阅读说明：本技术 利用含有nadp-依赖性甘油醛-3-磷酸脱氢酶的微生物产生l-氨基酸的方法 (Method for producing L-amino acids using microorganisms containing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase ) 是由 裵智妍 尹炳勋 权秀渊 金径林 金朱恩 卞效情 曹承铉 权娜罗 金亨俊 于 2021-01-21 设计创作，主要内容包括：本公开涉及具有增加的L-氨基酸产生能力的棒杆菌属的微生物,其含有来源于乳杆菌属的NADP-依赖性甘油醛-3-磷酸脱氢酶。根据本公开,引入来源于德氏乳杆菌保加利亚亚种的NADP-依赖性甘油醛-3-磷酸脱氢酶,以通过NADP-依赖性甘油醛-3-磷酸脱氢酶的活性增加还原力,从而增加属于棒杆菌属的菌株的产生L-氨基酸的能力。(The present disclosure relates to a microorganism of the genus Corynebacterium having increased L-amino acid-producing ability, which contains NADP-dependent glyceraldehyde-3-phosphate dehydrogenase derived from Lactobacillus. According to the present disclosure, NADP-dependent glyceraldehyde-3-phosphate dehydrogenase derived from Lactobacillus delbrueckii subsp.bulgaricus is introduced to increase the reducing power by the activity of the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, thereby increasing the L-amino acid-producing ability of the strain belonging to Corynebacterium.)

1. A method of producing an L-amino acid comprising:

culturing a microorganism of the genus Corynebacterium comprising an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO. 1 in a medium; and

recovering the L-amino acid from the cultured microorganism or the culture medium.

2. The method according to claim 1, wherein the amino acid sequence of SEQ ID NO:1 is derived from Lactobacillus delbrueckii subsp.

3. The method according to claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum (Corynebacterium glutamicum).

4. A microorganism of the genus Corynebacterium having an increased L-amino acid-producing ability, comprising an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, which comprises the amino acid sequence of SEQ ID NO 1.

5. The method of claim 4, wherein the amino acid sequence of SEQ ID NO 1 is derived from Lactobacillus delbrueckii subsp.

6. The microorganism of claim 4, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

7. Use of a microorganism of the genus Corynebacterium, which comprises an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO 1, for the production of an L-amino acid.

Technical Field

The present disclosure relates to a microorganism of the genus Corynebacterium having increased L-amino acid-producing ability, which contains NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, and a method for producing L-amino acid using the same.

Background

Microorganisms of the genus Corynebacterium (Corynebacterium sp.) are gram-positive microorganisms that are commonly used in the industrial production of substances having various uses, such as feeds, pharmaceuticals, and foods including L-amino acids and various nucleic acids. In recent years, diamines and keto acids have been produced from microorganisms of the genus Corynebacterium.

In order to produce useful products by microbial fermentation, the requirement for energy sources or reducing power is increased while enhancing the biosynthetic pathway of the desired product in the microorganism. Among them, NADPH (nicotinamide adenine dinucleotide phosphate) is an essential element for providing reducing power. Oxidized NADP⁺And reduced form NADPH is an electron transfer substance in vivo and is involved in various synthetic processes. In the central metabolic pathway, NADPH is known to be mainly produced by NADP-dependent isocitrate dehydrogenase (Icd gene) of 1) oxidative pentose phosphate pathway and 2) TCA pathway. In addition, various microorganisms have malic enzyme, glucose dehydrogenase and non-phosphorylated glyceraldehyde-3-phosphate dehydrogenase as various alternative pathways to supply NADPH.

Further, NADPH producing enzymes include transhydrogenases, ferredoxins, NADP, regardless of the central metabolic pathway⁺Oxidoreductases and the like (Spaans et al 2015, NADPH-generating systems in bacteria and archaa, front. Microbiol.6: 742).

Disclosure of Invention

[ problem ] to

The present inventors have made extensive efforts to increase the production of each amino acid in amino acid-producing microorganisms, and as a result, they have confirmed that the production of amino acids and their precursors is increased in microorganisms of the genus Corynebacterium through various studies on the introduction of NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, thereby completing the present disclosure.

[ solution ]

It is an object of the present disclosure to provide a method for producing an L-amino acid, comprising: culturing in a medium a microorganism of the genus Corynebacterium comprising an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO 1; and recovering the L-amino acid from the cultured microorganism or the culture medium.

It is another object of the present disclosure to provide a microorganism of the genus Corynebacterium having an increased L-amino acid-producing ability, which contains an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO: 1.

It is still another object of the present disclosure to provide use of a microorganism of the genus Corynebacterium, which contains NADP-dependent glyceraldehyde-3-phosphate dehydrogenase including the amino acid sequence of SEQ ID NO. 1, for producing L-amino acids.

[ advantageous effects ]

According to the present disclosure, a gene encoding gapN derived from Lactobacillus delbrueckii subsp.

Detailed Description

The present disclosure will be described in detail below. Also, each of the descriptions and embodiments disclosed herein may be applied to the other descriptions and embodiments. That is, all combinations of the various elements disclosed herein are within the scope of the present disclosure. Further, the scope of the present disclosure is not limited by the following detailed description.

In order to achieve the above object, one aspect of the present disclosure is to provide a method for producing an L-amino acid, comprising: culturing a microorganism of the genus Corynebacterium comprising an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase in a medium, the glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO. 1; and recovering the L-amino acid from the cultured microorganism or the culture medium.

In the present disclosure, the term "NADP-dependent glyceraldehyde-3-phosphate dehydrogenase" refers to a polypeptide having an activity of converting glyceraldehyde-3-phosphate as a substrate into 3-phosphoglycerate using NADP as a coenzyme. Examples of the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase may include NADP-dependent glyceraldehyde-3-phosphate dehydrogenase derived from animals, plants and bacteria. Specifically, the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase may be derived from bacteria, more specifically, from Lactobacillus (Lactobacillus sp.) and Lactobacillus bulgaricus. The NADP-dependent glyceraldehyde-3-phosphate dehydrogenase may be, for example, a polypeptide comprising the amino acid sequence of SEQ ID NO. 1. The polypeptide comprising the amino acid sequence of SEQ ID NO. 1 can be used interchangeably with the polypeptide having the amino acid sequence of SEQ ID NO. 1 or the polypeptide consisting of the amino acid sequence of SEQ ID NO. 1.

In the present disclosure, SEQ ID NO 1 refers to an amino acid sequence having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. Specifically, SEQ ID NO 1 may be a polypeptide sequence having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity encoded by gapN gene. For the purpose of the present disclosure, the polypeptide may be derived from lactobacillus, and specifically from lactobacillus delbrueckii subsp bulgaricus, but is not limited thereto, and any sequence may be included without limitation as long as it has the same activity as the above-described amino acid. The amino acid sequence of SEQ ID NO. 1 can be obtained from the known database NIH GenBank. In addition, although the polypeptide having an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity is defined as a polypeptide having the amino acid sequence of SEQ ID NO:1 in the present disclosure, it does not exclude mutations that may occur by adding a nonsense sequence upstream or downstream of the amino acid sequence of SEQ ID NO:1 or mutations that may occur naturally, or silent mutations thereof. It will be apparent to those skilled in the art that any polypeptide having the same or corresponding activity as a polypeptide comprising the amino acid sequence of SEQ ID NO. 1 may fall within the scope of the polypeptides having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity of the present disclosure. In specific examples, the polypeptide having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity of the present disclosure may be a polypeptide having the amino acid sequence of SEQ ID No. 1, or a polypeptide consisting of an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more homology or identity with the amino acid sequence of SEQ ID No. 1. Further, it is apparent that any polypeptide having an amino acid sequence in which a part of the amino acid sequence is deleted, modified, substituted or added, as long as it includes an amino acid sequence having such homology or identity and exhibiting an effect corresponding to the effect of the above-mentioned polypeptide, may also fall within the scope of the polypeptide targeted for modification of the present disclosure.

That is, in the present disclosure, although it is described as "a protein or polypeptide consisting of an amino acid sequence of a specific SEQ ID NO", it is apparent that any polypeptide having deletion, modification, substitution or addition in a part of the amino acid sequence can be used in the present disclosure as long as the polypeptide has the same or corresponding activity as that of a polypeptide consisting of an amino acid sequence of a corresponding SEQ ID NO. For example, it is apparent that "a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1" may fall within the scope of "a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1" as long as the polypeptides have the same or corresponding activity.

In the present disclosure, the gene encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase is a gapN gene, and the gene may be derived from bacteria, and more specifically, from a microorganism of the genus lactobacillus, but the microorganism is not particularly limited as long as it is a microorganism of the genus lactobacillus capable of expressing the gapN gene. In particular, the microorganism of the genus Lactobacillus may be Lactobacillus delbrueckii subspecies Bulgaria. The gene may be a nucleotide sequence encoding the amino acid sequence of SEQ ID NO. 1, and more specifically, a sequence including the nucleotide sequence of SEQ ID NO. 2, but is not limited thereto. A polynucleotide comprising the nucleotide sequence of SEQ ID NO. 2 may be used interchangeably with a polynucleotide having the nucleotide sequence of SEQ ID NO. 2 and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO. 2.

As used herein, the term "polynucleotide", which refers to a polymer of nucleotides consisting of nucleotide monomers linked by covalent bonds to a long chain, means a DNA or RNA strand having at least a certain length, and more specifically, a polynucleotide fragment encoding a modified polypeptide.

In particular, the polynucleotides of the present disclosure may be variously modified in the coding region within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of codons preferred in an organism in which the polypeptide is to be expressed. Specifically, any polynucleotide sequence encoding an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO. 1 may be included without limitation.

In addition, probes that can be prepared from known gene sequences, for example, any sequence that can hybridize under stringent conditions to a sequence complementary to all or part of a nucleotide sequence to encode a polypeptide having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity including the amino acid sequence of SEQ ID NO. 1, can be included without limitation. The term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. These conditions are specifically disclosed in the literature (see J.Sambrook et al, Molecular Cloning, A Laboratory Manual,2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M.Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, stringent conditions may include conditions in which hybridization is performed between genes having high homology or identity (homology or identity is 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, and still more specifically 99% or more), while hybridization is not performed between genes having homology or identity lower than the above, or washing conditions for Southern hybridization, i.e., at temperatures corresponding to 60 ℃,1 × SSC, and 0.1% SDS; specifically, 60 ℃, 0.1 × SSC and 0.1% SDS; and more specifically 68 ℃, 0.1 x SSC and 0.1% SDS at salt concentration and temperature, one wash, specifically two or three washes.

Although mismatches between bases are possible depending on the stringency of hybridization, hybridization requires that the two nucleotides contain complementary sequences. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Thus, the disclosure may include isolated nucleic acid fragments that are complementary to the entire sequence as well as nucleic acid sequences substantially similar thereto.

In particular, T comprised at 55 ℃ may be used under the conditions described above_mThe hybridization conditions of the hybridization step at values below are used to detect polynucleotides having homology or identity. Further, T_mThe value may be 60 ℃, 63 ℃ or 65 ℃, but is not limited thereto, and may be appropriately adjusted by those skilled in the art according to the purpose thereof.

The appropriate degree of stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, and these parameters are well known in the art (see Sambrook et al).

As used herein, the term "homology" or "identity" refers to the degree of correlation between two given amino acid sequences or nucleotide sequences, and can be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably with each other.

Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms and can be used with default gap penalties (default gap penalties) established by the program used. In essence, it is generally contemplated that a homologous or identical sequence may hybridize under moderately or highly stringent conditions to all or at least about 50%, 60%, 70%, 80%, or 90% of the entire length of the sequence. Also contemplated are polynucleotides that comprise degenerate codons in place of codons in the hybridizing polynucleotide.

For example, whether any two polynucleotide sequences have homology, similarity, or identity can be determined using default parameters by known computer algorithms (e.g., "FASTA" program (Pearson et al, (1988) Proc. Natl. Acad. Sci. USA 85: 2444.) alternatively, it can be determined by performing The Needleman-Wunsch algorithm (preferably, 5.0.0 or higher version thereof) using The EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al, 2000, Trends Genet.16: 276-277) (preferably, 5.0.0.0 or higher version thereof) to determine (GCG program package (Devereux, J. et al, dieische Acidech 12: 387. 48: 443. 453), homology, similarity, or identity (see FAS. J. Biols et al., USA. J. 48: 1990, 1988, Mash. 65, Mash. J. 11, 1988, Mash. J. 11, 1994, see No. 5.0.0.0.0.0.0., Similarity, or identity, can be determined using BLAST or ClustalW from the National Center for Biotechnology Information (NCBI).

The homology, similarity, or identity of a polynucleotide or polypeptide can be determined by comparing sequence information using, for example, the GAP computer program disclosed in Smith and Waterman, adv.Appl.Math (1981)2:482 (e.g., Needleman et al, (1970), J Mol biol.48: 443). In summary, the GAP program defines homology, similarity, or identity as the value obtained by dividing the number of aligned symbols (i.e., nucleotides or amino acids) that are similar by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include: (1) unary comparison matrices (containing a value Of 1 for identity And a value Of 0 for non-identity) And Gribskov et al, published as Schwartz And Dayhoff, eds., Atlas Of Protein Sequence And Structure, National biological Research Foundation, pp.353-358 (1979)) (1986) weighted comparison matrices Of Nucl. acids Res.14:6745 (or EDNAFULL substitution matrices (EMBOSS version Of NCBI NUC 4.4)); (2) a penalty of 3.0 per gap and an additional 0.10 per symbol per gap (or a gap open penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

Further, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity to each other can be identified by comparing the sequences in a Southern hybridization experiment under defined stringency conditions, and the appropriate hybridization conditions defined are within the scope of the corresponding techniques and can be determined by methods well known to those of skill in the art (e.g., J.Sambrook et al, Molecular Cloning, A Laboratory Manual, 2)^ndEdition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; m. Ausubel et al, Current Protocols in Molecular Biology, John Wiley&Sons,Inc.,New York)。

The gene encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase can be introduced into a microorganism of Corynebacterium by a conventional method known in the art, and the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase can be expressed in a microorganism of Corynebacterium.

As used herein, the term "to be expressed/being expressed" refers to a state in which a polypeptide of interest is introduced into a microorganism or in which a polypeptide of interest is modified to be expressed in a microorganism. For the purposes of this disclosure, a "polypeptide of interest" may be an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase as described above.

Specifically, as used herein, the term "introduction of a polypeptide" means that a microorganism exhibits an activity of a polypeptide of interest that the microorganism does not otherwise possess. For example, it may mean that a polynucleotide encoding a polypeptide of interest is introduced into a chromosome of a microorganism, or a vector containing a polynucleotide encoding a polypeptide of interest is introduced into a microorganism, and thereby exhibits its activity. Even if the polypeptide of interest is already present in the microorganism, the expression or activity of the polypeptide in the microorganism can be increased or enhanced as compared to a non-modified microorganism due to the introduction of the polypeptide of interest into the microorganism.

In addition, as used herein, the term "enhancement of activity" means that the activity of a particular protein in a microorganism is enhanced over the activity of a polypeptide in its endogenous activity or in a non-modified microorganism. As used herein, the term "endogenous activity" refers to the activity of a particular protein that a parent strain originally had prior to transformation when the trait of a microorganism is altered due to genetic modification by natural or human factors.

Specifically, the enhancement of the activity may be achieved by one or more methods selected from the group consisting of: methods of introducing a polypeptide into a microorganism, methods of increasing the intracellular copy number of a gene encoding a polypeptide; a method of introducing a modification into an expression regulatory sequence of a gene encoding a polypeptide; a method of replacing an expression regulatory sequence of a gene encoding a polypeptide with a sequence having strong activity, and a method of further introducing a modification into a gene encoding a polypeptide such that the activity of the polypeptide is enhanced, but is not limited thereto.

Among the above, the method of introducing a polypeptide into a microorganism or the method of increasing the intracellular copy number of a gene may be performed by inserting a polynucleotide encoding the polypeptide into a chromosome or plasmid of the microorganism using a vector, but is not particularly limited thereto. In particular, the methods can be performed by introducing a vector operably linked to a polynucleotide encoding a polypeptide of the disclosure and capable of replication and function independently of the host cell. Alternatively, the method may be performed by introducing a vector into the chromosome of the host cell, the vector being capable of inserting the polynucleotide into the chromosome of the host cell and being operably linked to the polynucleotide. Insertion of the polynucleotide into the chromosome can be achieved by methods known in the art (e.g., by homologous recombination).

Next, modification of the expression control sequence to increase expression of the polynucleotide may be conducted by inducing modification of the sequence by deletion, insertion, non-conservative or conservative substitution of the nucleotide sequence or a combination thereof to further enhance the activity of the expression control sequence, or by replacing the polynucleotide sequence with a nucleic acid sequence having stronger activity, but is not particularly limited thereto. The expression control sequence may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating termination of transcription and translation.

In particular, a strong promoter (instead of the original promoter) may be linked to a region upstream of the expression unit of the polynucleotide. Examples of the strong promoter may include cj1 to cj7 promoter (Korean patent No. 10-0620092), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (Korean patent No. 10-1783170), O2 promoter (Korean patent No. 10-1632642), tkt promoter, and ycA promoter, but are not limited thereto.

In addition, although not particularly limited thereto, modification of the polynucleotide sequence on the chromosome may be performed by deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence or a combination thereof, inducing modification on the expression control sequence to further enhance the activity of the polynucleotide sequence, or by replacing the polynucleotide sequence with a polynucleotide sequence modified to have stronger activity.

The introduction and enhancement of the activity of a polypeptide may be, but is not limited to, an increase in the activity or concentration of the corresponding polypeptide compared to the activity or concentration of the polypeptide in a wild-type or non-modified microbial strain.

Specifically, the introduction or enhancement of the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity can be achieved by preparing a recombinant vector containing a gene encoding the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase for expression, and introducing the vector into a microorganism of Corynebacterium to produce a transformed microorganism of Corynebacterium. That is, the microorganism containing the gene encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase may be a recombinant microorganism produced by transformation with a vector containing the gene, but is not limited thereto.

As used herein, the term "vector" refers to a DNA product containing the appropriate control sequences and nucleotide sequences for a polypeptide of interest for expression of the polypeptide of interest in a suitable host. The control sequences may include a promoter capable of initiating transcription, any operator sequence for controlling transcription, sequences encoding appropriate mRNA ribosome binding sites, and sequences which control termination of transcription and translation. Once transformed into a suitable host cell, the vector may replicate or function independently of the host genome, or may integrate into the host genome itself.

The vector used in the present disclosure is not particularly limited as long as it can replicate in a host cell, and any vector known in the art may be used. Examples of commonly used vectors may include natural or recombinant plasmids, cosmids, viruses, and phages. For example, as phage vectors or cosmid vectors, pWE15, M13, λ EMBL3, λ EMBL4, λ FIXII, λ DASHII, λ ZAPII, λ gt10, λ gt11, MBL3, MBL4, xii, ASHII, APII, t10, t11, Charon4A, and Charon 21A; and as the plasmid vector, those based on pBR, pUC, pBluescriptII, pGEM, pTZ, pET, pMal, pQE, and pCL can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors can be used.

The recombinant vector for expressing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase can be prepared by a conventional method. That is, it can be prepared by ligating the gene sequence of NADP-dependent glyceraldehyde-3-phosphate dehydrogenase to an appropriate vector using a restriction enzyme.

A polynucleotide encoding a polypeptide of interest may be inserted into the chromosome using a recombinant vector for polypeptide expression. The insertion of the polynucleotide into the chromosome may be performed by any method known in the art (e.g., by homologous recombination), but the method is not limited thereto. In addition, the vector may further comprise a selection marker to confirm whether or not insertion into the chromosome is performed. Selection markers are used to select cells transformed with the vector, i.e., to confirm whether the nucleic acid molecule of interest has been inserted, and markers that provide a selectable phenotype, such as resistance, auxotrophy (auxotrophy), tolerance to a cytotoxic agent, or expression of a surface polypeptide, can be used. In the case of treatment with a selection agent, only cells expressing the selection marker will survive or express other phenotypic traits and transformed cells can thus be selected.

As used herein, the term "transformation" refers to the introduction of a vector comprising a polynucleotide encoding a polypeptide of interest into a host cell such that the polypeptide encoded by the polynucleotide can be expressed in the host cell. It is not important whether the transformed polynucleotide is integrated into and located extrachromosomally in the chromosome of the host cell, so long as the transformed polynucleotide can be expressed in the host cell, and both can be included. Further, the polynucleotide may include DNA and RNA encoding the protein of interest. The polynucleotide may be introduced in any form as long as it can be introduced into and expressed in a host cell. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct that includes all of the elements required for its autonomous expression. The expression cassette can generally include a promoter, a transcription terminator, a ribosome binding site, and a translation terminator operably linked to the polynucleotide. The expression cassette may be in the form of a self-replicating expression vector. In addition, the polynucleotide may be introduced into the host cell as it is and operably linked to a sequence required for expression in the host cell, but is not limited thereto.

In addition, as used herein, the term "operably linked" means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a polypeptide of interest of the present disclosure.

Methods of transforming the vectors of the present disclosure include any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique known in the art according to the host cell. For example, the method may comprise electroporation, calcium phosphate (CaHPO)₄) Precipitate, calcium chloride (CaCl)₂) Precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, and the like, but are not limited thereto.

For the purpose of the present disclosure, a microorganism of the genus Corynebacterium, which is genetically modified to express an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase comprising the amino acid sequence of SEQ ID NO:1, may be a microorganism having an increased L-amino acid-producing ability as compared to a non-modified microorganism.

As used herein, the term "L-amino acid-producing microorganism" or "microorganism of the genus Corynebacterium which produces L-amino acids" includes all microorganisms or microorganisms of the genus Corynebacterium in which natural or artificial genetic modification occurs, and as a microorganism having a specific attenuation or enhancement mechanism due to insertion of foreign genes or activity enhancement or inactivation of endogenous genes, may refer to a microorganism of the genus Corynebacterium in which genetic mutation occurs or in which activity is enhanced in order to produce desired L-amino acids.

Specifically, the L-amino acid-producing microorganism may be a microorganism in which the desired L-amino acid-producing ability is enhanced due to an increase in activity of a part of the polypeptide involved in the desired L-amino acid biosynthesis pathway or a decrease in activity of a part of the polypeptide involved in the desired L-amino acid degradation pathway. For example, the microorganism may be one in which the activity of aspartokinase (lysC), homoserine dehydrogenase (hom), L-threonine dehydratase (ilvA), 2-isopropylmalate synthase (leuA), acetolactate synthase (ilvN) or/and homoserine O-acetyltransferase (metX) is enhanced. In addition, the microorganism may include, for example, a gene or polypeptide that is modified to have resistance to feedback inhibition to enhance activity. Further, the microorganism may, for example, have an activity of attenuating or inactivating various genes or polypeptides which degrade a desired L-amino acid. In addition, the microorganism may be, for example, a microorganism having an increased L-amino acid-producing ability due to random mutation, but is not limited thereto. That is, the microorganism may be one in which production of a desired L-amino acid is increased by enhancing the activity of a polypeptide involved in the biosynthetic pathway of the desired L-amino acid or by inactivating/attenuating the activity of a polypeptide involved in the degradation pathway.

As described above, the activity of a polypeptide can be enhanced by increasing the intracellular copy number of the gene encoding the polypeptide; by introducing a mutation into a chromosomal gene encoding a polypeptide and/or an expression control sequence thereof; by replacing a gene expression regulatory sequence on a chromosome encoding the polypeptide with a sequence having strong activity; increasing expression of the polypeptide or having resistance to feedback inhibition by introducing a mutation into a portion of the gene on the chromosome encoding the polypeptide; or a combination thereof, but is not limited thereto.

As used herein, the term "attenuation/inactivation of the activity of a polypeptide" means that the native wild-type strain, parent strain or corresponding polypeptide does not express an enzyme or polypeptide, or has no activity or reduced activity, if expressed, as compared to the non-modified strain. In this case, the reduction is a comprehensive concept including a case where the activity of the polypeptide itself is reduced as compared with the activity of the polypeptide originally possessed by the microorganism due to mutation of a gene encoding the polypeptide, modification of an expression regulatory sequence, deletion of a part or all of the gene, or the like; a situation in which the overall level of intracellular polypeptide activity is reduced compared to the native strain or the pre-modified strain due to inhibition of expression or inhibition of translation of the gene encoding the polypeptide; and combinations thereof. In the present disclosure, inactivation may be achieved by applying various methods known in the art. Examples of methods may include methods for deleting a portion of a gene encoding a polypeptide orAll methods; methods for modifying expression regulatory sequences such that gene expression is reduced; methods for modifying a gene sequence encoding a polypeptide such that the activity of the polypeptide is removed or attenuated; a method of introducing an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of a gene encoding a polypeptide; incorporation upstream of Shine-Dalgarno sequence of the gene encoding the polypeptide (binding,) A sequence complementary to Shine-Dalgarno sequence to form a secondary structure, thereby inhibiting ribosome attachment; and a Reverse Transcription Engineering (RTE) method for incorporating a promoter at the 3' end of an Open Reading Frame (ORF) of a polynucleotide sequence of a gene encoding a polypeptide for reverse transcription; and combinations thereof.

However, as examples of the above-mentioned methods, a method for enhancing or inactivating the activity of a polypeptide and a method for genetic manipulation are known in the art, and L-amino acid-producing microorganisms can be prepared by applying various known methods.

As described above, for the purpose of the present disclosure, a microorganism of the genus Corynebacterium, which produces L-amino acids and contains NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, can produce desired L-amino acids in excess from a carbon source in a medium, as compared to a non-modified wild-type strain or a non-modified mutant. In the present disclosure, "L-amino acid-producing microorganism of the genus Corynebacterium" may be used interchangeably with "a strain of the genus Corynebacterium having L-amino acid-producing ability" or "a strain of the genus Corynebacterium producing L-amino acid".

The microorganism of the genus Corynebacterium which produces an L-amino acid, which is modified to express a polypeptide having the activity of NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, is not limited as long as it is a microorganism of the genus Corynebacterium which produces an L-amino acid. Specifically, the microorganism of the genus Corynebacterium may be selected from the group consisting of Corynebacterium glutamicum (Corynebacterium glutamicum), Corynebacterium ammoniagenes (Corynebacterium ammoniagenes), Corynebacterium crenatum (Corynebacterium crenulatum), Corynebacterium dissymanum (Corynebacterium depersti), Corynebacterium hepaticum (Corynebacterium efficiens), Corynebacterium stonemale (Corynebacterium calophyllum), Corynebacterium stasis (Corynebacterium stasis), Corynebacterium unicum (Corynebacterium sinense), Corynebacterium halodurans (Corynebacterium halodurans), Corynebacterium striatum (Corynebacterium striatum), Corynebacterium luteum (Corynebacterium luteum), Corynebacterium mimosum (Corynebacterium pseudobacterium), Corynebacterium testinum (Corynebacterium testinum), and Corynebacterium flavum (Corynebacterium luteum), and may be specifically, but not limited to any one or more.

The microorganism of the genus Corynebacterium which produces L-amino acids may be a recombinant microorganism. The recombinant microorganism is as described above.

As used herein, the term "culturing" means growing a microorganism under appropriately regulated environmental conditions. The culturing process of the present disclosure can be performed according to suitable medium and culture conditions known in the art. Such a cultivation process can be easily adjusted for use by those skilled in the art according to the strain to be selected. Specifically, the culture may be a batch culture, a continuous culture, and a fed-batch culture, but is not limited thereto.

As used herein, the term "medium" refers to a mixture of substances that contains nutrients required for culturing microorganisms as a main component, and it provides nutrients and growth factors, as well as water necessary for survival and growth. Specifically, the medium and other culture conditions for culturing the microorganism of the present disclosure may be any medium used for conventional microorganism culture, without any particular limitation. However, the microorganism of the present disclosure can be cultured under aerobic conditions in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid and/or vitamin while adjusting temperature, pH and the like. In particular, media for strains of the genus Corynebacterium may be found in the literature ("Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)).

In the present disclosure, the carbon source may include carbohydrates such as glucose, cane sugar, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol, sorbitol, and the like; organic acids such as pyruvic acid, lactic acid, citric acid, and the like; and amino acids such as glutamic acid, methionine, lysine, and the like. In addition, the carbon source may include natural organic nutrients such as starch hydrolysate, molasses, brown sugar paste, rice bran, cassava, sugarcane molasses, corn steep liquor, etc.). Specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and in addition, various other carbon sources may be used in appropriate amounts without limitation. These carbon sources may be used alone or in a combination of two or more, but are not limited thereto.

The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate and the like; amino acids such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in a combination of two or more, but are not limited thereto.

The phosphorus source may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or the corresponding sodium-containing salts, and the like. Examples of the inorganic compound may include sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, and the like. In addition, amino acids, vitamins and/or appropriate precursors may also be included. These constituents or precursors may be added to the medium in batch culture or in a continuous manner, but the phosphorus sources are not limited thereto.

In the present disclosure, the pH of the medium may be adjusted by adding a compound (such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc.) to the medium in an appropriate manner during the culture of the microorganism. In addition, during the culture, a defoaming agent (e.g., fatty acid polyglycol ester) may be added to prevent the generation of foam. In addition, in order to maintain the culture medium aerobic state, can be injected into the culture medium oxygen or oxygen containing gas; or, in order to maintain the anaerobic or microaerobic state of the medium, nitrogen, hydrogen or carbon dioxide gas may be injected without injecting gas, but the gas is not limited thereto.

The temperature of the medium may range from 20 ℃ to 45 ℃, and specifically from 25 ℃ to 40 ℃, but is not limited thereto. The culturing may be continued until a desired amount of useful material is obtained, and specifically 10 to 160 hours, but is not limited thereto.

The L-amino acid produced by the culture may be released into the medium, or may not be released and remain in the cells.

In the method of recovering an L-amino acid produced in culture of the present disclosure, a desired L-amino acid may be collected from the culture broth using an appropriate method known in the art according to the culture method. For example, methods such as centrifugation, filtration, ion exchange chromatography, crystallization, and HPLC may be used, and the desired L-amino acid may be recovered from the culture medium or the microorganism using an appropriate method known in the art.

Further, the recovery may further comprise a purification process, which may be performed using an appropriate method known in the art. Thus, the recovered L-amino acid may be in a purified state or in a fermentation broth of a microorganism containing the L-amino acid (Introduction to Biotechnology and Genetic Engineering, A.J.Nair., 2008).

The L-amino acid produced by the method for producing an L-amino acid according to the present disclosure is not limited by type. That is, L-amino acids that can be produced from microorganisms of the genus Corynebacterium may include any L-amino acid without limitation, and may also include intermediates of L-amino acids. The L-amino acid may be, for example, L-arginine, L-histidine, L-lysine, L-aspartic acid, L-glutamic acid, L-serine, L-threonine, L-asparagine, L-glutamine, L-tyrosine, L-alanine, L-isoleucine, L-leucine, L-valine, L-phenylalanine, L-methionine, L-tryptophan, glycine, L-proline and L-cysteine, and may be specifically L-lysine, L-threonine, L-isoleucine, L-leucine, L-valine, L-arginine and L-glutamic acid, but is not limited thereto. The intermediate of the L-amino acid may be, for example, O-acetylhomoserine, but is not limited thereto.

Another aspect of the present disclosure is to provide a microorganism of the genus Corynebacterium having an increased L-amino acid-producing ability, which contains an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase including the amino acid sequence of SEQ ID NO. 1.

NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, a gene encoding the enzyme, its expression and a microorganism of the genus Corynebacterium are as described above.

In the present disclosure, a microorganism of the genus Corynebacterium, which contains a gene encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, may have an increased or improved L-amino acid-producing ability as compared to a non-modified microorganism due to the expression of NADP-dependent glyceraldehyde-3-phosphate dehydrogenase.

The microorganism of the genus Corynebacterium of the present disclosure is a microorganism capable of producing an L-amino acid, and may include not only a wild-type microorganism but also a microorganism genetically modified to improve L-amino acid-producing ability. The L-amino acid-producing microorganism is as described above.

The microorganism of the present disclosure is a recombinant microorganism containing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase derived from Lactobacillus, and can produce a desired L-amino acid from a carbon source in an excess amount in a culture medium, as compared with a microorganism not containing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase. The increased L-amino acid-producing ability of the recombinant microorganism can be obtained with increased reducing power by activating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase. That is, by introducing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase into a microorganism of Corynebacterium that produces L-amino acids, the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase is activated, so that NADP can be used instead of NAD as a coenzyme, and accordingly the amount of NADPH can be increased, which can then be used for reducing power as an energy source in the biosynthesis of L-amino acids.

In the present disclosure, the term "non-modified microorganism" may refer to a native strain itself, a microorganism not containing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, or a microorganism which is not transformed with a vector containing a polynucleotide encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, but is not limited thereto.

The L-amino acid is as described above.

The microorganism of Corynebacterium, in which the L-amino acid-producing ability is increased by introducing the gene encoding NADP-dependent glyceraldehyde-3-phosphate dehydrogenase according to the present disclosure, may be any one selected from the microorganisms of Corynebacterium deposited with the accession No. KCCM12580P, the accession No. KCCM12581P, the accession No. KCCM12582P, the accession No. KCCM12583P, the accession No. KCCM12584P, the accession No. KCCM12585P, the accession No. KCCM12586P, or the accession No. KCCM 12587P.

A further aspect of the present disclosure is to provide a use of a microorganism of the genus Corynebacterium, which contains NADP-dependent glyceraldehyde-3-phosphate dehydrogenase including the amino acid sequence of SEQ ID NO. 1, for producing L-amino acids.

NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, a gene encoding the enzyme, its expression, a microorganism of the genus Corynebacterium comprising NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (which comprises the amino acid sequence of SEQ ID NO:1), and L-amino acids are as described above.

[ means for carrying out the invention ]

Hereinafter, the present disclosure will be described in detail by examples. However, it will be apparent to those skilled in the art to which the present disclosure pertains that these embodiments are provided for illustrative purposes only, and the scope of the present invention is not intended to be limited thereto.

Example 1-1 NADP-dependent Glycerol for the origin Lactobacillus delbrueckii subsp.bulgaricus ATCC11842 Preparation of vector for transposon in aldehyde-3-phosphate dehydrogenase (gapN (L)) introduced into chromosome of microorganism of Corynebacterium genus

The NADP-dependent glyceraldehyde-3-phosphate dehydrogenase from Lactobacillus delbrueckii subsp. Thereafter, in order to enhance the activity thereof, the following experiment was performed.

The amino acid sequence (SEQ ID NO:1) and nucleotide sequence (SEQ ID NO:2) of the Ldb1179 gene encoding gapN derived from Lactobacillus delbrueckii subspecies bulgaricus ATCC11842 were obtained from NIH GenBank.

Further, in order to introduce Ldb1179 gene into chromosome using transposon gene region of microorganism of Corynebacterium genus, four vectors for transformation were each prepared and cj7 (Korean patent No. 10-0620092) was used as promoter.

1-1-1) pDZ2457 preparation of P (cj7) -gapN (L) vector

The Ldb1179 gene was amplified into a gene fragment of about 1.43kb by modifying the initiation codon TTG to ATG using the primers of SEQ ID NOS:3 and 4 based on the chromosome of Lactobacillus delbrueckii subspecies bulgaricus ATCC11842 strain as a template (Table 1). At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute and 30 seconds). This PCR product was electrophoresed in 0.8% agarose gel, and then a band of about 1.4kb was eluted and purified. Further, PCR was performed on the cj7 promoter region under the same conditions using a pair of primers of SEQ ID NOS.5 and 6 to obtain a PCR product. At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds). The PCR product obtained above was subjected to fusion cloning. Use ofThe cloning kit (Clontech) was used for fusion cloning. The resulting plasmid was designated pDZ2457: P (cj7) -gapN (L).

The vector was used to introduce gapN into lysine, leucine or acetylhomoserine producing strains.

1-1-2) preparation of pDZ 1108P (cj7) -gapN (L) vector

The Ldb1179 gene was amplified to a gene fragment of about 1.43kb by modifying the initiation codon TTG to ATG using primers of SEQ ID NOS:3 and 7 based on the chromosome of Lactobacillus delbrueckii subspecies bulgaricus ATCC11842 strain as a template (Table 1). At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute and 30 seconds). This PCR product was electrophoresed in 0.8% agarose gel, and then a band of about 1.4kb was eluted and purified. Further, using SEQ ID NO:a pair of primers of 8 and 6 was subjected to PCR on the cj7 promoter region under the same conditions to obtain a PCR product. At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds). The PCR product obtained above was subjected to fusion cloning. Use ofThe cloning kit (Clontech) was used for fusion cloning. The resulting plasmid was designated pDZ1108: P (cj7) -gapN (L).

A vector was used to introduce gapN into isoleucine-or threonine-producing strains.

1-1-3) preparation of pDZTn5, P (cj7) -gapN (L) vector

The Ldb1179 gene was amplified into a gene fragment of about 1.43kb by modifying the initiation codon TTG to ATG using the primers of SEQ ID NOS:3 and 10 based on the chromosome of Lactobacillus delbrueckii subspecies bulgaricus ATCC11842 strain as a template (Table 1). At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute and 30 seconds). This PCR product was electrophoresed in 0.8% agarose gel, and then a band of about 1.4kb was eluted and purified. Further, PCR was performed on the cj7 promoter region under the same conditions using a pair of primers of SEQ ID NOS: 9 and 6 to obtain a PCR product. At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds). The PCR product obtained above was subjected to fusion cloning. Use ofThe cloning kit (Clontech) was used for fusion cloning. The resulting plasmid was designated pDZTn5: (P (cj7) -gapN (L).

The vector was used to introduce gapN into valine or arginine producing strains.

1-1-4) preparation of pDZ 0286P (cj7) -gapN (L) vector

Based on the chromosome of Lactobacillus delbrueckii strain ATCC11842 as a template, primers of SEQ ID NOS:3 and 12 were used by mixingThe start codon TTG was modified to ATG, and the Ldb1179 gene was amplified into a gene fragment of about 1.43kb (Table 1). At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute and 30 seconds). This PCR product was electrophoresed in 0.8% agarose gel, and then a band of about 1.4kb was eluted and purified. Further, PCR was performed on the cj7 promoter region under the same conditions using a pair of primers of SEQ ID NOS: 11 and 6 to obtain a PCR product. At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds). The PCR product obtained above was subjected to fusion cloning. Use ofThe cloning kit (Clontech) was used for fusion cloning. The resulting plasmid was designated pDZ0286: P (cj7) -gapN (L).

gapN was introduced into a glutamic acid-producing strain using a vector.

[ Table 1]

SEQ ID NO:	Sequence (5 '-3')
		3	CCCAACGAAAGGAAACACTCATGACAGAACACTATTTAAA
4	GCTTGTGAATAAGCCTGCCCTTAGTCTTCGATGTTGAAGACAACG
		5	GATTCCAGGTTCCTTAACCCAGAAACATCCCAGCGCTACT
6	TTTAAATAGTGTTCTGTCATGAGTGTTTCCTTTCGTTGGG
		7	TTTCGTGCGAGTCTAGAAGTTTAGTCTTCGATGTTGAAGA
8	ACGAGGTCAGCATCTCGAGTAGAAACATCCCAGCGCTACT
		9	CGCGGAACTGTACTAGTAGAAACATCCCAGCGCTAC
10	GGAAGGATATCTCTAGAAGATAAAACGAAAGGCC
		11	CCCTTCCGGTTTAGTACTAGAAACATCCCAGCGCTA
12	CTCTTCCTGTTTAGTACTTTAGTCTTCGATGTTGAAG

Examples 1-2 NADP-Yl for the isolation of Streptococcus mutans (Streptococcus mutans) ATCC25175 Vector for introducing lysine glyceraldehyde-3-phosphate dehydrogenase (gapN (S)) into transposon on chromosome of microorganism of genus Corynebacterium Preparation of bodies

As a control group of gapN derived from Lactobacillus delbrueckii subsp.bulgaricus ATCC11842, the following experiment was conducted in order to introduce SMUFR 0590 having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity in Streptococcus mutans ATCC25175 (Korean patent No. 10-1182033).

The amino acid sequence (SEQ ID NO:13) and nucleotide sequence (SEQ ID NO:14) of SMUFR 0590 gene encoding gapN derived from Streptococcus mutans ATCC25175 were obtained from NIH GenBank, and a vector for introducing SMUFR 0590 expressed by cj7 promoter into transposon gene was prepared.

As in example 1-1, pDZ was used as a vector for transformation, and cj7 was used as a promoter. The SMUFR 0590 gene from Streptococcus mutans ATCC25175 was amplified to a gene fragment of about 1.7kb using primers of SEQ ID NOS: 15 and 16 based on pECCG122-Pcj7-gapN (Korean patent No. 10-1182033) as a template (Table 2). At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 2 minutes). This PCR product was electrophoresed in a 0.8% agarose gel, and then bands of the desired size were eluted and purified. The PCR product obtained above was subjected to fusion cloning. Use ofThe cloning kit (Clontech) was used for fusion cloning. The resulting plasmid was designated pDZTn:: P (cj7) -gapN (S).

[ Table 2]

SEQ ID NO:	Sequence (5 '-3')
		15	TAGATGTCGGGCCCCATATGAGAAACATCCCAGCGCTACT
16	GCCAAAACAGCCTCGAGTTATTTGATATCAAATACGACGGATTTA

Examples 1-3 NADP-IyI for Clostridium acetobutylicum (Clostridium acetobutylicum) sources Vector for introducing lysine glyceraldehyde-3-phosphate dehydrogenase (gapN (C)) into transposon on chromosome of microorganism of genus Corynebacterium Preparation of bodies

As a control group of gapN derived from Lactobacillus delbrueckii subsp.bulgaricus ATCC11842, the following experiment was conducted in order to introduce gapN of NCBI GenBank WP _010966919.1 having NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity in Clostridium acetobutylicum.

The amino acid sequence (SEQ ID NO:35) and nucleotide sequence (SEQ ID NO:36) of the gapN gene of NCBI GenBank WP _010966919.1 and NCBI GenBank NC _015687.1 derived from Clostridium acetobutylicum were obtained from NCBI GenBank, and a vector for introducing the gapN gene of NCBI GenBank WP _010966919.1 expressed by cj7 promoter into the transposon gene was prepared.

As in example 1-1, pDZ was used as a vector for transformation, and cj7 was used as a promoter. The gapN gene of NCBI GenBank WP _010966919.1 derived from Clostridium acetobutylicum was amplified to a gene fragment of about 1.5kb using primers of SEQ ID NOS: 37 and 38 based on gDNA of Clostridium acetobutylicum as a template. In addition, in order to obtain the cj7 promoter, the gapN gene was amplified to a gene fragment of about 400bp, based on pECCG122-Pcj7-gapN (Korean patent No. 10-1182033) as a template, using primers of SEQ ID NOS: 15 and 39. At this time, PCR was performed by repeating 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 2 minutes). This PCR product was electrophoresed in a 0.8% agarose gel, and then bands of the desired size were eluted and purified. The PCR product obtained above was subjected to fusion cloning. Use ofThe cloning kit (Clontech) was used for fusion cloning. The resulting plasmid was designated pDZTn:: P (cj7) -gapN (C).

[ Table 3]

SEQ ID NO:	Sequence (5 '-3')
		37	ACCCAACGAAAGGAAACACTCatgtttgaaaatatatcatcaaa
38	GCCAAAACAGCCTCGAGttataggtttaaaactattgatt
		39	tttgatgatatattttcaaacatGAGTGTTTCCTTTCGTTGGGT

Example 2-1 introduction of gapN (L), gapN (S) or gapN into L-lysine-producing Strain KCCM11016P (C) Preparation of the Strain of (1) and evaluation thereof

In order to confirm the effect of the introduction of gapN derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans (S.mutans) on the L-lysine-producing ability based on the Corynebacterium glutamicum ATCC13032 strain, the plasmids prepared in examples 1-1-1, examples 1-2, and examples 1-3 were introduced into Corynebacterium glutamicum KCCM110 11016P (Korean patent No. 10-0159812) by electroporation to obtain a transformant mutant, and the transformant was spread on BHIS plate medium (37g/L brain-heart infusion, 91g/L sorbitol, 2% agar) containing kanamycin (25. mu.g/mL) and X-gal (5-bromo-4-chloro-3-indol-. beta. -D-galactoside) and cultured to form colonies. Blue colonies were selected from the colonies thus formed to select strains introduced with P (cj7) -gapN (L), P (cj7) -gapN (S), or P (cj7) -gapN (C).

The colonies thus selected were designated KCCM11016P: P (cj7) -gapN (L), KCCM11016P: P (cj7) -gapN (S), and KCCM11016P: P (cj7) -gapN (C), respectively.

The prepared strains were cultured in the following manner to compare lysine-producing ability. Each strain was inoculated into a 250mL corner-baffle flask (corner-baffle flash) containing 25mL of seed medium (seed medium) and cultured with shaking at 200rpm at 30 ℃ for 20 hours. Then, 1mL of the seed culture was inoculated into a 250mL Erlenmeyer flask containing 24mL of production medium (production medium), and cultured with shaking at 200rpm at 32 ℃ for 72 hours. The compositions of the seed medium and the production medium are shown below.

< seed culture Medium (pH 7.0) >

20g glucose, 10g peptone, 5g yeast extract, 1.5g urea, 4g KH₂PO₄、8g K₂HPO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1000. mu.g thiamine-HCl, 2000. mu.g calcium pantothenate, 2000. mu.g nicotinamide (based on 1L of distilled water)

< production Medium (pH 7.0) >

100g glucose, 40g (NH)₄)₂SO₄2.5g of soy protein, 5g of corn steep solids (corn steep solids), 3g of urea and 1g of KH₂PO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1000. mu.g thiamine-HCl, 2000. mu.g calcium pantothenate, 3000. mu.g nicotinamide, 30g CaCO₃(distilled water based on 1L)

After completion of the culture, L-lysine-producing ability was measured by HPLC. The concentration and concentration increase rate of L-lysine in the culture solution for each of the strains tested are shown in Table 4.

[ Table 4]

Strain name	L-lysine concentration (g/L)	L-lysine concentration increase rate (%)
			KCCM11016P	43g/L	-
KCCM11016P::P(cj7)-gapN(S)	50g/L	16％
			KCCM11016P:::P(cj7)-gapN(L)	52g/L	20％
KCCM11016P:::P(cj7)-gapN(C)	47g/L	9％

As shown in Table 4, it was confirmed that the concentration of L-lysine was increased by about 16% in KCCM11016P: P (cj7) -gapN (S), by about 20% in KCCM11016P: P (cj7) -gapN (L), and by about 9% in KCCM11016P: P (cj7) -gapN (C), in which the gapN gene was introduced into KCCM11016P: P (cj7) -gapN (S), KCCM11016P: P (cj7) -gapN (L) and KCCM11016P: P (cj7) -gapN (C), as compared with the L-lysine-producing strain KCCM 11016P.

KCCM11016P, P (cj7) -gapN (L) is named as CA01-7528 and is deposited under Budapest treaty at 9/2.2019 with the number KCCM12585P in Korean Culture Center of Microorganisms.

Example 2-2 introduction of gapN (L), gapN (S) or gapN into L-lysine-producing Strain KCCM11347P (C) Preparation of the Strain of (1) and evaluation thereof

In order to confirm lysine-producing ability in other lysine-producing strains belonging to Corynebacterium glutamicum, strains introduced into KCCM11347P (Korean patent No. 10-0073610) as an L-lysine-producing strain were prepared in the same manner as in the above-described example 2-1 using the plasmid prepared in example 1-1-1, the plasmid prepared in example 1-2, and the plasmid prepared in example 1-3, and were respectively designated KCCM11347P:: P (cj7) -gapN (L), KCCM11347P: P (cj7) -gapN (S), and KCCM11347P: P (cj7) -gapN (C).

The thus-prepared strain was cultured in the same manner as in example 2-1 described above, and L-lysine-producing ability was measured by HPLC after completion of the culture. The concentration and concentration increase rate of L-lysine in the culture solution for each of the tested strains are shown in Table 5.

[ Table 5]

Strain name	L-lysine concentration (g/L)	L-lysine concentration increase rate (%)
			KCCM11347P	38g/L	-
KCCM11347P::P(cj7)-gapN(S)	43g/L	14％
			KCCM11347P:::P(cj7)-gapN(L)	45g/L	19％
KCCM11347P:::P(cj7)-gapN(C)	40g/L	5％

As shown in Table 5, it was confirmed that the concentration of L-lysine was increased by about 14% in KCCM11347P: P (cj7) -gapN (S), by about 19% in KCCM11347P: P (cj7) -gapN (L), and by about 5% in KCCM11347P: P (cj7) -gapN (C), in which the gapN gene was introduced into both KCCM11347P: P (cj7) -gapN (S), KCCM11347P: P (cj7) -gapN (L) and KCCM11347P: P (cj7) -gapN (C), as compared with L-lysine-producing strain KCCM 11347P.

Example 2-3 introduction of the bacterium gapN (L), gapN (S) or gapN (C) into L-lysine-producing Strain CJ3P Preparation of the strains and evaluation thereof

In order to confirm the effect in other lysine-producing strains belonging to Corynebacterium glutamicum, the plasmids prepared in example 1-1-1, the plasmids prepared in example 1-2, and the plasmids prepared in example 1-3 were used to prepare strains introduced into Corynebacterium glutamicum CJ3P (Binder et al Genome Biology 2012,13: R40) as an L-lysine-producing strain in the same manner as in example 2-1 above and named CJ3P: P (CJ7) -gapN (L), CJ3P: P (CJ7) -gapN (S) and CJ3P: P (CJ7) -gapN (C), respectively. The CJ3P strain is a Corynebacterium glutamicum strain having L-lysine-producing ability by introducing three mutations (pyc (Pro458Ser), hom (Val59Ala), lysC (Thr311Ile)) into a wild-type strain based on a known technique.

The thus-prepared strain was cultured in the same manner as in example 2-1 described above, and L-lysine-producing ability was measured by HPLC after completion of the culture. The concentration and concentration increase rate of L-lysine in the culture solution for each of the strains tested are shown in Table 6.

[ Table 6]

Strain name	L-lysine concentration (g/L)	L-lysine concentration increase rate (%)
			CJ3P	8.3g/L	-
CJ3P::P(cj7)-gapN(S)	9.0g/L	8％
			CJ3P::P(cj7)-gapN(L)	9.4g/L	13％
CJ3P::P(cj7)-gapN(C)	8.7g/L	4％

As shown in Table 6, it was confirmed that the concentration of L-lysine was increased by about 8% in CJ3P: P (CJ7) -gapN (S), by about 13% in CJ3P: P (CJ7) -gapN (L), and by about 4% in CJ3P: P (CJ7) -gapN (C) compared with L-lysine-producing strain CJ3P, wherein CJ3P: P (CJ7) -gapN S, CJ3P (CJ7) -gapN (L) and CJ3P: P (CJ7) -gapN (C) all had the gapN gene introduced therein.

Examples 2-4 introduction of gapN (L), gapN (S) or gapN into L-lysine-producing strain KCCM10770P (C) Preparation of Strain and evaluation thereof

In order to confirm the effect in other lysine-producing strains belonging to Corynebacterium glutamicum, using the plasmid prepared in example 1-1-1, the plasmid prepared in example 1-2, and the plasmid prepared in example 1-3, strains introduced into Corynebacterium glutamicum KCCM107 10770P (Korean patent No. 10-0924065), which is an L-lysine-producing strain in which the lysine biosynthesis pathway has been enhanced, were prepared in the same manner as in example 2-1 above and named KCCM10770P: (cj7) -gapN (L), KCCM10770P:: P (cj7) -gapN (S), and KCCM107 10770P:: P (cj7) -gapN (C), respectively. The KCCM10770P strain is an L-lysine-producing strain having aspB (a gene encoding aspartate aminotransferase), lysC (a gene encoding aspartate kinase), asd (a gene encoding aspartate-semialdehyde dehydrogenase), dapA (a gene encoding dihydrodipicolinate synthase), dapB (a gene encoding dihydrodipicolinate reductase), and lysA (a gene encoding diaminopimelate decarboxylase) among genes constituting the lysine biosynthetic pathway, that is, a strain in which 6 genes each have 2 copies on the chromosome.

The thus-prepared strain was cultured in the same manner as in example 2-1 described above, and L-lysine-producing ability was measured by HPLC after completion of the culture. The concentration and concentration increase rate of L-lysine in the culture solution for each of the tested strains are shown in Table 7.

[ Table 7]

Strain name	L-lysine concentration (g/L)	L-lysine concentration increase rate (%)
			KCCM10770P	48g/L	-
KCCM10770P::P(cj7)-gapN(S)	56g/L	17％
			KCCM10770P::P(cj7)-gapN(L)	60g/L	25％
KCCM10770P::P(cj7)-gapN(C)	53g/L	10％

As shown in Table 7, it was confirmed that the concentration of L-lysine was increased by about 17% in KCCM107 10770P: P (cj7) -gapN (S), by about 25% in KCCM10770P: P (cj7) -gapN (L), and by about 10% in KCCM107 10770P: P (cj7) -gapN (C), as compared with the L-lysine-producing strain KCCM10770P, in which KCCM10770P: P (cj7) -gapN (S), KCCM10770P: P (cj7) -gapN (L) and KCCM107 10770P: P (cj7) -gapN (C) each had a gapN gene introduced thereinto (C).

From the results of the above examples 2-1 to 2-4, it was found that the compounds are present in different familiesAmong the various L-lysine-producing Corynebacterium glutamicum strains of (1), the introduction of gapN derived from Lactobacillus delbrueckii subsp. Further, it was confirmed that the strain introduced with gapN derived from Lactobacillus delbrueckii subspecies bulgaricus exhibited increased L-lysine-producing ability as compared with the strain introduced with gapN derived from Streptococcus mutans known as Korean patent No. 10-1182033 and the strain introduced with gapN derived from Clostridium acetobutylicum known as NCBI GenBank WP _ 010966919.1.

Example 3-1 preparation of a Strain in which gapN (L) or gapN (S) was introduced into an L-threonine producing Strain and the same Evaluation of

An L-threonine-producing strain was prepared by introducing a lysC (L377K) variant (Korean patent No. 10-2011994) and a hom (R398Q) variant (Korean patent No. 10-1947959) based on a Corynebacterium glutamicum ATCC13032 (hereinafter, referred to as WT) strain. The plasmids prepared in example 1-1-2 and the plasmids prepared in example 1-2 were introduced into these strains, and strains were prepared in the same manner as in example 2-1 described above, and threonine-producing abilities were compared.

To prepare a vector for introducing lysC (L377K), PCR was performed using primers of SEQ ID NOS:17 and 18 or primers of SEQ ID NOS:19 and 20, based on the WT chromosome as a template. PCR was performed by denaturation at 95 ℃ for 5 minutes, followed by 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 30 seconds), followed by polymerization at 72 ℃ for 7 minutes. As a result, a 5' upstream region was obtained around the mutation of lysC gene509bp DNA fragment and 3' downstream region520bp DNA fragment of (1).

PCR was performed under PCR conditions (denaturation at 95 ℃ for 5 minutes, followed by 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 60 seconds), and then polymerization at 72 ℃ for 7 minutes) using the two amplified DNA fragments as templates and primers of SEQ ID NOS:17 and 20. As a result, a 1011bp DNA fragment containing a mutation of the lysC gene encoding an aspartokinase variant in which the 377 rd leucine was substituted with lysine was amplified.

A pDZ vector (Korean patent No. 0924065) incapable of replicating in Corynebacterium glutamicum and a 1011bp DNA fragment were treated with a restriction enzyme XbaI, ligated using a DNA ligase, and then cloned to obtain a plasmid, which was designated pDZ-lysC (L377K).

The pDZ-lysC (L377K) vector obtained above was introduced into the WT strain by electroporation, and then a transformed strain was obtained in a selection medium containing 25mg/L kanamycin. By the second crossover, lysC (L377K) (a strain in which a nucleotide mutation was introduced into the lysC gene by a DNA fragment inserted on the chromosome) was obtained.

[ Table 8]

SEQ ID NO:	Sequence (5 '-3')
		17	TCCTCTAGAGCTGCGCAGTGTTGAATACG
18	TGGAAATCTTTTCGATGTTCACGTTGACAT
		19	ACATCGAAAAGATTTCCACCTCTGAGATTC
20	GACTCTAGAGTTCACCTCAGAGACGATTA

In addition, to prepare a vector for introducing hom (R398Q), PCR was performed using primers for SEQ ID NOS:21 and 22 and primers for SEQ ID NOS:23 and 24, based on WT genomic DNA as a template. PCR was performed under PCR conditions (denaturation at 95 ℃ for 5 minutes, followed by 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 30 seconds), and then polymerization at 72 ℃ for 7 minutes). As a result, a 290bp DNA fragment of the 5 'upstream region and a 170bp DNA fragment of the 3' downstream region around the hom gene mutation were obtained. PCR was performed using two amplified DNA fragments as templates, using primers of SEQ ID NOS:21 and 24, at 95 ℃ for 5 minutes, then 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 30 seconds), and then polymerization at 72 ℃ for 7 minutes. As a result, a 440bp DNA fragment containing the hom gene mutation was amplified.

[ Table 9]

SEQ ID NO:	Sequence (5 '-3')
		21	TCCTCTAGACTGGTCGCCTGATGTTCTAC
22	CTCTTCCTGTTGGATTGTAC
		23	GTACAATCCAACAGGAAGAG
24	GACTCTAGATTAGTCCCTTTCGAGGCGGA

The pDZ vector used above and a 440bp DNA fragment were treated with a restriction enzyme XbaI, ligated using a DNA ligase, and then cloned to obtain a plasmid, which was designated pDZ-hom (R398Q).

The pDZ-hom (R398Q) vector obtained above was introduced into WT by electroporation, lysC (L377K) strain, and then a transformed strain was obtained in a selection medium containing 25mg/L of kanamycin. By the secondary crossover, WT: lysC (L377K) -hom (R398Q) (a strain in which a nucleotide mutation was introduced into the hom gene by a DNA fragment inserted on the chromosome) was obtained.

By introducing the plasmids prepared in example 1-1-2 and the plasmids prepared in example 1-2 into WT:: lysC (L377K) -hom (R398Q) strain, strains were prepared in the same manner as in example 2-1 above and named WT:: lysC (L377K) -hom (R398Q): P (cj7) -gapN (L) and WT:: lysC (L377K) -hom (R398Q): P (cj7) -gapN (S), respectively.

The thus-prepared strains were cultured in the same manner as in example 2-1 above, and the L-threonine-producing abilities were compared after completion of the culture. The concentration and concentration increase rate of L-threonine in the culture broth for each of the strains tested are shown in Table 10.

[ Table 10]

As shown in Table 10, it was confirmed that the L-threonine concentration was increased by about 15% in WT:: lysC (L377K) -hom (R398Q): P (cj7) -gapN (S) and by about 22% in WT:: lysC (L377K) -hom (R398Q): P (cj7) -gapN (L) in comparison with WT:: lysC (L377K) -hom (R398Q), wherein the gapN gene was introduced in both lysC (L377K) -hom (R398Q): P (cj7) -gapN (S) and WT:: lysC (L377K) -hom (R398Q): P (cj7) -gapN (L) in WT.

WT (lysC (L377K) -hom (R398Q) P (cj7) -gapN (L) was named CA09-0906 and was deposited under Budapest treaty at 9/2.2019 with the Korean Collection of microorganisms under KCCM 12586P.

Example 3-2 Strain having gapN (L) or gapN (S) introduced into L-threonine producing Strain KCCM11222P Preparation of (1) and evaluation thereof

By introducing the plasmid prepared in example 1-1-2 and the plasmid prepared in example 1-2 into Corynebacterium glutamicum KCCM11222P (WO 2013/081296) as an L-threonine producing strain, strains were prepared in the same manner as in example 2-1 above and designated KCCM11222P:: P (cj7) -gapN (L) and KCCM11222P:: P (cj7) -gapN (S), respectively.

The thus-prepared strains were cultured in the same manner as in example 2-1 described above, and L-threonine-producing abilities were compared after completion of the culture. The concentration and concentration increase rate of L-threonine in the culture broth for each of the tested strains are shown in Table 11.

[ Table 11]

Strain name	L-threonine concentration (g/L)	L-threonine concentration increase (%)
			KCCM11222P	3.6g/L	-
KCCM11222P::P(cj7)-gapN(S)	4.1g/L	14％
			KCCM11222P::P(cj7)-gapN(L)	4.3g/L	20％

As shown in Table 11, it was confirmed that the L-threonine concentration was increased by about 14% in KCCM11222P: P (cj7) -gapN (S) and by about 20% in KCCM11222P: P (cj7) -gapN (L) in comparison with the L-threonine-producing strain KCCM11222P, in which the gapN gene was introduced in both KCCM11222P: P (cj7) -gapN (S) and KCCM11222P: P (cj7) -gapN (L).

The results obtained from the above examples show that, in an L-threonine-producing strain belonging to the genus Corynebacterium, the introduction of gapN derived from Lactobacillus delbrueckii subspecies bulgaricus is effective for L-threonine production.

Examples 4-1 in LPreparation of strains in which gapN (L) or gapN (S) is introduced into isoleucine-producing strains and the use thereof Evaluation of

In order to confirm the effect of introducing gapN derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans on L-isoleucine-producing ability based on the Corynebacterium glutamicum ATCC13032 (hereinafter referred to as WT) strain, a strain having enhanced L-isoleucine-producing ability was prepared by introducing a mutation of ilvA (V323A); S.Morbach et al, appl.enviro.Microbiol.,62(12): 4345-4351, 1996), ilvA being a gene known to encode L-threonine dehydratase.

Primer pairs for amplifying the 5 'upstream region (SEQ ID NOS:25 and 26) and primer pairs for amplifying the 3' downstream region (SEQ ID NOS:27 and 28) were designed around the mutation site to prepare a vector for introducing ilvA gene-based mutation. The primers of SEQ ID NOS:25 and 28 were inserted with BamHI restriction enzyme sites (underlined) at each end, and the primers of SEQ ID NOS:26 and 27 were designed to be exchanged with each other so that nucleotide substitution mutations (underlined) were located at the designed sites.

[ Table 12]

SEQ ID NO:	Sequence (5 '-3')
		25	ACGGATCCCAGACTCCAAAGCAAAAGCG
26	ACACCACGGCAGAACCAGGTGCAAAGGACA
		27	CTGGTTCTGCCGTGGTGTGCATCATCTCTG
28	ACGGATCCAACCAAACTTGCTCACACTC

PCR was performed using primers of SEQ ID NO. 25, SEQ ID NO. 26, SEQ ID NO. 27 and SEQ ID NO. 28 based on the WT chromosome as a template. PCR was performed under PCR conditions (denaturation at 95 ℃ for 5 minutes, followed by 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 60 seconds), and then polymerization at 72 ℃ for 7 minutes). As a result, a 627bp DNA fragment in the 5 'upstream region and a 608bp DNA fragment in the 3' downstream region were obtained around the mutation of the ilvA gene.

PCR was performed using two amplified DNA fragments as templates, using primers of SEQ ID NOS:25 and 28, at 95 ℃ for 5 minutes, then 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 60 seconds), and then polymerization at 72 ℃ for 7 minutes. As a result, a 1217bp DNA fragment containing the mutation of the ilvA gene encoding the ilvA variant in which valine at position 323 was substituted with alanine was amplified.

pECCG117 (Korean patent No. 10-0057684) and a 1011bp DNA fragment were treated with a restriction enzyme BamHI, ligated using DNA ligase, and then cloned to obtain a plasmid, which was designated pECCG117-ilvA (V323A).

A strain into which ilvA (V323A) mutation was introduced was prepared by introducing pECCG117-ilvA (V323A) vector into WT of example 3-1: lysC (L377K) -hom (R398Q): P (cj7) -gapN (L) and WT: lysC (L377K) -hom (R398Q): P (cj7) -gapN (S). In addition, a strain in which only the ilvA (V323A) mutation was introduced into WT:lysC (L377K) -hom (R398Q) was prepared as a control.

The thus-prepared strains were cultured in the same manner as in example 2-1 described above to compare L-isoleucine-producing ability. The concentration and concentration increase rate of L-isoleucine in the culture solution for each tested strain are shown in Table 13.

[ Table 13]

As shown in Table 13, it was confirmed that the concentration of L-isoleucine was increased by about 18.6% in WT: lysC (L377K) -hom (R82398) and P (cj7) -gapN (S)/pECCG117-ilvA (V323A) and about 30% in WT: lysC (L377K) -hom (R Q) and WT: lysC (L377 96398) and P (cj7) -gapN (L)/pECCG117-ilvA (V323 8938) compared with WT: lysC (L377K) -hom (R398Q)/pECCG117-ilvA (V323A), wherein both lysC (L377K) -hom (R Q) and P (cj7) -gapN 39393939117-hom (R K) and WT: 96-g 968 (WT: WT: t # and t # are introduced into WT: lysC (L377 638) -hom (R9622).

WT (L377K) -hom (R398Q) P (cj7) -gapN (L)/pECCG117-ilvA (V323A) was named CA10-3108 and deposited under Budapest treaty on day 9 and 2 of 2019 under accession number KCCM 12582P.

Example 4-2 introduction of GapN (L) or GapN (S) into L-isoleucine-producing Strain KCCM11248P Preparation of the strains and evaluation thereof

By introducing the plasmids prepared in examples 1-1-2 and 1-2 into Corynebacterium glutamicum KCCM11248P (Korean patent No. 10-1335789) which is an L-isoleucine producing strain, strains were prepared in the same manner as in the above example 2-1 and were designated KCCM11248P:: P (cj7) -gapN (L) and KCCM11248P:: P (cj7) -gapN (S), respectively.

The thus-prepared strains were cultured in the same manner as in example 2-1 above, and L-isoleucine-producing ability was compared. After completion of the culture, L-isoleucine-producing ability was measured by HPLC, and the concentration and concentration increase rate of L-isoleucine in the culture solution for each of the strains tested are shown in Table 14.

[ Table 14]

Strain name	L-isoleucine concentration (g/L)	L-isoleucine concentration increase (%)
			KCCM11248P	1.3g/L	-
KCCM11248P::P(cj7)-gapN(S)	1.8g/L	38％
			KCCM11248P::P(cj7)-gapN(L)	2.1g/L	61.5％

As shown in Table 14, it was confirmed that the concentration of L-isoleucine was increased by about 38% in KCCM11248P: P (cj7) -gapN (S) and by about 61.5% in KCCM11248P: P (cj7) -gapN (L) in comparison with the L-isoleucine-producing strain KCCM11248P, in which KCCM11248P: P (cj7) -gapN (S) and KCCM11248P: P (cj7) -gapN (L) had the gapN gene introduced thereinto.

The results obtained from the examples indicate that, in an L-isoleucine producing strain belonging to the genus Corynebacterium, the introduction of gapN derived from Lactobacillus delbrueckii subspecies bulgaricus is effective for the production of L-isoleucine.

Example 5-1 preparation of strains having gapN (L) or gapN (S) introduced into L-leucine producing strains and the use thereof Evaluation of

In order to confirm the effect of introducing gapN derived from Lactobacillus delbrueckii subspecies bulgaricus or Streptococcus mutans on the L-leucine-producing ability based on the Corynebacterium glutamicum ATCC13032 strain, a strain having an enhanced L-leucine-producing ability was prepared by introducing a mutation of leuA synthase (leuA (R558H, G561D); Korean application laid-open No. 2018-0077008), which is a gene known to encode 2-isopropylmalate synthase.

Specifically, the recombinant plasmid pDZ-leuA (R558H, G561D) prepared in the above patent was introduced into the WT strain by electroporation, and then selected in a medium containing 25mg/L kanamycin. Through the second crossover, WT: leuA (R558H, G561D) (a strain in which a nucleotide mutation was introduced into the leuA gene by a DNA fragment inserted on the chromosome) was obtained and named CJL 8001.

By introducing the plasmid prepared in example 1-1-1 and the plasmid prepared in example 1-2 into Corynebacterium glutamicum CJL8001 having L-leucine producing ability, strains were prepared in the same manner as in example 2-1 above and named CJL8001:, P (cj7) -gapN (S) and CJL8001:, P (cj7) -gapN (L), respectively.

The thus-prepared strains were cultured in the following manner to compare L-leucine-producing ability. Each strain was subcultured in nutrient medium and then inoculated into a 250mL Erlenmeyer flask containing 25mL of production medium and cultured at 30 ℃ for 72 hours with shaking at 200 rpm. Then, the concentration of L-leucine was analyzed by HPLC, and the analyzed concentration of L-leucine and the rate of increase in concentration are shown in Table 15.

< nutrient Medium (pH 7.2) >

10g glucose, 5g meat extract, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (based on 1L distilled water)

< production Medium (pH 7.0) >

50g glucose, 20g ammonium sulfate, 20g corn steep liquor solid, 1g K₂HPO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1mg thiamine-HCl, 15g calcium carbonate (based on 1L of distilled water)

[ Table 15]

Strain name	L-leucine concentration (g/L)	L-leucine concentration increase Rate (%)
			CJL8001	3.4g/L	-
CJL8001::P(cj7)-gapN(S)	3.9g/L	15％
			CJL8001::P(cj7)-gapN(L)	4.1g/L	21％

As shown in Table 15, it was confirmed that the concentration of L-leucine was increased by about 15% in CJL8001:: P (cj7) -gapN (S) and by about 21% in CJL8001:: P (cj7) -gapN (L) in which CJL8001:: P (cj7) -gapN (S) and CJL8001:: P (cj7) -gapN (L) both introduced with the gapN gene, as compared with CJL 8001.

CJL8001, P (cj7) -gapN (L) was named CA13-8102 and deposited under Budapest treaty at 9/2 in 2019 under accession number KCCM12583P in Korean culture Collection of microorganisms.

Example 5-2: gapN (L) or (B) is introduced into L-leucine producing strains KCCM11661P and KCCM11662P Preparation of the GapN (S) Strain and evaluation thereof

Strains were prepared in the same manner as in example 2-1 above by introducing the plasmids prepared in example 1-1-1 and the plasmids prepared in example 1-2 into Corynebacterium glutamicum KCCM11661P (Korean patent No. 10-1851898) and KCCM11662P (Korean patent No. 10-1796830) which are L-leucine producing strains, and were designated KCCM11661P:: P (cj7) -gapN (L), KCCM11661P:: P (cj7) -gapN (S), KCCM11662P:: P (cj7) -gapN (L), and KCCM11662P:: P (cj7) -gapN (S).

The thus-prepared strains were cultured in the same manner as in example 5-1, and after completion of the culture, L-leucine-producing ability was compared. The concentration and the rate of increase in the concentration of L-leucine produced in each strain are shown in Table 16 below.

[ Table 16]

Strain name	L-leucine concentration (g/L)	L-leucine concentration increase Rate (%)
			KCCM11661P	2.7g/L	-
KCCM11661P::P(cj7)-gapN(S)	2.8g/L	4％
			KCCM11661P::P(cj7)-gapN(L)	3.0g/L	11％
KCCM11662P	3.0g/L	-
			KCCM11662P::P(cj7)-gapN(S)	3.1g/L	3％
KCCM11662P::P(cj7)-gapN(L)	3.3g/L	11％

As shown in Table 16, it was confirmed that the concentration of L-leucine was increased by about 4% in KCCM11661P: (P (cj7) -gapN (S) and KCCM11662P: (P (cj7) -gapN (S)) and by about 11% in KCCM11661P: (P (cj7) -gapN (L)) and KCCM11662P: (P (cj7) -gapN (L)), wherein KCCM11661P: (cj7) -gapN (S)), KCCM11662P: (P (cj7) -gapN (S)), KCCM11661P: (P (cj7) -gapN (L)) and KCCM11662P: (P (cj7) -gapN) were introduced with the gapN gene, as compared with the L-leucine-producing strains KCCM11661P and KCCM 11662P.

The results obtained from the examples show that, in an L-leucine producing strain belonging to the genus Corynebacterium, the introduction of gapN derived from Lactobacillus delbrueckii subspecies bulgaricus is effective for L-leucine production.

Example 6-1 preparation of a Strain in which gapN (L) or gapN (S) was introduced into an L-valine-producing Strain and the same Evaluation of

To confirm the effect of the introduction of gapN derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans on L-valine-producing ability, a variant having L-valine-producing ability was prepared by introducing a mutation (ilvN (A42V); Biotechnology and Bioprocess Engineering, June2014, Volume 19, Issue 3, pp.456-467) into the wild-type Corynebacterium glutamicum ATCC13869 strain, and the resulting recombinant strain was named Corynebacterium glutamicum CJ 8V.

Specifically, PCR was carried out using the genomic DNA of the wild type Corynebacterium glutamicum ATCC13869 strain as a template. To prepare a vector for introducing the A42V mutation into the ilvN gene, gene fragments (A and B) were obtained using the primer set of SEQ ID NOS:29 and 30 and the primer set of SEQ ID NOS:31 and 32. PCR was performed under PCR conditions (denaturation at 94 ℃ for 5 minutes, followed by 30 cycles (denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 60 seconds), and then polymerization at 72 ℃ for 7 minutes).

As a result, 537bp of polynucleotide was obtained for both fragments A and B. Based on the two fragments as templates, overlap PCR (overlapping PCR) was performed using primers of SEQ ID NO. 29 and SEQ ID NO. 32 to obtain a DNA fragment of 1044 bp.

The 1044bp DNA fragment thus obtained and the pDZ vector used above were treated with restriction enzyme XbaI, ligated using ligase, and then cloned to obtain a plasmid, which was designated pDZ-ilvN (A42V).

[ Table 17]

The recombinant plasmid pDZ-ilvN (A42V) thus prepared was introduced into the wild type Corynebacterium glutamicum ATCC13869 strain by electroporation, and then a transformed strain was obtained in a selection medium containing 25mg/L kanamycin. Based on the transformed Corynebacterium glutamicum strain in which the second recombination was completed, the gene fragment was amplified by PCR using the primers of SEQ ID NO. 29 and SEQ ID NO. 32, and then the strain introduced with the mutation was confirmed by gene sequencing. The obtained recombinant strain was named as Corynebacterium glutamicum CJ 8V.

Finally, by introducing the plasmids prepared in examples 1-1-3 and the plasmids prepared in examples 1-2 into Gluconobacter glutamicum CJ8V having L-valine productivity, strains were prepared in the same manner as in example 2-1 above and were named CJ8V:: P (CJ7) -gapN (L) and CJ8V:: Pcj7-gapN (S), respectively. The thus-prepared strains were cultured in the following manner to compare L-valine-producing ability.

Each strain was subcultured in nutrient medium and then inoculated into a 250mL Erlenmeyer flask containing 25mL of production medium and cultured at 30 ℃ for 72 hours with shaking at 200 rpm. Then, the L-valine concentration was analyzed by HPLC, and the analyzed L-valine concentration and the concentration increase rate are shown in Table 18.

< nutrient Medium (pH 7.2) >

10g glucose, 5g meat extract, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (based on 1L distilled water)

< production Medium (pH 7.0) >

100g glucose, 40g ammonium sulfate, 2.5g soy protein, 5g corn steep liquor solids, 3g urea, 1g K₂HPO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1mg thiamine-HCl, 2mg calcium pantothenate, 3mg nicotinamide, 30g calcium carbonate (based on 1L of distilled water)

[ Table 18]

Strain name	L-valine concentration (g/L)	L-valine concentration increase Rate (%)
			CJ8V	3.4g/L	-
CJ8V-Pcj7/gapN(S)	3.8g/L	12％
			CJ8V-Pcj7/gapN(L)	4.0g/L	18％

As shown in Table 18, it was confirmed that the L-valine productivity of CJ8V-Pcj7/gapN (L) and CJ8V-Pcj7/gapN (S) strains were increased by 18% and 12%, respectively, as compared with the control.

As a result, it was confirmed that the introduction of the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans into an L-valine-producing strain belonging to the genus Corynebacterium improves the L-valine-producing ability.

CJ8V-Pcj7/gapN (L) was named CA08-2038 and was deposited at Budapest treaty on day 9 and 2 in 2019 under accession number KCCM12581P in Korean Collection of microorganisms.

Example 6-2 Strain introduced with gapN (L) or gapN (S) in L-valine-producing Strain KCCM11201P Preparation of (1) and evaluation thereof

By introducing the plasmids prepared in examples 1-1-3 and the plasmids prepared in examples 1-2 into Corynebacterium glutamicum KCCM11201P (Korean patent No. 10-1117022) which is an L-valine producing strain, strains were prepared in the same manner as in example 2-1 above and were designated KCCM11201P:: P (cj7) -gapN (L) and KCCM 1123801 11201P:: P (cj7) -gapN (S), respectively.

In order to compare L-valine-producing ability, the thus-prepared strain was cultured in the same manner as in example 6-1. Then, the concentration of L-valine was analyzed, and the analyzed concentration and concentration increasing rate of L-valine are shown in Table 19.

[ Table 19]

Strain name	L-valine concentration (g/L)	L-valine concentration increase Rate (%)
			KCCM11201P	2.8g/L	-
KCCM11201P::P(cj7)-gapN(S)	3.3g/L	17％
			KCCM11201P::P(cj7)-gapN(L)	3.7g/L	32％

As shown in Table 19, it was confirmed that KCCM11201P, P (cj7) -gapN (L) and KCCM11201P, the L-valine-producing ability of P (cj7) -gapN (S) strain was increased by 32.1% and 17.9%, respectively, as compared with the control.

As a result, in an L-valine-producing strain belonging to the genus Corynebacterium, the introduction of the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans improves the L-valine-producing ability.

Example 7-1 preparation of strains having gapN (L) or gapN (S) introduced into L-arginine producing strains and the use thereof Evaluation of

To confirm the effect of introducing gapN derived from Lactobacillus delbrueckii subspecies bulgaricus or Streptococcus mutans on the L-arginine producing ability, strains were prepared in the same manner as in the above-described example 2-1 by introducing the plasmids prepared in examples 1-1-3 and the plasmids prepared in examples 1-2 into the wild type Corynebacterium glutamicum ATCC21831 strain, and designated ATCC21831:: P (cj7) gapN (L) and ATCC21831:: P (cj7) -gapN (S), respectively.

The thus-prepared strains were cultured in the following manner to compare L-arginine producing ability. Each strain was subcultured in nutrient medium, and then inoculated into a 250mL Erlenmeyer flask containing 25mL of seed medium, and cultured at 30 ℃ for 20 hours with shaking at 200 rpm. Then, 1mL of the seed culture was inoculated into a 250mL Erlenmeyer flask containing 24mL of the production medium, and cultured at 30 ℃ for 72 hours with shaking at 200 rpm. The compositions of the nutrient medium, seed medium and production medium are shown below. After completion of the culture, the amount of L-arginine produced was measured by HPLC, and the concentration and concentration increase rate of L-arginine analyzed are shown in Table 20 below.

< nutrient Medium (pH 7.2) >

10g glucose, 5g meat extract, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (based on 1L distilled water)

< seed culture Medium (pH 7.0) >

20g sucrose, 10g peptone, 5g yeast extract, 1.5g urea, 4g KH₂PO₄、8g K₂HPO₄、0.5g MgSO₄.7H₂O, 100. mu.g biotin, 1mg thiamine-HCl, 2mg calcium pantothenate, 2mg nicotinamide (based on 1L of distilled water)

< production Medium (pH 7.0) >

6% of sucrose, 3% of ammonium sulfate and KH₂PO₄ 0.1％、MgSO₄·7H₂O O0.2.2%, CSL (corn steep liquor solid content) 1.5%, NaCl 1%, yeast extract 0.5%, biotin 100mg/L (based on 1L of distilled water)

[ Table 20]

Strain name	L-arginine concentration (g/L)	Increased L-arginine concentrationPercentage (%)
			ATCC21831	4.1g/L	-
ATCC21831::P(cj7)-gapN(S)	4.6g/L	12％
			ATCC21831::P(cj7)-gapN(L)	4.9g/L	19％

As shown in Table 20, ATCC 21831:P (cj7) -gapN (L) and ATCC 21831:P (cj7) -gapN (S) strain had an increase in L-arginine producing ability of 19.5% and 12.1%, respectively, as compared to the control.

ATCC21831: P (cj7) -gapN (L) was named CA06-2951 and was deposited under the Budapest treaty at 9/2.2019 under the accession number KCCM 12580P.

As a result, it was confirmed that the L-arginine producing ability was improved by introducing the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans into an L-arginine producing strain belonging to the genus Corynebacterium.

Example 7-2 introduction of GapN (L) or GapN (S) into L-arginine producing Strain KCCM10741P Preparation of (1) and evaluation thereof

By introducing the plasmids prepared in examples 1-1-3 and the plasmids prepared in examples 1-2 into Corynebacterium glutamicum KCCM10741P (Korean patent No. 10-0791659) which is an L-arginine producing strain, strains were prepared in the same manner as in example 2-1 above and designated KCCM10741P:: P (cj7) -gapN (L) and KCCM10741P:: P (cj7) -gapN (S), respectively.

In order to compare L-arginine producing ability, the strain thus prepared was cultured in the same manner as in example 7-1. Then, the concentration of L-arginine was analyzed, and the concentration increase rate of L-arginine analyzed are shown in Table 21.

[ Table 21]

Strain name	L-arginine concentration (g/L)	L-arginine concentration increase (%)
			KCCM10741P	3.1g/L	-
KCCM10741P::P(cj7)-gapN(S)	3.4g/L	9％
			KCCM10741P::P(cj7)-gapN(L)	3.8g/L	22％

As shown in Table 21, it was confirmed that KCCM10741P: P (cj7) -gapN (L) and KCCM10741P: P (cj7) -gapN (S) strain had an increased L-arginine producing ability by 22.6% and 9.7%, respectively, as compared with the control.

As a result, it was confirmed that the L-arginine producing ability was improved by introducing the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans into an L-arginine producing strain belonging to the genus Corynebacterium.

Example 8-1 inProduction of strains in which gapN (L) or gapN (S) is introduced into O-acetylhomoserine producing strain Preparation and evaluation thereof

By introducing the plasmid prepared in example 1-1-1 and the plasmid prepared in example 1-2 into a wild type Corynebacterium glutamicum ATCC13032 strain, strains were prepared in the same manner as in example 2-1 above and designated ATCC13032:: P (cj7) -gapN (L) and ATCC13032:: P (cj7) -gapN (S), respectively. The thus-prepared strains were cultured in the following manner to compare O-acetylhomoserine producing ability.

Each strain was inoculated into a 250mL corner baffle flask containing 25mL of seed medium and cultured with shaking at 200rpm at 30 ℃ for 20 hours. Then, 1mL of the seed culture was inoculated into a 250mL angle baffle flask containing 24mL of the production medium, and cultured at 30 ℃ for 48 hours with shaking at 200 rpm. The compositions of the seed medium and the production medium are shown below.

< seed culture Medium (pH 7.0) >

20g glucose, 10g peptone, 5g yeast extract, 1.5g urea, 4g KH₂PO₄、8g K₂HPO₄、0.5g MgSO₄.7H₂O, 100. mu.g biotin, 1000. mu.g thiamine HCl, 2000. mu.g calcium pantothenate, 2000. mu.g nicotinamide (based on 1L of distilled water)

< production Medium (pH 7.0) >

50g glucose, 12.5g (NH)₄)₂SO₄2.5g of soy protein, 5g of corn steep liquor solid, 3g of urea and 1g of KH₂PO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1000. mu.g thiamine-HCl, 2000. mu.g calcium pantothenate, 3000. mu.g nicotinamide, 30g CaCO₃(distilled water based on 1L)

After completion of the culture, O-acetylhomoserine producing ability was measured by HPLC. The concentration and concentration increase rate of O-acetylhomoserine in the culture solution for each of the tested strains are shown in Table 22 below.

[ Table 22]

Strain name	O-acetylhomoserine concentration (g/L)	Increasing ratio of O-acetylhomoserine concentration (%)
			ATCC13032	0.3g/L	-
ATCC13032::P(cj7)-gapN(S)	0.4g/L	33％
			ATCC13032::P(cj7)-gapN(L)	0.5g/L	67％

As shown in Table 22, it was confirmed that O-acetylhomoserine concentration was increased by about 33% in ATCC13032: (cj7) -gapN (S) and about 67% in ATCC13032: (cj7) -gapN (L) compared with the wild-type ATCC13032 strain, wherein the gapN genes were introduced into both ATCC13032: (cj7) -gapN (S) and ATCC13032: (cj7) -gapN (L).

ATCC13032: P (cj7) -gapN (L) was named CM04-0531 and was deposited under Budapest treaty at 9/2.2019 under the number KCCM 12584P.

Example 8-2 introduction of Lactobacillus delbrueckii Bulgarian into Corynebacterium glutamicum producing O-acetylhomoserine Preparation and evaluation of strains of either sub-species-derived gapN (L) or S

In order to confirm the effect of introducing gapN derived from Lactobacillus delbrueckii subspecies bulgaricus or Streptococcus mutans on the O-acetylhomoserine producing ability of Corynebacterium glutamicum, the activity of autologous homoserine O-acetyltransferase of Corynebacterium glutamicum was enhanced.

For amplification of the gene encoding O-acetylhomoserine transferase (MetX), primers of SEQ ID NOS:33 and 34 were designed based on the reported Wild Type (WT) -derived sequence for amplification from the promoter region (located about 300bp upstream of the start codon) to the terminator region (located about 100bp downstream of the stop codon). BamHI restriction enzyme sites were inserted into both ends of each of the primers of SEQ ID NOS:33 and 34, and PCR was performed under PCR conditions (denaturation at 95 ℃ for 5 minutes, followed by 30 cycles (denaturation at 95 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and polymerization at 72 ℃ for 30 seconds), and then polymerization at 72 ℃ for 7 minutes). As a result, a 1546bp DNA fragment was obtained in the coding region of metX gene. The pECCG117 vector (Korean patent No. 10-0057684) and the metX DNA fragment were treated with the restriction enzyme BamHI, ligated using DNA ligase, and cloned to obtain a plasmid designated pECCG117-metX WT.

[ Table 23]

SEQ ID NO:	Sequence (5 '-3')
		33	GGATCCCCTCGTTGTTCACCCAGCAACC
34	GGATCCCAAAGTCACAACTACTTATGTTAG

A strain in which the autologous metX of Corynebacterium glutamicum was overexpressed was prepared by introducing pECCG117-metX WT into the WT of example 3-1 described above, lysC (L377K) -hom (R398Q), P (cj7) -gapN (L) and WT, lysC (L377K) -hom (R398Q), P (cj7) -gapN (S) strains. Further, the same vector was introduced into WT:lysC (L377K) -hom (R398Q) as a control.

The thus-prepared strain was cultured in the same manner as in the flask culture method of example 8-1 to analyze the concentration and concentration increasing rate of O-acetylhomoserine in the culture solution. The results are shown in table 24.

[ Table 24]

As shown in Table 24, it was confirmed that O-acetylhomoserine concentration was increased by about 35% in WT: lysC (L377K) -hom (R398Q)/pECCG117-metX WT, and that about 55% was increased in WT: lysC (L377K) -hom (R398Q): P (cj7) -gapN (S)/pECCG117-metX WT, and that about 55% was increased in WT: lysC (L377K) -hom (R398Q): P (cj7) -gapN (L)/pECCG117-metX WT, wherein WT: lysC (L377K) -hom (R398): P (cj7) -gapN S/pCCG 117-metX and WT: lysC (L637) -hom (R53962): pEP 117/7/GAP 117) were introduced into WT: (g).

The results obtained from the examples show that, in a wild-type strain belonging to the genus Corynebacterium, the introduction of gapN derived from Lactobacillus delbrueckii subspecies bulgaricus is effective for O-acetylhomoserine production.

Example 9-1 preparation of strains having gapN (L) or gapN (S) introduced into glutamic acid-producing strains and evaluation thereof Price of

To confirm the effect of introducing gapN derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans on the glutamic acid-producing ability, strains were prepared in the same manner as in example 2-1 above based on the wild type Corynebacterium glutamicum ATCC13869 strain by introducing the plasmids prepared in examples 1-1-4 and the plasmids prepared in examples 1-2, and designated ATCC13869:: P (cj7) -gapN (L) and ATCC13869:: P (cj7) -gapN (S), respectively.

Each strain was inoculated into a 250mL corner baffle flask containing 25mL of seed medium and cultured at 30 ℃ for 20 hours with shaking at 200 rpm. Then, 1mL of the seed culture was inoculated into a 250mL angle baffle flask containing 25mL of the production medium and cultured at 30 ℃ for 40 hours with shaking at 200 rpm. The cultivation is carried out under biotin-limited conditions. After completion of the culture, the concentration and the concentration increase rate of L-glutamic acid were measured by HPLC, and the measurement results are shown in Table 25 below.

< seed culture Medium (pH 7.2) >

Glucose 1%, meat extract 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, and urea 0.2%

< production Medium >

6% of crude sugar, 5% of calcium carbonate, 2.25% of ammonium sulfate and KH₂PO₄0.1 percent, 0.04 percent of magnesium sulfate, 10mg/L of ferric sulfate and 0.2mg/L of thiamine-HCl

[ Table 25]

Strain name	L-glutamic acid concentration (g/L)	L-glutamic acid concentration increase rate (%)
			ATCC13869	0.5g/L	-
ATCC13869::P(cj7)-gapN(S)	0.8g/L	60％
			ATCC13869::P(cj7)-gapN(L)	0.9g/L	80％

As shown in Table 25, it was confirmed that the concentration of glutamic acid was increased by about 60% in ATCC13869: P (cj7) -gapN (S) and by about 80% in ATCC13869: P (cj7) -gapN (L) as compared with the wild-type ATCC13869 strain, wherein the gapN gene was introduced into both ATCC13869: P (cj7) -gapN (S) and ATCC13869: P (cj7) -gapN (L).

ATCC 13869P (cj7) -gapN (L) was named CA02-1360 and deposited under Budapest treaty on 2.9.2019 under accession number KCCM 12587P.

Example 9-2 preparation of glutamic acid-producing Strain KFCC11074 introduced with gapN (L) or gapN (S) Preparation and evaluation thereof

By introducing the plasmids prepared in examples 1-1-4 and the plasmids prepared in examples 1-2 into Corynebacterium glutamicum KFCC11074 strain (Korean patent No. 10-0292299) which is an L-glutamic acid-producing strain, strains were prepared in the same manner as in the above example 2-1 and were named KFCC11074:: P (cj7) -gapN (L) and KFCC11074:: P (cj7) -gapN (S), respectively.

The thus-prepared strains were cultured in the same manner as in example 10-1 to compare L-glutamic acid-producing ability. After completion of the culture, the concentration of L-glutamic acid was analyzed, and the concentration increase rate of the analyzed L-glutamic acid are shown in Table 26.

[ Table 26]

As shown in Table 26, it was confirmed that the concentration of glutamic acid was increased by about 22.9% in KFCC11074:: P (cj7) -gapN (S) and by about 37.3% in KFCC11074:: P (cj7) -gapN (L) in which the gapN gene was introduced in both KFCC11074:: P (cj7) -gapN (S) and KFCC11074:: P (cj7) -gapN (L) as compared with KFCC 11074.

As a result, in an L-glutamic acid-producing strain belonging to the genus Corynebacterium, introduction of the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans improves L-glutamic acid-producing ability.

In conclusion, the results obtained from examples 1 to 9 indicate that the introduction of the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus or Streptococcus mutans improves the L-amino acid-producing ability in the L-glutamic acid-producing strain belonging to the genus Corynebacterium, and in particular, it was confirmed that the introduction of the gapN gene derived from Lactobacillus delbrueckii subsp.bulgaricus showed a superior L-amino acid-producing ability compared to the introduction of the gapN gene derived from Streptococcus mutans.

One of ordinary skill in the art to which the disclosure pertains will recognize that the disclosure may be presented in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the disclosure is, therefore, indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope.

<110> CJ first sugar manufacturing Co., Ltd

<120> method for producing L-amino acid using microorganism containing NADP-dependent glyceraldehyde-3-phosphate dehydrogenase

<130> OPA20125

<150> KR 10-2020-0008025

<151> 2020-01-21

<160> 39

<170> KoPatentIn 3.0

<210> 1

<211> 476

<212> PRT

<213> unknown

<220>

<223> Lactobacillus delbrueckii subspecies bulgaricus gapN amino acid

<400> 1

Met Thr Glu His Tyr Leu Asn Tyr Val Asn Gly Glu Trp Arg Asp Ser

1 5 10 15

Ala Asp Ala Ile Glu Ile Phe Glu Pro Ala Thr Gly Lys Ser Leu Gly

20 25 30

Thr Val Pro Ala Met Ser His Glu Asp Val Asp Tyr Val Met Asn Ser

35 40 45

Ala Lys Lys Ala Leu Pro Ala Trp Arg Ala Leu Ser Tyr Val Glu Arg

50 55 60

Ala Ala Tyr Leu Gln Lys Ala Ala Asp Ile Leu Tyr Arg Asp Ala Glu

65 70 75 80

Lys Ile Gly Ser Thr Leu Ser Lys Glu Ile Ala Lys Gly Leu Lys Ser

85 90 95

Ser Ile Gly Glu Val Thr Arg Thr Ala Glu Ile Val Glu Tyr Thr Ala

100 105 110

Lys Val Gly Val Thr Leu Asp Gly Glu Val Met Glu Gly Gly Asn Phe

115 120 125

Glu Ala Ala Ser Lys Asn Lys Leu Ala Val Val Arg Arg Glu Pro Val

130 135 140

Gly Leu Val Leu Ala Ile Ser Pro Phe Asn Tyr Pro Val Asn Leu Ala

145 150 155 160

Gly Ser Lys Ile Ala Pro Ala Leu Met Gly Gly Asn Val Val Ala Phe

165 170 175

Lys Pro Pro Thr Gln Gly Ser Ile Ser Gly Leu Leu Leu Ala Lys Ala

180 185 190

Phe Ala Glu Ala Gly Leu Pro Ala Gly Val Phe Asn Thr Ile Thr Gly

195 200 205

Arg Gly Arg Val Ile Gly Asp Tyr Ile Val Glu His Pro Ala Val Asn

210 215 220

Phe Ile Asn Phe Thr Gly Ser Ser Ala Val Gly Lys Asn Ile Gly Lys

225 230 235 240

Leu Ala Gly Met Arg Pro Ile Met Leu Glu Leu Gly Gly Lys Asp Ala

245 250 255

Ala Ile Val Leu Glu Asp Ala Asp Leu Asp Leu Thr Ala Lys Asn Ile

260 265 270

Val Ala Gly Ala Phe Gly Tyr Ser Gly Gln Arg Cys Thr Ala Val Lys

275 280 285

Arg Val Leu Val Met Asp Ser Val Ala Asp Glu Leu Val Glu Lys Val

290 295 300

Thr Ala Leu Ala Lys Asp Leu Thr Val Gly Ile Pro Glu Glu Asp Ala

305 310 315 320

Asp Ile Thr Pro Leu Ile Asp Thr Lys Ser Ala Asp Tyr Val Gln Gly

325 330 335

Leu Ile Glu Glu Ala Ala Glu Lys Gly Ala Lys Pro Leu Phe Asp Phe

340 345 350

Lys Arg Glu Gly Asn Leu Ile Tyr Pro Met Val Met Asp Gln Val Thr

355 360 365

Thr Asp Met Arg Leu Ala Trp Glu Glu Pro Phe Gly Pro Val Leu Pro

370 375 380

Phe Ile Arg Val Lys Ser Ala Asp Glu Ala Val Met Ile Ala Asn Glu

385 390 395 400

Ser Glu Tyr Gly Leu Gln Ser Ser Val Phe Ser Arg Asn Phe Glu Lys

405 410 415

Ala Phe Ala Ile Ala Gly Lys Leu Glu Val Gly Thr Val His Ile Asn

420 425 430

Asn Lys Thr Gln Arg Gly Pro Asp Asn Phe Pro Phe Leu Gly Val Lys

435 440 445

Ser Ser Gly Ala Gly Val Gln Gly Val Lys Tyr Ser Ile Gln Ala Met

450 455 460

Thr Arg Val Lys Ser Val Val Phe Asn Ile Glu Asp

465 470 475

<210> 2

<211> 1431

<212> DNA

<213> unknown

<220>

<223> Lactobacillus delbrueckii subspecies bulgaricus gapN nucleotide

<400> 2

atgacagaac actatttaaa ctatgtcaat ggcgaatggc gggactccgc tgacgcgatt 60

gaaattttcg aaccagcaac tggcaagtcc ctgggtactg tacctgccat gtcccacgaa 120

gacgtggact acgtaatgaa cagcgccaaa aaggcccttc cagcctggcg ggccctctca 180

tacgttgaac gggccgcata cttgcaaaag gcagcggaca tcctttaccg agatgctgaa 240

aagatcggtt ctaccttgtc caaggaaatc gccaagggcc tcaagtcctc tatcggcgaa 300

gtaacccgga cggcggaaat cgttgaatac acggccaagg tcggcgtaac tttggacggg 360

gaagtcatgg agggcggcaa ctttgaagcg gcaagcaaga acaagttggc tgttgtccgc 420

cgggaaccag tcggcctggt tttggcaatt tcacccttca actacccggt taacctggcc 480

ggctcaaaga tcgcgcctgc tttgatgggc gggaacgtgg tggccttcaa gccgccgaca 540

caagggtcaa tctccggtct gcttttggcc aaggccttcg ccgaagctgg cctgccagcc 600

ggcgtcttca acaccattac cggccggggt cgggttatcg gcgactacat cgttgaacac 660

ccggcagtca acttcatcaa cttcaccggt tccagtgctg tcggcaagaa catcggcaaa 720

ctggccggga tgcggccgat tatgctggaa cttggcggca aggacgcggc catcgtcttg 780

gaagacgctg acttggacct gacggccaag aacatcgttg ccggcgcctt tggctactcc 840

ggccagcgtt gtaccgccgt taagcgggtt ctggtcatgg acagcgtggc tgacgaattg 900

gttgaaaagg tgactgcttt ggccaaggat ttgacggtcg ggataccaga agaggatgcc 960

gacatcactc ctttgatcga cactaagtct gccgactacg tacaaggctt aattgaagaa 1020

gccgcagaaa agggcgctaa gcctttgttt gacttcaagc gcgaaggcaa cctgatctac 1080

ccaatggtca tggaccaagt gacgactgac atgcgcctgg cctgggaaga accatttgga 1140

ccagtattgc cattcatccg cgtcaagtca gctgacgaag ctgtcatgat tgccaatgaa 1200

tcagaatacg gccttcaaag ctccgtcttc tcacggaact ttgaaaaagc ctttgccatt 1260

gcaggaaaat tggaagtggg cacggtccac atcaacaaca agacccaaag aggtccggac 1320

aacttcccat tcctgggcgt aaagagctca ggggcaggcg tacagggggt caagtactcc 1380

attcaagcca tgacccgggt caagtccgtt gtcttcaaca tcgaagacta a 1431

<210> 3

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> gapN F

<400> 3

cccaacgaaa ggaaacactc atgacagaac actatttaaa 40

<210> 4

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> gapN R

<400> 4

gcttgtgaat aagcctgccc ttagtcttcg atgttgaaga caacg 45

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7 F

<400> 5

gattccaggt tccttaaccc agaaacatcc cagcgctact 40

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7 R

<400> 6

tttaaatagt gttctgtcat gagtgtttcc tttcgttggg 40

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Ldb1179 R

<400> 7

tttcgtgcga gtctagaagt ttagtcttcg atgttgaaga 40

<210> 8

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7_2 F

<400> 8

acgaggtcag catctcgagt agaaacatcc cagcgctact 40

<210> 9

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7_3 F

<400> 9

cgcggaactg tactagtaga aacatcccag cgctac 36

<210> 10

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Ldb1179_2 R

<400> 10

ggaaggatat ctctagaaga taaaacgaaa ggcc 34

<210> 11

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7_4 F

<400> 11

cccttccggt ttagtactag aaacatccca gcgcta 36

<210> 12

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Ldb1179_3 R

<400> 12

ctcttcctgt ttagtacttt agtcttcgat gttgaag 37

<210> 13

<211> 475

<212> PRT

<213> unknown

<220>

<223> Streptococcus mutans gapN amino acid

<400> 13

Met Thr Lys Gln Tyr Lys Asn Tyr Val Asn Gly Glu Trp Lys Leu Ser

1 5 10 15

Glu Asn Glu Ile Lys Ile Tyr Glu Pro Ala Ser Gly Ala Glu Leu Gly

20 25 30

Ser Val Pro Ala Met Ser Thr Glu Glu Val Asp Tyr Val Tyr Ala Ser

35 40 45

Ala Lys Lys Ala Gln Pro Ala Trp Arg Ser Leu Ser Tyr Ile Glu Arg

50 55 60

Ala Ala Tyr Leu His Lys Val Ala Asp Ile Leu Met Arg Asp Lys Glu

65 70 75 80

Lys Ile Gly Ala Val Leu Ser Lys Glu Val Ala Lys Gly Tyr Lys Ser

85 90 95

Ala Val Ser Glu Val Val Arg Thr Ala Glu Ile Ile Asn Tyr Ala Ala

100 105 110

Glu Glu Gly Leu Arg Met Glu Gly Glu Val Leu Glu Gly Gly Ser Phe

115 120 125

Glu Ala Ala Ser Lys Lys Lys Ile Ala Val Val Arg Arg Glu Pro Val

130 135 140

Gly Leu Val Leu Ala Ile Ser Pro Phe Asn Tyr Pro Val Asn Leu Ala

145 150 155 160

Gly Ser Lys Ile Ala Pro Ala Leu Ile Ala Gly Asn Val Ile Ala Phe

165 170 175

Lys Pro Pro Thr Gln Gly Ser Ile Ser Gly Leu Leu Leu Ala Glu Ala

180 185 190

Phe Ala Glu Ala Gly Leu Pro Ala Gly Val Phe Asn Thr Ile Thr Gly

195 200 205

Arg Gly Ser Glu Ile Gly Asp Tyr Ile Val Glu His Gln Ala Val Asn

210 215 220

Phe Ile Asn Phe Thr Gly Ser Thr Gly Ile Gly Glu Arg Ile Gly Lys

225 230 235 240

Met Ala Gly Met Arg Pro Ile Met Leu Glu Leu Gly Gly Lys Asp Ser

245 250 255

Ala Ile Val Leu Glu Asp Ala Asp Leu Glu Leu Thr Ala Lys Asn Ile

260 265 270

Ile Ala Gly Ala Phe Gly Tyr Ser Gly Gln Arg Cys Thr Ala Val Lys

275 280 285

Arg Val Leu Val Met Glu Ser Val Ala Asp Glu Leu Val Glu Lys Ile

290 295 300

Arg Glu Lys Val Leu Ala Leu Thr Ile Gly Asn Pro Glu Asp Asp Ala

305 310 315 320

Asp Ile Thr Pro Leu Ile Asp Thr Lys Ser Ala Asp Tyr Val Glu Gly

325 330 335

Leu Ile Asn Asp Ala Asn Asp Lys Gly Ala Ala Ala Leu Thr Glu Ile

340 345 350

Lys Arg Glu Gly Asn Leu Ile Cys Pro Ile Leu Phe Asp Lys Val Thr

355 360 365

Thr Asp Met Arg Leu Ala Trp Glu Glu Pro Phe Gly Pro Val Leu Pro

370 375 380

Ile Ile Arg Val Thr Ser Val Glu Glu Ala Ile Glu Ile Ser Asn Lys

385 390 395 400

Ser Glu Tyr Gly Leu Gln Ala Ser Ile Phe Thr Asn Asp Phe Pro Arg

405 410 415

Ala Phe Gly Ile Ala Glu Gln Leu Glu Val Gly Thr Val His Ile Asn

420 425 430

Asn Lys Thr Gln Arg Gly Thr Asp Asn Phe Pro Phe Leu Gly Ala Lys

435 440 445

Lys Ser Gly Ala Gly Ile Gln Gly Val Lys Tyr Ser Ile Glu Ala Met

450 455 460

Thr Thr Val Lys Ser Val Val Phe Asp Ile Lys

465 470 475

<210> 14

<211> 1428

<212> DNA

<213> unknown

<220>

<223> Streptococcus mutans gapN nucleotides

<400> 14

atgacaaaac aatataaaaa ttatgtcaat ggcgagtgga agctttcaga aaatgaaatt 60

aaaatctacg aaccggccag tggagctgaa ttgggttcag ttccagcaat gagtactgaa 120

gaagtagatt atgtttatgc ttcagccaag aaagctcaac cagcttggcg atcactttca 180

tacatagaac gtgctgccta ccttcacaag gtagcagata ttttgatgcg tgataaagaa 240

aaaataggtg ctgttctttc caaagaggtt gctaaaggtt ataaatcagc agtcagcgaa 300

gttgttcgta ctgcagaaat cattaattat gcagctgaag aaggccttcg tatggaaggt 360

gaagtccttg aaggcggcag ttttgaagca gccagcaaga aaaaaattgc cgttgttcgt 420

cgtgaaccag taggtcttgt attagctatt tcaccattta actaccctgt taacttggca 480

ggttcgaaaa ttgcaccggc tcttattgcg ggaaatgtta ttgcttttaa accaccgacg 540

caaggatcaa tctcagggct cttacttgct gaagcatttg ctgaagctgg acttcctgca 600

ggtgtcttta ataccattac aggtcgtggt tctgaaattg gagactatat tgtagaacat 660

caagccgtta actttatcaa ttttactggt tcaacaggaa ttggggaacg tattggcaaa 720

atggctggta tgcgtccgat tatgcttgaa ctcggtggaa aagattcagc catcgttctt 780

gaagatgcag accttgaatt gactgctaaa aatattattg caggtgcttt tggttattca 840

ggtcaacgct gtacagcagt taaacgtgtt cttgtgatgg aaagtgttgc tgatgaactg 900

gtcgaaaaaa tccgtgaaaa agttcttgca ttaacaattg gtaatccaga agacgatgca 960

gatattacac cgttgattga tacaaaatca gctgattatg tagaaggtct tattaatgat 1020

gccaatgata aaggagccgc tgcccttact gaaatcaaac gtgaaggtaa tcttatctgt 1080

ccaatcctct ttgataaggt aacgacagat atgcgtcttg cttgggaaga accatttggt 1140

cctgttcttc cgatcattcg tgtgacatct gtagaagaag ccattgaaat ttctaacaaa 1200

tcggaatatg gacttcaggc ttctatcttt acaaatgatt tcccacgcgc ttttggtatt 1260

gctgagcagc ttgaagttgg tacagttcat atcaataata agacacagcg cggcacggac 1320

aacttcccat tcttaggggc taaaaaatca ggtgcaggta ttcaaggggt aaaatattct 1380

attgaagcta tgacaactgt taaatccgtc gtatttgata tcaaataa 1428

<210> 15

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7-gapN1 F

<400> 15

tagatgtcgg gccccatatg agaaacatcc cagcgctact 40

<210> 16

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Pcj7-gapN1 R

<400> 16

gccaaaacag cctcgagtta tttgatatca aatacgacgg attta 45

<210> 17

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> lysC-1 F

<400> 17

tcctctagag ctgcgcagtg ttgaatacg 29

<210> 18

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> lysC-1 R

<400> 18

tggaaatctt ttcgatgttc acgttgacat 30

<210> 19

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> lysC-2 F

<400> 19

acatcgaaaa gatttccacc tctgagattc 30

<210> 20

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> lysC-2 R

<400> 20

gactctagag ttcacctcag agacgatta 29

<210> 21

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Hom-1 F

<400> 21

tcctctagac tggtcgcctg atgttctac 29

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Hom-1 R

<400> 22

ctcttcctgt tggattgtac 20

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Hom-2 F

<400> 23

gtacaatcca acaggaagag 20

<210> 24

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Hom-2 R

<400> 24

gactctagat tagtcccttt cgaggcgga 29

<210> 25

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> ilvA-1 F

<400> 25

acggatccca gactccaaag caaaagcg 28

<210> 26

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> ilvA-1 R

<400> 26

acaccacggc agaaccaggt gcaaaggaca 30

<210> 27

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> ilvA-2 F

<400> 27

ctggttctgc cgtggtgtgc atcatctctg 30

<210> 28

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> ilvA-2 R

<400> 28

acggatccaa ccaaacttgc tcacactc 28

<210> 29

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> ilvN-1 F

<400> 29

aatttctaga ggcagaccct attctatgaa gg 32

<210> 30

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> ilvN-1 R

<400> 30

agtgtttcgg tctttacaga cacgagggac 30

<210> 31

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> ilvN-2 F

<400> 31

gtccctcgtg tctgtaaaga ccgaaacact 30

<210> 32

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> ilvN-2 R

<400> 32

aatttctaga cgtgggagtg tcactcgctt gg 32

<210> 33

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> MetX F

<400> 33

ggatcccctc gttgttcacc cagcaacc 28

<210> 34

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> MetX R

<400> 34

ggatcccaaa gtcacaacta cttatgttag 30

<210> 35

<211> 482

<212> PRT

<213> unknown

<220>

<223> Clostridium acetobutylicum gapN amino acids

<400> 35

Met Phe Glu Asn Ile Ser Ser Asn Gly Val Tyr Lys Asn Leu Phe Asp

1 5 10 15

Gly Lys Trp Val Glu Ser Lys Thr Asn Lys Thr Ile Glu Thr His Ser

20 25 30

Pro Tyr Asp Gly Ser Leu Ile Gly Lys Val Gln Ala Leu Ser Lys Glu

35 40 45

Glu Val Asp Glu Ile Phe Lys Ser Ser Arg Thr Ala Gln Lys Lys Trp

50 55 60

Gly Glu Thr Pro Ile Asn Glu Arg Ala Arg Ile Met Arg Lys Ala Ala

65 70 75 80

Asp Ile Leu Asp Asp Asn Ala Glu Tyr Ile Ala Lys Ile Leu Ser Asn

85 90 95

Glu Ile Ala Lys Asp Leu Lys Ser Ser Leu Ser Glu Val Lys Arg Thr

100 105 110

Ala Asp Phe Ile Arg Phe Thr Ala Asn Glu Gly Thr His Met Glu Gly

115 120 125

Glu Ala Ile Asn Ser Asp Asn Phe Pro Gly Ser Lys Lys Asp Lys Leu

130 135 140

Ser Leu Val Glu Arg Val Pro Leu Gly Ile Val Leu Ala Ile Ser Pro

145 150 155 160

Phe Asn Tyr Pro Val Asn Leu Ser Gly Ser Lys Val Ala Pro Ala Leu

165 170 175

Ile Ala Gly Asn Ser Val Val Leu Lys Pro Ser Thr Thr Gly Ala Ile

180 185 190

Ser Ala Leu His Leu Ala Glu Ile Phe Asn Ala Ala Gly Leu Pro Ala

195 200 205

Gly Val Leu Asn Thr Val Thr Gly Lys Gly Ser Glu Ile Gly Asp Tyr

210 215 220

Leu Ile Thr His Glu Glu Val Asn Phe Ile Asn Phe Thr Gly Ser Ser

225 230 235 240

Ala Val Gly Lys His Ile Ser Lys Ile Ala Gly Met Ile Pro Met Val

245 250 255

Leu Glu Leu Gly Gly Lys Asp Ala Ala Ile Val Leu Glu Asp Ala Asn

260 265 270

Leu Glu Thr Thr Ala Lys Ser Ile Val Ser Gly Ala Tyr Gly Tyr Ser

275 280 285

Gly Gln Arg Cys Thr Ala Val Lys Arg Val Leu Val Met Asp Lys Val

290 295 300

Ala Asp Glu Leu Val Glu Leu Val Thr Lys Lys Val Lys Glu Leu Lys

305 310 315 320

Val Gly Asn Pro Phe Asp Asp Val Thr Ile Thr Pro Leu Ile Asp Asn

325 330 335

Lys Ala Ala Asp Tyr Val Gln Thr Leu Ile Asp Asp Ala Ile Glu Lys

340 345 350

Gly Ala Thr Leu Ile Val Gly Asn Lys Arg Lys Glu Asn Leu Met Tyr

355 360 365

Pro Thr Leu Phe Asp Asn Val Thr Ala Asp Met Arg Ile Ala Trp Glu

370 375 380

Glu Pro Phe Gly Pro Val Leu Pro Ile Ile Arg Val Lys Ser Met Asp

385 390 395 400

Glu Ala Ile Glu Leu Ala Asn Arg Ser Glu Tyr Gly Leu Gln Ser Ala

405 410 415

Val Phe Thr Glu Asn Met His Asp Ala Phe Tyr Ile Ala Asn Lys Leu

420 425 430

Asp Val Gly Thr Val Gln Val Asn Asn Lys Pro Glu Arg Gly Pro Asp

435 440 445

His Phe Pro Phe Leu Gly Thr Lys Ser Ser Gly Met Gly Thr Gln Gly

450 455 460

Ile Arg Tyr Ser Ile Glu Ala Met Thr Arg His Lys Ser Ile Val Leu

465 470 475 480

Asn Leu

<210> 36

<211> 1449

<212> DNA

<213> unknown

<220>

<223> C.acetobutylicum gapN nucleotides

<400> 36

atgtttgaaa atatatcatc aaatggagtt tataaaaatc tatttgatgg aaaatgggtt 60

gaaagtaaga caaataaaac catagaaacg cattctcctt atgatggaag tttaattgga 120

aaagttcagg ccttatcaaa agaggaagtt gatgagattt ttaaaagttc aagaacagct 180

cagaaaaaat ggggtgaaac tccaataaat gagcgtgcta gaatcatgcg taaagcagct 240

gatatactag atgataacgc agaatatata gcaaaaattc tttcaaatga gatagcaaaa 300

gatttaaaat cttctctttc agaagtaaaa agaacagctg attttataag atttacagct 360

aatgaaggta ctcatatgga aggagaagct attaactcag ataattttcc tggttctaaa 420

aaagataaac tttctctagt tgaaagagtt cctttaggaa tagttttagc tatatctcct 480

tttaattatc ctgtaaatct ttctgggtct aaggttgctc cagcacttat agctggaaat 540

agtgttgttt taaaaccttc tacaactggt gctataagcg cacttcatct tgcagaaatt 600

tttaatgcag ctggtcttcc agcaggtgtt ttaaacactg taacaggaaa agggtctgaa 660

ataggcgatt atttaattac ccatgaagaa gtaaacttta ttaactttac gggaagctct 720

gctgtaggta agcatatttc aaaaatagct ggaatgatac ctatggttct tgagcttggt 780

ggtaaagatg ctgctatagt tctcgaagat gccaatcttg aaacaacagc taaaagcata 840

gtatctggag catatggata ctccggccaa aggtgtactg ctgtaaaaag agttcttgta 900

atggataaag tagctgatga attagttgaa cttgttacaa aaaaagttaa agaattaaag 960

gtaggtaatc cttttgatga tgttacaata accccactta tagacaacaa ggcagcagat 1020

tatgttcaaa ctctcattga cgacgctatc gaaaagggtg caactcttat cgttggaaat 1080

aagcgtaaag aaaatttaat gtatcctact ttatttgata atgtaactgc tgatatgcgt 1140

attgcttggg aagaaccatt tggaccagtt ttacctatta ttcgtgtaaa aagcatggat 1200

gaagcaatag aattagcaaa tagatctgaa tatggtcttc aatctgcagt atttactgaa 1260

aatatgcatg atgcctttta tattgccaat aaattagatg ttggaactgt tcaagtaaat 1320

aataagcctg aaagaggccc agatcacttc ccattccttg gaacaaagtc atcaggtatg 1380

ggcactcaag gaattcgata cagtatagag gcaatgacaa ggcataaatc aatagtttta 1440

aacctataa 1449

<210> 37

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> gapN F

<400> 37

acccaacgaa aggaaacact catgtttgaa aatatatcat caaa 44

<210> 38

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> gapN R

<400> 38

gccaaaacag cctcgagtta taggtttaaa actattgatt 40

<210> 39

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> gapN R

<400> 39

tttgatgata tattttcaaa catgagtgtt tcctttcgtt gggt 44

PCT/RO/134 Table