阅读说明：本技术 多价纳米抗体及其药物偶联物的制备方法和应用 (Preparation method and application of multivalent nano antibody and drug conjugate thereof ) 是由 刘曼曼 武田田 刘扬中 于 2020-08-17 设计创作，主要内容包括：本发明涉及多价纳米抗体及其药物偶联物的制备方法和应用。本发明提供多价纳米抗体的制备方法,所述方法包括使多个纳米抗体通过酶促反应与树枝状聚合物连接的步骤。本发明还提供制备多价纳米抗体的药物偶联物的方法,包括将多价纳米抗体通过基因工程改造添加的标签与药物偶联物偶联的步骤。本发明还涉及多价纳米抗体或其药物偶联物、包含它们的药物组合物或试剂盒以及它们用于制备药物的用途。本发明的多价纳米抗体及其药物偶联物具有良好的稳定性和靶向性,对肿瘤组织具有高穿透力,能够高效杀伤肿瘤细胞,同时延长了抗肿瘤药物的循环时间并且降低了它的系统毒性。(The invention relates to a preparation method and application of a multivalent nano antibody and a drug conjugate thereof. The present invention provides a method for preparing a multivalent nanobody, the method comprising the step of linking a plurality of nanobodies to a dendrimer through an enzymatic reaction. The invention also provides a method for preparing the drug conjugate of the multivalent nanobody, which comprises the step of coupling the multivalent nanobody with the drug conjugate through the added label modified by genetic engineering. The invention also relates to multivalent nanobodies or drug conjugates thereof, pharmaceutical compositions or kits comprising them and their use for the preparation of a medicament. The multivalent nano antibody and the drug conjugate thereof have good stability and targeting property, have high penetrating power on tumor tissues, can efficiently kill tumor cells, prolong the circulation time of the antitumor drug and reduce the systemic toxicity of the antitumor drug.)

1. A method of making a multivalent nanobody, the method comprising the step of linking a plurality of nanobodies to a dendrimer via an enzymatic reaction.

2. The method of claim 1, wherein the plurality of nanobodies comprises 2-16 or more nanobodies, such as 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more, to produce multivalent nanobodies of corresponding valency; optionally the nanobody may be a drug, e.g. a targeted drug for the treatment of tumors, e.g. a drug targeting a tumor antigen or a growth factor receptor, e.g. a drug targeting EGFR, HER2, VEGFR.

3. The method of claim 1 or 2, wherein the nanobody further comprises a polypeptide tag and may be site-specifically linked to the dendrimer via the polypeptide tag.

4. The method of any one of claims 1-3, wherein the nanobody comprises Nb, a C-tag (cysteine tag) and/or a Q-tag (glutamine tag), wherein Nb is a nanobody, the C-tag comprises one or more (e.g. 2,3, 4, 5) cysteines, e.g. 3 cysteines, which may be present continuously or discontinuously in the C-tag, preferably, to ensure specificity, the Q-tag may comprise only one glutamine, optionally the Q-tag may further comprise one or more other arbitrary amino acids, e.g. one or more (e.g. 2,3, 4, 5) leucines and/or one serine and/or one glycine, e.g. the Q-tag may be LLQX, X representing an arbitrary amino acid.

5. The method of any one of claims 1-4, wherein Nb, C tags and/or Q tags may be linked by one or more linkers, which may comprise one or more (e.g. 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids (e.g. G and/or S), e.g. the linker may be a GS and/or GGGS and/or GGS linker.

6. The method of any one of claims 1-5, wherein the nanobody has one or more structures selected from any one of the following formulae: Nb-C tag, Nb-Q tag, Nb-linker-C tag, Nb-linker-Q tag, Nb-linker 1-C tag-linker 2-Q tag, Nb-linker 1-Q tag-linker 2-C tag, wherein linker, linker1 and/or linker 2 may comprise 2-20 (e.g., 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids, e.g., linker1 may comprise 8-15 amino acids, linker 2 may comprise 6-10 amino acids, C tag may be one or more, C tag may be, e.g., CCC, C-GS-C, Q tag may be, e.g., LLQS, LLQG.

7. The method of any one of claims 1-6, wherein the dendrimer may be a dendrimer having a reactive group, such as a reactive amino group, e.g., a dendritic polylysine.

8. The method of claim 7, wherein the dendritic polylysine can be a primary, secondary, tertiary, quaternary, or quinary polylysine.

9. The method of any one of claims 1-8, wherein the dendrimer may be further linked to a modifying agent, such as a modifying agent that increases stability, reduces antigenicity, increases half-life in vivo, such as a polymer modifying agent, such as a polyethylene glycol (PEG) modifying agent, which may be modified by a reactive group of the dendrimer, such as a reactive carboxyl group.

10. The method of any one of claims 1-9, wherein the enzymatic reaction is a transglutaminase-catalyzed reaction.

11. The method of claim 10, wherein the plurality of nanobodies are catalyzed by transglutaminase, and the carbon termini between the nanobodies are attached in a site-directed manner by the dendrimer as a scaffold.

12. The process of any of claims 1-11, wherein the enzymatic reaction can be carried out at room temperature (25-35 ℃) for 15-120 min.

13. The method of any one of claims 1-12, wherein the ratio of dendrimer to nanobody is 1:1 to 1:20, such as 1:1, 1:2, 1: 4.

14. A method of preparing a multivalent nanobody drug conjugate, which may be prepared by the method of any one of claims 1-13, wherein the drug may be an anti-tumor drug, such as a metal drug, e.g. a platinum (e.g. tetravalent platinum) drug, wherein the method comprises a method of conjugating the multivalent nanobody to a drug with a functional group, such as a tetravalent platinum prodrug with a maleimide functional group.

15. The method of claim 14, wherein the method comprises:

treating the multivalent nanobody to obtain an active group, e.g., by treatment with a reducing agent to obtain an active thiol group;

preparing a complex of the bifunctional coupling agent and a drug, such as a complex of a maleimide group-containing metal drug;

reacting the multivalent nanobody having an active group with the complex of the metal drug.

16. The method of claim 14 or 15, wherein the multivalent nanobody is in a 1:3 to 1:30 relationship to the mass of the complex concentration of the metal drug conjugate; optionally the reaction may be carried out at room temperature (25-35 ℃); optionally the reaction time is 6-15 h.

17. The method of any one of claims 14-16, wherein the complex of the metal drug is coupled via a site-specific reaction via a bifunctional coupling agent and an active thiol group on a cysteine tag of the multivalent nanobody.

18. A multivalent nanobody or a drug conjugate thereof, optionally prepared by the method of any one of claims 1-17, wherein the carbon end of the multivalent nanobody is attached in a site-directed manner, on a dendrimer scaffold, optionally the multivalent nanobody, the dendrimer and/or the drug conjugate are as defined in any one of claims 1-17.

19. A pharmaceutical composition or kit, e.g. which may be used for the treatment of a tumor, comprising a multivalent nanobody according to claim 18 or a drug conjugate thereof.

20. Use of a multivalent nanobody according to claim 18 or a drug conjugate thereof for the preparation of a medicament or a kit, for example for the treatment of a tumor.

Technical Field

The invention belongs to the field of biological agents, relates to a preparation method and application of a multivalent nano antibody and a drug coupling drug thereof, and particularly relates to a simple and efficient method for constructing the multivalent nano antibody by using dendritic molecules as a scaffold, a preparation method of a multivalent nano antibody coupling tetravalent platinum prodrug and application of the multivalent nano antibody coupling tetravalent platinum prodrug in the aspect of tumor resistance.

Background

Cancer is a group of genetic diseases that severely threaten human health. In recent years, the incidence of cancer has increased dramatically in various countries of the world, and has become a common disease and a frequently encountered disease, and the attack of cancer is a serious test that scientists need to face. With the continuous progress and development of science and medical technology, single or multiple cancer treatment methods mainly including surgical resection, traditional chemotherapy and radiotherapy have been greatly developed. Chemotherapy is called chemical drug therapy, plays an important role in clinical treatment as a classical tumor inhibition treatment means, but still has a plurality of problems in the application process: many solid tumors have no effective targeted drugs, natural or acquired drug resistance of the tumors, severe toxic reaction and severe toxic and side effects of the antitumor drugs on human bodies and the like. Approaches to targeted delivery of drugs to specific tumor sites are being developed.

Antibody conjugate drugs (ADCs) have gained remarkable success as targeted therapeutics in the cancer treatment field, but due to the large molecular weight of antibodies, poor tissue penetration, poor therapeutic effect on solid tumors, cumbersome antibody preparation process and high cost, further limit its wide application.

The nano antibody is paid more attention in recent years as a novel nano targeting preparation, and compared with the traditional monoclonal antibody, the nano antibody has the following characteristics: high affinity with antigen, small relative molecular weight, high stability and solubility, low immunogenicity, easy humanization modification, strong tissue penetration capacity, low cost, easy modification at molecular level, and the like. The tumor treatment drug prepared from the nano antibody has high selectivity, and the specific uptake of the anti-tumor drug is increased by the nano antibody drug through a receptor-mediated internalization way, so that the drug can be enriched at a specific tissue part. The nano antibody coupling drug (NDC) is generated at the same time.

However, the monovalent NDC has some limitations, such as fast clearance in vivo, relatively low drug loading, and the multivalent nanobody has a prolonged circulation half-life in vivo due to its relatively increased molecular weight, while retaining strong targeting and tumor penetration abilities, and shows more effective targeting anti-tumor effect than the single nanobody.

The current preparation methods related to multivalent nanobodies are as follows: i) genetic engineering, such as multivalent nanobodies against death receptor-5, have shown that multivalent nanobodies have superior ability to cause apoptosis in cancer cells (Sadeghnezhad, int.j.mol.sci,2019,20, 4818; huet h.a., MAbs,2014,6(6), 1560-. However, there are some defects, such as the selection and length of the linker between the nanobody fragments, and the connection mode of the nanobody ends may affect the antigen binding function. In addition, the expression level and stability of the recombinant protein are also considered. The operation is relatively complicated and the difficulty is slightly high. Ii) construction of bivalent or bispecific constructs (Els Consrath K, J.biol.chem.,2001, 276(10),7346-7350) using antibodies as templates and nanobodies as building blocks, which are simpler and more complicated than antibodies. Iii) linking by means of enzymes or chemical cross-linking agents, so far, coupling between nanobodies by means of chemical cross-linking agents has not been retrieved, and it is likely that reaction efficiency and nonspecific linking between nanobodies affect protein function, thereby limiting the application thereof. The construction of enzymatically mediated multivalent nanobodies has not yet emerged.

Based on the current technology, a simple and efficient preparation method of the multivalent nano antibody is urgently needed to be designed and developed, and the application of the multivalent nano antibody coupling drug in tumor treatment is urgently needed to be researched and developed.

Disclosure of Invention

The present invention has been devised in view of the above-mentioned problems. The existing multivalent nano antibody is mainly expressed by gene fusion during construction, and has the technical or cost problem. And the multivalent nanometer antibody of gene fusion has certain difficulty in expression and preparation.

Based on the problems, the invention provides a preparation method of a multivalent nano antibody, a multivalent nano antibody drug conjugate is prepared, and the application of the multivalent nano antibody drug conjugate in the aspect of tumor resistance is explored.

In some embodiments, the present invention provides a method of making a multivalent nanobody, the method comprising the step of linking a plurality of nanobodies to a dendrimer by an enzymatic reaction.

In some embodiments, the number of nanobodies in the multivalent nanobody is not particularly limited, and may include, for example, 2 to 16 or more nanobodies, such as 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more, to prepare multivalent nanobodies of corresponding valency.

In some embodiments, nanobodies (Nb) described herein include single domain antibodies with only heavy chain variable region, also known as heavy chain antibodies (HcAb), heavy chain variable region antibodies (VHH), which have the full antigen binding capacity of heavy chain antibodies, but are small in molecular weight, simple in structure, high in stability, and easily enter tissues. The nano antibody is easy to carry out gene operation to prepare a multivalent antibody, and can also be prepared into fusion protein for targeted therapy and the like. In some embodiments, the nanobody comprises a modified nanobody, e.g., a reduced immunogenicity modification (e.g., humanization) and an extended half-life modification (e.g., attachment of an anti-albumin domain, etc.).

Herein, the nanobody may comprise a nanobody for use as a medicament, e.g. a targeted medicament for the treatment of tumors, e.g. a medicament targeting a tumor antigen or a growth factor receptor, e.g. a medicament targeting EGFR, HER2, VEGFR. In some embodiments, the nanobody may comprise a nanobody that has been approved as a drug or is undergoing research and clinical trials, such as cablevi (caplacizumab), Vobarilizumab, ozolarizumab, LCAR-B38M, BI836880, BI655088, and the like.

In some embodiments, the nanobody further comprises a polypeptide tag, and may be site-specifically linked to the dendrimer via the polypeptide tag. In some embodiments, the nanobody comprises Nb, a C-tag (cysteine tag) and/or a Q-tag (glutamine tag), wherein Nb is a nanobody and the C-tag comprises one or more (e.g., 2,3, 4, 5) cysteines, e.g., 3 cysteines, which may be present continuously or discontinuously in the C-tag. In some embodiments, the C-tag may be one or more, and the C-tag may be, for example, CCC, CGG, CSS, CGS, CCGG, CCGS, CGSC, CGCS, C-GS-C-GS-C, and the like. In some embodiments, to ensure specificity, the Q-tag may comprise only one glutamine, optionally the Q-tag may also comprise one or more other arbitrary amino acids, such as one or more (e.g. 2,3, 4, 5) leucines and/or one serine and/or one glycine, e.g. the Q-tag may be LLQX, X representing an arbitrary amino acid. In some embodiments, the Q-tag may be LLQS, LLQG, LLLQS, LLLQG, LLQSG, LLQGs, and the like.

In some embodiments, the Nb, C-tag, and/or Q-tag of the nanobody may be linked by one or more linkers. In some embodiments, the polypeptide linker used in the present invention is not particularly limited, and may be any linker suitable for use in fusion proteins. In some embodiments, the linker of the invention may be, for example, a flexible, rigid, or cleavable linker known in the art, such as (G) n, (GGGGS) n, (EAAAK) n, (XP) n, where n may be an integer of 1,2,3, 4, 5, 6, 7, 8, 9, 10, or more, and X may be any amino acid, such as alanine, lysine, or glutamic acid, and the like. In some embodiments, a linker of the invention may comprise one or more (e.g., 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids (e.g., G and/or S), for example the linker may be a GS and/or GGGS and/or GGGGS linker.

In some embodiments, the nanobody has one or more structures selected from any of the following formulae: Nb-C tag, Nb-Q tag, Nb-linker-C tag, Nb-linker-Q tag, Nb-linker 1-C tag-linker 2-Q tag, Nb-linker 1-Q tag-linker 2-C tag, wherein linker, linker1 and/or linker 2 may comprise 2-20 (e.g., 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) amino acids, e.g., linker1 may comprise 8-15 amino acids, linker 2 may comprise 6-10 amino acids, C tag may be one or more, C tag may be, e.g., CCC, GS-C, Q tag may be, e.g., LLQS, LLQG.

In some embodiments, the dendrimers of the present invention may be dendrimers with reactive groups such as reactive amino groups, for example, dendritic polylysine. Dendrimers in this context include polymers with a regular branching structure from the center, including central molecules known as nuclei and side chain moieties known as dendrons, which can be prepared by methods known in the art, for example by synthesis by the divergent or convergent method, and with a corresponding generation number (generations). Dendrimers can make the dendrimers water soluble by binding charged or hydrophilic functional groups to functional groups on the dendrimer surface, which may also have characteristics of low viscosity, high solubility, miscibility, and high reactivity. In some embodiments, the dendrimers of the present invention may include, for example, polyamides, polyethyleneimines, polypropyleneimines, polylysines, and the like. In some embodiments, the dendritic polylysine can be a primary, secondary, tertiary, quaternary, quinary polylysine.

In some embodiments, the dendrimer may be further linked to a modifying agent, such as a modifying agent that increases stability, reduces antigenicity, increases half-life in vivo, for example a polymer modifying agent, such as a polyethylene glycol (PEG) modifying agent, which may be modified by a reactive group, such as a reactive carboxyl group, of the dendrimer.

In some embodiments, the enzymatic reaction is a transglutaminase-catalyzed reaction.

In some embodiments, the plurality of nanobodies are catalyzed by transglutaminase, and the carbon termini between the nanobodies are attached in a site-directed manner by the dendrimer as a scaffold.

In some embodiments, the enzymatic reaction may be carried out at room temperature (25-35 ℃) for 15-120 min.

In some embodiments, the ratio of dendrimer to nanobody is 1:1 to 1:20, e.g. 1:1,1: 2,1: 4.

in some embodiments, the present invention provides a method of making a multivalent nanobody drug conjugate, which may be prepared by the methods described herein. In some embodiments, the drug may be an anti-tumor drug, such as a metal drug, for example a platinum (e.g., tetravalent platinum) drug. In some embodiments, the method comprises coupling the multivalent nanobody to a drug with a functional group, such as a tetravalent platinum prodrug with a maleimide functional group.

In some embodiments, the method of making a multivalent nanobody drug conjugate comprises:

treating the multivalent nanobody to obtain an active group, e.g., by treatment with a reducing agent to obtain an active thiol group;

preparing a complex of the bifunctional coupling agent and a drug, such as a complex of a maleimide group-containing metal drug;

reacting the multivalent nanobody having an active group with the complex of the metal drug.

In some embodiments, the mass-to-mass relationship of the concentration of the complex of the multivalent nanobody to the metal drug conjugate is 1:3 to 1:30 (e.g., 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, etc.); optionally the reaction may be carried out at room temperature (25-35 ℃); optionally the reaction time is 6-15h (e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 h).

In some embodiments, the complex of the metal drug is coupled via a site-specific reaction via a bifunctional coupling agent and an active thiol group on a cysteine tag of the multivalent nanobody.

In some embodiments, the present invention provides a multivalent nanobody or a drug conjugate thereof, e.g., a multivalent nanobody or a drug conjugate thereof prepared by the methods described herein. In some embodiments, the carbon termini of the multivalent nanobody are attached in a site-directed manner, using a dendrimer as a scaffold. In some embodiments, the multivalent nanobody, the dendrimer, and/or the drug conjugate comprise a suitable multivalent nanobody, dendrimer, and/or drug conjugate described herein.

In some embodiments, the invention provides a pharmaceutical composition or kit, e.g., which can be used to treat a tumor. In some embodiments, the pharmaceutical compositions or kits of the invention comprise a multivalent nanobody or drug conjugate as described herein.

In some embodiments, the present invention provides the use of a multivalent nanobody or drug conjugate as described herein in the manufacture of a medicament or kit, e.g., for the treatment of a tumor.

In some embodiments, a medicament, composition, or kit of the invention may be administered by any route of administration known in the art, such as intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal, or other parenteral routes of administration, e.g., by injection or infusion. In some embodiments, the medicament, composition or kit of the invention may be administered by a non-parenteral route, such as a topical, epidermal or mucosal route of administration.

In some embodiments, the medicaments, compositions or kits of the present invention may comprise pharmaceutically acceptable sterile aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions. In some embodiments, the agents of the invention may be used in combination with additional therapeutic agents, such as anti-cancer agents. The amount of the drug of the present invention to be used can be determined by a method known in the art and can be appropriately adjusted according to the particular circumstances.

In some embodiments, the multivalent nanobody or drug conjugate thereof in the drug, composition or kit of the present invention may be present alone or in combination with a pharmaceutically acceptable carrier, excipient or diluent. The drug of the present invention can be prepared by methods known in the art, for example, the drug can be formulated into a solid or liquid form. In some embodiments, a medicament, composition or kit of the invention may comprise an inert solid, semi-solid or liquid filler, diluent, or any type of excipient. In some embodiments, pharmaceutically acceptable carriers, such as aqueous and non-aqueous carriers, diluents, solvents may include water, alcohols such as ethanol, polyols (propylene glycol, polyethylene glycol, glycerol, and the like) and suitable mixtures, vegetable oils, and organic esters such as ethyl oleate. In some embodiments, the medicament, composition or kit of the present invention may also comprise preservatives, wetting agents, emulsifying agents, dispersing agents, isotonic agents, such as sugars, sodium chloride, and the like, agents for prolonging the absorption of injectable medicaments, such as aluminum monostearate, gelatin, and the like. In some embodiments, the medicaments, compositions or kits of the invention may comprise the active ingredient in unit dosage form in a container such as a pre-filled syringe, a small volume infusion container or a multi-dose container. In some embodiments, the active ingredient of the medicament may be a powder, combined with a suitable carrier prior to use. In some embodiments, injectable formulations may be prepared according to known techniques, e.g., using an appropriate liquid carrier (e.g., sterile water) and optionally other additives such as preservatives, pH adjusters, buffers, isotonics, dissolution aids, and/or surfactants, and the like, to provide injectable solutions or suspensions, which may also include other additives that delay the release of the drug, e.g., salts, solubility modifiers, or precipitating agents. The medicament, composition or kit of the invention may further comprise a label or package insert which may contain information regarding the indication, usage, dosage, administration, contraindications and/or warnings associated with the use of the medicament.

The preparation method of the multivalent nano antibody provided by the invention can realize the fixed-point and accurate assembly of a plurality of nano antibodies into the multivalent nano antibody. The invention provides a framework by utilizing dendritic polylysine, and a multivalent nano antibody is constructed by catalysis of glutamine transaminase. The enzyme-mediated ligation reaction has the characteristics of mild conditions, simplicity, high efficiency and innovativeness, and the technical problems are overcome.

In addition, to improve the current disadvantages of chemotherapeutic drugs: such as natural or acquired drug resistance of the tumor, severe toxic and side effects and the like. In the embodiment of the invention, a tetravalent platinum prodrug is synthesized, and a functional group maleimide is modified on the tetravalent platinum prodrug, so that the tetravalent platinum prodrug can be site-specifically coupled with a nanobody without interfering the function of the nanobody. The targeting property of the nano antibody is utilized to specifically deliver the tetravalent platinum prodrug to tumor cells, and due to the good penetrating capacity of the nano antibody, the design can play an important role in the treatment of solid tumors.

In addition, in order to obtain prolonged half-life and enhanced affinity and targeting of related receptors, a multivalent nanobody is constructed, so that prolonged circulation half-life in vivo is obtained, accumulation at a tumor part is increased, tumor is treated in a more effective targeted manner, and meanwhile, toxic and side effects of the system are reduced. Thereby being hopeful to mediate the application of the platinum metal drug in the aspect of target treatment of tumors.

The invention provides a multivalent nano antibody and a preparation method thereof, which can realize the fixed-point and accurate assembly of a plurality of nano antibodies. According to the technical means of genetic engineering provided by the invention, the nano antibody is modified, and the modified nano antibody provides a site C tag capable of being specifically coupled with an anti-tumor drug and a site Q tag capable of realizing multimerization.

Preferably, in the construction of the nanobody fused with the tag, in order to obtain a more stable property and function-maintaining nanobody, linkers (linkers) of different lengths are designed.

According to the method provided by the invention, the dendritic polylysine is used for providing a framework in the embodiment, and the multivalent nanobody is constructed by catalysis of glutamine transaminase. The enzyme-mediated ligation reaction has the characteristics of mild conditions, simplicity and high efficiency.

In particular, the pegylation of the protein is completed at the same time of constructing the multivalent nanobody. The molecular weight of the product is further increased on the molecular weight of the multivalent nanobody so as to obtain longer in vivo circulation half-life; and simultaneously, the stability of the multivalent nano antibody in vivo and in vitro is improved.

After the construction of the multivalent nano antibody is completed, according to the preparation method of the nano antibody drug conjugate provided by the invention, a tetravalent platinum site is specifically connected to the C tag of the nano antibody, so that the multivalent nano antibody tetravalent platinum conjugate is constructed. In the examples, the system studies of the application of the pegylated multivalent nanobody-tetravalent platinum conjugate in anti-tumor. The prepared multivalent nano antibody-tetravalent platinum conjugate is mediated by a nano antibody, and a tetravalent platinum prodrug is enriched at a tumor part, is specifically taken up by cells through a receptor-mediated internalization pathway, is reduced into bivalent platinum after entering tumor cells, and kills the cells. Compared with the monovalent nano antibody-tetravalent platinum conjugate, the multivalent nano antibody-tetravalent platinum conjugate prepared according to the invention has more remarkable tumor inhibition effect in an animal model, and the multivalent nano antibody prolongs the in vivo circulation half-life period of the drug, improves the pharmacokinetic property and reduces the systemic toxicity of the drug. Thereby being hopeful to mediate the application of the platinum metal drug in the aspect of targeted therapy.

In the invention, a preparation method of a multivalent nanobody and a tetravalent platinum prodrug conjugate thereof is disclosed. The carbon end of the nano antibody is fused with a polycysteine tag and a glutamine tag, and the polycysteine tag is used for coupling tetravalent platinum drugs; the dendritic polylysine provides an active amino group, and is connected with a glutamine label at the carbon terminal of the nano antibody under the catalysis of glutamine transaminase to construct the multivalent nano antibody taking the dendritic polylysine as a framework. In some embodiments of the invention, the generation number of the dendritic polylysine may be one to five generations, and pegylation is performed to construct a pegylated multivalent nanobody. In some embodiments, the method for preparing the pegylated multivalent nanobody-tetravalent platinum conjugate essentially comprises the steps of:

the first step is as follows: the carbon end of the nano antibody sequence in the cDNA plasmid of the nano antibody is fused with a linker 1-C3 tag-linker 2-Q tag fragment by using a molecular cloning technology. And transferring the modified plasmid into a prokaryotic expression system.

The second step is that: the labeled nano antibody is expressed by an isopropyl thiogalactoside-induced expression strain and is primarily purified by nickel column affinity chromatography.

The third step: preparing dendritic polylysine by a solid-phase synthesis method, and pegylating the dendritic molecules to obtain the pegylated dendritic polylysine.

The fourth step: and (3) utilizing glutamine transaminase to connect a plurality of labeled nano-antibodies to a polyethylene glycol polylysine molecule to construct the multivalent nano-antibody.

The fifth step: preparing a tetravalent platinum complex containing maleimide groups.

And a sixth step: the complex of tetravalent platinum of maleimide group, namely the maleamido platinum, is mixed with the pegylated multivalent nano antibody to obtain the pegylated multivalent nano antibody-tetravalent platinum conjugate.

It is worth noting that in accordance with the method provided by the present invention, we prepared first, second and multiple generation dendritic polylysines in the examples and constructed bivalent, trivalent, tetravalent, pentavalent and even more multivalent nanobodies accordingly. And is coupled with a drug, thereby preparing a multivalent nano antibody-based drug conjugate system and applying the multivalent nano antibody-based drug conjugate system in antitumor treatment. Herein, unless otherwise specifically stated, the term "linked" may encompass covalent linkage; the term "amino acid" may include D-and L-amino acids, preferably referring to L-amino acids.

In particular, in the first step of the process provided by the present invention: the Nb-linker 1-C3 tag-linker 2-Q tag has a series of attempts and improvements on the length and sequence of the linker1 and the linker 2, wherein the length of the linker1 is 8-15 amino acids, and the length of the linker 2 is 6-10 amino acids.

Preferably, in the fifth step: the relation between the concentration of the pegylated multivalent nano antibody (based on the monovalent nano antibody) and the substance amount of the concentration of the tetravalent platinum complex with the maleimide group is 1: 3-1: 30; the reaction condition is normal temperature (25-35 ℃), and the time is 6-15 h.

Furthermore, the preparation method for constructing the multivalent nano antibody provided by the invention can be suitable for the modification and preparation of all nano antibodies. Moreover, the multivalent nanobody conjugate method provided in the embodiments of the present invention is also applicable to other functionally active metal drugs.

Particularly, the pegylated multivalent nano antibody-tetravalent platinum prodrug conjugate provided by the invention has good penetrating power on tumor tissues, has longer circulation time in a mouse body than a monovalent nano antibody, has an especially obvious tumor inhibition effect, and reduces the systemic toxicity of the drug.

While the anti-tumor platinum drug plays an anti-tumor role, the multivalent nano antibody also plays an anti-tumor role through influencing a signal channel of a tumor cell surface marker. The combination of the nano antibody of the targeted cell surface antigen and the antigen can induce the cell internalization of the nano antibody-receptor complex, generate certain interference on a downstream signal path related to a membrane receptor, and play a role in tumor inhibition together with a platinum drug.

The invention discloses a method for preparing a multivalent nano antibody and a drug conjugate thereof, and researches the application of the conjugate in the aspect of tumor resistance. The embodiment of the invention discloses simple, convenient and efficient preparation of an enzyme-catalyzed multivalent nano antibody, wherein a pegylated multivalent nano antibody connected between carbon ends is prepared in a fixed-point manner by using pegylated dendritic polylysine, and an anticancer metal drug tetravalent platinum prodrug is modified in a site specificity manner to prepare a pegylated multivalent nano antibody-tetravalent platinum conjugate. The preparation method comprises the following steps: 1. and (3) preparing a multivalent nanobody-tetravalent platinum conjugate. Firstly, constructing a nano antibody with a cysteine label and a glutamine label by utilizing a genetic engineering technology, preparing pegylated dendritic polylysine again, and constructing to obtain the pegylated multivalent nano antibody by taking the pegylated dendritic polylysine as a bracket under the catalysis of transglutaminase. Preparing tetravalent platinum prodrug with a maleimide functional group, incubating the tetravalent platinum prodrug with the polyethylene glycol multivalent nano antibody after reduction treatment at room temperature, and purifying to obtain the polyethylene glycol multivalent nano antibody-tetravalent platinum conjugate. 2. The application of the conjugate in the aspect of resisting tumors is explored. The polyethylene glycol multivalent nano antibody-tetravalent platinum conjugate disclosed by the invention can specifically deliver the tetravalent platinum prodrug to a tumor part in a targeted manner, and has no damage to a normal part, so that the system toxicity of a platinum anti-tumor drug is reduced. And the coupling of a plurality of nano antibodies and the increase of molecular weight enable the drug to obtain longer half-life period in a mouse body, simultaneously maintain the penetrating capacity of tumor tissues, increase the accumulation amount at tumor parts and have good tumor inhibition effect in the aspect of treating tumors.

In some embodiments, the present invention relates to the following aspects:

1. a method for preparing a multivalent nano antibody and a metal drug conjugate thereof by utilizing dendritic polylysine is characterized by comprising the following steps: constructing a multivalent nano antibody connected with a carbon end by using dendritic polylysine as a scaffold fixed point, and pegylating the multivalent nano antibody to obtain a prolonged circulation half-life; and the prepared tetravalent platinum prodrug with the maleimide functional group is coupled with the multivalent nano antibody to form the polyethylene glycol multivalent nano antibody-tetravalent platinum conjugate.

2. The pegylated multivalent nanobody-tetravalent platinum conjugate according to item 1, characterized in that: the nano antibody is modified through genetic engineering, a cysteine label and a Q label are fused on the nano antibody to obtain Nb-linker 1-C tag-linker 2-Q tag, and linkers (linker 1:8-15 amino acids; linker 2: 6-10 amino acids) with different lengths are designed among the labels to construct different nano antibodies. The method is applicable to a wide variety of nanobodies.

3. The pegylated multivalent nanobody-tetravalent platinum conjugate according to item 1, characterized in that: the dendritic polylysine is polylysine with generation numbers of one to five.

4. The pegylated multivalent nanobody-tetravalent platinum conjugate according to item 1, characterized in that: the multivalent nano antibody is formed by catalytic connection of transglutaminase, carbon ends among the nano antibodies are connected in a fixed-point mode, and dendritic polylysine is used as a support to obtain the pegylated multivalent nano antibody with remarkably improved stability, and the pegylated multivalent nano antibody has good targeting capability and tumor penetrating capability on tumor cells and tissues with high expression of corresponding antigens or receptors.

5. The pegylated multivalent nanobody-tetravalent platinum conjugate according to item 1, characterized in that: the multivalent nanobody is not only tetravalent, but also can be used for correspondingly constructing multivalent nanobodies with other valence states such as bivalent, trivalent and pentavalent according to the method disclosed by the invention.

6. The pegylated multivalent nanobody-tetravalent platinum conjugate according to item 1, characterized in that: in the preparation method of the multivalent nano antibody and the coupling of the anti-tumor metal drugs, the multivalent nano antibody and the coupling of the anti-tumor metal drugs are site-specific. In particular, the influence of non-specific coupling on protein stability and function is avoided.

7. According to the pegylation multivalent nanobody-tetravalent platinum conjugate shown in the item 1, the application of the pegylation multivalent nanobody-tetravalent platinum conjugate in treating cancer can specifically deliver tetravalent platinum drugs into tumor cells and reduce the tetravalent platinum drugs into bivalent platinum, so that the tumor cells are killed, and the tumor growth is inhibited.

8. According to the pegylated multivalent nanobody-tetravalent platinum conjugate shown in item 1, in the application for treating cancer, the conjugation of the multivalent nanobody can increase the circulation half-life of the platinum-based drug in vivo and reduce the systemic toxicity of the drug.

9. The polyethylene glycol multivalent nanobody-tetravalent platinum conjugate shown in item 1 can specifically bind to the membrane receptor to cause complex internalization, interfere or block the downstream pathway thereof and down-regulate the expression level of the receptor on the surface of tumor cells when being used for treating tumors with high expression of corresponding antigens or receptors of the nanobody, and shows synergistic antitumor effect with antitumor metal drugs.

10. A method for preparing a pegylated multivalent nanobody, comprising the steps of:

1) preparing a nano antibody with cysteine and glutamine labels by utilizing a genetic engineering technical means, and designing nano antibodies with different linker lengths;

2) preparing first, second and/or multi-generation dendritic polylysine by using a solid phase synthesis method, wherein the dendritic polylysine contains a plurality of active amino groups, and the carbon end of the dendritic polylysine is modified with polyethylene glycol;

3) the pegylated polylysine and the purified labeled nano antibody are incubated with transglutaminase with catalytic linking function for 15-120min at room temperature, and the bivalent, quadrivalent and multivalent nano antibodies are purified by a molecular exclusion chromatographic column.

11. The method according to item 10, wherein the multivalent nanobody is prepared by: the polymerization of the nano antibody is realized by using the pegylated dendritic polylysine as a framework and realizing the site-specific catalytic connection through the transglutaminase. The obtained multivalent nano antibody is connected with a carbon end, so that the influence on the binding capacity of a complementarity determining region structurally close to the N end of the nano antibody, which is possibly caused by carbon-nitrogen end connection, is avoided.

12. The method according to item 8, wherein the multivalent nanobody is prepared by: the reaction is an enzymatic reaction, the reaction condition is mild, and the reaction can be carried out efficiently at room temperature (25-35 ℃).

13. The method according to item 8, wherein the multivalent nanobody is prepared by: the reaction is an enzymatic reaction, and the ratio of the polyethylene glycol polylysine (based on active amino) to the nano antibody is 1:1, the reaction efficiency is high.

14. A method for preparing a polyethylene glycol multivalent nanobody-tetravalent platinum conjugate, which is characterized by comprising the following preparation steps:

1) obtaining the pegylated multivalent nanobody according to the preparation method of item 10, treating the pegylated multivalent nanobody with a reducing agent for a period of time, and purifying the pegylated multivalent nanobody to obtain a nanobody having a plurality of active thiol groups;

2) preparing a tetravalent platinum complex containing maleimide groups;

3) the tetravalent platinum complex of maleimide group, namely the maleamido platinum, and the pegylated multivalent nano antibody are mixed for a period of time at room temperature, and then the small molecular compound is removed by a desalting column to obtain the pegylated multivalent nano antibody-tetravalent platinum conjugate.

15. The method of preparing the pegylated multivalent nanobody-tetravalent platinum conjugate of item 14, wherein: the relation between the concentration of the polyethylene glycol multivalent nano antibody (based on the univalent nano antibody) and the substance amount of the concentration of the tetravalent platinum complex with the maleimide group is 1: 3-1: 30; the reaction condition is normal temperature (25-35 ℃), and the reaction time is 6-15 h.

16. The method of preparing the pegylated multivalent nanobody-tetravalent platinum conjugate of item 14, wherein: the maleamidoplatinum is coupled to the nanobody through a click reaction of the maleamido and thiol groups on the cysteine tag, and the reaction is site-specific.

17. The pegylated multivalent nanobody-tetravalent platinum conjugate prepared according to the method of item 14, characterized in that the pegylated multivalent nanobody-tetravalent platinum conjugate has very good stability, simultaneously has very good targeting to cells with high expression of the corresponding receptor, and has very good penetration to tumor tissues, can kill tumor cells in vitro, has good inhibition effect on tumors in a tumor-implanted mouse model, simultaneously prolongs the circulation time of the anti-tumor metal drug and reduces its systemic toxicity.

The invention has the following advantages and positive effects.

1. Enzymatic reaction mediated site-specific, precise ligation assembly of multiple nanobodies

The invention transforms a plurality of nano antibodies by a genetic engineering transformation technology. Different flexible chains were designed to add functional tags: and Q tag, taking dendritic lysine with amino at the tail end as a framework, and catalyzing the nano antibody Q tag and the tail end amino of the dendritic polymer to form an isopeptide bond by using mTGase to complete the polymerization of the nano antibody. The construction method of the multivalent nano antibody is site-specific, has no influence on the function of the nano antibody, and is simple and convenient, mild in condition and high in efficiency. The pegylation multivalent nano antibody can be simply and efficiently prepared. In addition, the multivalent nano antibody constructed by the method not only retains the targeting property of the nano antibody and improves the binding affinity of the nano antibody to the corresponding antigen, but also has good penetrating power and prolongs the half-life period in vivo. The method effectively avoids the problems caused by the gene fusion expression of the multivalent nano antibody: such as stability, expression level, operation difficulty and the like. But also exhibits greater penetration than multivalent antibodies.

2. Site-directed ligation of tetravalent platinum prodrugs

The invention transforms the nano antibody by genetic engineering transformation technology. Different flexible chains were designed to add functional tags: c tag, namely coupling the PEGylated multivalent nanobody with a tetravalent platinum prodrug in a targeted manner through cysteine tags on the PEGylated multivalent nanobody to prepare the PEGylated multimeric nanobody drug conjugate. So that the nano-antibody targeting property, the polyethylene glycol enhanced stability and the tetravalent platinum complex cytotoxicity are realized.

For the univalent nano antibody, the multivalent nano antibody can provide more drug binding sites, improve the drug loading rate and enhance the killing capacity of tumor cells.

3. Improved pharmacokinetic properties

Compared with the univalent nano antibody drug conjugate, the multivalent nano antibody drug conjugate has the advantages of increased molecular mass and prolonged in vivo circulation time. Particularly, the multivalent nano antibody has stronger penetrating power while improving the affinity of the targeted antigen, increases the enrichment of the multivalent nano antibody in tumor tissues, further improves the pharmacokinetic property and enhances the anti-tumor effect.

4. Excellent antitumor effect

The multivalent nano antibody tetravalent platinum conjugate prepared by the method provided by the invention has more excellent anti-tumor effect than a monovalent nano antibody drug conjugate.

5. Reducing systemic toxicity

The multivalent nano antibody drug conjugate prepared by the method provided by the invention is a targeted drug system capable of being taken up by specific tumor cells. The system has obvious stability and cell selectivity, so that the system has no damage to normal cells, and can reduce the toxic and side effects of the traditional medicine.

In general, the pegylation multivalent nanobody and the drug conjugate thereof prepared according to the method provided by the invention have the characteristics of simplicity and high efficiency while finishing site-specific modification, and show good effects in the aspect of targeting anti-tumor. The method is characterized in that a label containing two active sites is fused at the carbon end of a nano antibody through a molecular cloning technology, the label on the nano antibody is catalyzed by cheap and easily-obtained glutamine transaminase, dendritic polylysine is taken as a bracket to realize fixed-point nano antibody polymerization, and the carbon ends of the multivalent nano antibody are connected together, so that the influence on the binding capacity of a complementary determining region close to the N end is small; the reaction of maleimide group and sulfhydryl group is adopted to couple tetravalent platinum prodrug on cysteine label of nano antibody specifically. Simply and efficiently preparing the pegylated multivalent nano-antibody drug conjugate.

The results of the researches on the aspects of stability, targeting property, tumor penetrating capability, accumulation amount of drugs on tumor parts, tumor inhibition effect, systemic toxicity and the like of the multivalent nano antibody tetravalent platinum conjugate constructed according to the preparation method provided by the invention show that the polyethylene glycol multivalent nano antibody-drug conjugate designed and prepared according to the invention has excellent anti-tumor performance and has huge potential in the field of tumor targeted therapy. The multivalent nano antibody and the drug conjugate thereof have good stability and targeting property, have high penetrating power on tumor tissues, can efficiently kill tumor cells, prolong the circulation time of the antitumor drug and reduce the systemic toxicity of the antitumor drug.

Drawings

FIG. 1 is a map of expression plasmid pET 22b used in the construction of the labeled nanobody in the present example.

FIG. 2 shows the identification and purity detection of the purified labeled nanobody protein of example 6 of the present invention.

FIG. 3 is an HPLC analytical characterization of the dendrimeric polylysine constructed in example 7 of the present invention.

FIG. 4 is an ESI-MS analytical characterization of a dendrimeric polylysine constructed in example 7 of the present invention.

FIG. 5 is a gel chromatography (GPC) analytical characterization of the pegylated dendritic polylysine constructed in example 8 of the present invention.

FIG. 6 is a drawing showing the preparation of pegylated dendritic polylysine constructed in example 8 of the present invention¹And H NMR analysis and characterization.

Fig. 7 is a schematic diagram of an embodiment of a preparation method of the pegylated and multivalent nanobodies, and identification and purity detection of the products thereof.

Lane 1: the transglutaminase catalyzes the pegylation reaction of the labeled nanobody. Lane 2: and (3) the polyethylene glycol nano antibody after the purification of a size exclusion chromatographic column. Lane 3: the transglutaminase catalyzed conjugation reaction of the labeled nanobody with the pegylated dendritic polylysine. Lane 4: a pegylated multivalent nanobody after size exclusion chromatography column purification.

FIG. 8 is an ESI-MS characterization of maleimidotetravalent platinum prepared in example 10 of the present invention, wherein A shows the ESI-MS characterization; b shows a Simlated isotatic pattern and an Experimental isotatic pattern.

FIG. 9 is a 1H NMR characterization of maleimidotetravalent platinum prepared in inventive example 10.

FIG. 10 shows targeting of the nanobody-tetravalent platinum conjugate system of the disclosed embodiment. As known in the art, the nuclei and the nanobody-tetravalent platinum conjugates were labeled with different dyes (nuclei: DAPI; conjugate: FITC), respectively, to show targeting of the conjugates.

FIG. 11 is a graph depicting cellular uptake of the Nanobody-tetravalent platinum conjugate system of the disclosed embodiments.

The uptake by EGFR-positive A431 cells is shown in ■ and by □ for EGFR-negative A2780 cells. For each time point, the left-to-right histogram represents Cisplatin, Pt @ Nb, Pt @ Nb-PEG, Pt @ Nb₄-PEG。

FIG. 12 is a tumor cytotoxicity assay of an example nanobody-tetravalent platinum conjugate system disclosed herein. For comparison purposes, the left bar represents a431 and the right bar represents a2780 for the same drug.

FIG. 13 is a graph showing the permeability of multicellular spheres of a nanobody-tetravalent platinum conjugate system according to an embodiment of the present disclosure.

FIG. 14 is a pharmacokinetic study of an example Nanobody-tetravalent platinum conjugate system disclosed herein.

FIG. 15 shows the accumulation of nanobody-tetravalent platinum conjugate systems in the major organs of mice according to the disclosed embodiment of the present invention.

The accumulation amounts for different organs are shown in panel a. For each organ, the left-to-right histograms represent Cisplatin, Pt @ Nb, Pt @ Nb-PEG, Pt @ Nb₄-PEG. The accumulated amount of drug in the organ at different time points is shown in panel B. From left to right, liver, spleen, kidney and blood are indicated.

FIG. 16 is an intra-tumor accumulation of an example nanobody-tetravalent platinum conjugate system disclosed herein.

The figure shows the accumulation of the drug in the tumor at different time points, and the drugs Cisplatin, Pt @ Nb-PEG and Pt @ Nb are sequentially arranged at the same time point from left to right₄-PEG。

FIG. 17 is a graph depicting tissue permeability of an example nanobody-tetravalent platinum conjugate system disclosed herein.

As known in the art, the nucleus (DAPI), nanobody-tetravalent platinum conjugate (FITC), and blood vessels (Cy5) were labeled with different dyes, respectively, to show the tissue permeability of the conjugates.

FIG. 18 shows the in vivo anti-tumor effect of the Nanobody-tetravalent platinum conjugate system of the present invention in mice. A) Inhibition rate of groups against a431 cell xenograft tumors; B) the body weight of each group of mice was changed.

FIG. 19 is an immunohistochemical analysis of the example Nanobody-tetravalent platinum conjugate system disclosed herein.

FIG. 20 is a graph showing the EGFR expression level of tumors treated with the nanobody-tetravalent platinum conjugate system of the present disclosure. In the figure, 1 is a PBS group, 2 is a cisplatin group, 3 is a polyethylene glycol nano antibody-tetravalent platinum group, and 4 is a polyethylene glycol multivalent nano antibody-tetravalent platinum group. A) Immunohistochemical results; B) and (5) analyzing the result by Western blot.

FIG. 21: stability of Nanobody-tetravalent platinum conjugates. A) Pt @ Nb, Pt @ Nb-PEG, Pt @ Nb₄-picture of PEG. At this time, the drug concentration was 5mM (based on platinum), protein aggregation occurred at Pt @ Nb, and Pt @ Nb-PEG, Pt @ Nb₄PEG remains stable at this concentration. B) Stability testing of different concentrations of Pt @ Nb.

FIG. 22: and (3) analyzing the interaction of the platinum drug, the nano antibody-tetravalent platinum conjugate and the DNA by fluorescence spectroscopy.

Detailed Description

The enzymes, kits, vectors, host bacteria and the like described in the present invention are commercially available, and strains such as Escherichia coli (Escherichia coli) Rosetta-gami and Top10 are commercially available from NEB, restriction enzymes and the like are commercially available from Takara, PCR primers, bacterial genomic DNA extraction kits and PCR amplification kits are commercially available from Shanghai Biotechnology, Inc., and Fomc-L-Lys (Fomc) is commercially available from Shanghai Aladdin Biotechnology, Inc. Such chemicals and reagents as maleimidocaproic acid, tetramethylmorpholine, oxalyl chloride, dimethylformamide, trifluoroacetic acid, pyridine, methanol, ethyldiisopropylamine (DIEA), HBTU, HOBt, etc. are available from sigma Chemicals, Inc.

Those whose conditions are not specified in the examples are carried out according to the conventional or manufacturer-recommended conditions.

Example 1: design of linker1 and linker 2

According to the length of the linker (the length of 1:8-15 amino acids; the length of 2: 6-10 amino acids), different linker sequences and lengths are designed so as to construct a nano antibody expression vector.

In this example, we take the following length and sequence of linker for illustration.

Linker 1:GGGSGGGS,GGGGSGGGGS,GGGGSGGGGSGGGGS

Linker 2:GSGSGS,GGSGGS,GSGSGSGS,GGSGSGSGGS

Example 2: design of C tag and Q tag

According to the sequences and lengths of the C tag and the Q tag provided by the invention, different tag sequences and lengths are designed. And applied in the following embodiments.

Considering that C tag may be continuous or discontinuous, we make the following design for C tag.

C tag：CCC，C-GS-C-GS-C，CC-GS-CC

Q tag：LLQS，LLQG

Example 3: expression vector for constructing nano antibody targeting EGFR (epidermal growth factor receptor)

According to the reports of related documents, EGFR is over-expressed in 30% of tumors, and the selection of nano antibodies targeting EGFR is of great significance. In this example, we fused the carbon end of the nanobody sequence in the plasmid targeting the cDNA of the nanobody 7D12 (total gene synthesis, bio-engineering, ltd) of epidermal growth factor receptor to the linker1-C tag-linker 2-Q tag fragment to form 7D12-linker 1-C tag-linker 2-Q tag.

According to the method provided by the invention and the design in the embodiments 1 and 2, in the embodiment, the following length and sequence of the linker are selected for illustration.

Linker 1:GGGSGGGS,GGGGSGGGGS,GGGGSGGGGSGGGGS

Linker 2:GSGSGS,GGSGGS,GSGSGSGS,GGSGSGSGGS,

1.7D12-GGGGSGGGGS-CCC-GSGSGS-LLQS

The target fragment with the tag sequence was obtained by performing two reactions using the polymerase chain reaction technique according to the reaction system shown in Table 1 and the reaction conditions shown in Table 2.

First polymerase chain reaction:

a forward primer:

GGAATTCCATATGCACCATCACCATCACCATAGCGATAAA；

reverse primer: CAGCAGGAACCACCGCCACCAGAGCCACCGCCGCCGCTGCTTACGGTCACCTGG GTA, respectively;

template: artificially synthesized nano antibody sequence

Second polymerase chain reaction:

a forward primer:

GGAATTCCATATGCACCATCACCATCACCATAGCGATAAA；

reverse primer: CCGCTCGAGTTAAGATTGAAGAAGACTACCGCTACCACTACCACAGCAGGAACC ACCG, respectively;

template: first polymerase chain reaction product

Table 1: PCR reaction system for amplifying nano antibody sequence

ddH2O	30.5μL
		10xPCR buffer solution	5μL
2mM dNTP(mix)	5μL
		25mM MgCl2	3μL
10mM forward primer	2.5μL
		10mM reverse primer	2.5μL
Anti-EGFR Nanobody 7D12 plasmid	1μL
		Taq DNA polymerase	0.5μL

Table 2: PCR thermal cycling parameters for amplification of cDNA for Nanobodies

And (4) carrying out agarose gel electrophoresis analysis after the PCR reaction is finished, cutting the gel and recovering the target fragment. The recovered target fragment was digested with restriction enzymes NdeI and XhoI. The reaction system is shown in Table 3.

The expression vector pET 22b (map: FIG. 1) was digested with restriction enzymes NdeI and XhoI, and after digestion at 37 ℃ for 4 hours, it was purified by agarose gel electrophoresis, and recovered after cutting. The reaction system is shown in Table 3.

Table 3: double restriction enzyme pET 22b plasmid

pET 22b	16μL
		ddH2O	10μL
10 Xenzyme digestion buffer solution	3μL
		NdeI enzyme	1μL
XhoI enzymes	1μL

The digested target fragment was ligated with digested pET 22b using T4 DNA ligase. The target fragment and the vector plasmid were mixed at a ratio of 1:5, and ligated in a thermostatic water bath at 16 ℃ overnight. The connected plasmid is transferred into an escherichia coli Top10 sensitive strain, a monoclonal colony is selected for amplification culture, the plasmid is extracted, and the plasmid is used in the subsequent examples after sequencing identification (Biotechnology engineering Co., Ltd.).

2.7D12-GGGSGGGS-CCC-GSGSGS-LLQS

3.7D12-GGGSGGGS-CCC-GGSGGS-LLQS

4.7D12-GGGSGGGS-CCC-GSGSGSGS-LLQS

5.7D12-GGGSGGGS-CCC-GGSGSGSGGS-LLQG

6.7D12-GGGGSGGGGS-CCC-GGSGGS-LLQG

7.7D12-GGGGSGGGGS-CCC-GSGSGSGS-LLQG

8.7D12-GGGGSGGGGS-CCC-GGSGSGSGGS-LLQG

9.7D12-GGGGSGGGGSGGGGS-CGSCGSC-GSGSGS-LLQS

10.7D12-GGGGSGGGGSGGGGS-CGSCGSC-GGSGGS-LLQS

11.7D12-GGGGSGGGGSGGGGS-CGSCGSC-GSGSGSGS-LLQS

12.7D12-GGGGSGGGGSGGGGS-CGSCGSC-GGSGSGSGGS-LLQS

13.7D12-GGGSGGGS-CC-GS-CC-GGSGGS-LLQG

2-13 the construction steps of the nano antibody protein expression vector are described in 1.

Example 4: expression vector for constructing HER 2-targeted nano antibody

Breast cancer has become a big killer for women, and the search for effective drugs for treating breast cancer is very slow. HER2 is overexpressed in a variety of breast cancer cells and is considered a valuable target. In accordance with the methods provided herein, we prepared multivalent 2Rs15d nanobodies capable of targeting HER 2.

We fused the-linker 1-C tag-linker 2-Q tag fragment on the carbon end of the nano antibody sequence in the cDNA plasmid of the nano antibody 2Rs15d (whole gene synthesis, general biological system (Anhui) Co., Ltd.) targeting HER2 to form 2Rs15d-linker 1-C tag-linker 2-Q tag. According to the method provided by the invention and the design of the examples 1 and 2, the nano antibody 2Rs15 d-GGGSGGGSGS-C tag-GSSGSGS-Q tag with cysteine and Q tag is designed and prepared. Meanwhile, different sequence reconstruction can be carried out according to the sequences and the lengths of the linker1 and the linker 2 provided by the invention.

The target fragment with the tag sequence was obtained by performing two reactions using the polymerase chain reaction technique according to the reaction system shown in Table 1 and the reaction conditions shown in Table 2.

First polymerase chain reaction:

a forward primer:

GGAATTCCATATGCACCATCACCATCACCATAGCGATAAA；

reverse primer: TACCCAGGTGACCGTAAGCAGCGGCGGCGGTGGCTCTGGTGGCGGTGGTTCCGG TTCCTGCTG, respectively;

template: artificially synthesized nano antibody sequence

Second polymerase chain reaction:

a forward primer:

GGAATTCCATATGCACCATCACCATCACCATAGCGATAAA；

reverse primer: CCGCTCGAGTTAAGATTGAAGAAGACTACCACTACCGCTACCACTACCACAGCA GCAGGAACC, respectively;

template: first polymerase chain reaction product

All steps thereafter are identical to those in example 3.

Example 5: expression vector for constructing nano antibody of targeting VEGFR

VEGFR2 is a subtype of vascular endothelial growth factor receptor that promotes tumor cell proliferation, leading to dysregulation of the cell cycle of tumor cells. Therefore, the research on the compound has very important significance. According to the method provided by the invention, the anti-VEGFR nano antibody (whole gene synthesis, biological engineering Co., Ltd.) is also modified by a genetic engineering technology, and C tag and Q tag are added.

The procedure was as in example 3.

Example 6: expression purification of tagged Nanobodies

1. The labeled nanobodies are overexpressed in E.coli:

the plasmids obtained in examples 3, 4 and 5 and having the correct sequencing were transferred into the competent Rosetta-gami strain, heat shocked and recovered, and the bacterial liquid was plated, and the monoclonal transformants were picked and expanded to 4-1000mL LB medium (containing 100. mu.g/mL ampicillin) for culture. Culturing the strain to OD₆₀₀When the concentration is 0.8-1.0, isopropyl thiogalactoside (0.1-0.8mM) is added, and the induction is carried out at 25 ℃ for 10-15 h. After the completion of the culture, the cells were collected by centrifugation at 4000rpm for 20min at 4 ℃.

2. Roughly purifying the labeled nano-antibody by using Ni-NTA affinity chromatography resin:

the cells were resuspended in a resuspension buffer (20mL of cells from buffer/L of broth). The resuspended suspension was sonicated (20KHz, 15 min). The cell disruption solution was centrifuged at 16000rpm at 4 ℃ for 30 min. The supernatant was filtered with 0.8 and 0.22 μm microporous membranes and the clear solution was collected.

And pouring the supernatant into a Ni-NTA affinity chromatography resin column, placing the column on a rotary shaking table at 4 ℃, and incubating for 30min to ensure that the labeled nano antibody is fully combined on the Ni-NTA affinity chromatography resin.

The flow-through was discharged, 20mL washing buffer (containing 0-20mM imidazole for gradient elution) was added, and the mixture was placed on a rotary shaker at 4 ℃ and incubated for 30min to remove the foreign proteins bound to the resin. After the flow through was released, the resin was rinsed three times with washing buffer (containing 20mM imidazole). The tagged nanobodies were eluted from the resin with 20mL of Elution buffer (containing 160-250mM imidazole). Collecting Elution buffer, removing imidazole in the protein system by ultrafiltration and concentrating the labeled nano antibody.

Protein concentration was determined by UV-vis and BCA methods.

The purity characterization SDS-PAGE electrophoresis of the obtained labeled nanobody proteins is shown in FIG. 2.

Note: 1. resuspending buffer:20-50mM Tris-HCl pH 8.0,150mM NaCl

Washing buffer 20-50mM Tris-HCl pH 8.0,150mM NaCl,0-20mM imidazole

Elution buffer:20-50mM Tris-HCl pH 8.0,150mM NaCl,160 ℃ 250mM imidazole

Example 7: preparation of dendritic polylysine

In this example, we used the Solid Phase Peptide Synthesis (SPPS) method to prepare Dendritic Polylysine (DPK) at room temperature (25 deg.C) under nitrogen flow.

1.DPK-G₁Preparation of

600 mg of 2-chlorotrityl chloride resin was dispersed in DMF and transferred to a solid phase synthesis reactor, and the resin was allowed to swell for 30min under nitrogen sparging. Subsequently, the resin was washed with DMF (5X 5 mL). After the resin had fully swelled, 2 equivalents of Fomc-L-Lys (Fomc) -COOH (957.1 mg) and 4 equivalents of ethyldiisopropylamine (DIEA) (129.24 mg) relative to the active reactive groups of the resin were added. After 3h reaction at room temperature, the resin was washed with DMF (5X 5 mL). The reactor was charged with DMF/pyridine (4:1, V/V, 5mL) and bubbled for 20min to remove the Fomc protecting group on Fomc-L-Lys (Fomc) -resin. After the reaction, the resin was washed with DMF (5X 5 mL). Subsequently, 4-fold equivalent of Fomc-L-Lys (Fomc) -COOH (1914.2 mg), 8-fold equivalent of ethyldiisopropylamine (DIEA) (258.48 mg), and 1-fold equivalent of HBTU and HOBT relative to Fomc-L-Lys (Fomc) -COOH were added. The reaction was carried out at room temperature for 3 hours. After the reaction was complete, the resin was washed with DMF (5X 5 mL). Adding ninhydrin developer into a small amount of resin, heating in metal bath at 105 deg.C for 1min, and indicating that the indicator has no blue reaction to prove that the amino reaction is complete. Isopropanol (5X 5mL) and n-hexane (5X 5mL) were added to the reaction column, respectively, to compress the resin and blow dry the resin with nitrogen. Finally, the dendrimer polylysine was cleaved from the resin by addition of 10% TFA/methanol. After removal of the solvent by rotary evaporation, an excess of anhydrous ether was added for recrystallization, and the collected product was left to dry at room temperature. Since the product with the Fomc protecting group was difficult to analyze, we removed a small amount of the product and analyzed it by HPLC (0-60% B, 30min, 0.1% TFA) and ESI-MS after removing the protecting group with piperidine, the results of which are shown in FIG. 3 and FIG. 4.

The reaction scheme is as follows:

2.DPK-G₂preparation of

To obtain more active amino groups, multivalent nanobodies were prepared. We continued to prepare DPK-G according to the solid phase peptide synthesis method of example 7-1₂. The structural formula is as follows:

3.DPK-G₃preparation of

To obtain more active amino groups, multivalent nanobodies were prepared. We continued to prepare DPK-G according to the solid phase peptide synthesis method of example 7-1₃. The structural formula is as follows:

4.DPK-G_npreparation of

The solid-phase synthesis method can be used for preparing multi-generation dendritic polylysine compounds, and the compounds can be extracted in practical applicationFor the desired amino group. In the present invention, the n-1, 2,3 … embodiment is provided with only DPK-G₁And DPK-G₂And DPK-G₃The preparation of (2) is not limited to the examples provided in this example, and the multivalent nanobody can be prepared and subsequently studied by constructing the dendrimer polylysine compound for multiple generations according to actual needs. In particular, the dendritic polymer can be further modified as required to modify other functional groups to complete diversified loads.

Example 8 preparation of pegylated dendritic polylysine

1.DPK-G₁By pegylation of

The dendritic polylysine (DPK-G) obtained by solid phase synthesis in example 7-1 was added₁) Mixing with aminopolyethylene glycol (Shanghai Peng Biotech Co., Ltd., 80506-64-5), HBTU, DIEA according to 1.25:1:1:2, and reacting with DMF at room temperature for 3 h. After the reaction is finished, ninhydrin color reagent is used for detecting that the amino group is completely reacted, most of the solvent is removed by high vacuum rotary evaporation, and DMF/piperidine (4:1, V/V) is added into the reaction liquid and stirred for 20min at room temperature. After the reaction is finished, most of solvent is removed from the product through rotary evaporation, then the concentrated product is transferred into a dialysis bag with the molecular weight cutoff of 3kDa, secondary water is used as dialysis external liquid, liquid is changed every 2h, and the dialysis is carried out for 5 times to remove small molecular impurities such as an activating reagent and the like in the product. The dialyzed product was transferred to an EP tube and lyophilized to give a pale yellow solid. We performed gel chromatography (GPC) and nuclear magnetic analysis on the samples. The results are shown in FIGS. 5 and 6.

The reaction scheme is as follows:

2.DPK-G₂by pegylation of

Following the procedure of example 8-1, we similarly treated DPK-G₂PEGylation is carried out to obtain PEG-DPK-G₂. The structural formula is as follows:

3.DPK-G₃by pegylation of

Following the procedure of example 8-1, we similarly treated DPK-G₃PEGylation is carried out to obtain PEG-DPK-G₃. The structural formula is as follows:

example 9: preparation of multivalent nanobodies

1. Preparation of bivalent Nanobodies

The amino-protected polylysine was reacted with aminopolyethylene glycol (Shanghai Peng Biotech Co., Ltd., 80506-64-5) EDC, NHS mixed at room temperature for 24 hours. After the reaction is finished, ninhydrin chromogenic reagent detects that the amino group reaction is complete, and then the product is transferred into a dialysis bag with the molecular weight cutoff of 1kDa and ddH₂And O is dialysis external liquid, and the liquid is changed once every 2h and dialyzed for 5 times to remove micromolecular impurities such as an activating reagent and the like in the product. The dialyzed product was transferred to an EP tube and lyophilized to give a pale yellow solid.

The various labeled nanobodies obtained in example 6 were mixed with pegylated dendritic polylysine PEG-DPK-G0 at 2:1 at room temperature, and glutamine transaminase (mTGase, supplied by singing (china)) was added and reacted for 15-120min at room temperature. The product after reaction is the polyethylene glycol multivalent nanometer antibodyFurther purification was carried out in a protein purifier (HiLoad 10/60Superdex 200column),

2. preparation of tetravalent Nanobody

PEG-DPK-G obtained in example 8-1₁Contains 4 active amino groups which can be recognized by glutamine transaminase, catalyzes the connection of amino groups and glutamine labels at the carbon end of the nano antibody to form isopeptide bonds and can form the carbon endA linked multivalent nanobody.

The various labeled nanobodies obtained in example 6 were mixed with pegylated dendritic polylysine PEG-DPK-G1 at 4:1 at room temperature, and glutamine transaminase (mTGase, supplied by singing (china)) was added and reacted for 15-120min at room temperature. The product after reaction is the polyethylene glycol multivalent nanometer antibodyFurther purifying in a protein purifier (HiLoad 10/60Superdex 200column), and identifying the purity of the purified polyethylene glycol multivalent nano antibody by polyacrylamide gel, wherein the SDS-PAGE electrophoresis picture is shown in figure 7.

3. Preparation of multivalent (>4) nanobody

PEG-DPK-G prepared in example 8-2 was catalyzed by the coupling function of mTGase according to the procedure in example 9-2₂，PEG-DPK-G₃And connecting with a plurality of kinds of nano antibodies obtained in example 6 to form a plurality of different multivalent nano antibodies.

Example 10: preparation of tetravalent platinum prodrugs

Platinum drugs, due to the properties of platinum, form complexes in both tetravalent and divalent states. And studies have shown that tetravalent platinum is more stable than divalent platinum. Modification of the functional group is possible because it can contain more coordination sites. And the tetravalent platinum can be reduced into bivalent platinum under the reduction action of a reducing agent, so that the original function of the tetravalent platinum is exerted.

In accordance with the present invention, we provide in the examples the preparation of two tetravalent platinum drugs.

1. Preparation of tetravalent cisplatin prodrug

300mg of cisplatin (Shandong platinum source pharmaceutical Co., Ltd.) was dispersed in 40mL of acetic acid, and then 2mL of 30% hydrogen peroxide was added and reacted at 35 ℃ for 4 hours. After the reaction was complete, most of the solvent was removed by rotary evaporation and then precipitated with ether to give a solid. Washing with diethyl ether for three times, and freeze drying the obtained precipitate to obtain powder, i.e. cis- [ PtCl ]₂(NH₃)₂(OH)(OAc)](Ac-Pt(IV))。

Meanwhile, 250mg of maleimidocaproic acid and 1mL of oxalyl chloride were dissolved in 5mL of anhydrous dichloromethane under ice bath conditions, mixed well and then reacted overnight with shielding from light. After the reaction is finished, oxalyl chloride and dichloromethane in the mixture are removed by rotary evaporation to obtain the maleimide caproyl chloride. Ac-Pt (IV) was then dispersed in anhydrous DMF, 400mg of 4-methylmorpholine (NMM) was added, and then maleimidocaproyl chloride was slowly added dropwise under ice-water bath conditions, and the mixture was stirred overnight at room temperature in the absence of light. After the reaction is finished, most of the solvent is dried by spinning, and ether is added to precipitate the product, so as to obtain a white solid maleimide tetravalent platinum prodrug (Mal-Pt (IV)). After washing the product three times with ether, the product was obtained as a powder by freeze-drying. Product via ESI-MS and¹and H NMR identification. The results are shown in FIGS. 8 and 9. The reaction scheme is as follows:

2. preparation of tetravalent oxaliplatin

300mg of oxaliplatin (Shandong platinum source pharmaceutical Co., Ltd.) was dispersed in 2mL of 30% hydrogen peroxide and reacted at 50 ℃ for 4 hours. After the reaction was complete, most of the solvent was removed by rotary evaporation and then precipitated with acetone to give a solid. Washing with ether is repeated for three times, and the obtained precipitated solid is freeze-dried to obtain powder, namely the product, namely the tetrahydroxy tetravalent oxaliplatin.

Meanwhile, maleimide succinimide ester and tetrahydroxy tetravalent oxaliplatin are dissolved in 5mL of anhydrous dichloromethane, fully mixed and then reacted overnight in the dark. After the reaction was completed, the solvent was removed by rotary evaporation. After the reaction was completed, most of the solvent was spin-dried, resuspended in acetone, and the product was washed with diethyl ether to obtain white solid of maleimidoplatinum (Mal-Pt (IV)). After washing the product three times with ether, the product was obtained as a powder by freeze-drying.

Example 11: preparation of multivalent nanobody-tetravalent platinum conjugate

At 37 deg.CPegylation of various di-, tetra-, and multi-valencies obtained in example 9 at a constant temperature>4) Adding beta-aminoethanethiol hydrochloride, beta-mercaptoethanol or tri (2-carboxyethyl) phosphine into the nano antibody in an amount which is 5 times of the molar equivalent of the nano antibody for treatment for 3 hours, so that the sulfydryl of the cysteine on the carbon end of the multivalent nano antibody is fully reduced. Is then usedProtein purification instrument (HiTrap)^TMDesaling) to remove the reducing agent mixed in the system. The content of sulfydryl on the nano antibody is analyzed by a DTNB method, namely, by adding 5,5' -dithiobis (2-nitrobenzoic acid), through the specific color development of the reaction of the dithiobis (2-nitrobenzoic acid) and the sulfydryl.

According to the measured content of the sulfydryl, the purified nano antibody and the maleimide platinum are mixed according to the mass ratio of 1: 3-1: 30, and mixing. After incubation for 6-15h at room temperature, byThe maleimide platinum that did not participate in the reaction was removed from the system by a protein purification instrument (HiTrappTM Desainting).

The concentration of the protein was determined by BCA method and the amount of platinum in the conjugate was measured by inductively coupled plasma mass spectrometry. The dosage ratio of the different nano antibodies to the maleimide platinum determines the quantity of the maleimide tetravalent platinum which can be combined on the nano antibodies. According to the experimental results, one molecular weight nanobody can bind to about 1.8 tetravalent platinum prodrug molecules.

The preparation process of the multivalent nano antibody-tetravalent platinum conjugate comprises the following steps:

example 12: preparation of nano antibody-tetravalent platinum conjugate (Pt @ Nb) and polyethylene glycol modification (Pt @ Nb-PEG) thereof

Nanobody-tetravalent platinum conjugate (Pt @ Nb) was used as a comparative sample in example 11, wherein the protein sample preparation method was as in examples 1 to 6, and a nanobody with a cysteine tag was constructed, and the preparation of the nanobody-tetravalent platinum conjugate was as in example 11.

A pegylated Nanobody-tetravalent platinum conjugate (Pt @ Nb-PEG) was also used as the control sample in example 11, wherein the protein samples were the Nanobodies with glutamine and cysteine tags of examples 1-6. In addition, the preparation steps of the pegylated nanobody are as follows:

the labeled nanobody (3mg/mL) was mixed with aminopolyethylene glycol (1mg/mL) having a molecular weight of 5kDa at room temperature, and 1U/mL of transglutaminase was added thereto to react at room temperature for 1 hour. The product after reaction is the polyethylene glycol nano antibodyFurther purifying in a protein purifier (HiLoad 10/60Superdex 200column), and identifying the purity of the purified PEGylated nanobody by polyacrylamide gel, wherein the SDS-PAGE electrophoresis picture is shown in FIG. 7.

Preparation of pegylated nanobody-tetravalent platinum conjugate refer to example 11.

Example 13: stability of multivalent Nanobody-tetravalent platinum conjugates

The Pt @ Nb, Pt @ Nb-PEG, Pt @ Nb prepared in examples 5, 11 and 13₄PEG was concentrated by ultrafiltration, and the samples were observed for stability at time points during the concentration process. As a result, it was found that, as shown in FIG. 21A, Pt @ Nb-PEG, Pt @ Nb modified with PEG₄PEG did not precipitate at the concentration up to 5mM (based on platinum concentration) and it can be seen that the introduction of PEG has a positive effect on the in vitro stability of the Nanobody-tetravalent platinum conjugate.

In addition, Pt @ Nb was incubated at different concentrations in an incubator at 25 ℃, and at different time points, portions of the samples were centrifuged and the protein concentration was determined and found to maintain good stability over 6 days. The results are shown in FIG. 21B.

Example 14: reaction of multivalent Nanobody-tetravalent platinum conjugate with DNA

Tetravalent platinum prodrugs are a class of metal prodrugs that are capable of remaining relatively stable in the blood circulation. And can be reduced to divalent platinum by the action of a reducing agent. The presence of an amount of a reducing agent such as GSH in tumor cells can reduce tetravalent platinum to divalent platinum, which subsequently interacts with DNA to exert cytotoxicity.

Ethidium bromide (EtBr) is a highly sensitive fluorescent indicator, and can be used as a fluorescent probe for detecting the combination of platinum drugs and DNA. EtBr mixed with DNA can intercalate into double strands of DNA, generating a fluorescent signal. The platinum compound interacts with DNA to distort and unwind the DNA double helix, and the corresponding EtBr fluorescence signal changes. Therefore, whether the platinum compound interacts with the DNA or not is judged by detecting the fluorescence signal. And the combination of the two is analyzed by fluorescence spectroscopy.

Mixing the milt DNA with cisplatin, tetravalent platinum, Pt @ Nb, Pt @ Nb-PEG, Pt @ Nb₄PEG incubations in 37 ℃ water bath with/without addition of reducing agent, kept protected from light all the way. At this point. EtBr was then added at various time points and analyzed with a fluorescence spectrometer: excitation at 530nm, emission at 615nm, and recording the absorbance of the fluorescence spectrum. As shown in FIG. 22, the nanobody-tetravalent platinum conjugate was bound to DNA by the reduction of ASA/GSH. And the group without the reducing agent has no obvious signal change, which indicates that the nano antibody-tetravalent platinum conjugate can keep inertia before entering cells and is reduced in tumor cells to play a role of combining with DNA.

Example 15: application of multivalent nano antibody-tetravalent platinum conjugate in anti-tumor aspect

According to the preparation method disclosed by the invention, a series of nano-antibody-tetravalent platinum drug coupling systems are constructed, and in the embodiment, the polyethylene glycol multivalent nano-antibody-tetravalent platinum conjugate (Pt @ Nb) obtained in the embodiment 11 is used₄PEG) and the Nanobody-tetravalent platinum conjugate (Pt @ Nb) and the PEGylated Nanobody-tetravalent platinum conjugate (Pt @ Nb-PEG) in example 12 were compared to investigate the PEGylated multivalent conjugate constructed according to the preparation method provided by the present inventionThe application of the nano antibody-tetravalent platinum conjugate in the aspect of tumor resistance.

1. Targeted verification of nano antibody-tetravalent platinum system prepared by invention

Targeting of the pegylated multivalent nanobody tetravalent platinum conjugate of example 11 of the present invention was verified by immunofluorescence and compared to example 12. The method comprises the steps of labeling a nano antibody with a fluorescent probe fluorescein isothiocyanate (FITC, excitation light 488nm) in advance, and preparing a nano antibody-tetravalent platinum conjugate, a pegylated nano antibody-tetravalent platinum conjugate and a pegylated multivalent nano antibody-tetravalent platinum conjugate with the fluorescein-labeled nano antibody.

The cancer cell A431 with the epidermal growth factor over-expression and the cancer cell A2780 with the epidermal growth factor under-expression as a negative control are inoculated in a 24-well plate, and the inoculation density is 1 multiplied by 10⁵Cells/well, placed in incubator overnight culture. 1mL of fresh medium containing 50. mu.M of fluorescein-labeled nanobody-tetravalent platinum conjugate, pegylated nanobody-tetravalent platinum conjugate, or pegylated multivalent nanobody-tetravalent platinum conjugate was substituted for the original medium in the culture wells. The cells were further cultured in an incubator for 3 hours. Subsequently, the cells were washed 3 times with cold PBS and fixed for 10min by adding 4% paraformaldehyde. Nuclei were stained with DAPI (see product description). After sectioning, the binding of the drug to the cells was analyzed by detection of fluorescence using confocal laser scanning microscope (LSM 710 CLSM, Carl Zeiss, Jena, Germany). The targeting verification results are shown in fig. 10. The green fluorescent signal was enriched in EGFR-overexpressing a431 cells, whereas the control EGFR-underexpressing a2780 group showed no observable green fluorescent signal. The experimental result shows that no significant influence is shown on the targeting property of the nano antibody by the pegylation and tetramerization of the nano antibody and the coupling of the Pt (IV) metal drug. The nano antibody-tetravalent platinum system prepared in the embodiment of the invention has obvious cell selectivity on cancer cells with high EGFR expression.

2. Cellular uptake of the Nanobody-tetravalent platinum System prepared according to the invention

Cell uptake assayUsing the cells with vigorous logarithmic growth phase according to 1 × 10⁵The density of individual cells/well was seeded in 24-well plates and tested after overnight incubation in an incubator. After the cells were attached to the wall, a culture medium solution containing 50 μ M of cisplatin, nanobody-tetravalent platinum conjugate, pegylated nanobody-tetravalent platinum conjugate or polyethyleneglycol multivalent nanobody-tetravalent platinum conjugate was added and the culture was continued for 4 hours. The media with the drug was then aspirated and the cells were washed 3 times with cold PBS. Cells were harvested by digestion with trypsin and after cell counting, harvested cells were digested with nitric acid for ICP-MS measurement. The accumulation amount of platinum in the cells was measured by ICP-MS. The cellular uptake results are shown in fig. 11, and the platinum accumulation of a431 cells over-expressed by Epidermal Growth Factor Receptor (EGFR) is significantly higher than that of a2780 cells under-expressed by epidermal growth factor receptor, indicating that the nanobody-tetravalent platinum system can be specifically taken up by tumor cells over-expressed by epidermal growth factor receptor.

3. Determination of binding force of nano antibody-tetravalent platinum system prepared by the invention

In order to investigate the binding force of the nanobody-tetravalent platinum system constructed in the present invention to a431 cells over-expressed by Epidermal Growth Factor Receptor (EGFR), this example was conducted using a flow cytometer. To prevent the nanobody-tetravalent platinum system from internalizing during the measurement, the cell binding assay experiment was performed at 4 ℃. A431 cells were incubated with a series of nanobody-tetravalent platinum systems at the desired concentrations. After a series of nano antibody-tetravalent platinum systems are cultured at different times, the culture medium is discarded, the supernatant is centrifuged after trypsinization, and the supernatant is washed three times by cold PBS and immediately detected by a flow cytometer. K_D、K_onAnd K_offThe calculation of (c) is performed according to the following formula.

k_obs＝[sdAb]k_on+k_off

The calculation results are shown in the following table:

table 4: determination of binding affinity and dissociation rate constant of nano antibody-tetravalent platinum coupling system

Group	KD(nM)	Kon(μM-1 min-1)	Koff(s-1)×10-3
				Nb	23.1	0.31	7.16
[email protected]	24.2	0.36	8.71
				[email protected]	22.9	0.40	9.16
[email protected]4-PEG	3.4	0.28	0.95

4. Tumor cell toxicity determination of nano antibody-tetravalent platinum system prepared by the invention

A431 cells, MDA-MB-231 and A549 cells with different expression levels of epidermal growth factors and A2780 and MCF-7 cells with low expression of epidermal growth factors are cultured in a DMEM medium containing 10 percent of fetal calf serum at 37 ℃ and 5 percent of CO₂Until the cells adhere to the wall. Cells with vigorous logarithmic growth phase are selected for cytotoxicity experiments according to the proportion of 3 multiplied by 10³The density of individual cells/well was seeded in 96-well plates and tested after 24 hours of culture in an incubator. An experimental group, a control group and a blank group are arranged, different types of medicines with different concentrations are added into the experimental group, no medicine is added into the control group, and the blank group is not inoculated with cells and is not added with the medicines. The cells in the plate were cultured for a further 72 hours.

Old medium was aspirated off and 100. mu.L of fresh medium was added, followed by 25. mu.L of MTT solution (5 mg/mL, i.e., 0.5% MTT) per well and incubation was continued for 4 hours. Subsequently, 100. mu.L of dimethyl sulfoxide was added to each well, and the mixture was shaken in a shaking chamber at 37 ℃ for 15 to 30min to dissolve the crystals sufficiently. The absorbance A value of each well was measured at 490nm using a microplate reader.

Survival (%) [ a value of experimental group (S) -a value of blank (B) ]/[ a value of control group (C) -a value of blank (B) ]

Cytotoxicity assay experimental results as shown in fig. 12 and table 5, in combination with the results of example 15-2 and fig. 11, it can be found that both cellular uptake and cytotoxicity of the nanobody-tetravalent platinum system have significant selectivity. The A2780 cells with low EGFR expression do not have obvious platinum drug accumulation, and the nano antibody-tetravalent platinum system does not have obvious influence on the cell activity of the cells. The toxicity of the different modified nano antibody-tetravalent platinum systems on EGFR (epidermal growth factor receptor) high-expression A431 cells is different, the pegylation has no obvious influence on the cytotoxicity of the nano antibody-tetravalent platinum, and the pegylation multivalent nano antibody-tetravalent platinum conjugate has no obvious influence on the EGFR⁺Cytotoxicity of A431The performance is slightly reduced. But to EGFR^-A2780 cells had no significant growth inhibition. The selective cytotoxicity of the polyethylene glycol multivalent nano antibody-tetravalent platinum is embodied. In addition, it can be seen from toxicity experiments on tumor cells with different EGFR expression levels that the toxicity of the pegylated multivalent nanobody-tetravalent platinum on the cells is dependent on the EGFR expression level.

Table 5: IC of Nanobody-tetravalent platinum System₅₀Value of (. mu.M)

5. The prepared nano antibody-tetravalent platinum system multi-cell sphere permeability

MCSs were cultured according to literature reports (Small 2018,14, 1702858). The T75 flask was previously covered with 10mL of hot agarose solution (1% w/v) and left to cool until the agarose completely solidified. EGFR (epidermal growth factor receptor)⁺A431 cells were cultured overnight, digested and counted, and EGFR was added⁺A431 cells were as per 1X 10⁶Each cell/well was seeded in T75 flask containing 1% penicillin-streptomycin in 15mL DMEM medium and spheroids formed after about 4 days of culture. MCSs were transferred to agarose pretreated 24-well plates and incubated with fluorescein-labeled nanobodies, nanobody-tetravalent platinum conjugates, pegylated nanobody-tetravalent platinum conjugates, or pegylated multivalent nanobody-tetravalent platinum conjugates (added at a concentration of 50nM Nb). After incubation at 37 ℃ for 4h, MCSs were collected and washed three times with cold PBS. MCSs were fixed with 4% (w/v) PFA for 1h at room temperature and observed with a confocal laser scanning microscope (LSM 710 CLSM, Carl Zeiss, Jena, Germany). The results are shown in fig. 13, the green fluorescence signals are distributed in the center and the periphery of the MCSs, which indicates that the nanobody-tetravalent platinum system has better permeability in an in vitro model, and quantitative analysis of fluorescence density can find that pegylation and tetramerization have no significant influence on the permeability of the nanobody.

6. Pharmacokinetics research of nano antibody-tetravalent platinum system prepared by the invention

The strategy of coupling polyethylene glycol by covalent bond is widely considered to increase the in vivo stability and circulation half-life of antibody drugs. In example 11 of the present invention, polyethylene glycol was coupled to the carbon terminal of the framework dendropolylysine of the multivalent nanobody by site-directed modification. It is expected that the in vivo circulation half-life period of the nano antibody-tetravalent platinum is improved by a polyethylene glycol coupling method, so that the medicament can have longer circulation action time.

The pharmacokinetic study make internal disorder or usurp of the nanobody-tetravalent platinum system was performed in Nude mice. Mice were randomly divided into 5 groups (3 per group). Mice were injected with drug (2mg Pt/kg body weight) via tail vein. Mice were bled orbitally at 5min, 30min, 1h, 2h, 4h, 6h, 8h, 12h, 24h post-injection, and blood samples were centrifuged at 4 ℃ (3000g, 10min) to collect serum. The content of Pt in serum was determined by ICP-MS.

As a result, as shown in fig. 14, the half-life of the pegylated nanobody-tetravalent platinum conjugate in blood circulation was not significantly increased compared to the nanobody-tetravalent platinum conjugate, while the tetramerization product showed the longest half-life of blood circulation in the experimental group due to its higher molecular weight (about 56 kDa) and ability to maintain a relatively high concentration in serum for a longer time. In addition to the function of the polyethylene glycol chain, the polyethylene glycol multivalent nano antibody tetravalent platinum conjugate has larger size so as to avoid glomerular filtration and clearance, thereby prolonging the circulation time in vivo.

7. The nano antibody-tetravalent platinum system prepared by the invention is accumulated in the main organs of mice

To explore the tissue distribution of nanobodies with tetravalent platinum conjugates and the effect of pegylation modification and nanobody tetrapoly-pair drug distribution, cisplatin, nanobody-tetravalent platinum conjugates, pegylated nanobody-tetravalent platinum conjugates, and pegylated multivalent nanobody-tetravalent platinum conjugates were administered at a dose of 40 μ g Pt per mouse, which was sacrificed after a period of injection. The heart, liver, spleen, lung and kidney were harvested and washed twice with PBS, wiped dry with filter paper and weighed. Cutting each tissue into small pieces, and measuring the Pt content in the organ by adopting ICP-MS after acid digestion.

As shown in fig. 15A, compared with the cisplatin, the nanobody-tetravalent platinum conjugate, the pegylated nanobody-tetravalent platinum conjugate and the pegylated multivalent nanobody-tetravalent platinum conjugate treatment groups, the accumulation amount of Pt in the major organs after 12h injection was observed, and the accumulation amount of the nanobody-tetravalent platinum system in the liver and kidney was significantly lower than that of the cisplatin. It is demonstrated that pegylation modification reduces the enrichment of the nanobody-tetravalent platinum system in the liver. Also, as seen in fig. 15B, the amount of the pegylated multivalent nanobody-tetravalent platinum conjugate accumulated in the liver did not change significantly and the amount in the kidney gradually decreased within 24h of the mice injected.

8. The nano antibody-tetravalent platinum system prepared by the invention accumulates in the tumor

EGFR at a dose of 40. mu.g Pt/mouse⁺A431 xenogeneic tumor bearing mice (n-3 in parallel per group) were dosed tail vein. Mice were sacrificed at 3h, 6h, 9h, 12h, 24h post injection. Tumors were removed, washed twice with cold PBS, wiped dry on filter paper and the removed tumors weighed. Tumor tissue was cut into small pieces and acid digested and the Pt content was determined by ICP-MS.

Comparing the accumulation amount of different platinum drugs in tumor tissues, the experimental result fig. 16 shows that the platinum content in the tumor tissues of the group treated by the pegylated multivalent nanobody-tetravalent platinum conjugate is the highest. Moreover, the polyethylene glycol nano antibody-tetravalent platinum conjugate and the polyethylene glycol multivalent nano antibody-tetravalent platinum conjugate have different trends of drug accumulation at the tumor site along with time change. The difference in this trend may be related to the size of the molecule and also to the binding capacity of the nanobody platinum to the target cell.

9. Tissue penetration capacity of nano antibody-tetravalent platinum system prepared by the invention

In the present invention, two products having a large difference in molecular weight are produced under catalytic ligation of mTGase. Wherein the polyethylene glycol multivalent nanometer antibody-tetravalent platinum conjugate with larger molecular weight shows the longest blood circulation half-life period and is medicinal energyCan keep the long-acting effect and lay the foundation. However, drug size is often associated with its tissue penetration capacity. The tissue penetration of the nano antibody platinum is also an important criterion for drug evaluation. We examined the tissue permeability of the embodiments of the present invention by immunofluorescence. Injecting fluorescein-labeled nano antibody, pegylated multivalent nano antibody and tetravalent platinum conjugate thereof into EGFR according to the dosage of 0.15 mu M Nb⁺A431 tumor-bearing mice. Mice were sacrificed 6h after injection, tumors excised and fixed in 4% paraformaldehyde. The next step after tumor fixation was to soak the tumor in 30% sucrose solution overnight. The samples were cut into 8 μm thick sections in a cryostat and incubated with the corresponding antibodies according to the product protocol requirements. The fluorescence signal of the samples was observed under a Zeiss LSM 710Meta confocal microscope with 10-or 20-fold objective.

As shown in fig. 17, blue is nuclei (DAPI), green fluorescence is from FITC-labeled nanobodies, and red fluorescence is from blood vessels (Cy 5). It can be seen that the green fluorescence signals are obviously and uniformly dispersed in all the test groups, indicating that the nanobody-tetravalent platinum system has excellent tissue penetration capability of the nanobody. Moreover, no matter small molecular metal drugs are coupled, or the nano antibody is subjected to pegylation or polymerization, the targeting property and tissue penetration of the nano antibody are not obviously affected.

10. The therapeutic effect of the nano antibody-tetravalent platinum system prepared by the invention at the animal level

Mice implanted with a431 cell xenografts were randomly divided into 5 groups (5 mice per group). Up to about 100-200mm in tumor volume³Then, cisplatin, pegylated nanobody-tetravalent platinum conjugate, pegylated multivalent nanobody-tetravalent platinum conjugate (1-2mg Pt/kg body weight) or PBS was administered to mice by tail vein injection. All drugs were injected on day 0, day 4 and day 8. Body weight and tumor volume of mice were measured daily. According to the formula V ═ lw²Calculation of tumor volume (mm)³) Where l and w represent the length and width of the tumor. The inhibition rate was calculated according to the following formulaCalculating: [1- (V)_tf-V_ti)/(V_pf-V_pi)]×100％。(V_tfAnd V_tiRepresents the tumor volume, V, at the start and after treatment, respectively, of the treatment group_pfAnd V_piRepresenting tumor volumes after initiation and treatment, respectively, in the PBS group).

As shown in fig. 18A, the inhibition rates of cisplatin, pegylated nanobody-tetravalent platinum conjugate, and pegylated multivalent nanobody-tetravalent platinum conjugate on a431 cell xenograft tumor were 30.32%, 31.64%, and 63.78%, respectively, relative to the PBS control group. The differences of the treatment effects of the cis-platinum group and the pegylated nanobody-tetravalent platinum conjugate group are not significant, and the pegylated multivalent nanobody-tetravalent platinum conjugate has the most significant treatment effect.

In addition, the results of the experiment in fig. 18B show that the body weight of the mice also varied. The body weight of the mice in the cisplatin treatment group is obviously reduced in the later stage, while the weight of the mice in the polyethylene glycol nano antibody-tetravalent platinum treatment group is slightly influenced in the early stage of treatment and is not obviously influenced in the later stage. While the pegylated multivalent nanobody-tetravalent platinum conjugate had little effect on the body weight of the mice.

11. Immunohistochemical analysis after treatment with pegylated multivalent Nanobody tetravalent platinum conjugates

The tumor volume of the mice was measured for the last time and the animal model treatment was terminated. After 24h, the mice were sacrificed. Tumor tissue and other major organs were removed and fixed with 4% formaldehyde and embedded in paraffin. These tissues were then cut into 5 μm thick sections. TUNEL staining was performed on tumors and other major organs to observe apoptosis. The related operations are carried out according to the requirements of the kit. And (3) detecting the prepared sample by adopting a Zeiss LSM 710 inverted laser confocal scanning microscope imaging system.

The results of the immunohistochemical analysis experiments are shown in figure 19. The results indicate that the pegylated multivalent nanobody-tetravalent platinum conjugate has less damage to major organs such as liver and kidney than cisplatin and pegylated nanobody-tetravalent platinum conjugate. Combining the change of body weight of the mouse (fig. 18B), it is demonstrated that the pegylated multivalent nanobody tetravalent platinum conjugate generates higher toxicity to the tumor tissue of the mouse model, but only generates lower systemic toxicity, thus embodying the targeting property and multimerization of the nanobody and reducing the toxic and side effects of the traditional metal drugs.

12. Effect of Nanobody tetravalent platinum System on tumor EGFR expression level

The binding of the nano-antibody targeting the EGFR with the EGFR can induce the cellular internalization of an antibody-receptor complex, and the binding of the nano-antibody with the EGFR can also generate certain interference on epidermal growth factor related downstream signal paths. In order to explore the influence of the nano antibody-tetravalent platinum system on the EGFR level on the surface of tumor cells, immunohistochemical analysis and Western blot analysis are carried out on the expression level of the EGFR at the tumor site.

Approximately 500mg of tumor tissue after treatment was placed in a homogenizer and ground with 250. mu.L of lysis buffer (protease inhibitor was added according to the kit protocol before use). The collected protein solution was centrifuged at 4 ℃ to collect the supernatant (14000 rpm, 15 min). The total protein extracted was quantified by the BCA method (procedure reference product protocol). 8% SDS-PAGE was prepared for electrophoretic separation of proteins, which were then transferred to membranes by wet transfer (PVDF membranes). After incubation with EGFR antibody, Tubulin antibody as an internal control, and a secondary antibody, development was performed.

The immunohistochemical results are shown in fig. 20A, and the experimental results of the PBS control group show that the tumor tissue whole cells are in the EGFR high expression state. The EGFR level of the tumor tissue in the cisplatin experimental group is slightly changed, and the EGFR level of the tissue treated by the nano antibody platinum group (the pegylated monovalent and multivalent nano antibody tetravalent platinum conjugates) is reduced.

The results of Western blot analysis are shown in FIG. 20B, and the PEGylated univalent and multivalent nanobody tetravalent platinum conjugate treatment group reduced the EGFR level of the tumor tissue population, which is consistent with the results of immunohistochemistry experiments.

In combination with all experimental results, among the nanobody-tetravalent platinum, pegylated nanobody-tetravalent platinum and pegylated multivalent nanobody-tetravalent platinum conjugates prepared according to the method provided by the present invention, the pegylated multivalent nanobody-tetravalent platinum conjugate shows more specific properties, has excellent stability, tumor penetration and targeting ability, and the larger size prolongs the circulation time, and exerts a good tumor inhibiting effect in anti-tumor applications while reducing the systemic toxicity of metal drugs.