans and some other primate species. AAV is known to not cause disease and to elicit a very mild immune response. Gene therapy vectors using AAV can infect dividing and quiescent cells and can remain extrachromosomal without integrating into the genome of the host cell. These characteristics make AAV an attractive viral vector for gene therapy.

Administration/administration: an agent, such as a therapeutic agent (e.g., a recombinant AAV), is provided or administered to a subject by an effective route. Exemplary routes of administration include, but are not limited to, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, intravascular, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes.

Codon-optimized: a "codon-optimized" nucleic acid refers to a nucleic acid sequence that has been altered to make codons optimal for expression in a particular system (e.g., a particular species or group of species). For example, the nucleic acid sequence may be optimized for expression in a mammalian cell or a particular mammalian species (e.g., a human cell). Codon optimization does not change the amino acid sequence of the encoded protein.

Enhancer: a nucleic acid sequence which increases the transcription rate by increasing the activity of a promoter.

An intron: a piece of DNA in which the gene does not contain information encoding a protein. Introns are removed prior to translation of messenger RNA. Hybrid intron (hybrid intron): is a combined intron that includes sequences from more than one native intron.

Inverted Terminal Repeat (ITR): a symmetric nucleic acid sequence in the genome of the adeno-associated virus required for efficient replication. The ITR sequences are located at each end of the AAV DNA genome. The ITRs serve as origins of replication for viral DNA synthesis and are essential cis-elements for the generation of AAV integrative vectors.

Separating: an "isolated" biological component (e.g., a nucleic acid molecule, protein, virus, or cell) has been substantially isolated or purified from cells or tissues of an organism in which the component naturally occurs, or other biological components in the organism itself (e.g., other chromosomal and extra-chromosomal DNA and RNA, proteins, and cells). Nucleic acid molecules and proteins that have been "isolated" include those purified by standard purification methods. The term also includes nucleic acid molecules and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acid molecules and proteins.

Operatively connected to: the first nucleic acid sequence is operably linked to the second nucleic acid sequence when the first nucleic acid sequence and the second nucleic acid sequence are placed in a functional relationship. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, when necessary to join two protein coding regions, in the same reading frame.

A pharmaceutically acceptable carrier: pharmaceutically acceptable carriers (solvents) that may be used in the present disclosure are conventional. Remington's Pharmaceutical Sciences, by e.w. martin, mack publishing co., Easton, PA,15th Edition (1975) describe compositions and formulations suitable for drug delivery of one or more therapeutic compounds, molecules or agents.

In general, the nature of the carrier will depend on the particular mode of administration used. For example, parenteral formulations typically comprise injectable fluids, including pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, and the like as solvents. For solid compositions (e.g., in the form of powders, pills, tablets or capsules), conventional non-toxic solid carriers can be included, such as pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical compositions to be administered may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate.

Prevention, treatment or amelioration of diseases: "preventing" a disease (e.g., GSD-Ia) refers to inhibiting the overall occurrence of the disease. "treatment" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after initiation of the disease. By "improving" is meant reducing the number or severity of signs or symptoms of disease.

A promoter: a DNA region that directs/causes transcription of a nucleic acid (e.g., a gene). Promoters include the necessary nucleic acid sequences near the transcription start site. Typically, a promoter is located in the vicinity of the gene that it transcribes. The promoter region also optionally includes distal enhancer or repressor elements, which can be located thousands of base pairs away from the transcription start site.

And (3) recombination: a recombinant nucleic acid molecule refers to a nucleic acid molecule that has a sequence that is not naturally occurring, or that has a sequence that has been prepared by an artificial combination of two sequence segments that would otherwise be separate. Such artificial combinations can be achieved by chemical synthesis or by artificial manipulation of isolated nucleic acid molecule fragments, such as by genetic engineering techniques.

Likewise, a recombinant virus is a virus that comprises a sequence that is not naturally occurring or is prepared by an artificial combination of sequences from at least two different sources. The term "recombinant" also includes nucleic acids, proteins and viruses that are altered by the addition, substitution or deletion of only a portion of a native nucleic acid molecule, protein or virus. As used herein, "recombinant AAV" refers to an AAV particle having a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule encoding G6Pase- α) encapsulated therein.

Serotype: a class of closely related microorganisms (e.g., viruses) that are distinguished by a characteristic set of antigens.

Subject: living multicellular vertebrate organisms, including the classes of human and non-human mammals.

Synthesizing: produced in the laboratory by artificial means, for example, synthetic nucleic acids can be chemically synthesized in the laboratory.

A therapeutically effective amount of: an amount of a particular drug or therapeutic agent (e.g., a recombinant AAV) sufficient to achieve a desired effect in a subject or cell treated with the agent. The effective amount of an agent depends on a variety of factors including, but not limited to, the subject or cell being treated, and the mode of administration of the therapeutic composition.

Carrier: a vector is a nucleic acid molecule that allows for the insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and/or integrate in a host cell. A vector may comprise a nucleic acid sequence, such as an origin of replication, which allows it to replicate in a host cell. The vector may also comprise one or more selectable marker genes and other genetic elements. An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of an inserted gene. In some embodiments herein, the vector is an AAV vector. Sequence identity: identity or similarity between two or more nucleic acid sequences or between two or more amino acid sequences is expressed in terms of identity or similarity between the sequences. Sequence identity can be measured in terms of percent identity; the higher the percentage, the more identical the sequence. Sequence similarity can be measured in terms of percent similarity (taking into account conservative amino acid substitutions); the higher the percentage, the more similar the sequence. Homologues or orthologues of nucleic acid or amino acid sequences have a relatively high degree of sequence identity/similarity when aligned using standard methods. This homology is more pronounced when the orthologous protein or cDNA is from more closely related species (e.g., human and mouse sequences) than from more distantly related species (e.g., human and nematode (c. elegans) sequences).

The length of the sequence identity comparison can be over the full length of the genome, the full length of the gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides is desired. However, identity in smaller fragments (e.g., having at least about 9 nucleotides, typically at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides) may also be desirable.

Percent amino acid sequence identity can be readily determined over the full-length protein, polypeptide, about 32 amino acids, about 330 amino acids or peptide fragments thereof, or the corresponding nucleic acid sequence encoding sequence. Suitable amino acid fragments can be at least about 8 amino acids in length, and can be up to about 700 amino acids in length. In general, when referring to "identity", "homology" or "similarity" between two different sequences, reference is made to "aligning" the sequences to determine "identity", "homology" or "similarity". "aligned" sequences or "alignment" refers to a plurality of nucleic acid sequences or protein (amino acid) sequences, which typically contain deletions or additional corrections of bases or amino acids as compared to a reference sequence.

The alignment is performed using any publicly or commercially available multiple sequence alignment program. Sequence alignment programs can be used for amino acid sequences, such as the "Clustal X", "MAP", "PIMA", "MSA", "BLOCKAKER", "MEME" and "Match-Box" programs. Typically, any of these programs are used with default settings, although those settings can be changed as desired by those skilled in the art. Alternatively, one skilled in the art may employ another algorithm or computer program that provides at least the level of identity or alignment as provided by the reference algorithm or program. See, e.g., J.D.Thomson et al, Nucl.acids.Res., "acidic composition of multiple sequence alignments", 27(13): 2682-.

Multiple sequence alignment programs can also be used for nucleic acid sequences. Examples of such programs include "Clustal W", "CAPSequence Assembly", "BLAST", "MAP", and "MEME", which are accessible through a Web server on the Internet. Other sources of such procedures are known to those skilled in the art. Alternatively, a Vector NTI application is also used. There are also many algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, Fasta may be used^TM(one program in GCG Version 6.1) to compare polynucleotide sequences. Fasta^TMAlignments and percent sequence identities of the best overlapping regions between the query and search sequences are provided. For example, Fasta may be used^TMPercent sequence identity between nucleic acid sequences was determined with the default parameters (word length 6, and NOPAM factor for the scoring matrix) provided in GCG version6.1 (incorporated by reference herein).

In one aspect, a coding sequence encoding a functional SMN protein is provided. The nucleotide and amino acid sequences of various SMN1 molecules and SMN proteins are known. For example, NCBI accession nos. NM _000344 (human), NP _000335 (human), NM _011420 (mouse), EU791616 (pig), NM _001131470 (orangutan), NM _131191 (zebrafish), BC062404 (rat), NM _001009328 (cat), NM _001003226 (dog), NM _175701 (cow). In one embodiment, the polynucleotide sequence encoding functional SMN1 is the sequence shown in SEQ ID NO. 8 or a sequence sharing 95% identity therewith. In one embodiment, a modified hSMN1 coding sequence is provided. Preferably, the modified hSMN1 coding sequence has less than about 80% identity, preferably about 75% or less identity, to the full length native hSMN1 coding sequence. In one embodiment, the modified hSMN1 coding sequence is characterized by improved translation rate following AAV-mediated delivery (e.g., rAAV) compared to native hSMN 1. In one embodiment, a modified hSMN1 coding sequence shares less than about 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61% or less identity with a full-length native hSMN1 coding sequence. In one embodiment, the modified hSMN1 coding sequence is SEQ ID No. 6, or a sequence sharing 70%, 75%, 80%, 85%, 90%, 95% or greater identity with SEQ ID No. 6.

In one embodiment, the modified hSMN1 coding sequence is a codon optimized sequence optimized for expression in a test species. As used herein, a "subject" is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon, or gorilla. In a preferred embodiment, the subject is a human. In one embodiment, the sequence is codon optimized for expression in humans.

Codon-optimized coding regions can be designed by a variety of different methods. This optimization can be performed using an online available method (e.g. GeneArt), the published method, or a company offering codon optimization services, such as DNA2.0(Menlo Park, CA). For example, one codon optimization method is described in U.S. international patent publication No. WO 2015/012924, which is incorporated herein by reference in its entirety. See also, for example, U.S. patent publication No. 2014/0032186 and U.S. patent publication No. 2006/0136184. Suitably, the entire length of the Open Reading Frame (ORF) of the product is modified. However, in some embodiments, only a fragment of the ORF may be altered. By using one of these methods, the frequency can be applied to any given polypeptide sequence and a nucleic acid fragment encoding a codon-optimized coding region for that polypeptide can be produced.

Many options are available for making actual changes to codons or for synthesizing codon-optimized coding regions designed as described herein. Such modifications or syntheses may be carried out using standard and conventional molecular biological procedures well known to those of ordinary skill in the art. In one method, a series of complementary oligonucleotide pairs, each 80-90 nucleotides in length and spanning the length of the desired sequence, are synthesized by standard methods. These oligonucleotide pairs are synthesized such that they anneal to form a double-stranded fragment of 80-90 base pairs containing sticky ends, e.g., each oligonucleotide in the pair is synthesized to extend 3, 4, 5, 6, 7, 8, 9, 10 or more bases beyond the region complementary to the other oligonucleotide in the pair. The single stranded ends of each oligonucleotide pair are designed to anneal to the single stranded ends of the other oligonucleotide pair. Annealing the oligonucleotide pair and then annealing together about five to six of these double-stranded fragments via the sticky single-stranded ends, and then ligating them together and cloning into a standard bacterial cloning vector, such as available from Invitrogen Corporation, Carlsbad, CalifAnd (3) a carrier. This construct was then sequenced by standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 base pairs (i.e., fragments of about 500 base pairs) linked together were prepared so that the entire desired sequence was displayed as a series of plasmid constructs. The inserts of these plasmids are then cleaved with appropriate restriction enzymes and ligated together to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and carried onAnd (4) performing sequencing. Additional methods will be apparent to those skilled in the art. In addition, gene synthesis is readily available.

In one embodiment, the modified hSMN1 described herein is genetically engineered into a suitable genetic element (vector) useful for generating viral vectors and/or delivery to host cells, such as naked DNA, phage, transposons, cosmids, episomes, and the like, which conveys the hSMN1 sequence carried thereon. The selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated beads, viral infection, and protoplast fusion. Methods for making such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning, laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y..

In one aspect, an expression cassette comprising the hSMN1 nucleic acid sequence is provided. An "expression cassette" as used herein refers to a nucleic acid molecule comprising the promoter hSMN1 sequence and may include other regulatory sequences therefor, which cassette may be packaged into the capsid of a viral vector, such as a viral particle. Typically, such expression cassettes used to generate viral vectors contain the hSMN1 sequence described herein, which flank the packaging signals for the viral genome, as well as other expression control sequences, such as those described herein. For example, for AAV viral vectors, the packaging signals are the 5 'Inverted Terminal Repeats (ITRs) and the 3' ITRs. The ITRs associated with this expression cassette when packaged into an AAV capsid are referred to herein as a "recombinant AAV (raav) genome" or "vector genome".

Thus, in one aspect, an adeno-associated viral vector is provided, comprising an AAV capsid and at least one expression cassette, wherein the at least one expression cassette comprises a nucleic acid sequence encoding SMN1 and expression control sequences that direct expression of the SMN1 sequence in a host cell. The AAV vector further comprises AAV ITR sequences. In one embodiment, the ITRs are from a different AAV than the AAV providing the capsid. In a preferred embodiment, the ITR sequence is from AAV2, or a deleted version thereof (Δ ITR), which may be used for convenience and to accelerate regulatory approvals. However, ITRs from other AAV sources may be selected. When the source of the ITR is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as pseudotyped. Typically, the AAV vector genome comprises AAV5 'ITRs (hSMN1 coding sequence and any regulatory sequences) as well as AAV 3' ITRs. However, other configurations of these elements may be suitable. A shortened version of the 5' ITR (referred to as. DELTA.ITR) has been described in which the D-sequence and the terminal resolution site (trs) are deleted. In some embodiments, full length AAV5 'and 3' ITRs are used.

In one aspect, a construct is provided that is a DNA molecule (e.g., a plasmid) that can be used to generate a viral vector. An illustrative plasmid containing the required vector elements comprises the polynucleotide sequence shown in SEQ ID NO 9 or 10. The polynucleotide sequence shown in SEQ ID NO. 9 comprises the following nucleic acid sequence: cytomegalovirus early enhancer (CMVE) element (nt 1-287 of SEQ ID NO: 9), chicken beta-actin (CBA) promoter (nt 288-565 of SEQ ID NO: 9), hybrid intron (hybrid intron) (nt 566-793 of SEQ ID NO: 9), hSMN (nt 822-1706 of SEQ ID NO:9, total 885bp), polyadenylation (polyA) of the bovine Growth Hormone (GH) gene (nt 1742-1966 of SEQ ID NO: 9). The polynucleotide sequence shown in SEQ ID NO. 10 comprises the following nucleic acid sequence: cytomegalovirus early enhancer (CMVE) element (nt 1-287 of SEQ ID NO: 10), chicken beta-actin (CBA) promoter (nt 288-565 of SEQ ID NO: 10), hybrid intron (hybrid intron) (nt 566-793 of SEQ ID NO: 10), hSMN (nt 822-1706 of SEQ ID NO:10, 885bp in total), polyadenylation (polyA) of the bovine Growth Hormone (GH) gene (nt 1742-1966 of SEQ ID NO: 10).

Other expression cassettes may be generated using other synthetic hSMN1 coding sequences described herein and other expression control elements described herein.

The expression cassette will typically contain a promoter sequence as part of the expression control sequence, for example between the selected 5' ITR sequence and the hSMN1 coding sequence. The illustrative plasmids and vectors described herein use a plasmid containing the cytomegalovirus early enhancer (CMVE) and chicken β -actin (CBA) promoters. Alternatively, other neuron-specific promoters can be used [ see, e.g., Lockery Lab neuron-specific promoter database accessed at http:// chinook. uooregon. edu/promoters. html ]. Such neuron-specific promoters include, but are not limited to, for example, synapsin I (syn), calcium/calmodulin-dependent protein kinase II, tubulin α I, neuron-specific enolase, and platelet-derived growth factor β -chain promoters. See Hioki et al, Gene Therapy, 6.2007, 14(11):872-82, which is incorporated herein by reference. Other neuron-specific promoters include the 67kDa glutamate decarboxylase (GAD67), homeobox Dlx5/6, glutamate receptor 1(GluR1), preprotachykinin 1(Tac1) promoter, neuron-specific enolase (NSE), and dopaminergic receptor 1(Drd1a) promoters. See, e.g., Delzor et al, Human Gene Therapy methods, 8.2012, 23(4): 242-. In another embodiment, the promoter is the GUSB promoter http:// www.jci.org/articules/view/41615 # B30.

Other promoters such as constitutive promoters, regulatable promoters [ see, e.g., WO 2011/126808 and WO2013/04943], or promoters responsive to physiological signals (cues) may be used in the vectors described herein. The promoter may be selected from different sources, such as the human Cytomegalovirus (CMV) immediate early enhancer/promoter, SV40 early enhancer/promoter, JC polymorus promoter, Myelin Basic Protein (MBP) or Glial Fibrillary Acidic Protein (GFAP) promoter, herpes simplex virus (HSV-1) Latency Associated Promoter (LAP), Rous Sarcoma Virus (RSV) Long Terminal Repeat (LTR) promoter, neuron specific promoter (NSE), Platelet Derived Growth Factor (PDGF) promoter, hsin, Melanin Concentrating Hormone (MCH) promoter, CBA, matrix metalloproteinase promoter (MPP), and chicken beta actin promoter.

In addition to the promoter, the expression cassette and/or vector may contain one or more other suitable transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA, such as WPRE; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and, where necessary, sequences that enhance secretion of the encoded product. Examples of suitable polyA sequences include, for example, SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. One example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those suitable for CNS indications. In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, the expression cassette contains two or more expression enhancers. These enhancers may be the same, or may be different from each other. For example, the enhancer may include the CMV immediate early enhancer. Such an enhancer may be present in two copies located adjacent to each other. Alternatively, the two copies of the enhancer may be separated by one or more sequences. In yet another embodiment, the expression cassette further comprises an intron, such as the chicken β actin intron. Other suitable introns include those known in the art, for example as described in WO 2011/126808. Optionally, one or more sequences may be selected to stabilize the mRNA. An example of such a sequence is a modified WPRE sequence which can be engineered upstream of the polyA sequence and downstream of the coding sequence [ see, e.g., MA Zanta-Boussif et al, Gene Therapy (2009)16:605-619 ].

These control sequences are "operably linked" to the hSMN1 gene sequence. The term "operably linked" as used herein refers to both expression control sequences that are contiguous with the gene of interest and expression control sequences that function in trans or at a distance to control the gene of interest.

Adeno-associated virus (AAV) viral vectors are AAV DNase resistant particles having a capsid of AAV proteins into which nucleic acid sequences are packaged for delivery to target cells. The AAV capsid is composed of 60 capsid (cap) protein subunits VP1, VP2, and VP3, arranged in icosahedral symmetry at a ratio of about 1:1:10 to 1:1:20 according to the AAV selected. The AAV capsid may be selected from those known in the art, including variants thereof. In one embodiment, the AAV capsid is selected from those effective to transduce neuronal cells. In one embodiment, the AAV capsid is selected from AAV1, AAV2, AAV7, AAV8, AAV9, aavrh.10, AAV5, aavhu.11, AAV8DJ, aavhu.32, aavhu.37, aavpi.2, aavrh.8, aavhu.48rr 3, and variants thereof. See Royo et al, Brain Res,2008, month 1, 1190: 15-22; petrosyan et al, Gene Therapy, 12 months 2014, 21(12): 991-1000; holehonnur et al, BMC Neuroscience,2014,15: 28; and Cearley et al, Mol ther.2008, 10.16 (10): 1710-. Other AAV capsids useful herein include aavrh.39, aavrh.20, aavrh.25, AAV10, aavbb.1, and AAV bb.2 and variants thereof. As a source of the capsid of the AAV viral vector (DNase resistant virion), other AAV serotypes may be selected, including for example AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh10, AAVrh64R1, AAVrh64R2, rh8, rh.10, variants of any known or mentioned AAV or yet to be discovered AAV. See, e.g., U.S. published patent application No. 2007-0036760-A1; U.S. published patent application No. 2009-0197338-a 1; EP 1310571. See also WO 2003/042397(AAV7 and other simian AAV), US 7790449 and US 7282199(AAV8), WO2005/033321 and US 7,906,111(AAV9), and WO 2006/110689 and WO 2003/042397 (rh.10). Alternatively, a recombinant AAV based on any of the AAV can be used as the source of the AAV capsid. These documents also describe other AAVs that may be selected for use in generating the AAV and are incorporated by reference herein. In some embodiments, the AAV cap for use in the viral vector can be produced by mutagenesis (i.e., by insertion, deletion, or substitution) of one of the AAV caps described above or a nucleic acid encoding therefor. In some embodiments, the AAV capsid is chimeric, comprising domains from two or three or four or more of the foregoing AAV capsid proteins. In some embodiments, the AAV capsid is a chimera of Vpl, Vp2, and Vp3 monomers from two or three different AAV or recombinant AAV. In some embodiments, the rAAV composition comprises more than one of the foregoing caps. As used herein, with respect to AAV, the term variant refers to any AAV sequence derived from a known AAV sequence, including those that share at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or more sequence identity in amino acid or nucleic acid sequence. In another embodiment, the AAV capsid comprises a variant comprising up to about 10% variation from any of the described or known AAV capsid sequences. That is, the AAV capsid shares from about 90% identity to about 99.9% identity, from about 95% to about 99% identity, or from about 97% to about 98% identity with an AAV capsid provided herein and/or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with the AAV capsid. This comparison can be made for any variable protein (e.g., vp1, vp2, or vp3) when determining the percent identity of the AAV capsid. In one embodiment, the AAV capsid shares at least 95% identity with AAV8 vp 3. In another embodiment, a self-complementary AAV is used.

In one embodiment, the capsid is an AAV9 capsid or a variant thereof.

In one embodiment, self-complementary AAV is provided. The abbreviation "sc" in this context refers to self-complementary forms. "self-complementary AAV" refers to a construct in which the coding region carried by a recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. Rather than waiting for cell-mediated synthesis of the second strand upon infection, the two complementary halves of the scAAV will associate to form a double stranded dna (dsdna) unit ready for immediate replication and transcription. See, for example, D M McCarty et al, "Self-complementary additional introduction of DNA synthesis (scAAV) vector promoter reaction introduction of DNA synthesis", Gene Therapy (8.2001), Vol.8, No. 16, p.1248 and 1254. Self-complementary AAV is described, for example, in U.S. patent nos. 6,596,535; 7,125,717 and 7,456,683, each of which is incorporated by reference herein in its entirety.

Methods of generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., U.S. published patent application No. 2007/0036760 (2/15/2007); us patent 7790449; us patent 7282199; WO 2003/042397; WO 2005/033321; WO 2006/110689 and US 7588772B 2. In one system, a producer cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct encoding rep and cap. In the second system, a packaging cell line stably providing rep and cap is transiently transfected with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpes virus, where isolation of rAAV from contaminating virus is required. Recently, systems have been developed which do not require infection with a helper virus to recover AAV and which also provide the required helper functions in trans (i.e. adenovirus E1, E2a, VA and E4 or herpes viruses UL5, UL8, UL52 and UL29 and herpes virus polymerase). In these newer systems, helper functions can be provided by transiently transfecting the cell with a construct encoding the desired helper function, or the cell can be engineered to stably contain the gene encoding the helper function, the expression of which can be controlled at the transcriptional or post-transcriptional level. In yet another system, the ITR-flanked transgene and the rep/cap gene are introduced into insect cells by infection with a baculovirus-based vector. For an overview of these production systems, see generally, for example, Zhang et al, 2009, "Adenoviral-assisted viral hybrid for large-scale viral receptor viral production," Human Gene Therapy 20: 922-. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941; 5,741,683, respectively; 6,057,152, respectively; 6,204,059, respectively; 6,268,213, respectively; 6,491,907, respectively; 6,660,514, respectively; 6,951,753, respectively; 7,094,604, respectively; 7,172,893, respectively; 7,201,898; 7,229,823, and 7,439,065.

Optionally, the hSMN1 genes described herein can be used to generate viral vectors other than rAAV. Such other viral vectors may include any virus suitable for the gene therapy that may be employed, including but not limited to adenovirus; herpes virus; a lentivirus; retroviruses, and the like. Suitably, when one of these other vectors is produced, it is produced as a replication-defective viral vector.

"replication-defective virus" or "viral vector" refers to a synthetic or artificial virion in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, wherein any viral genomic sequence also packaged in the viral capsid or envelope is replication-defective; i.e., they are unable to produce progeny virions, but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding enzymes required for replication (the genome may be engineered "without content" -containing only the relevant transgenes flanking the signals required for amplification and packaging of the artificial genome), but these genes may be provided during production. Thus, it is considered safe for use in gene therapy because replication and infection with progeny virions does not occur except in the presence of the viral enzymes required for replication. Such replication-defective viruses may be adeno-associated virus (AAV), adenovirus, lentivirus (integrated or non-integrated), or another suitable viral source.

Also provided herein are pharmaceutical compositions. The pharmaceutical compositions described herein are designed to be delivered to a subject in need thereof by any suitable route or combination of different routes. In one embodiment, direct delivery to the CNS is desired and can be via intrathecal injection. The term "intrathecal administration" refers to targeted delivery of cerebrospinal fluid (CSF). This may be accomplished by direct injection into the ventricle or lumbar CSF, by sub-occipital puncture, or by other suitable methods. Meyer et al, Molecular Therapy (10 months 31 years 2014) demonstrated the efficacy of direct CSF injection, which results in broad transgene expression throughout the spinal cord in mice and non-human primates when using 10-fold lower doses compared to IV administration. This document is incorporated herein by reference. In one embodiment, the composition is delivered via intraventricular viral injection (see, e.g., Kim et al, J Vis exp.2014, 9, 15, (91):51863, which is incorporated herein by reference). See also passsini et al, Hum Gene ther, 2014, month 7; 25(7) 619-30, which is incorporated herein by reference. In another embodiment, the composition is delivered via lumbar injection.

Typically, these delivery methods are designed to avoid direct systemic delivery of suspensions containing AAV compositions described herein. Suitably, this may have the benefit of reduced dose, reduced toxicity and/or reduced undesirable immune responses to AAV and/or transgene product compared to systemic administration.

Alternatively, other routes of administration may be selected (e.g., oral, inhalation, intranasal, intratracheal, intraarterial, intraocular, intravenous, intramuscular, and other parenteral (parent) routes).

The hSMN1 delivery constructs described herein can be delivered in a single composition or in multiple compositions. Optionally, two or more different AAVs can be delivered [ see, e.g., WO 2011/126808 and WO 2013/049493 ]. In another embodiment, such multiple viruses may contain different replication-defective viruses (e.g., AAV, adenovirus, and/or lentivirus). Alternatively, delivery can be mediated by non-viral constructs, such as "naked DNA," "naked plasmid DNA," RNA, and mRNA; in combination with various delivery compositions and nanoparticles, including, for example, micelles, liposomes, cationic lipid-nucleic acid compositions, poly-glycan (poly-glycan) compositions and other polymers, lipid-based and/or cholesterol-nucleic acid conjugates, and other constructs as described herein. See, e.g., x.su et al, mol. pharmaceuticals, 2011,8(3), pages 774-; network publishing, 3 months and 21 days in 2011; WO2013/182683, WO 2010/053572 and WO 2012/170930, all incorporated herein by reference, and such a non-viral hSMN1 delivery construct may be administered by the aforementioned routes.

The viral vector, or non-viral DNA or RNA transfer moieties, may be formulated with physiologically acceptable vectors for gene transfer and gene therapy applications. A variety of suitable purification methods may be selected. Examples of Purification methods suitable for isolating empty capsids from carrier particles are described, for example, international patent application No. PCT/US16/65976 and its priority documents, filed 2016, 12, 9, 2016, methods described in U.S. patent application No. 62/322,098, filed 2016, 4, 13, 2016, and U.S. patent application No. 62/266,341, entitled "Scalable Purification Method for AAV8," which are filed 2016, 12, 11, and which are incorporated herein by reference. See also purification methods described in the following documents: international patent application No. PCT/US16/65974 filed on 9/2016, and priority documents thereof, U.S. patent application No. 62/322,083 filed on 13/4/2016, and 62/266,351(AAV1) filed on 11/12/2015; international patent application No. PCT/US16/66013 filed on 9/12/2016, and priority documents thereof, united states provisional application No. 62/322,055 filed on 13/4/2016, and 62/266,347 filed on 11/12/2015 (AAVrh 10); and international patent application No. PCT/US16/65970 filed on 9.12.2016, and priority application US provisional application nos. 62/266,357 and 62/266,357(AAV9), which are incorporated herein by reference. Briefly, a two-step purification scheme is described that selectively captures and isolates genome-containing rAAV vector particles from a clarified concentrated supernatant of a rAAV producing cell culture. The method utilizes an affinity capture process performed at high salt concentrations followed by an anion exchange resin process performed at high pH to provide rAAV vector particles substantially free of rAAV intermediates.

In the case of AAV viral vectors, quantification of the viral genome (vg) can be used as a measure of the dose contained in the formulation. The dosage of rAAV administered in the methods disclosed herein will vary depending on, for example, the particular rAAV, the mode of administration, the therapeutic target, the individual, and the cell type targeted, and can be determined by methods standard in the art. The dose can be expressed in units of viral genome (vg) (i.e., 1X 10, respectively)⁷vg、1×10⁸vg、1×10⁹vg、1×10¹⁰vg、1×10¹¹vg、1×10¹²vg、1×10¹³vg、1×l0¹⁴vg、1×10¹⁵vg). The dose can also be expressed in units of viral genome (vg) per kilogram (kg) of body weight (i.e., 1 × 10, respectively)¹⁰vg/kg、1×10¹¹vg/kg、1×10¹²vg/kg、1×10¹³vg/kg、1×10¹⁴vg/kg、1×10¹⁵vg/kg). Methods for titration of AAV are described in Clark et al, "human gene therapy (hum. genether.) 1999; 10:1031-1039.

These above doses may be administered in various volumes of the vector, excipient or buffer formulation, ranging from about 25 to about 1000 microliters, including all numbers within this range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μ L. In one embodiment, the volume is about 50 μ L. In another embodiment, the volume is about 75 μ L. In another embodiment, the volume is about 100 μ L. In another embodiment, the volume is about 125 μ L. In another embodiment, the volume is about 150 μ L. In another embodiment, the volume is about 175 μ L. In yet another embodiment, the volume is about 200 μ L. In another embodiment, the volume is about 225 μ L. In yet another embodiment, the volume is about 250 μ L. In yet another embodiment, the volume is about 275 μ L. In yet another embodiment, the volume is about 300 μ L. In yet another embodiment, the volume is about 325 μ L. In another embodiment, the volume is about 350 μ L. In another embodiment, the volume is about 375 μ L. In another embodiment, the volume is about 400 μ L. In another embodiment, the volume is about 450 μ L. In another embodiment, the volume is about 500. mu.L. In another embodiment, the volume is about 550 μ L. In another embodiment, the volume is about 600 μ L. In another embodiment, the volume is about 650 μ L. In another embodiment, the volume is about 700 μ L. In another embodiment, the volume is between about 700 and 1000 μ L.

In other embodiments, volumes of about 1 μ L to 150mL may be selected, with higher volumes being selected for adults. Typically, a suitable volume is about 0.5mL to about 10mL for newborn infants, and about 0.5mL to about 15mL may be selected for older infants. For toddlers, a volume of about 0.5mL to about 20mL may be selected. For children, volumes up to about 30mL may be selected. For pre-pubertal and adolescent children, volumes up to about 50mL may be selected. In yet another embodiment, the patient may receive intrathecal administration, selecting a volume of from about 5mL to about 15mL, or from about 7.5mL to about 10 mL. Other suitable volumes and dosages may be determined. The dosage will be adjusted to balance the therapeutic benefit with any side effects, and such dosage may vary depending on the therapeutic application in which the recombinant vector is used.

The above recombinant vectors can be delivered to host cells according to the disclosed methods. The rAAV, preferably suspended in a physiologically compatible carrier, can be administered to a human or non-human mammalian patient. In another embodiment, the composition comprises a carrier, diluent, excipient and/or adjuvant. Suitable vectors can be readily selected by those skilled in the art in view of the indication against which the transfer virus is directed. For example, suitable carriers include saline, which may be formulated with a variety of buffer solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The buffer/vector should include components that prevent rAAV attachment to the infusion tube but do not interfere with rAAV binding activity in vivo.

Optionally, the compositions of the invention may contain, in addition to the rAAV and the carrier, other conventional pharmaceutical ingredients, such as preservatives or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

The compositions of the invention may comprise a pharmaceutically acceptable carrier as defined above. Suitably, the compositions described herein comprise an effective amount of one or more AAV designed for delivery to a subject via injection, osmotic pump, intrathecal catheter, or by another device or route, suspended in a pharmaceutically suitable carrier and/or mixed with a suitable excipient. In one example, the composition is formulated for intrathecal delivery. In one embodiment, the intrathecal injection comprises injection into the spinal canal, e.g., the subarachnoid space.

The viral vectors described herein can be used to prepare a medicament for delivering hSMN1 to a subject (e.g., a human patient) in need thereof, providing functional SMN to a subject, and/or treating spinal muscular atrophy. The course of treatment may optionally include repeated administration of the same viral vector (e.g., AAV9 vector) or a different viral vector (e.g., AAV9 and AAV 10). Still other combinations can be selected using the viral vectors and non-viral delivery systems described herein.

The hSMN1 cDNA sequences described herein can be synthesized in vivo using techniques well known in the artTo produce. For example, PCR-based precision synthesis (PAS) using the long DNA sequence method can be used, as described by Xiong et al, PCR-based synthesis of Long DNA sequences, Nature Protocols 1, 791-. Methods combining the double asymmetric PCR and overlap extension PCR methods are described by Young and Dong, Two-step total gene synthesis method, Nucleic Acids Res.2004; 32(7) e 59. See also Gordeeva et al, J Microbiol methods, improved PCR-based gene synthesis method and ligation to the citronbacter free gene coding modification, 5 months 2010; 81(2) 147-52.Epub, 3/10/2010; see also the following patents on oligonucleotide synthesis and Gene synthesis, Gene seq.2012, month 4; 10 to 21 parts by weight of (6); US 8008005 and US 7985565. Each of these documents is incorporated herein by reference. In addition, kits and protocols for generating DNA via PCR are commercially available. These include the use of polymerases, including but not limited to Taq polymerase;(New England Biolabs)；High-Fidelity DNA polymerase (New England Biolabs); andg2 polymerase (Promega). DNA can also be produced by cells transfected with plasmids containing hSMN sequences described herein. Kits and protocols are known and commercially available and include, but are not limited to, the QIAGEN plasmid kit;pro Filter plasmid kit (Invitrogen); andplasmid kit (Sigma Aldrich). Other techniques that may be used herein include sequence-specific isothermal amplification methods, which eliminate the need for thermal cycling. These methods generally employ strand displacement DNA polymerases such as Bst DNA polymerizationDuplex DNA was isolated using enzyme, Large Fragment (Large Fragment) (New England Biolabs) instead of heating. DNA can also be generated from RNA molecules by amplification via the use of Reverse Transcriptase (RT), which is an RNA-dependent DNA polymerase. RT polymerizes a DNA strand complementary to the original RNA template and is called cDNA. This cDNA can then be further amplified by PCR or by isothermal methods as described above. Custom DNA may also be generated commercially by companies including, but not limited to, GenScript; (Life Technologies) and Integrated DNAtechnologies.

The term "expression" is used herein in its broadest sense and includes the production of RNA or RNA and protein. In the case of RNA, the terms "expression" or "translation" relate in particular to the production of peptides or proteins. Expression may be transient, or may be stable.

The term "translation" in the context of the present invention relates to a process at the ribosome where the mRNA chain controls the assembly of amino acid sequences to produce a protein or peptide.

In accordance with the present invention, a "therapeutically effective amount" of hSMN1 is delivered as described herein to achieve the desired result, i.e., to treat SMA or one or more symptoms thereof. As described herein, desirable results include reducing muscle weakness, increasing muscle strength and tone (tone), preventing or reducing scoliosis, or maintaining or improving respiratory health, or reducing tremors or twitches. Other desired endpoints may be determined by the physician.

In some cases, SMA is detected in the fetus at about 30 to 36 weeks of gestation. In such cases, it may be desirable to treat the neonate as soon as possible after delivery. It may also be desirable to treat the fetus in utero. Thus, a method of rescuing and/or treating a neonatal subject having SMA is provided, comprising the step of delivering the hsmm 1 gene to neuronal cells of the neonatal subject (e.g. a human patient). Methods of rescuing and/or treating a fetus with SMA are provided, comprising the step of delivering the hsmm 1 gene to neuronal cells of the fetus in utero. In one embodiment, the gene is delivered via intrathecal injection in the compositions described herein. The methods may utilize any nucleic acid sequence encoding a functional hSMN protein, whether codon-optimized hSMN1 or native hSMN1 as described herein, or an hSMN1 allele having enhanced activity compared to a "wild-type" protein, or a combination thereof. In one embodiment, treatment in utero is defined as administration of the hSMN1 construct as described herein after detection of SMA in the fetus. See, e.g., David et al, Recombinant adheno-assisted virus-mediated in Gene transfer viral transfer expression the sheet, Hum Gene ther, 4 months 2011; 22(4) 419-26.doi:10.1089/hum.2010.007.epub 2011, 2/month 2, which is incorporated herein by reference.

In one embodiment, neonatal treatment is defined as administration of the hSMN1 construct described herein within 8 hours, the first 12 hours, the first 24 hours, or the first 48 hours of delivery. In another embodiment, particularly for primates (human or non-human), the neonatal delivery is within a period of about 12 hours to about 1 week, 2 weeks, 3 weeks, or about 1 month, or after about 24 hours to about 48 hours.

In another embodiment, for delayed SMA, the composition is delivered after the onset of symptoms. In one embodiment, treatment (e.g., first injection) of the patient is initiated prior to the first year of life. In another embodiment, treatment is initiated after the first year, or after 2 to 3 years of age, after 5 years of age, after 11 years of age, or after a older age.

In another embodiment, the construct is reapplied at a later time. Optionally, more than one reapplication is allowed. Such re-administration may be of the same type of vector, a different viral vector, or via non-viral delivery as described herein. For example, if a patient is treated with a rAAV9 encoding SMN and requires a second treatment, rAAV10 may be administered subsequently, and vice versa.

Treatment of SMA patients may require combination therapy, such as transient co-treatment with an immunosuppressant before, during and/or after treatment with a composition of the invention. Immunosuppressive agents used in such co-therapies include, but are not limited to, steroids, antimetabolites, T cell inhibitors, and alkylating agents. For example, such transient treatments may include taking steroids (e.g., prednisone) in decreasing doses once daily for 7 days, starting at an amount of about 60 milligrams, and decreasing by 10 milligrams daily (no dose on day 7). Other dosages and immunosuppressive agents may be selected.

"functional hSMN 1" refers to a gene encoding a native SMN protein, such as the gene shown in SEQ ID NO. 8, or another SMN protein that provides a level of biological activity of at least about 50%, at least about 75%, at least about 80%, at least about 90% or about the same, or more than 100% of the native survival of a motor neuron protein, or a native variant or polymorph thereof that is not associated with a disease. In addition, the SMN1 homologous chromosome, SMN2, also encodes this SMN protein, but less efficiently handles functional proteins. Based on the copy number of SMN2, subjects lacking a functional hSMN1 gene showed varying degrees of SMA. Thus, for some subjects, it may be desirable for the SMN protein to provide less than 100% of the biological activity of the native SMN protein.

In one embodiment, such functional SMNs have a sequence that is about 95% or greater identity to the native protein or to the full-length sequence of the protein encoded by the gene set forth in SEQ ID No. 8, or about 97% or greater, or about 99% or greater identity at the amino acid level to the protein encoded by the gene set forth in SEQ ID No. 8. Such functional SMN proteins may also include native polymorphs. The identity can be determined by preparing an alignment of sequences and by using a variety of algorithms and/or computer programs known in the art or commercially available [ e.g., BLAST, ExPASy; ClustalO; FASTA; using, for example, the Needleman-Wunsch algorithm, the Smith-Waterman algorithm ].

There are a variety of assays for measuring SMN expression and activity levels in vitro. See, e.g., Tanguy et al, 2015, cited above. The methods described herein may also be combined with any other therapy for treating SMA or symptoms thereof. See also Wang et al, Consensuss State for Standard of Care in mineral muscle Atcopy (which provides a discussion of the current Standard of Care for SMA) and http:// www.ncbi.nlm.nih.gov/books/NBK 1352/. For example, when nutrition is a concern in SMA, placement of a gastrostomy tube is appropriate. Tracheotomy or non-invasive respiratory support is provided as respiratory function deteriorates. Sleep disordered breathing may be treated by using continuous positive airway pressure during the night. If the forced vital capacity is more than 30% -40%, scoliosis operation of individuals suffering from SMA II and SMA III can be safely performed. Powered chairs and other devices may improve the quality of life. See also U.S. patent No. 8211631, which is incorporated herein by reference.

It is noted that the terms "a" or "an" refer to one or more than one. Thus, the terms "a" (or "an"), "one or more" and "at least one" are used interchangeably herein.

The words comprises, comprising and comprising should be interpreted as being inclusive and not exclusive. The words "consisting of" and variations thereof are to be construed as exclusive and not inclusive. Although various embodiments in the specification are presented using the language "comprising," in other instances related embodiments are also intended to be interpreted and described using the language "consisting of … …" or "consisting essentially of … ….

The term "about" as used herein means 10% (± 10%) different from the given reference unless otherwise specified.

As used herein, "disease," "disorder," and "condition" are used interchangeably to indicate an abnormal state in a subject.

Unless otherwise defined in this specification, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art and by reference to the disclosure, which provides those skilled in the art with a general guidance to many of the terms used in this application.

Detailed description of the preferred embodiments

In one aspect, the invention provides a recombinant nucleic acid molecule comprising, in operable linkage, a promoter, a hybrid intron, and a nucleic acid sequence encoding a functional survival motor neuron.

Preferably, the promoter is a CAG promoter comprising a cytomegalovirus early enhancer element and a chicken β -actin promoter; the sequence of the hybrid intron is shown in SEQ ID NO 3.

Preferably, the cytomegalovirus early enhancer element has a polynucleotide sequence selected from the group consisting of:

1) 1, or a polynucleotide sequence shown in SEQ ID NO;

2) 1, a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 1, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity;

preferably, the chicken β -actin promoter has a polynucleotide sequence selected from the group consisting of:

1) 2, or a polynucleotide sequence shown in SEQ ID NO;

2) 2, a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 2, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity.

Preferably, the nucleic acid sequence encoding functional motor neuron survivin has a polynucleotide sequence selected from the group consisting of:

1) a polynucleotide sequence shown as SEQ ID NO. 6 or SEQ ID NO. 8;

2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO. 6 or SEQ ID NO. 8; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 6 or SEQ ID NO. 8, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity;

more preferably, the polynucleotide sequence is a codon optimized sequence.

Preferably, the recombinant nucleic acid molecule further comprises one or more of a polyadenylation acid, Kozak sequence, WPRE, and post-transcriptional regulatory elements; wherein the polyadenylic acid has a polynucleotide sequence selected from the group consisting of:

1) the polynucleotide sequence shown in SEQ ID NO. 7;

2) the nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO. 7; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 7, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity.

Preferably, the recombinant nucleic acid molecule comprises the polynucleotide sequence shown in SEQ ID NO. 4; preferably, the recombinant nucleic acid molecule has a polynucleotide sequence selected from the group consisting of:

1) a polynucleotide sequence shown as SEQ ID NO. 9 or SEQ ID NO. 10;

2) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides in the polynucleotide sequence shown in SEQ ID NO. 9 or SEQ ID NO. 10; or

3) A polynucleotide sequence having more than 80% sequence identity to SEQ ID NO. 9 or SEQ ID NO. 10, preferably a sequence having more than 85%, 90%, 95%, 96%, 97%, 98%, 99% identity; more preferably, sequences with 98% or 99% or more identity.

Preferably, the recombinant nucleic acid molecule further comprises an AAV inverted terminal repeat sequence; preferably, the AAV inverted terminal repeats are selected from AAV of different serotypes; preferably, the AAV inverted terminal repeat is selected from any one of AAV or AAV1 type, AAV2 type, AAV3 type, AAV4 type, AAV5 type, AAV6 type, AAV7 type, AAV8 type, AAV9 type, or hybrid/chimeric types thereof of any serotype in clades a-F; more preferably, the AAV inverted terminal repeat is from AAV2 type.

In one aspect, the present invention provides a recombinant vector comprising the aforementioned recombinant nucleic acid molecule, wherein said vector is selected from the group consisting of a plasmid vector, a phage vector and a viral vector, wherein the viral vector is selected from the group consisting of an adeno-associated viral vector, an adenoviral vector, a lentiviral vector and a hybrid viral vector.

In one aspect, the invention provides a recombinant adeno-associated virus, wherein the recombinant adeno-associated virus comprises an AAV capsid and a vector genome comprising an AAV inverted terminal repeat, a nucleic acid sequence encoding a motor neuron survivin, and expression control sequences that direct expression of SMN in a host cell; preferably, the capsid of the recombinant adeno-associated virus is preferably AAV9, more preferably the recombinant adeno-associated virus is a self-complementary adeno-associated virus.

In one aspect, the invention provides an isolated host cell comprising the aforementioned recombinant nucleic acid molecule, recombinant vector or recombinant adeno-associated virus.

In one aspect, the present invention provides a pharmaceutical composition comprising the aforementioned recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus and/or host cell, and a pharmaceutically acceptable excipient; preferably, it is formulated for intravenous administration.

In one aspect, the present invention provides the use of the aforementioned recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and/or pharmaceutical composition for the preparation of a medicament for the prevention or treatment of spinal muscular atrophy.

The use according to the previous aspect, wherein the recombinant nucleic acid molecule, recombinant vector, recombinant adeno-associated virus, host cell and/or pharmaceutical composition can be administered in combination with another therapy.

Use according to the previous aspect, wherein the recombinant nucleic acid molecule, the recombinant vector, the recombinant adeno-associated geneThe virus, host cell and/or pharmaceutical composition may be at about 1X 10¹⁰vg/kg to about 1X 10¹⁶A dose of vg/kg; preferably, the recombinant adeno-associated virus can be at about 5 × 10¹³A dose of vg/kg; preferably, the recombinant adeno-associated virus or composition can be present at about 2.5 × 10¹²A dose of vg/kg; preferably, the vector or composition may be administered more than once.

In one aspect, the invention provides a method of treating spinal muscular atrophy in a subject, the method comprising administering to a subject in need thereof a recombinant nucleic acid molecule, a recombinant vector, a recombinant adeno-associated virus, a host cell, and/or a pharmaceutical composition as described above. Preferably, the composition is administered intrathecally; preferably, the subject is a mammal; more preferably, the subject is a human.

The following examples are illustrative only and are not intended to limit the present invention.

Example 1 plasmid construction

The shuttle plasmid pSC-CMV of the double-stranded AAV virus was used as a backbone for plasmid construction, and the plasmid map thereof is shown in FIG. 1. A fragment containing a promoter, an intron, a cDNA of a target gene, and a poly A of bovine growth hormone (bGH) is inserted between Inverted Terminal Repeats (ITRs) at both ends. The promoters of the insert are two, one is CAG promoter, and the other is tissue-specific promoter 3 xNRSE-PGK. For example, the EGFP gene of interest is inserted, and the main structure of the insert is shown in FIG. 2.

1.1 design and construction of plasmids L-S1, L-G1 and L-orS1

Designing a gene fragment comprising a CAG promoter and a hybrid intron (hybrid intron), wherein the CAG promoter consists of a cytomegalovirus early enhancer element (CMVE) and a chicken beta-actin (CBA) promoter, the CMVE element and the hybrid intron sequence being from the pSpCas9(BB) -2A-GFP (PX458) plasmid, respectively; the CBA sequence is derived from the promoter region (249-526bp) of the pSNAV2.0-CAG-EGFP plasmid (the map is shown in figure 3). Wherein, the polynucleotide sequence of cytomegalovirus early enhancer element (hereinafter abbreviated as CMVE) is shown as SEQ ID NO 1; the polynucleotide sequence of chicken beta-actin promoter (CBA promoter) is shown in SEQ ID NO. 2; the polynucleotide sequence of the hybrid intron (hybrid intron) is shown in SEQ ID NO 3.

A gene fragment comprising a CAG promoter-hybrid intron region (the polynucleotide sequence of which is shown in SEQ ID NO: 4), a gene encoding green fluorescent protein GFP (the polynucleotide sequence of which is shown in SEQ ID NO: 5) or an SMN gene (the polynucleotide sequence of which is shown in SEQ ID NO: 6) with an optimized coding region and a poly A region of bovine growth hormone (bGH) gene (the polynucleotide sequence of which is shown in SEQ ID NO: 7) which are sequentially linked was synthesized, and an AvaI cleavage site and a HindIII cleavage site were added to the 5 'end and the 3' end of the gene fragment. The gene fragment is cloned to a plasmid pSC-CMV by utilizing the two enzyme cleavage sites, and the constructed plasmids are respectively named as L-S1 (SMN gene with optimized coding region) and L-G1 (green fluorescent protein GFP gene); then, the directly synthesized human SMN cDNA sequence (Genebank NM-000344.3) containing BamHI cleavage site at 5 'end and HindIII cleavage site at 3' end was cloned to the L-S1 plasmid by double digestion, the optimized SMN gene was replaced by wild-type SMN gene (the polynucleotide sequence of which is shown in SEQ ID NO: 8), and the recombinant plasmid was named L-orS 1. Wherein, the polynucleotide sequence contained in the plasmid L-orS1 is shown in SEQ ID NO. 9; the polynucleotide sequence contained in the plasmid L-S1 is shown in SEQ ID NO 10; the polynucleotide sequence of plasmid L-G1 is shown in SEQ ID NO. 11.

1.2 design and construction of plasmids L-S2 and L-G2

Designing a gene fragment comprising a 3 xNRSE-CMVE-PGK-hybrid intron, wherein, 3 xNRE is a repetitive sequence of 3 nerve-restricted silencing elements (NRSE) of a rat non-productive neural-restrictive gene (scg-10) gene (Genebank M90489.1, 629 to 649bp) (the polynucleotide sequence of M90489.1 is shown in SEQ ID NO: 12), CMVE is a cytomegalovirus early enhancer element, PGK is a core promoter of phosphoglycerate kinase (PGK) (the polynucleotide sequence of which is shown in SEQ ID NO: 13), CMVE element (the polynucleotide sequence of which is shown in SEQ ID NO: 1) and a hybrid intron sequence (the polynucleotide sequence of which is shown in SEQ ID NO: 3) are from pSpCas9(BB) -2A-GFP (458), and the PGK sequence is derived from a mouse phosphoglycerate kinase 1 gene (Genebank M18735, 1025bp 834).

Synthesizing a gene segment which comprises a 3 xNRSE-CMVE-PGK-heterozygous intron region, a green fluorescent protein GFP gene or SMN gene with optimized coding region and a polyA region of bGH which are sequentially connected, and adding an AvaI enzyme cutting site at the 5 'end and a HindIII enzyme cutting site at the 3' end of the gene segment. The gene fragment was cloned into the plasmid pSC-CMV by using these two enzyme cleavage sites, and the constructed plasmids were designated L-S2 (SMN gene with optimized coding region) and L-G2 (green fluorescent protein GFP gene), respectively.

1.3 construction of plasmids L-S3 and L-G3

Kpn I/Xho I cleavage sites were introduced into the multiple cloning sites of L-G1 and L-S1 plasmids by PCR, the intron of the CAG promoter-Chicken beta actin (CAG intron) was excised and recovered by Kpn I/Xho I double cleavage of the plasmid pSNAV2.0-CAG-EGFP (the polynucleotide sequence of which is shown in SEQ ID NO: 14), and cloned into the same double cleaved L-G1 and L-S1 plasmids, respectively, to replace the CAG promoter-hybrid intron region (the polynucleotide sequence of which is shown in SEQ ID NO: 4) in the plasmid, and the resulting recombinant plasmids were called L-S3 and L-G3, respectively.

1.4 design and construction of plasmids L-S4, L-orS4 and L-G4

Designing a gene segment of a CAG promoter-SV 40mini intron, wherein CMVE is a cytomegalovirus early enhancer element (the polynucleotide sequence of which is shown in SEQ ID NO: 1) and comes from a pSpCas9(BB) -2A-GFP (PX458) plasmid; the CBA sequence is derived from the promoter region (249-526bp) of the pSNAV2.0-CAG-EGFP plasmid, and the polynucleotide sequence is shown as SEQ ID NO. 2; the SV40mini intron is derived from the Simian virus 40strain 777 genome (Genebank SEQ ID NO: 332562.1, 430 to 489 and 1338 to 1425, and the polynucleotide sequence of AF332562.1 is shown in SEQ ID NO: 15.

A fragment of an intron region of the CAG promoter SV40mini is synthesized, and Xho I and BamH I enzyme cutting sites are respectively introduced into the 5 'end and the 3' end of the fragment. The CAG promoter-SV 40mini intron region was cloned into plasmid L-S1 using these two enzymatic cleavage sites to replace the CAG promoter-hybrid intron region in this plasmid (the polynucleotide sequence of which is shown in SEQ ID NO: 4), and the recombinant plasmid was designated L-S4. The synthesized wild-type SMN cDNA gene (the polynucleotide sequence of which is shown in SEQ ID NO: 8) is cloned to a plasmid L-S4 through the 5 'BamH I enzyme cutting site and the 3' EcoRV enzyme cutting site, and a recombinant plasmid named L-orS4 is constructed. Similarly, the green fluorescent protein GFP gene (the polynucleotide sequence of which is shown in SEQ ID NO: 5) was cloned into plasmid L-S4 using the restriction sites BamH I and Hind III to replace the SMN gene, and the constructed recombinant plasmid was named L-G4.

1.5 design and construction of plasmids L-S5 and L-G5

A gene fragment of CAG promoter-CAG intron 1+2+ exon 1 is designed, wherein the CAG intron 1+2+ exon 1 sequence is derived from a balloon cytoplasmic beta-action gene (Genebank X00182,634-1596bp, polynucleotide sequence of X00182 is shown in SEQ ID NO: 16).

Synthesizing a gene fragment of CAG promoter-CAG intron 1+2+ exon 1, and respectively introducing Xho I and BamH I enzyme cutting sites at the 5 'end and the 3' end of the gene fragment. The synthetic fragment was cloned into plasmid L-S1 using restriction sites Xho I and BamH I in place of the CAG promoter-hybrid intron gene fragment, and the constructed recombinant plasmid was designated L-S5. Similarly, the GFP gene (the polynucleotide sequence of which is shown in SEQ ID NO: 5) was cloned into the plasmid L-S5 by using BamH I and Hind III double digestion, and the constructed recombinant plasmid was named L-G5.

1.6 construction of L-S7, L-G7 and L-orS7

Xho I and BamH I cleavage sites were introduced into primers, a CAG promoter gene fragment (the polynucleotide sequence of which is shown in SEQ ID NO:17, which was cloned into plasmid L-S1 by Xho I and BamH I double cleavage to replace the CAG promoter-hybrid intron gene fragment, the constructed recombinant plasmid was named L-S7. similarly, the CAG promoter gene fragment was cloned into plasmid L-G1 to replace the CAG promoter-hybrid intron gene fragment, the constructed recombinant plasmid was named L-G7. as the recombinant plasmid L-S orS1 by cleavage sites BamH I and EcoR V double cleavage, the wild type SMN gene (the polynucleotide sequence of which is shown in SEQ ID NO: 8) was cloned into the plasmid L-S7, and the constructed recombinant plasmid was named L-orS 7.

Example 2 viral packaging and genome Titer detection

This example used HEK293 cells (purchased from ATCC under the accession number CRL-1573) as the producer cell line for the production of recombinant AAV viral vectors using a conventional three plasmid packaging system. The experimental procedures used are conventional in the art (see Xiao Xiao Xiao Xiao, Juan Li, and Richard Jude Samulski. production of high-titer conjugated viruses vectors in the absence of the human adenovirus J. Virol.1998,72(3): 2224).

Taking a proper amount of purified AAV samples, preparing DNase I digestion reaction mixed liquor according to the following table (Table 1), incubating for 30min at 37 ℃, incubating for 10min at 75 ℃, and inactivating DNase I.

TABLE 1

After the treated purified AAV sample was diluted by an appropriate factor, the Q-PCR reaction system was prepared according to the following table (Table 2), and the detection was carried out according to the following procedure.

TABLE 2

The primers used therein are shown in the following table (table 3):

TABLE 3

Forward primer (5 '-3')	GTCAATGACGGTAAATGG
		Reverse primer (5 '-3')	GTAATAGCGATGACTAATACG

Packaging yield results are seen in the following table (table 4):

TABLE 4

Example 3 selection of drug candidates

3.1 selection and infection efficiency of promoters

In order to confirm which promoter of the CAG promoter and the tissue-specific promoter 3xNRSE-PGK is suitable for the expression of the target gene, L-G1 and L-G2 are respectively expressed in 293 cells, the expression of GFP is observed after 24 hours, and the expression efficiency of GFP in an L-G1 sample is obviously higher than that of L-G2, as shown in FIG. 4A, which indicates that the CAG promoter has higher capability of driving the expression of the target gene than that of the 3xNRSE-PGK promoter.

Since the expression of 3xNRSE expression elements in neuronal cells was selective, L-G1 and L-G2 were expressed in PC12 cells, respectively, in order to verify the expression specificity of 3xNRSE-PGK in the present invention, and after 24 hours, the ratio of GFP expressing cells of L-G1 was 35% and that of GFP expressing cells of L-G2 was 24% in the cells of both expression samples, as shown in FIG. 4B, whereby no significant difference was observed in the ratio of GFP.

The scAAV2/9-L-G1 and the scAAV2/9-L-G2 are packaged into viruses, the two viruses respectively infect PC12 cells with the same MOI, and the expression of GFP is detected, as shown in FIG. 4C, the infection efficiency of the L-G1 virus is obviously higher than that of the L-G2, and the infection capacity of the L-G2 is very low. This result suggests that the efficiency of infection of cells by scAAV2/9-L-G1 is higher for the same total amount of virus. Based on the selection of the expression intensity and expression specificity, CAG promoters are preferred promoters.

3.2. Selection of different Intron elements and SMN encoding genes and their Effect on Activity

In order to express the target gene SMN more optimally, different intron elements and different target genes SMN are selected, wherein the target genes SMN are selected as follows: (1) a sequence of the codon optimized SMN gene, designated L-S1; and (2) the original sequence of the wild-type SMN gene, designated L-orS 1.

The following 5 groups of recombinant plasmids were prepared as shown in example 2: (1) L-S1, L-orS1 and L-G1; (2) L-S3 and L-G3; (3) L-S4, L-orS4 and L-G4; (4) L-S5 and L-G5; and (5) L-S7, L-orS7, and L-G7. The structure of the recombinant plasmids for the 5 different mini intron elements is shown in FIG. 5.

These recombinant plasmids were transfected into 293 cells and PC12 cells, respectively, and the effect of these different molecular structures on the expression of SMN molecules was examined. These recombinant plasmids were transfected into 293 cells and fibroblasts, respectively, and the effect of these different molecular structures on their proliferative biological activity was examined. And finally determining the structure of the medicine to be selected according to the detection result.

The plasmids in the above groups were transfected into 293 cells and PC12 cells, respectively, and 48 hours after transfection, cDNA was extracted, RNA expression levels were measured, and as shown in FIGS. 6A and 6B (FIG. 6A represents PC12 cells, and FIG. 6B represents 293 cells), SMN was expressed, but all of the SMN molecules expressed in the L-orS sample were free of isomers, while the SMN target molecule expressed in the L-S1 sample contained two fragments, 37KD and 20KD, which are one band higher than the predicted 37KD, presumably are isomers of SMN molecules, and the L-orS1 sample expressed SMN at a slightly higher level.

The above groups of plasmids were transfected into 293 cells, respectively, and their effects on the proliferation activity of 293 cells were examined. As can be seen from FIG. 7A, the recombinant plasmids containing the expression cassette of the hybrid intron (L-S1 and L-orS1) had a significantly higher effect on the proliferation activity of 293 cells than the other recombinant plasmids containing the expression cassettes of different introns (L-S3, L-S4, L-orS4, L-S5) and the recombinant plasmids containing no expression cassette of the intron (L-S7, L-orS 7).

This conclusion was also verified in the infection of primary fibroblasts after packaging the recombinant plasmids containing the different intron expression cassettes described above (L-orS1, L-orS4, L-orS7) into recombinant viruses, as shown in FIG. 7B.

Through the above studies, recombinant viruses L-S1 and L-orS1 were initially selected as drug candidates.

Example 4 measurement of SMN molecule expression level and transcriptional Activity

To determine expression of the candidate gene drug, SMN expression is measured from RNA and protein levels by a stable in vitro assay method comprising infecting the candidate drug in patient fibroblasts with low endogenous SMN Δ 7 expression; the transcriptional activity was examined by the gem body formation assay.

4.1 expression of potent SMN molecules for drug candidate potentiation at the RNA level

Extracting total RNA of cells, carrying out reverse transcription to obtain cDNA, and carrying out Real-time PCR reaction. Wherein each pair of primers is provided with 3 compound wells, the internal reference is GAPDH, each reaction system is 20 mu L, cDNA is 10 ng/reaction, Primer-F (S-full-F/S-7-F) is 0.4 mu L, Primer-R is 0.4 mu L, and Probe is 0.3 mu L; the primer sequences are specifically shown in the following table (table 5):

TABLE 5

Observing PCR product by electrophoresis imaging, and using 2 as data after PCR reaction^-△△CTRelative expression values were calculated and statistically analyzed by SPSS 13.0.

The effects of a normal cell control group, an L-G1 (containing GFP) virus-infected group, an L-S1 (containing an optimized SMN1 gene) virus-infected group, and an L-orS1 (containing an SMN1 gene) virus-infected group on fibroblasts were investigated. The action mechanism of the candidate drug is to supplement the expression of SMN in the cells of the patient lacking SMN, and in order to determine that the candidate drug can promote the transcription of SMN RNA after being expressed in the cells, real-time quantitative PCR (qPCR) detection is carried out. As shown in FIG. 8(a, b, c), after the candidate drug was infected into the patient fibroblasts with low endogenous SMN.DELTA.7 expression, it was clearly seen that the RNA expression level of SMN.DELTA.7 was increased in the group infected with L-S1 virus and the group infected with L-orS1 virus.

4.2 drug candidates enhance expression of SMN molecules at the protein level

To further confirm this result, the candidate drug was infected with patient fibroblasts (less endogenous SMN) and the expression of SMN protein in the cells was examined using the Western-Blot method. As shown in fig. 9a and 9b, it was evident that the SMN molecule was enhanced by about 2-fold in the fibroblasts of patients infected with the drug candidates.

4.3 drug candidates promote gem body formation in the nucleus

Gem body (GB for short) is a transcriptional minibody, which was first found in the nucleus in the 80 th century and has a diameter of not more than 0.1. mu.m. In the gem body, the specific molecule found so far is SMN, so the transcriptional body of SMN in the nucleus represents the gem body. An increase in the number of gem bodies in the cell indicates an increase in the transcriptional activity of the cell by SMN. The candidate drug plasmid was transfected into 293 cells, the cells were immunofluorescent stained with SMN antibody, and the number of gem bodies stained with SMN in the nucleus of the cells was examined by confocal microscopy, as shown in FIG. 10, and the candidate drugs L-S1 and L-orS1 caused an increase in the number of gem bodies in the nucleus, indicating that the candidate drug promoted the transcriptional activity of the cells.

Since the expression of a particular molecule by transfection in a cell tends to cause the aggregation of the molecule, a false positive effect appears on cell morphology. Therefore, when the candidate drug virus solution was diluted at different concentrations to infect 293 cells, as shown in FIGS. 11A and 11B (FIGS. 11A and 11B are different manifestations of the same result), the number of gem bodies in the nucleus of cells after infection of cells at different doses had a significant dose-dependent effect, indicating that the candidate drug specifically promoted the transcriptional activity of the cells.

In conclusion, in the in vitro activity test, the candidate drugs L-S1 and L-orS1 can be tested to increase the expression of SMN molecules and promote the cell transcription activity through different cells and different experimental methods. By infecting cells with different doses of the candidate drug, a clear dose-dependent activity effect can be seen, further illustrating the specificity of the candidate drug.

Example 5 drug candidates promote cellular Activity

In order to test the effects of candidate drugs in promoting cell proliferation and inhibiting apoptosis, two stable methods for detecting cell activity were established in this example, wherein the cell proliferation activity was detected by CCK8 activity and the apoptosis of cells was detected by flow cytometry.

5.1 candidate drug promotes proliferation of fibroblasts of SMA patients

CCK8 Activity assay for cell proliferation Activity

The basic principle of the Cell Counting Kit-8 (CCK-8 for short) method is as follows: the reagent contains WST-8 [ chemical name: 2- (2-Methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2, 4-disulfonic acid benzene) -2H-tetrazole monosodium salt ] which is reduced to a highly water-soluble yellow Formazan product (Formazan dye) by a dehydrogenase in cells under the action of the electron carrier 1-Methoxy-5-methylphenazinium dimethylsulfate (1-Methoxy PMS). The amount of formazan produced was proportional to the number of living cells. Therefore, this property can be used to directly perform cell proliferation analysis.

PC12 cells were cultured at 1X 10⁴One well was seeded in 96-well plates with 100 μ L1640 complete medium (10% HS + 5% FBS + 1% PS +1640) per well. On the fifth day after the infection with the recombinant virus, except for the normal control group (uninfected virus sample, medium containing serum) and the blank medium group (uninfected virus sample, medium containing no serum), all the other groups (L-G1/L-S1/L-orS1) were infected virus samples, and the original medium was replaced with serum-free 1640 medium (wherein serum + means that the original medium containing serum was used). After 24h, 10. mu.L of CCK-8 reagent (DojinDo, CK04) was added to each well using a pipette and placed at 37 ℃ in CO₂Incubate for 3 h. OD value was measured with a microplate reader, and the absorption wavelength was 450 nm. Analysis of the experimental data using SPSS statistics 13.0 indicated that the drug candidate promoted proliferation of PC12 cells (data not shown).

The candidate drugs L-S1 and L-orS1 infected human fibroblasts were also able to detect increased CCK8 activity (FIG. 12) with a dose-dependent effect. Therefore, the test method of CCK8 activity proves that the candidate drug can promote the cell proliferation.

5.2 drug candidates inhibit early apoptosis of cells

In normal living cells, phosphatidylserine (phosphotidyl)serine, PS) is located inside the cell membrane, but in early apoptotic cells, PS flips from the inside of the cell membrane to the surface of the cell membrane, exposing it to the extracellular environment. Annexin-V (Annexin-V) is Ca with molecular weight of 35-36kDa²⁺The dependent phospholipid binding protein can be combined with PS with high affinity and can be combined with the cell membrane of cells in early apoptosis through phosphatidylserine exposed outside the cells; propidium Iodide (PI) binds to cells with intermediate and late apoptosis.

Infecting PC12 cells with the candidate drug, and detecting the ratio of Annexin V-FITC and PI in the cells by flow cytometry, wherein the Annexin V is⁺Indicating early apoptotic cells; PI (proportional integral)⁺Indicating intermediate and late apoptotic cells; annexin V⁺+Annexin V⁺PI⁺+PI⁺Represents Annexin V⁺、Annexin V⁺PI⁺And PI⁺All contained, representing all apoptotic cells in the early, middle and late stages.

As shown in FIG. 13, apoptotic cells in candidate drug-expressing cells (Annexin V)⁺+Annexin V⁺PI⁺+PI⁺) Reduced proportion of (B), early apoptotic cells (Annexin V)⁺) The ratio of (a) to (b) is decreased, indicating that early-to-mid apoptosis of the cell is inhibited, and that this inhibition has a dose-dependent effect.

To further confirm this result, the drug candidate was infected with human fibroblasts, apoptotic cells (Annexin V) in drug candidate-expressing cells⁺+Annexin V⁺PI⁺+PI⁺) Reduced proportion of (B), early apoptotic cells (Annexin V)⁺) The ratio of (a) to (b) was decreased, indicating that early-to-mid apoptosis of the cells was inhibited, and that this inhibition also had a dose-dependent effect (see fig. 14).

The experimental results of the two cells are combined, which shows that the cell is inhibited in the early apoptosis stage after the cell is infected with the candidate drug, and the survival capability of the cell is improved.

Example 6 in vivo detection of infection of recombinant viruses in anterior spinal cord motor neurons

The P2 newborn suckling mouse is injected with virus through a stereotaxic ventricular injection method, so that the newborn suckling mouse is infected with spinal nerves through cerebrospinal fluid circulation, and the expression condition is observed. The method comprises the following specific operations: the newborn suckling mouse is frozen and anesthetized for 5-10 minutes on ice to be fully anesthetized; mounting the ground electrode for microinjection on a stereotaxic apparatus; placing a mouse on a manually made mould, inserting a needle 1mm above the Bregma line of the mouse and 0.5mm on the left or right side of the center line, injecting the virus with the depth of 1.5mm, and injecting the virus with the volume of 1.5 mu L inwards; after the injection of the virus, the microinjection electrode is kept in the brain for 4 to 10 minutes, and then the electrode for microinjection is slowly taken out; the suckling mice are placed back into cages for breeding again, and the survival condition of the mice is observed the next day.

Experimental method for intravenous injection: the suckling mouse of 2-8 days old is placed on ice to calm for 2 minutes, the suckling mouse is grabbed, the head is well fixed, and one cheek is leaked. The surface skin is lightly rubbed with alcohol cotton ball to locally dilate blood vessel, and then the sample is injected into superficial temporal vein with insulin syringe, wherein the injection speed should be slowed as much as possible, and the animal is slow when pulling out the needle after injection is completed to prevent the sample from flowing out. The injection volume was 50. mu.l/vial.

In order to detect whether the candidate drug can reach anterior horn motoneurons of spinal cord in vivo, mice are divided into two groups in 2 days of birth, L-G1 virus solution is injected through superficial temporal vein and ventricle respectively, spinal cord of the mice is collected after 10 days, paraffin section is carried out, and immunohistochemical staining is carried out by GFP antibody and ChAT antibody specific to the motoneurons. As shown in FIG. 15, it was confirmed by confocal microscopy that the motor neurons expressed GFP molecules. Therefore, the experiment shows that the L-G1 virus solution injected by the two modes can enter anterior horn motor neurons of the spinal cord of the mouse.

Example 7 in vivo pharmacodynamic assay

7.1 candidate drug increases mouse survival (short term observations)

According to research, different time windows of drug injection of SMA model mice can generate inconsistent treatment effects, and the 7 th day administration time of the model mice after birth is selected to compare the influence of the candidate drug L-orS1 and L-orS4 with the intron of SV40 on the survival rate of the mice. Tg (SMN2 × delta7)4299Ahmb mice were bred, homozygote newborn mice were obtained and administered on day 7 after birth. Set 3 groupsMouse experiment, each group contains 10 mice, and the mice are respectively a model control group, an L-orS1 administration group and an L-orS4 administration group, and the administration dose is 1 x 10¹³vg/kg, was injected intravenously via the temples for 30 days, and the results are shown in FIG. 16, in which the mice in the model control group all died at day 15, while the survival rate of the mice in the L-orS1 administration group was as high as 60% at day 30, the survival rate of the mice in the L-orS4 administration group was about 40% at day 30, and the survival rate of the mice in the L-orS1 administration group was higher than that of the mice in the L-orS4 administration group, and was accompanied with the entire observation period (day 30). Therefore, the candidate drug can improve the survival rate of the mice more effectively and more quickly.

7.2 drug candidates enhance mouse locomotor ability

Tg (SMN2 × delta7)4299Ahmb mice were bred, homozygote newborn mice were obtained, and administered within 2 days after birth. 5 groups of mice are set for experiments, each group contains 6 mice, and the mice are respectively a normal control group, a model control group and a test article low-dose administration group (virus dose 10)¹²vg/kg), group of doses in test article (viral dose 10)¹³vg/kg) and test article high dose administration group (viral dose 10)¹⁴vg/kg), temporal intravenous injection. In the aspect of animal behavior detection, a rotating rod experiment and a muscle strength test are mainly carried out on the mice.

The rod rotating experiment comprises the following specific steps: adaptive training was performed for 1 time 5min each day starting 12 days after administration (D12) for all surviving mice, the rotation speed of the rotarod fatigue apparatus was adjusted to 20r/min, and if the mice dropped halfway, the mice were returned to the rotarod to continue adaptation. On day 14 of dosing (D14), trained mice were placed on the rotating bars in order and the time from the start of the experiment to the dropping of the bars was recorded for 5min (5 min was recorded if the animals did not drop from the rotating bars for 5 min). The results of the rod rotation experiment are shown in fig. 17, and it can be known from the rod rotation experiment that the rod time of the mice administered with low, medium and high doses is obviously prolonged, and the rod time and the administered dose have obvious dose dependence, and the high dose group is close to the mice in the normal control group.

The muscle strength test comprises the following specific steps: the tail of the mouse is grasped on the 14 th day (D14) of administration, the mouse is placed on a test bracket, when the mouse grasps the bracket, the mouse is pulled backwards slightly and quickly along the horizontal direction, the instrument display number when the mouse loosens the claw is the maximum grasping force of the mouse, each mouse is tested for 2 times, and the average value is calculated (if the two results are greatly different, the detection can be carried out for 1 time, and the 2 close results are taken for calculating the average value). The experimental results are shown in fig. 18, and it can be seen from the results of muscle strength tests that the muscle strength values of the mice administered with low, medium and high doses are significantly prolonged and have significant dose-effect relationship with the administered dose, compared with the model control group, and the high dose group is close to the normal mice.

Through the rod rotation experiment and the muscle strength test experiment, the mice can achieve complete correction of the movement function after administration.

7.3 other in vivo efficacy tests

Tg (SMN2 × delta7)4299Ahmb mice were bred, homozygote newborn mice were obtained, and administered within 2 days after birth. 5 groups of mice are set for experiments, each group contains 6 mice, and the mice are respectively a normal control group, a model control group and a test article low dose group (virus dose 10)¹²vg/kg), test article middle dose group (viral dose 10)¹³vg/kg) and test article high dose group (viral dose 10)¹⁴vg/kg), temporal intravenous injection. After administration, the SMN content in the spinal cord of the animals was measured by ELISA method and immunohistochemical method, and the survival time and body weight of the animals were observed.

After administration, spinal cord tissues of some mice are taken, and the SMN content in motor neurons in spinal cords is detected by ELISA and immunohistochemical methods, wherein the SMN protein expression level of the mice in medium-dose and high-dose administration groups is obviously higher than that of a control group (specific data are as follows). The survival time of the model control group mice is about 15 days, and the survival time of the mice can reach more than 360 days after the administration of medium and high doses. The survival rate of the mouse is obviously improved. Mice in the dosed group weighed approximately normal mice (specific data not shown).

Regarding SMN protein expression amount: the drug candidate (L-orS1) increased SMN levels in mouse tissues.

The SMN content in the left brain, spinal cord and left posterior muscle of the administered group was significantly elevated relative to the model control group and was dose-dependent. Wherein in brain tissue, the SMN content of the test sample high-dose administration group is increased to 3 times of that of the model control group and is recovered to 60% of that of the normal control group; in spinal cord, the SMN content of the test article high-dose administration group is increased to 2 times of that of the model control group and is restored to 75 percent of that of the normal dose group; in muscle, the test article high dose group increased the SMN content to 5.3 times that of the model control group, and returned to 85% of that of the normal dose group. From the above results, it was found that the drug candidate (L-orS1) was capable of efficiently delivering and expressing the SMN protein in the disease-associated tissue.

7.4 drug candidates improve tissue atrophy in mice

Tg (SMN2 × delta7)4299Ahmb mice were bred, homozygote newborn mice were obtained, and administered within 2 days after birth. 4 groups of mice are set for experiments, each group contains 6 mice, and the mice are respectively a normal control group, a model control group and a dosage administration group (virus dosage 10) in a test article (L-orS1)¹³vg/kg) and test article (L-orS1) high dose administration group (viral dose 10)¹⁴vg/kg), temporal intravenous injection.

Taking right brain tissue, spinal cord and right posterior muscle of each animal on 14 days after administration, fixing with 10% neutral formalin, slicing with conventional paraffin, performing histopathological examination by optical microscope after HE staining, and diagnosing and grading pathological changes by standard terms; and measuring the cross sectional area of the right posterior muscle fiber by taking a picture of the section by an optical microscope with the magnification of 200 x, analyzing the cross sectional area of the muscle by using Image J, and measuring the cross sectional area of 20 muscle fibers selected by each mouse.

In the observation results of the skeletal muscle (fig. 19-21), the skeletal muscle tissue structure of the normal control group was normal (fig. 19), the skeletal muscle of the model control group was severely atrophic (fig. 20), and the skeletal muscle of the test article high dose group was slightly atrophic (fig. 21); in spinal cord (fig. 22-24), spinal cord tissue structure was normal in the normal control group (fig. 22), moderate atrophy of spinal cord was in the model control group (fig. 23), and mild atrophy of spinal cord was in the test high dose group (fig. 24); in the brain tissue (FIGS. 25-27), the normal control brain tissue structure was normal (FIG. 25), the model control brain tissue was moderately atrophic (FIG. 26), and the test sample high dose brain tissue was slightly atrophic (FIG. 27), so that it was found that the drug candidate (L-orS1) alleviated the atrophy in the skeletal muscle, spinal cord and brain tissue of the model mouse.

The measurement results of the size of the muscle fiber cross section in the right posterior muscle show that the muscle atrophy is basically observed in the right posterior muscle of the animals of other groups except the normal control group, the area of the muscle cross section is reduced, but the cross section area of the muscle fiber can be increased in a dose-dependent manner by the test article, wherein the cross section area of the muscle fiber can be increased to 2.5 times of that of the model control group by the high-dose administration group of the test article, and the normal control group is recovered to 60 percent. The results show that the test article (L-orS1) can obviously improve the muscle atrophy symptom of mice.

Sequence listing

<110> Shutaishen (Beijing) biopharmaceutical corporation, Trinojiayi Biotech company of Beijing

<120> adeno-associated virus vector for treating spinal muscular atrophy and use thereof

<130> 2021060201

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 287

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatgg 287

<210> 2

<211> 278

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcgaggtgag ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa 60

ttttgtattt atttattttt taattatttt gtgcagcgat gggggcgggg gggggggggg 120

ggcgcgcgcc aggcggggcg gggcggggcg aggggcgggg cggggcgagg cggagaggtg 180

cggcggcagc caatcagagc ggcgcgctcc gaaagtttcc ttttatggcg aggcggcggc 240

ggcggcggcc ctataaaaag cgaagcgcgc ggcgggcg 278

<210> 3

<211> 228

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggagtcgctg cgcgctgcct tcgccccgtg ccccgctccg ccgccgcctc gcgccgcccg 60

ccccggctct gactgaccgc gttactccca caggtgagcg ggcgggacgg cccttctcct 120

ccgggctgta attagctgag caagaggtaa gggtttaagg gatggttggt tggtggggta 180

ttaatgttta attacctgga gcacctgcct gaaatcactt tttttcag 228

<210> 4

<211> 793

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 300

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 360

tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc gcgcgccagg 420

cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa 480

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 540

taaaaagcga agcgcgcggc gggcgggagt cgctgcgcgc tgccttcgcc ccgtgccccg 600

ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg accgcgttac tcccacaggt 660

gagcgggcgg gacggccctt ctcctccggg ctgtaattag ctgagcaaga ggtaagggtt 720

taagggatgg ttggttggtg gggtattaat gtttaattac ctggagcacc tgcctgaaat 780

cacttttttt cag 793

<210> 5

<211> 720

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaagggcg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

<210> 6

<211> 885

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atggcgatga gctccggcgg ctccggaggc ggcgtccctg aacaggagga tagcgtgctg 60

ttcaggaggg gcaccggcca aagcgatgat agcgacatct gggacgacac cgccctgatc 120

aaggcctatg acaaggccgt ggcctccttc aagcacgccc tgaagaacgg cgacatctgc 180

gagaccagcg gcaagcccaa gaccaccccc aaaaggaagc ccgccaagaa gaacaagagc 240

cagaagaaaa acaccgccgc cagcctgcag caatggaaag tgggcgacaa gtgctccgcc 300

atctggagcg aggatggatg catctacccc gccaccatcg ccagcatcga cttcaagagg 360

gagacatgcg tggtggtgta caccggctac ggaaacaggg aggagcagaa cctgagcgac 420

ctgctgagcc ccatctgtga ggtggccaac aacattgagc agaacgccca ggagaacgaa 480

aacgagagcc aggtgagcac cgacgagagc gagaacagca gaagccccgg caataagagc 540

gacaacatca agcccaagag cgctccctgg aatagctttc tgcccccccc ccctcctatg 600

cctggaccca gactgggacc tggcaaaccc ggcctgaaat tcaacggccc tccccctcct 660

cctcctcctc ctccccctca tctgctgagc tgctggctgc ccccttttcc tagcggcccc 720

cctatcatcc ctcctccccc tcctatctgt cccgacagcc tggatgacgc cgacgccctg 780

ggaagcatgc tgatcagctg gtacatgtcc ggctaccaca ccggctacta catgggcttc 840

aggcagaacc agaaggaagg caggtgctcc cacagcctga actga 885

<210> 7

<211> 225

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60

tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120

tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180

gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

<210> 8

<211> 885

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atggcgatga gcagcggcgg cagtggtggc ggcgtcccgg agcaggagga ttccgtgctg 60

ttccggcgcg gcacaggcca gagcgatgat tctgacattt gggatgatac agcactgata 120

aaagcatatg ataaagctgt ggcttcattt aagcatgctc taaagaatgg tgacatttgt 180

gaaacttcgg gtaaaccaaa aaccacacct aaaagaaaac ctgctaagaa gaataaaagc 240

caaaagaaga atactgcagc ttccttacaa cagtggaaag ttggggacaa atgttctgcc 300

atttggtcag aagacggttg catttaccca gctaccattg cttcaattga ttttaagaga 360

gaaacctgtg ttgtggttta cactggatat ggaaatagag aggagcaaaa tctgtccgat 420

ctactttccc caatctgtga agtagctaat aatatagaac aaaatgctca agagaatgaa 480

aatgaaagcc aagtttcaac agatgaaagt gagaactcca ggtctcctgg aaataaatca 540

gataacatca agcccaaatc tgctccatgg aactcttttc tccctccacc accccccatg 600

ccagggccaa gactgggacc aggaaagcca ggtctaaaat tcaatggccc accaccgcca 660

ccgccaccac caccacccca cttactatca tgctggctgc ctccatttcc ttctggacca 720

ccaataattc ccccaccacc tcccatatgt ccagattctc ttgatgatgc tgatgctttg 780

ggaagtatgt taatttcatg gtacatgagt ggctatcata ctggctatta tatgggtttc 840

agacaaaatc aaaaagaagg aaggtgctca cattccttaa attga 885

<210> 9

<211> 1966

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 300

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 360

tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc gcgcgccagg 420

cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa 480

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 540

taaaaagcga agcgcgcggc gggcgggagt cgctgcgcgc tgccttcgcc ccgtgccccg 600

ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg accgcgttac tcccacaggt 660

gagcgggcgg gacggccctt ctcctccggg ctgtaattag ctgagcaaga ggtaagggtt 720

taagggatgg ttggttggtg gggtattaat gtttaattac ctggagcacc tgcctgaaat 780

cacttttttt cagactagtt tctagatcgg atcctgccac catggcgatg agcagcggcg 840

gcagtggtgg cggcgtcccg gagcaggagg attccgtgct gttccggcgc ggcacaggcc 900

agagcgatga ttctgacatt tgggatgata cagcactgat aaaagcatat gataaagctg 960

tggcttcatt taagcatgct ctaaagaatg gtgacatttg tgaaacttcg ggtaaaccaa 1020

aaaccacacc taaaagaaaa cctgctaaga agaataaaag ccaaaagaag aatactgcag 1080

cttccttaca acagtggaaa gttggggaca aatgttctgc catttggtca gaagacggtt 1140

gcatttaccc agctaccatt gcttcaattg attttaagag agaaacctgt gttgtggttt 1200

acactggata tggaaataga gaggagcaaa atctgtccga tctactttcc ccaatctgtg 1260

aagtagctaa taatatagaa caaaatgctc aagagaatga aaatgaaagc caagtttcaa 1320

cagatgaaag tgagaactcc aggtctcctg gaaataaatc agataacatc aagcccaaat 1380

ctgctccatg gaactctttt ctccctccac caccccccat gccagggcca agactgggac 1440

caggaaagcc aggtctaaaa ttcaatggcc caccaccgcc accgccacca ccaccacccc 1500

acttactatc atgctggctg cctccatttc cttctggacc accaataatt cccccaccac 1560

ctcccatatg tccagattct cttgatgatg ctgatgcttt gggaagtatg ttaatttcat 1620

ggtacatgag tggctatcat actggctatt atatgggttt cagacaaaat caaaaagaag 1680

gaaggtgctc acattcctta aattgaagtg gccgcgactc tagactgata tcattgctag 1740

cctgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc 1800

ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt 1860

ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat 1920

tgggaagaca atagcaggca tgctggggat gcggtgggct ctatgg 1966

<210> 10

<211> 1966

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 300

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 360

tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc gcgcgccagg 420

cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa 480

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 540

taaaaagcga agcgcgcggc gggcgggagt cgctgcgcgc tgccttcgcc ccgtgccccg 600

ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg accgcgttac tcccacaggt 660

gagcgggcgg gacggccctt ctcctccggg ctgtaattag ctgagcaaga ggtaagggtt 720

taagggatgg ttggttggtg gggtattaat gtttaattac ctggagcacc tgcctgaaat 780

cacttttttt cagactagtt tctagatcgg atcctgccac catggcgatg agctccggcg 840

gctccggagg cggcgtccct gaacaggagg atagcgtgct gttcaggagg ggcaccggcc 900

aaagcgatga tagcgacatc tgggacgaca ccgccctgat caaggcctat gacaaggccg 960

tggcctcctt caagcacgcc ctgaagaacg gcgacatctg cgagaccagc ggcaagccca 1020

agaccacccc caaaaggaag cccgccaaga agaacaagag ccagaagaaa aacaccgccg 1080

ccagcctgca gcaatggaaa gtgggcgaca agtgctccgc catctggagc gaggatggat 1140

gcatctaccc cgccaccatc gccagcatcg acttcaagag ggagacatgc gtggtggtgt 1200

acaccggcta cggaaacagg gaggagcaga acctgagcga cctgctgagc cccatctgtg 1260

aggtggccaa caacattgag cagaacgccc aggagaacga aaacgagagc caggtgagca 1320

ccgacgagag cgagaacagc agaagccccg gcaataagag cgacaacatc aagcccaaga 1380

gcgctccctg gaatagcttt ctgccccccc cccctcctat gcctggaccc agactgggac 1440

ctggcaaacc cggcctgaaa ttcaacggcc ctccccctcc tcctcctcct cctccccctc 1500

atctgctgag ctgctggctg cccccttttc ctagcggccc ccctatcatc cctcctcccc 1560

ctcctatctg tcccgacagc ctggatgacg ccgacgccct gggaagcatg ctgatcagct 1620

ggtacatgtc cggctaccac accggctact acatgggctt caggcagaac cagaaggaag 1680

gcaggtgctc ccacagcctg aactgaagtg gccgcgactc tagactgata tcattgctag 1740

cctgtgcctt ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc 1800

ctggaaggtg ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt 1860

ctgagtaggt gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat 1920

tgggaagaca atagcaggca tgctggggat gcggtgggct ctatgg 1966

<210> 11

<211> 1809

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 300

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 360

tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc gcgcgccagg 420

cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa 480

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 540

taaaaagcga agcgcgcggc gggcgggagt cgctgcgcgc tgccttcgcc ccgtgccccg 600

ctccgccgcc gcctcgcgcc gcccgccccg gctctgactg accgcgttac tcccacaggt 660

gagcgggcgg gacggccctt ctcctccggg ctgtaattag ctgagcaaga ggtaagggtt 720

taagggatgg ttggttggtg gggtattaat gtttaattac ctggagcacc tgcctgaaat 780

cacttttttt cagactagtt tcggatcctg aattcgccac catggtgagc aagggcgagg 840

agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca 900

agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt 960

tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct 1020

acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt 1080

ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaagggc gacggcaact 1140

acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga 1200

agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca 1260

acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca 1320

agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca 1380

cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg 1440

ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg 1500

ccgccgggat cactctcggc atggacgagc tgtacaagta aagtggccgc gactctagag 1560

ggaattcctg atatcattgc tagcctgtgc cttctagttg ccagccatct gttgtttgcc 1620

cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 1680

atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 1740

ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg gatgcggtgg 1800

gctctatgg 1809

<210> 12

<211> 2227

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

catatgatag ctccccctgc acacactgac ctccttctca cgttcctgtc tgtcagggag 60

gaatactcac tagagagtaa aaaatgagga caatggaagt tgtgttgcat tttgtgctcg 120

caagtgcaac agatctcatt gaatcgccaa ttgttgttaa agacattctg tcattgtgtt 180

tgaaggaccg gtcctctgag gaagttgaag aatgtatgta gatgacacaa gcctgggaag 240

aagggtgtgg tgagggaagt attagtcaca caggcgagct gaagagtcct catcttgtgg 300

ctactaacta gcctactgag aaggaagaag ctctcacatt tatactgaga aatggctttt 360

gggaaggaga aaatgatcat ttatttccaa accctgccat ttccatacag tacgctatct 420

atatcatagt cgtgggcctg ttcaatgaca ggaacaataa tttctcatct tcctgctcaa 480

gaaataattt tattgatctt catttttttt atttttccca tgattcagca ggtcaggaat 540

gctccctttt cagtagcttc ctgccgttca gcaaatcatc cagagtgtga aaatgccttt 600

acaaagtaaa aaggaagtgc aaagccattt cagcaccacg gagagtgcct ctgctttttc 660

ttccaccact ggcatttgca cttcggactg tgcaggaaac aaaaaagaaa ttttaaggtg 720

taaattagta gctaccaaaa aacttaccaa tgggcaaaat cttagtttta aaattagaca 780

gtgtttcata catgttcatg attgcaacga tttttttttc atctctgaga tggaattatc 840

tatttctagc tatttttaaa tacctcaacc acaattccta catgagttta gactgataca 900

atgttagtac agtaaagttc agtgttgtac attaaaagtc ctaggactta tatccctaag 960

gctttttctc cagtgcagtg cagatgctca gtatatatat atacatacat acacacagtt 1020

gtggcttttt tggagttcca tccacttcac cacagctctg tatgattttc caaagagggg 1080

ataggttagt ataaattact gtaaaacaga tagtgagtta ttattgattg gataagagag 1140

tgagatggat taaaagattc atatctatct tgactgatgc cttttattaa tatatatatt 1200

aatacatata tatgtatgaa ttgagaaaaa ttggacattt gctaaatgtt ttttaagtga 1260

atgaataaat gaataagtaa atgccttgtt tataatttgt ttcaaagttc gttgcacttc 1320

atactgctta atctgactgt gaatgcaggg aaaccattcc tagtccaggt tctcctgctc 1380

tcttgcatca tgtccttagg tggaatttat atccctgtgc ccaagtagcc aacagttctc 1440

tcctctatgt tagagaggaa aggccaggcc acccccctct actaggaaac tttcctgaga 1500

ttatggacta tgaagcccaa ctatgcaaga agggaaaacg agtagccctg gccatatctg 1560

agctactacc acaatcagac gtgggctagt ttgggaattc catcacctat taggaaggtc 1620

aggatctacc aagggcaagg ccaaaggtga aagagaaaac aagaaacagt aataacataa 1680

gctttaaacc acttttccga cactcggcaa ctggggtgag ttttcaggcc cctgggcctt 1740

ctctttgcca atctatgcag tgacacatgt ttgaagcaaa gtatagcctc ctgggtacag 1800

ataagcacag cccagtcctt agctcctagg aggcttcctg gctaaggcac cactgcactt 1860

ggactgtact atcgggctcc aaactggggg ggagcttcca ggcaagagct gatttccatt 1920

tcaaactgca ttctggtact ttgtactcca gcaccattgg ccgatcaata tttaatgctt 1980

ggagattctg actctgcagg agtcatgtca ggggaccctg agagccaatc tgcttgagcg 2040

ttctgcgtga taattattca tgggctcctg cctctcgctc tttctctagc acggtcccac 2100

gtctgcagac tcatgcctta ctcagactcc tctctcgctc tctccgcggc tacagctgga 2160

cccttctcct tcgcctttgc caccgctccg agcgtgcaca tccctacaat ggctaaaaca 2220

gcaatgg 2227

<210> 13

<211> 191

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cccgaaggtc ctccggaggc ccggcattct gcacgcttca aaagcgcacg tctgccgcgc 60

tgttctcctc ttcctcatct ccgggccttt cgacctcacg gtgttgccaa aatgtcgctt 120

tccaacaagc tgactttgga caagctggac gtgaagggga agcgggtcgt gatgaggtaa 180

ttccgtactg c 191

<210> 14

<211> 934

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg 60

tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 120

gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca 180

gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 240

taccatggtc gaggtgagcc ccacgttctg cttcactctc cccatctccc ccccctcccc 300

acccccaatt ttgtatttat ttatttttta attattttgt gcagcgatgg gggcgggggg 360

gggggggggg cgcgcgccag gcggggcggg gcggggcgag gggcggggcg gggcgaggcg 420

gagaggtgcg gcggcagcca atcagagcgg cgcgctccga aagtttcctt ttatggcgag 480

gcggcggcgg cggcggccct ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgcg 540

ctgccttcgc cccgtgcccc gctccgccgc cgcctcgcgc cgcccgcccc ggctctgact 600

gaccgcgtta ctcccacagg tgagcgggcg ggacggccct tctcctccgg gctgtaatta 660

gcgcttggtt taatgacggc ttgtttcttt tctgtggctg cgtgaaagcc ttgaggggct 720

ccgggagggc cctttgtgcg gggggagcgg ctcggggctg tccgcggggg gacggctgcc 780

ttcggggggg acggggcagg gcggggttcg gcttctggcg tgtgaccggc ggctctagag 840

cctctgctaa ccatgttcat gccttcttct ttttcctaca gctcctgggc aacgtgctgg 900

ttattgtgct gtctcatcat tttggcaaag aatt 934

<210> 15

<211> 5180

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gcctcggcct ctgcataaat aaaaaaaatt agtcagccat ggggcggaga atgggcggaa 60

ctgggcggag ttaggggcgg gatgggcgga gttaggggcg ggactatggt tgctgactaa 120

ttgagatgca tgctttgcat acttctgcct gctggggagc ctggggactt tccacaccct 180

aactgacaca cattccacag ctggttcttt ccgcctcaga aggtacctaa ccaagttcct 240

ctttcagagg ttatttcagg ccatggtgct gcgccggctg tcacgccagg cctccgttaa 300

ggttcgtagg tcatggactg aaagtaaaaa aacagctcaa cgcctttttg tgtttgtttt 360

agagcttttg ctgcaatttt gtgaagggga agatactgtt gacgggaaac gcaaaaaacc 420

agaaaggtta actgaaaaac cagaaagtta actggtaagt ttagtctttt tgtcttttat 480

ttcaggtcca tgggtgctgc tttaacactg ttgggggacc taattgctac tgtgtctgaa 540

gctgctgctg ctactggatt ttcagtagct gaaattgctg ctggagaggc cgctgctgca 600

attgaagtgc aacttgcatc tgttgctact gttgaaggcc taacaacctc tgaggcaata 660

gctgctatag gcctcagtcc acaggcctat gctgtgatat ctggggctcc tgctgctata 720

gctggatttg cagctttact gcaaactgtg actggtgtga gcgctgttgc tcaagtgggg 780

tatagatttt ttagtgactg ggatcacaaa gtttctactg ttggtttata tcaacaacca 840

ggaatggctg tagatttgta taggccagat gactattatg atattttatt tcctggagta 900

caaacctttg ttcacagtgt tcagtatctt gaccccagac attggggtcc aacacttttt 960

aatgccattt ctcaagcttt ttggcgtgta atacaaaatg acattcctag gctcacctca 1020

caggagcttg aaagaagaac ccaaagatat ttaagggaca gtttggcaag gtttttagag 1080

gaaactactt ggacagtaat taatgctcct gttaattggt ataactcttt acaagattac 1140

tactctactt tgtctcccat taggcctaca atggtgagac aagtagccaa cagggaaggg 1200

ttgcaaatat catttgggca cacctatgat aatattgatg aagcagacag tattcagcaa 1260

gtaactgaga ggtgggaagc tcaaagccaa agtcctaatg tgcagtcagg tgaatttatt 1320

gaaaaatttg aggctcctgg tggtgcaaat caaagaactg ctcctcagtg gatgttgcct 1380

ttacttctag gcctgtacgg aagtgttact tctgctctaa aagcttatga agatggcccc 1440

aacaaaaaga aaaggaagtt gtccaggggc agctcccaaa aaaccaaagg aaccagtgca 1500

agtgccaaag ctcgtcataa aaggaggaat agaagttcta ggagttaaaa ctggagtaga 1560

cagcttcact gaggtggagt gctttttaaa tcctcaaatg ggcaatcctg atgaacatca 1620

aaaaggctta agtaaaagct tagcagctga aaaacagttt acagatgact ctccagacaa 1680

agaccaactg ccttgctaca gtgtggctag aattcctttg cctaatttaa atgaggactt 1740

aacctgtgga aatattttga tgtgggaagc tgttactgtt aaaactgagg ttattggggt 1800

aactgctatg ttaaacttgc attcagggac acaaaaaact catgaaaatg gtgctggaaa 1860

acccatacaa gggtcaaact ttcatttttt tgctgttggt ggggaacctt tggagctgca 1920

gggtgtgtta gcaaactaca ggaccaaata tcctgctcaa actgtaaccc caaaaaatgc 1980

tacagttgac agtcagcaga tgaacactga ccacaaggct gttttggata aggataatgc 2040

ttatccagtg gagtgctggg ttcctgatcc aagtaaaaat gaaaacacta gatattttgg 2100

aacctacaca ggtggggaaa atgtgcctcc tgttttacac attactaaca cagcaaccac 2160

agtgctgctt gatgagcagg gtgttgggcc cttgtgcaaa gctgacagct tgtatgtttc 2220

tgctgttgac atttgtgggc tgtttaccaa cacttctgga acacagcagt ggaagggact 2280

tcccagatat tttaaaatta cccttagaaa gaggtctgtg aaaaacccct acccaatttc 2340

ctttttgtta agtgacctaa ttaacaggag gacacagagg gtggatgggc agcctatgat 2400

tggaatgtcc tctcaagtag aggaggttag ggtttatgag gacacagagg agcttcctgg 2460

ggatccagac atgataagat acattgatga gtttggacaa accacaacta gaatgcagtg 2520

aaaaaaatgc tttatttgtg aaatttgtga tgctattgct ttatttgtaa ccattataag 2580

ctgcaataaa caagttaaca acaacaattg cattcatttt atgtttcagg ttcaggggga 2640

ggtgtgggag gttttttaaa gcaagtaaaa cctctacaga tgtgatatgg ctgattatga 2700

tcatgaacag actgtgagga ctgtgagggc tgaggggcct gaaatgagcc ttgagactgt 2760

gaatcaatgc ctgtttcatg ccctgagtct tccatgttct tctccccacc atcttcattt 2820

ttatcagcat tttcctggct gtcatcatca tcatcatcac tgtttcttag ccaatctaaa 2880

actccaactc ccatagccac attaaacttc attttttgat acactgacaa actaaactct 2940

ttgtccaatc tctctttcca ctccacaatt ctgctctgaa tactttgagc aaactcagcc 3000

acaggtctgt accaaattaa cataagaagc aaagcaatgc cactttgaat tatcctcttt 3060

tctaacaaaa actcactgcg ttccaggcaa tgctttaaat aatctttggg cctaaaatct 3120

atttgtttta caaatctggc ctgcagtgtt ttaggcacac tgtactcatt catggtgact 3180

attccagggg gaaatatttg agttctttta tttaggtgtt tcttttctaa gtttacctta 3240

acactgccat ccaaataatc ccttaaattg tccaggttat taattccctg acctgaaggc 3300

aaatctctgg actcccctcc agtgcccttt acatcctcaa aaactactaa aaactggtca 3360

atagctactc ctagctcaaa gttcagcctg tccaagggca aattaacatt taaagctttc 3420

cccccacata attcaagcaa agcagctgct aatgtagttt taccactatc aattggtcct 3480

ttaaacagcc agtatctttt tttaggaatg ttgtacacca tgcattttaa aaagtcatac 3540

accactgaat ccattttggg caacaaacag tgtagccaag caactccagc catccattct 3600

tctatgtcag cagagcctgt agaaccaaac attatatcca tcctatccaa aagatcatta 3660

aatctgtttg ttaacatttg ttctctagtt agttgtaggc tatcaacccg ctttttagct 3720

aaaacagtat caacagcctg ttggcatatg gttttttggt ttttgctgtc agcaaatata 3780

gcagcatttg cataatgctt ttcatggtac ttatagtggc tgggctgttc ttttttaata 3840

cattttaaac acatttcaaa actgtactga aattccaagt acatcccaag caataacaac 3900

acatcatcac attttgtttc cattgcatac tctgttacaa gcttccagga cacttgttta 3960

gtttcctctg cttcttctgg attaaaatca tgctccttta acccaccagg caaactttcc 4020

tcaataacag aaaatggatc tctagttaag gcactataca tcaaatattc cttattaacc 4080

cctttacaaa ttaaaaagct aaaggtacac aatttttgag catagttatt aatagcagac 4140

actctatgcc tgtgtggagt aagaaaaaac agtatgttat gattataact gttatgccta 4200

cttataaagg ttacagaata tttttccata atttttttgt atagcagtgc agctttttcc 4260

tttgtggtgt aaatagcaaa gcaagcaaga gttctattac taaacacagc atgactcaaa 4320

aaacttagca attctgaagg aaagtccttg gggtcttcta cctttctctt cttttttgga 4380

ggagtagaat gttgagagtc agcagtagcc tcatcatcac tagatggcat ttcttctgag 4440

caaaacaggt tttcctcatt aaaggcattc caccactgct cccattcatc agttccatag 4500

gttggaatct aaaatacaca aacaattaga atcagtagtt taacacatta tacacttaaa 4560

aattttatat ttaccttata gctttaaatc tctgtaggta gtttgtccaa ttatgtcaca 4620

ccacagaagt aaggttcctt cacaaagatc aagtccaaac cacattctaa agcaatcgaa 4680

gcagtagcaa tcaacccaca caagtggatc tttcctgtat aattttctat tttcatgctt 4740

catcctcagt aagcacagca agcatatgca gttagtagac attttttttg cacactcagg 4800

ccattgtttg cagtatattg catcaacacc aggatttaag gaagaagcaa atacctcagt 4860

tgcatcccag aagcctccaa agtcaggttg atgagcatat tttactccat cttccatttt 4920

cttgtacaga gtattcattt tcttcatttt ttcttcatct cctcctttat caggatgaaa 4980

ctccttgcat ttttttaaat atgcctttct catcagagga atattccccc aggcactcct 5040

ttcaagacct agaaggtcca ttagctgcaa agattcctct ctgtttaaaa ctttatccat 5100

ctttgcaaag ctttttgcaa aagcctaggc ctccaaaaaa gcctcttcac tacttctgga 5160

atagctcaga ggccgaggcg 5180

<210> 16

<211> 5046

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

caccggtgtt attgctgctc ggtgcgtgca tgcacatcag tgtcgctgca gctcagtgca 60

tgcacgctca ttgcccatcg ctatccctgc ctctcctgct ggcgctcccc gggaggtgac 120

ttcaagggga ccgcaggacc acctcggggg tggggggagg gctgcacacg cggaccccgc 180

tccccctccc caacaaagca ctgtggaatc aaaaaggggg gaggggggat ggaggggcgc 240

gtcacacccc cgccccacac cctcacctcg aggtgagccc cacgttctgc ttcactctcc 300

ccatctcccc cccctcccca cccccaattt tgtatttatt tattttttaa ttattttgtg 360

cagcgatggg ggcggggggg gggggggcgc gcgccaggcg gggcggggcg gggcgagggg 420

cggggcgggg cgaggcggag aggtgcggcg gcagccaatc agagcggcgc gctccgaaag 480

tttcctttta tggcgaggcg gcggcggcgg cggccctata aaaagcgaag cgcgcggcgg 540

gcgggagtcg ctgcgttgcc ttcgccccgt gccccgctcc gcgccgcctc gcgccgcccg 600

ccccggctct gactgaccgc gttactccca caggtgagcg ggcgggacgg cccttctcct 660

ccgggctgta attagcgctt ggtttaatga cggctcgttt cttttctgtg gctgcgtgaa 720

agccttaaag ggctccggga gggccctttg tgcggggggg agcggctcgg ggggtgcgtg 780

cgtgtgtgtg tgcgtgggga gcgccgcgtg cggcccgcgc tgcccggcgg ctgtgagcgc 840

tgcgggcgcg gcgcggggct ttgtgcgctc cgcgtgtgcg cgaggggagc gcggccgggg 900

gcggtgcccc gcggtgcggg ggggctgcga ggggaacaaa ggctgcgtgc ggggtgtgtg 960

cgtggggggg tgagcagggg gtgtgggcgc ggcggtcggg ctgtaacccc cccctgcacc 1020

cccctccccg agttgctgag cacggcccgg cttcgggtgc ggggctccgt gcggggcgtg 1080

gcgcggggct cgccgtgccg ggcggggggt ggcggcaggt gggggtgccg ggcggggcgg 1140

ggccgcctcg ggccggggag ggctcggggg aggggcgcgg cggccccgga gcgccggcgg 1200

ctgtcgaggc gcggcgagcc gcagccattg ccttttatgg taatcgtgcg agagggcgca 1260

gggacttcct ttgtcccaaa tctggcggag ccgaaatctg ggaggcgccg ccgcaccccc 1320

tctagcgggc gcgggcgaag cggtgcggcg ccggcaggaa ggaaatgggc ggggagggcc 1380

ttcgtgcgtc gccgcgccgc cgtccccttc tccatctcca gcctcggggc tgccgcaggg 1440

ggacggctgc cttcgggggg gacggggcag ggcggggttc ggcttctggc gtgtgaccgg 1500

cggggtttat atcttccctt ctctgttcct ccgcagccag ccatggatga tgatattgct 1560

gcgctcgttg ttgacaatgg ctccggtatg tgcaaggccg gtttcgccgg ggacgatgcc 1620

ccccgtgctg tgttcccatc tatcgtgggt cgccccagac atcaggtacg gcaacggctg 1680

cggtgctgca tccggacgat agggaggagc gttcggtggg agtggttctg ctgagggcag 1740

cgagcctcaa gaagcccttt tattttcata tgtgacataa ggagtttctg tcctcaacag 1800

taatgggttg agtacgcagc ctccgcggag catcctgtgt tggagcagtt gctcagtccc 1860

ttccctgaca gagtagggac agtggggggt tggtaattaa aggtgtggca cttggaaaga 1920

aaactttatt tgtccgttgg agttgatcct tcagttaaac ttaaagcttt ttctttgttg 1980

tgcagggtgt gatggttggt atgggccaga aagacagcta cgttggtgat gaagcccaga 2040

gcaaaagagg tatcctgacc ctgaagtacc ccattgaaca cggtattgtc accaactggg 2100

atgatatgga gaagatctgg caccacactt tctacaatga gctgagagta gcccctgagg 2160

agcaccctgt gctgctcaca gaggctcccc tgaaccccaa agccaacaga gagaagatga 2220

cacaggtgtg taaaactctt tgagcctaga gctacagcag gtactgctgc aggccagctt 2280

tcctcttcca tgttgtcctc tatctgcctt caccacttct ccctttttgc catctttaca 2340

gggttttcct ttcctgacct gagtctcctc tttgctggac cttgacaggt tttgtttgct 2400

ctaagctggc tttctctgag actgaactag caacttgtct aactgctgtt tctgactaga 2460

cactaatcca tttaccatct ttgagtgact ataccgtagt ttcttggcct ttgtttcgtt 2520

ccttgctgtg tcatgtggat gggcctgtgg tagcagtgtc cttgctcagg ctctgacttg 2580

acaggtgtgg gtggagacca agtgagataa gtgctcatag ctccttctag aggagcagag 2640

aagcctctta tctagggaca aatgtaaacc acatgcatgg accgatgtag gtgtgcagtg 2700

agaaccttgg tttattctgc ttgactcagt gcttttttta tctttctaga tcatgtttga 2760

gaccttcaac accccagcca tgtatgtagc catccaggct gtgctgtccc tgtatgcctc 2820

tggtcgtacc actggtattg tgatggactc tggtgatggt gttacccaca ctgtgcccat 2880

ctatgaaggc tacgccctcc cccatgccat cctccgtctg gatctggctg gccgtgacct 2940

gacggactac ctcatgaaga tcctgacaga gagaggctac agcttcacca ccacagccga 3000

gagagaaatt gtgcgtgaca tcaaggagaa gctgtgctac gtcgcactgg atttcgagca 3060

ggagatggcc acagctgcct ctagctcttc cctagagaag agctatgaac tccctgatgg 3120

tcaggtcatc accattggca atgagaggtt caggtgcccc gaggccctct tccagccatc 3180

tttcttgggt aagtctgact cctttgagga gattccatgc cccttctgcc tagagcgact 3240

tagagactgg ccacaatatt gctggccctt agcaggtctg tcccattcca ctgcagtctt 3300

ttttcttcct cagtttgagg atgattgagg tacctaggtc agtagaacag gaggctgagc 3360

ctgtcagcca tgcctttgtc tgtgttgttt cccactatgg ggtgtttgat tctcttgttt 3420

tcccatagca gtaggtcctc tgtcttcctt gtccctgaac catttactga cttgacactg 3480

ctttttgctt gcaggtatgg agtcctgtgg tatccatgaa actaccttca actccatcat 3540

gaagtgtgat gtggatatcc gtaaggatct gtatgccaac acagtgctgt ctggtggtac 3600

cacaatgtac cctggcattg ctgacaggat gcagaaggag atcacagccc tggcacctag 3660

cacaatgaaa atcaaggtag gctggagccc taggctgctc ttagcacacc tcttaatgct 3720

gagtgggtgg aggaggctga gctaaactac tacagaagat ggaaactgct ttgtcttagt 3780

ggtggagcct tatggcctcg ctctgggcag ggtggcagcc actcagccat gtgagtaatg 3840

agattaagtg ctggctgtga gttggggtgg gagggggagg gtgctgtgtg tagggctgtg 3900

ccttaagcct gctcagactc tggagtgcct tggccaaggc ctgataaagg aattaggtag 3960

cggagcgcca cagggctgcg tgtgggttgt gtaccatcac actgcatctg accagttgtt 4020

ctctcctgca gatcattgcc ccacctgagc gcaggtactc tgtctggatt ggaggctcta 4080

tcctggcctc cctgtccacc ttccagcaga tgtggatcag caagcaggag tacgatgaat 4140

ccggaccctc cattgtccac cgcaaatgct tctaaaccgg actgttacca acacccacac 4200

ccctgtgatg aaacaaaacc cataaatgcg cataaaacaa gacgagattg gcatggcttt 4260

atttgttttt tcttttggcg cttgactcag gattaaaaaa ctggaatggt gaaggtgtca 4320

gcagcagtct taaaatgaaa catgttggag cgaacgcccc caaagttcta caatgcatct 4380

gaggactttg attgtacatt tgtttctttt ttaatagtca ttccaaatat tgttataatg 4440

cattgttaca ggaagttact cgcctctgtg aaggcaacag cccagctggg aggagccggt 4500

accaattact ggtgttagat gataattgct tgtctgtaaa ttatgtaacc caacaagtgt 4560

ctttttgtat cttccgcctt aaaaacaaaa cacacttgat cctttttggt ttgtcaagca 4620

agcgggctgt gttccccagt gatagatgtg aatgaaggct ttacagtccc ccacagtcta 4680

ggagtaaagt gccagtatgt gggggaggga ggggctacct gtacactgac ttaagaccag 4740

ttcaaataaa agtgcacaca atagaggctt gactggtgtt ggtttttatt tctgtgctgc 4800

gctgcttggc cgttggtagc tgttctcatc tagccttgcc agcctgtgtg ggtcagctat 4860

ctgcatgggc tgcgtgctgg tgctgtctgg tgcagaggtt ggataaaccg tgatgatatt 4920

tcagcaagtg ggagttggct ctgattccat cctgagctgc catcagtgtg ttctgaagga 4980

agctgttgga tgagggtggg ctgagtgctg ggggacagct gggctcagtg ggactgcagc 5040

tgtgct 5046

<210> 17

<211> 565

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 60

gacgtcaata gtaacgccaa tagggacttt ccattgacgt caatgggtgg agtatttacg 120

gtaaactgcc cacttggcag tacatcaagt gtatcatatg ccaagtacgc cccctattga 180

cgtcaatgac ggtaaatggc ccgcctggca ttgtgcccag tacatgacct tatgggactt 240

tcctacttgg cagtacatct acgtattagt catcgctatt accatggtcg aggtgagccc 300

cacgttctgc ttcactctcc ccatctcccc cccctcccca cccccaattt tgtatttatt 360

tattttttaa ttattttgtg cagcgatggg ggcggggggg gggggggggc gcgcgccagg 420

cggggcgggg cggggcgagg ggcggggcgg ggcgaggcgg agaggtgcgg cggcagccaa 480

tcagagcggc gcgctccgaa agtttccttt tatggcgagg cggcggcggc ggcggcccta 540

taaaaagcga agcgcgcggc gggcg 565