Aptamer and upconversion nanoparticle modified copolymer, synthesis and application
阅读说明：本技术 一种Aptamer和上转换纳米粒修饰共聚物及合成与应用 (Aptamer and upconversion nanoparticle modified copolymer, synthesis and application ) 是由 杜永忠 王君 徐晓玲 应晓英 于 2020-12-02 设计创作，主要内容包括：本发明提供一种Aptamer和上转换纳米粒修饰共聚物及合成与应用。Aptamer和上转换纳米粒修饰共聚物主要由Aptamer,上转换纳米粒和聚(2-羟基乙基甲基丙烯酸酯)-肉桂酸共聚物组成,通过将聚(2-羟基乙基甲基丙烯酸酯)-肉桂酸共聚物溶于DMSO中,然后加入均匀分散于DMSO中的氨基化上转换纳米粒,制得上转换纳米粒修饰共聚物,将两端马来酰亚胺修饰的聚乙二醇及Aptamer溶于TE缓冲液中,然后加入上转换纳米粒修饰共聚物制得目的物。所述的Aptamer和上转换纳米粒修饰共聚物无小分子细胞毒类药物参与,能在近红外光照下诱导肿瘤细胞表面受体聚集,触发凋亡信号通路,在体内外具有良好的抗肿瘤疗效。(The invention provides an Aptamer and upconversion nanoparticle modified copolymer, and synthesis and application thereof. The method mainly comprises the steps of dissolving a poly (2-hydroxyethyl methacrylate) -cinnamic acid copolymer in DMSO (dimethyl sulfoxide), adding aminated upconversion nanoparticles uniformly dispersed in the DMSO to prepare the upconversion nanoparticle modified copolymer, dissolving polyethylene glycol modified by maleimide at two ends and the Aptamer in TE buffer solution, and adding the upconversion nanoparticle modified copolymer to prepare a target object. The Aptamer and upconversion nanoparticle modified copolymer does not participate in micromolecular cytotoxic drugs, can induce the aggregation of tumor cell surface receptors under near-infrared illumination, triggers an apoptosis signal path, and has good anti-tumor curative effects in vivo and in vitro.)
1. An Aptamer and up-conversion nanoparticle modified copolymer is characterized in that a poly (2-hydroxyethyl methacrylate) molecule in a copolymer chemical structure contains a formula R1、R2And R3Structural units represented:
wherein:
the molecular weight of the poly (2-hydroxyethyl methacrylate) is 1-100 kDa, wherein m and n are the polymerization degree of the poly (2-hydroxyethyl methacrylate), and m + n is 7-769;
R1is cinnamic acid, the grafting rate of the cinnamic acid is 1-50% (m is 4-31)
PEG is polyethylene glycol with molecular weight of 132 Da;
R2is an upconversion nanoparticle UCNP with the particle size of 40 nm;
R3is an oligonucleotide Aptamer.
2. The Aptamer and upconverting nanoparticle modified copolymer of claim 1, wherein R is3Oligonucleotide capable of specifically targeting highly-expressed CD20 receptor on surface of Raji cell of human B cell lymphomaLigand Aptamer.
3. The Aptamer and upconversion nanoparticle modified copolymer according to claim 1 or 2, wherein the sequence of the oligonucleotide Aptamer is:
5’-CTCCTCTGACTGTAACCACGCCGTATGTCCGAAATACGGAGAACAGCACTCATATGCAAGCCATACGCGGAGGTGCACGCGCATAGGTAGTCCAGAAGCC-3’。
4. the Aptamer and upconversion nanoparticle modified copolymer according to claim 1, wherein the upconversion nanoparticle is prepared from a rare earth chloride RECl36H2O (RE: 79.5% yttrium (Y), 20% ytterbium (Yb), 0.5% thulium (Tm)), octadecene, and oleic acid were synthesized by a solvothermal method, and emitted ultraviolet light with a wavelength of 280-380nm under excitation of 980nm infrared light.
5. The method for synthesizing the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer according to claim 1, wherein the method is implemented by the following scheme:
(1) synthesis and amination modification of upconversion nanoparticles: preparing up-conversion nanoparticles by a solvothermal method by taking rare earth chloride as a raw material;
(2) synthesis of Poly (2-hydroxyethyl methacrylate): mixing 2-cyano-2-propylbenzodithio and 4, 4' -azobis (4-cyanovaleric acid), 2-hydroxyethyl methacrylate and dioxane, placing the mixture in a flask containing a magnetic stirrer, pumping nitrogen to remove oxygen in the system, placing the flask in an oil bath preheated to 80 deg.C, and heating in N2Reacting under protection, exposing the reaction solution to air, cooling to room temperature, adding 10 times of precooled ether into the reaction solution to precipitate a product, centrifugally cleaning the obtained precipitate with ether, and drying the obtained solid to obtain poly (2-hydroxyethyl methacrylate) solid powder;
(3) synthesis of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft: placing cinnamic acid, dicyclohexylcarbodiimide with the mole number 5 times that of cinnamic acid and 4-dimethylamino pyridine into a flask, adding anhydrous DMSO (dimethyl sulfoxide) for ultrasonic dissolution, stirring at 60 ℃ for 0.5h to activate carboxyl, then adding poly (2-hydroxyethyl methacrylate) dissolved by the anhydrous DMSO, stirring for reaction for 24h, cooling the final reaction liquid to room temperature, transferring the final reaction liquid into a dialysis bag, continuously dialyzing with pure water for 48h, centrifuging the liquid in the dialysis bag, collecting supernatant, and freeze-drying to obtain poly (2-hydroxyethyl methacrylate) -cinnamic acid graft powder;
(4) synthesis of an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: dissolving poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer powder in DMSO (dimethylsulfoxide), dissolving 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide and N-hydroxysuccinimide which are 6 times of the molar number of the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer in DMSO (dimethylsulfoxide), mixing the two solutions, stirring for 0.5h, adding aminated up-conversion nanoparticles uniformly dispersed in the DMSO, stirring for reaction for 48h, centrifuging the final reaction solution, taking precipitate, adding deionized water, centrifuging, repeating for 3 times, removing byproducts, unreacted EDC and NHS (ethylene diamine tetraacetic acid) and freeze-drying to obtain up-conversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer powder;
(5) synthesizing an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: performing ammonolysis on a thioester bond at the other end of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer by using cyclohexylamine to generate a sulfydryl, modifying a sulfydryl modified CD20 targeting Aptamer Aptamer at the tail end of a polymer chain by using polyethylene glycol modified by maleimide at two ends as a linking agent through Michael addition reaction of the sulfydryl and the maleimide to obtain the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid-graft copolymer.
6. The application of the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer of claim 1 in preparation of an antitumor drug.
Technical Field
The invention belongs to a compound and a synthesis method, relates to an Aptamer, an upconversion nanoparticle modified copolymer and a synthesis method, and particularly relates to an Aptamer, an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer and a synthesis method thereof, and application of the Aptamer and the upconversion nanoparticle modified copolymer in preparation of antitumor drugs.
Background
Cancer has become a major health threat, cancer death accounts for nearly one sixth of the total death worldwide, and the incidence of cardiovascular and cerebrovascular diseases is one of the main death causes worldwide. At present, the clinical means for treating tumor mainly comprise surgical operation treatment, radiotherapy, chemotherapy, biological immunotherapy and the like, and in addition, some tumor auxiliary treatment means such as tumor thermotherapy, radio frequency therapy, interventional therapy and the like are gradually applied. Although these therapeutic methods have achieved certain effects with the development of medical science and technology, they are still limited in the process of treating tumors due to the limitations of tumor prevention mechanism, etiology basic research, and early tumor diagnosis technology, and the overall situation is still severe.
The traditional medicine preparation mode is adopted for administration, the biological and pharmacological properties of the medicine are mainly influenced by the molecular structure of the chemotherapeutic medicine, and the problems of low curative effect and high toxicity exist in the treatment. The nonselectivity of the in vivo distribution of the existing small molecule drugs leads to the limitation of the number of drug molecules which can enter a molecular target; and the large amount of the drug is distributed in normal tissues, so that the toxic and side effects of the drug are promoted.
The targeted therapy of tumors is considered as an effective means for improving the curative effect of the medicament and reducing toxic and side effects, and mainly comprises two types of molecular targeted therapy and targeted chemotherapy represented by a carrier technology. The molecular targeted therapy mainly utilizes specific structural molecules of tumor tissues or cells as targets, and uses drugs capable of being specifically combined with the target molecules to kill tumor cells, so that the toxic and side effects on normal cells are reduced while stronger antitumor activity is exerted. A series of molecular targeted drugs aiming at tumor cell proliferation signal transduction pathways, such as crizotinib, erlotinib, vemurafenib and the like, developed in recent years achieve good treatment effects in different tumors, but primary or acquired resistance limits wide clinical application of the drugs. The targeted chemotherapy of the nano-carrier technology mainly utilizes the high permeability and Retention Effect (EPR) of solid tumors to realize passive targeting of tumor tissues and further modify ligands or antibodies to realize active targeting of the tumor tissues. The nano-carrier drugs have the advantages of changing the release rate of the drugs on a time axis, including solubilization of insoluble drugs and sustained or controlled release of the drugs; on the spatial axis, the medicine can change the distribution in vivo, so that the medicine can be accumulated in certain target organ tissues, and toxic and side effects on certain sensitive tissues and cells are reduced to a certain extent. However, the research on the successfully marketed preparations shows that the preparations do play a role in solubilization, change the in vivo distribution of the medicament and improve the medicament effect, but the targeting efficiency of the medicament on tumor tissues does not reach the designed expected target, and the toxic and side effects of the chemotherapeutic medicament cannot be effectively avoided.
Receptors are components on or in cells that recognize and bind biologically active molecules and which amplify and transmit the recognized and received signal into the cell without error, thereby causing a biological effect. Research shows that after the cell membrane surface receptor is cross-linked by multivalent ligand, a series of biological events are generated in cells, such as changing the communication process between neuron cells, influencing the hormone uptake and immune system function in vivo, and influencing the processes of cell-cell adhesion, cell activation, cell apoptosis and the like. Research reports indicate that cross-linking between Epidermal Growth Factor Receptors (EGFR) may be one of the necessary signals for inducing DNA synthesis; the expression of the alpha-interferon can be obviously regulated after the human plasma sample dendritic cell surface receptor is crosslinked. In addition, the study interest of scholars at home and abroad is aroused in recent years, when the non-internalization receptor with high expression on the surface of the cell membrane is highly cross-linked, the apoptosis of the tumor cell can be directly induced, and the process does not need the participation of micromolecule cytotoxic chemotherapy drugs, so that the toxic and side effects of the chemotherapy drugs can be avoided while the tumor cell is killed, and a novel treatment mode is provided for the treatment of the tumor.
The existing ways for inducing tumor cell apoptosis by using receptor cross-linking mainly include the following ways: the structure of monoclonal antibody (mAb) is modified to form homodimer/heterodimer or polymer, which is then targeted to cell surface high expression receptor to promote cross-linking. Secondly, after the monoclonal antibody monomer targets the cells, the anti-monoclonal antibody (secondary antibody) is used for secondary targeting to induce the crosslinking of the high-expression receptor on the cell surface. And inducing receptor cross-linking by adopting a bionic strategy in the field of nano medicine. The basic principle is that oligonucleotides with complementary sequences, antiparallel coiled-coil polypeptides and other motifs are grafted on the side chain of the synthesized polymer backbone, and the complementary pairing between the motifs is utilized to carry out the biological recognition process. Firstly, part of motif is targeted to a receptor with high expression on the cell surface after being modified by an antibody (or an aptamer), then a polymer grafted with a complementary sequence is subjected to secondary targeting, and the oligonucleotide chain or the coiled-coil polypeptide after complementary combination can further cause the receptor on the cell surface to be crosslinked, so that the cell is induced to be apoptotic. However, the above adopted receptor cross-linking methods all have certain defects, for example, the structure of the monoclonal antibody needs to be modified when the monoclonal antibody is used for receptor cross-linking, the separation and purification are complex, the technical requirements are high, the exertion of the effects of most of the monoclonal antibodies still needs to rely on complement-mediated cytotoxicity (CDC) and antibody-dependent cell-mediated cytotoxicity (ADCC) to a great extent, and the curative effect of directly inducing tumor cell apoptosis to exert the anti-tumor effect by using the structurally modified monoclonal antibodies is limited; in addition, in order to achieve better curative effect, the biomimetic strategy is adopted to induce receptor cross-linking, usually an antibody (aptamer) modified part is required to be targeted to a receptor on the surface of a cell in advance, and then a complementary part is subjected to secondary targeted drug delivery, so that off-target effect is easily caused, and the in-vivo application is limited.
The inventor uses reversible addition fragmentation chain transfer (RAFT) principle in the earlier stage, uses 2-hydroxyethyl methacrylate (Hema) as raw material to synthesize poly (2-hydroxyethyl methacrylate), then introduces carbon-carbon double bond on the branched chain, and modifies an aptamer capable of targeting CD20 receptor at one end of the polymer chain to construct a macromonomer. And then acting the CD20 targeting macromonomer on a human Raji cell, initiating macromonomer polymerization under the action of initiators Ammonium Persulfate (APS) and Tetramethylethylenediamine (TEMED), and inducing the CD20 receptor highly expressed on the surface of the Raji cell to generate crosslinking. Research results show that the derivative can effectively induce apoptosis of cells and has good anti-tumor effect in vitro. Unfortunately, the polymerization of carbon-carbon double bonds needs to be catalyzed by initiators which are highly toxic and have limited in vivo applications.
Upconversion nanoparticles (UCNPs) are a class of nanoparticles with anti-stokes emission that emit short wavelength light by absorbing long wavelength light, can be excited by deep penetrating near infrared light and possess multiple emission bands from ultraviolet to near infrared. In addition, the up-conversion nano material is excited in near infrared and emits in near infrared, so that two working windows of the up-conversion nano material belong to the range of a biological tissue optical window, and the up-conversion nano material has the advantages of good stability, low biological toxicity, high luminous intensity and the like. The unique characteristic that the upconversion nanoparticles can be excited by single near infrared light and emit in multiple spectral bands can be used as an ideal nano platform for biological imaging, drug delivery tracking and deep tissue treatment, and treatment and monitoring can be combined.
Disclosure of Invention
The invention aims to provide an Aptamer and upconversion nanoparticle modified copolymer, namely an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, wherein a poly (2-hydroxyethyl methacrylate) molecule in a chemical structure contains a formula (R) shown in the specification1)、(R2) And (R)3) Structural units represented:
the molecular weight of poly (2-hydroxyethyl methacrylate) is 1-100 kDa, wherein m and n are polymerization degrees of the poly (2-hydroxyethyl methacrylate) (m + n is 7-769), and the side chain part of the poly (2-hydroxyethyl methacrylate) is hydroxyl-substituted cinnamic acid (R)1) The cinnamic acid grafting rate is 1-50% (m is 4-31).
PEG is polyethylene glycol (molecular weight 132 Da).
R2The particle size of the up-conversion nano-particle UCNP is about 40nm, the up-conversion nano-particle UCNP is synthesized by rare earth chloride RECl3 & 6H2O (RE is 79.5% of yttrium (Y), 20% of ytterbium (Yb) and 0.5% of thulium (Tm)), octadecene and oleic acid through a solvothermal method, and ultraviolet light with the wavelength of 280-380nm can be emitted under the excitation of 980nm infrared light.
R3The Aptamer Aptamer of the oligonucleotide with the specificity targeting human B cell lymphoma Raji cell surface high expression CD20 receptor has the sequence as follows:
5’-CTCCTCTGACTGTAACCACGCCGTATGTCCGAAATACGGAGAACAGCACTCATATGCAAGCCATACGCGGAGGTGCACGCGCATAGGTAGTCCAGAAGCC-3’。
the second purpose of the invention is to provide a synthesis method of an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, which is realized by the following scheme:
(1) synthesis and amination modification of upconversion nanoparticles (UCNPs):
taking rare earth chloride as a raw material, and preparing upconversion nanoparticles (UCNP) by a solvothermal method: 1mmol of rare earth chloride RECl3 & 6H2O (RE is 79.5% Y, 20% Yb, 0.5% Tm), 15ml of octadecene and 6ml of Oleic Acid (OA) are placed into a 100ml three-neck flask, and under the protection of argon gas, the temperature is raised to 160 ℃ for 40min, so as to ensure that the solid substances are completely dissolved. Then naturally cooling the temperature of the system to room temperature, slowly dropwise adding 10mL of anhydrous methanol mixed solution dissolved with 0.15g of ammonium fluoride and 0.1g of sodium hydroxide into a three-neck flask, reacting for 30min under the condition of vigorous stirring at 50 ℃, and then removing the methanol in the reaction mixed solution under reduced pressure under the protection of argon; after the methanol is removed, quickly heating to 300 ℃, and keeping the temperature for 90 min; and naturally cooling to room temperature after the reaction is finished, precipitating the product by using excessive absolute ethyl alcohol, and centrifugally washing the obtained precipitate for 3 times by using the absolute ethyl alcohol to obtain the upconversion nanoparticle UCNP. On the basis, the UCNP is subjected to amino modification by adopting a ligand exchange method: dispersing 200mg of 2-aminoethyl dihydrogen phosphate (AEP) in 10ml of a mixed solution of deionized water and ethanol (deionized water: ethanol: 3:1, v/v), dropwise adding 5ml of UCNP cyclohexane dispersion (2mg/ml) into the mixed solution, and stirring at room temperature for reaction for 48 hours; centrifuging and taking the precipitate to obtain the UCNP modified by the amino.
(2) Synthesis of Poly (2-hydroxyethyl methacrylate): precisely weighing 0.012-0.56 g 2-cyano-2-propylbenzodithiol and 0.01g 4, 4' -azobis (4-cyanopentanoic acid), measuring 0.95ml 2-hydroxyethyl methacrylate (HEMA) and 2.56ml dioxane, placing the mixture in a 25ml three-necked flask containing a magnetic stirrer, pumping nitrogen gas for 30min to remove oxygen in the system, placing the flask in an oil bath preheated to 80 deg.C, and heating in N2The reaction was left under protection for 12h, and then the reaction was cooled to room temperature by exposure to air. And finally, adding 10 times of precooled ether into the reaction liquid to precipitate a product, centrifugally cleaning the precipitate for 3 times by using ether, and drying the obtained solid precipitate in a vacuum drying oven at 50 ℃ for 24 hours to obtain poly (2-hydroxyethyl methacrylate) solid powder.
(3) Synthesis of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft: 6-40 mg of cinnamic acid and 5 times of Dicyclohexylcarbodiimide (DCC) and 4-Dimethylaminopyridine (DMAP) in mole are precisely weighed and placed in a 15ml three-necked bottle, 5ml of anhydrous DMSO is added for ultrasonic dissolution, stirring is carried out for 0.5h at 60 ℃ to activate carboxyl, 50mg of poly (2-hydroxyethyl methacrylate) dissolved in 2ml of anhydrous DMSO is added, and the reaction system is stirred and reacts for 24h at 60 ℃. After the final reaction solution was cooled to room temperature, it was transferred to a dialysis bag (MWCO:1kDa) and continuously dialyzed with pure water for 48 hours to remove by-products and unreacted DCC and DMAP. And (3) centrifuging the liquid in the dialysis bag (2000rpm,15min), collecting the supernatant, and freeze-drying to obtain the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft powder.
(4) Synthesis of an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: accurately weighing 50mg of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, and dissolving in 2ml of DMSO; 1- (3-dimethylaminopropyl) -3-Ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS) in an amount of 6 times the molar amount of the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer were dissolved in 2ml of DMSO. The above two solutions were mixed, stirred at 60 ℃ for 0.5h to activate the carboxyl group, and then 5ml (2mg/ml) of aminated upconverting nanoparticles uniformly dispersed in DMSO were added. Stirring the reaction system at 60 ℃ for reaction for 48h, centrifuging the final reaction solution at 14000rpm/min for 15min, and taking the precipitate. And adding deionized water, centrifuging at 14000rpm/min for 15min, repeating for 3 times, and removing by-products, unreacted EDC and NHS. Freeze drying to obtain the upconversion nanometer particle modified poly (2-hydroxy ethyl methacrylate) -cinnamic acid graft copolymer powder.
(5) Synthesizing an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: performing ammonolysis on a thioester bond at the other end of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer by using cyclohexylamine to generate a sulfydryl group, modifying a sulfydryl group modified CD20 targeting Aptamer at the tail end of a polymer chain by using polyethylene glycol (Mal-PEG-Mal) modified by maleimide at two ends as a linking agent through Michael addition reaction of the sulfydryl group and the maleimide to obtain the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid-graft copolymer. Precisely weighing 50mg of upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, dispersing with 5ml of anhydrous Tetrahydrofuran (THF), adding excessive cyclohexylamine relative to thioester bond, and adding N2Reacting at room temperature for 12h under protection, precipitating the final reaction solution with 10 times of excessive precooled n-hexane, centrifuging (14000rpm/min, 15min), washing the precipitate with n-hexane for 3 times, drying the precipitate in a vacuum drying oven, and storing in a refrigerator at-20 ℃ for later use. After dissolving 0.1. mu.M of Mal-PEG-Mal in 1ml of TE buffer (pH 8), 0.02. mu.M of 5' -SH-Aptamer dissolved in 1ml of TE buffer was slowly added dropwise to the solution, and the mixture was poured into the above systemTris (2-chloroethyl) phosphate (TCEP) was added to a final concentration of 1mM to prevent oxidation of the thiol group, and the reaction was carried out at 37 ℃ for 12 hours with stirring. The mixed solution was dialyzed continuously with deionized water in a dialysis bag having a molecular weight of 3.5kDa for 24 hours to remove unreacted Mal-PEG-Mal. And collecting the dialysate, slowly dropwise adding 10mg of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer dispersion liquid dispersed in 5ml of deionized water into the solution, and stirring and reacting for 24 hours at room temperature. And centrifuging the final reaction solution at a high speed to obtain the Aptamer and up-conversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer powder.
The third purpose of the invention is to provide the application of the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer in preparing antitumor drugs. The tumor is a B cell lymphoma.
On the basis of the earlier research, the invention prepares the graft copolymer of the Aptamer and the upconversion nanoparticles modified poly (2-hydroxyethyl methacrylate) -cinnamic acid by grafting cinnamic acid groups on the side chain hydroxyl of the synthesized (2-hydroxyethyl methacrylate) polymer and grafting the Aptamer and the upconversion nanoparticles of the specific target cell surface high-expression CD20 receptor on the two ends of the polymer respectively. The copolymer has no participation of micromolecular cytotoxic drugs, and can ensure deep penetration of tumor tissues by irradiating the tumor cells or tissues with infrared excitation light with the wavelength of 980nm after the CD20 Aptamer Aptamer specifically targets Raji cells; in addition, the UCNP is excited by infrared light to generate ultraviolet light to trigger the photodimerization reaction of cinnamic acid, so that CD20 receptors are promoted to gather, tumor cells can be induced to apoptosis, and safe and efficient treatment of tumors is realized.
The Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer prepared by the invention has no micromolecular cytotoxic drug, is specifically targeted to tumor cells or tissues through the Aptamer, then the tumor cells or tissues are irradiated by infrared excitation light with the wavelength of 980nm, the UCNP is excited by infrared light to generate ultraviolet light to initiate the photodimerization reaction of cinnamic acid so as to promote the aggregation of cell surface high-expression receptors, so that the apoptosis of the tumor cells can be induced, the anti-tumor curative effect is exerted, and the toxic and side effects of chemotherapeutic drugs and the tumor drug resistance caused by multiple times of chemotherapy are avoided. The application of UCNP solves the problems of short ultraviolet wavelength and poor tissue penetrability required by cinnamic acid photodimerization reaction.
Drawings
Figure 1. characterization of physicochemical properties of upconversion nanoparticles (UCNPs). Wherein panel a. transmission electron microscopy of upconversion nanoparticles (UCNP); panel b emission spectra of upconversion nanoparticles (UCNP) in cyclohexane solution.
FIG. 2 is a transmission electron microscope photograph of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer before and after crosslinking. FIG. A is a transmission electron microscope photograph of an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer before crosslinking; FIG. B is a transmission electron microscope photograph of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer crosslinked by 980nm infrared light
FIG. 3 shows cytotoxicity studies of Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer. Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer; FIG. B.980nm infrared light; and C, adding 980nm infrared light to the APtamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer.
FIG. 4 shows tumor volume growth curves of nude mice with Raji lymphoma cells. Figure a. saline; FIG. B.980nm infrared light; aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer; and D, adding 980nm infrared light to the aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer.
Detailed Description
The invention is further described with reference to the accompanying drawings and examples.
The first embodiment is as follows: preparation of Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer
1. Synthesis and amination modification of upconversion nanoparticle UCNP: taking rare earth chloride as a raw material, and preparing upconversion nanoparticles (UCNP) by a solvothermal method: 1mmol of rare earth chloride RECl3 & 6H2O (RE is 79.5% Y, 20% Yb, 0.5% Tm), 15ml of octadecene and 6ml of Oleic Acid (OA) are placed into a 100ml three-neck flask, and under the protection of argon gas, the temperature is raised to 160 ℃ for 40min, so as to ensure that the solid substances are completely dissolved. Then naturally cooling the temperature of the system to room temperature, slowly dropwise adding 10mL of anhydrous methanol mixed solution dissolved with 0.15g of ammonium fluoride and 0.1g of sodium hydroxide into a three-neck flask, reacting for 30min under the condition of vigorous stirring at 50 ℃, and then removing the methanol in the reaction mixed solution under reduced pressure under the protection of argon; after the methanol is removed, quickly heating to 300 ℃, and keeping the temperature for 90 min; and naturally cooling to room temperature after the reaction is finished, precipitating the product by using excessive absolute ethyl alcohol, and centrifugally washing the obtained precipitate for 3 times by using the absolute ethyl alcohol to obtain the upconversion nanoparticle UCNP. The average particle size of UCNP was measured to be 41.5nm by dynamic light scattering; the UCNP can emit ultraviolet light of 280-380nm under the irradiation of 980nm infrared light by using a fluorescence spectrophotometer. Fig. 1 is a transmission electron micrograph and an emission spectrum of the resulting upconverting nanoparticle. On the basis, the UCNP is subjected to amino modification by adopting a ligand exchange method: dispersing 200mg of 2-aminoethyl dihydrogen phosphate (AEP) in 10ml of a mixed solution of deionized water and ethanol (deionized water: ethanol: 3:1, v/v), dropwise adding 5ml of UCNP cyclohexane dispersion (2mg/ml) into the mixed solution, and stirring at room temperature for reaction for 48 hours; centrifuging and taking the precipitate to obtain the UCNP modified by the amino.
2. Synthesis of Poly (2-hydroxyethyl methacrylate): 0.012g of 2-cyano-2-propylbenzodithiol, 0.01g of 4, 4' -azobis (4-cyanopentanoic acid), 0.95ml of 2-hydroxyethyl methacrylate (HEMA) and 2.56ml of dioxane were weighed precisely, the mixture was charged into a 25ml three-necked flask containing a magnetic stirrer, nitrogen was pumped in for 30min to remove oxygen in the system, and then the flask was put into an oil bath preheated to 80 ℃ in N2The reaction was left under protection for 12h, and then the reaction was cooled to room temperature by exposure to air. Finally, 10 times of precooled ether is addedAdding into the reaction solution to precipitate a product, centrifugally cleaning the precipitate for 3 times by using diethyl ether, and drying the obtained solid precipitate in a vacuum drying oven at 50 ℃ for 24 hours to obtain poly (2-hydroxyethyl methacrylate) solid powder. The average molecular weight of the poly (2-hydroxyethyl methacrylate) was determined to be 100kDa by gel permeation chromatography.
3. Synthesis of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft: 6mg of cinnamic acid, Dicyclohexylcarbodiimide (DCC) with the mole number 5 times that of the cinnamic acid and 4-Dimethylaminopyridine (DMAP) are precisely weighed and placed in a 15ml three-necked bottle, 5ml of anhydrous DMSO is added for ultrasonic dissolution, stirring is carried out for 0.5h at 60 ℃ to activate carboxyl, 50mg of poly (2-hydroxyethyl methacrylate) dissolved by 2ml of anhydrous DMSO is added, and the reaction system is stirred and reacted for 24h at 60 ℃. After the final reaction solution was cooled to room temperature, it was transferred to a dialysis bag (MWCO:1kDa) and continuously dialyzed with pure water for 48 hours to remove by-products and unreacted DCC and DMAP. And (3) centrifuging the liquid in the dialysis bag (2000rpm,15min), collecting the supernatant, and freeze-drying to obtain the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft powder. The grafting rate of the cinnamic acid is 1 percent through nuclear magnetic resonance hydrogen spectrum determination.
4. Synthesis of an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: accurately weighing 50mg of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, and dissolving in 2ml of DMSO; 1- (3-dimethylaminopropyl) -3-Ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS) in an amount of 6 times the molar amount of the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer were dissolved in 2ml of DMSO. The above two solutions were mixed, stirred at 60 ℃ for 0.5h to activate the carboxyl group, and then 5ml (2mg/ml) of aminated upconverting nanoparticles uniformly dispersed in DMSO were added. Stirring the reaction system at 60 ℃ for reaction for 48h, centrifuging the final reaction solution at 14000rpm/min for 15min, and taking the precipitate. And adding deionized water, centrifuging at 14000rpm/min for 15min, repeating for 3 times, and removing by-products, unreacted EDC and NHS. Freeze drying to obtain the upconversion nanometer particle modified poly (2-hydroxy ethyl methacrylate) -cinnamic acid graft copolymer powder.
Aptamer and upconversion nanoparticle modified polymerSynthesis of (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: performing ammonolysis on a thioester bond at the other end of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer by using cyclohexylamine to generate a sulfydryl group, modifying a sulfydryl group modified CD20 targeting Aptamer at the tail end of a polymer chain by using polyethylene glycol (Mal-PEG-Mal) modified by maleimide at two ends as a linking agent through Michael addition reaction of the sulfydryl group and the maleimide to obtain the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid-graft copolymer. Precisely weighing 50mg of upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, dispersing with 5ml of anhydrous Tetrahydrofuran (THF), adding excessive cyclohexylamine relative to thioester bond, and adding N2Reacting at room temperature for 12h under protection, precipitating the final reaction solution with 10 times of excessive precooled n-hexane, centrifuging (14000rpm/min, 15min), washing the precipitate with n-hexane for 3 times, drying the precipitate in a vacuum drying oven, and storing in a refrigerator at-20 ℃ for later use. After dissolving 0.1. mu.M of Mal-PEG-Mal in 1ml of TE buffer (pH 8), 0.02. mu.M of 5' -SH-Aptamer dissolved in 1ml of TE buffer was slowly added dropwise to the above solution, and tris (2-chloroethyl) phosphate (TCEP) was added thereto to a final concentration of 1mM to prevent oxidation of thiol, and the reaction was carried out at 37 ℃ for 12 hours with stirring. The mixed solution was dialyzed continuously with deionized water in a dialysis bag having a molecular weight of 3.5kDa for 24 hours to remove unreacted Mal-PEG-Mal. And collecting the dialysate, slowly dropwise adding 10mg of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer dispersion liquid dispersed in 5ml of deionized water into the solution, and stirring and reacting for 24 hours at room temperature. And centrifuging the final reaction solution at a high speed to obtain the Aptamer and up-conversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer powder.
Example two: preparation of Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer
1. Synthesis and amination modification of upconversion nanoparticle UCNP: taking rare earth chloride as a raw material, and preparing upconversion nanoparticles (UCNP) by a solvothermal method: 1mmol of rare earth chloride RECl3 & 6H2O (RE is 79.5% Y, 20% Yb, 0.5% Tm), 15ml of octadecene and 6ml of Oleic Acid (OA) are placed into a 100ml three-neck flask, and under the protection of argon gas, the temperature is raised to 160 ℃ for 40min, so as to ensure that the solid substances are completely dissolved. Then naturally cooling the temperature of the system to room temperature, slowly dropwise adding 10mL of anhydrous methanol mixed solution dissolved with 0.15g of ammonium fluoride and 0.1g of sodium hydroxide into a three-neck flask, reacting for 30min under the condition of vigorous stirring at 50 ℃, and then removing the methanol in the reaction mixed solution under reduced pressure under the protection of argon; after the methanol is removed, quickly heating to 300 ℃, and keeping the temperature for 90 min; and naturally cooling to room temperature after the reaction is finished, precipitating the product by using excessive absolute ethyl alcohol, and centrifugally washing the obtained precipitate for 3 times by using the absolute ethyl alcohol to obtain the upconversion nanoparticle UCNP. The average particle size of UCNP was measured to be 41.5nm by dynamic light scattering; the UCNP can emit ultraviolet light of 280-380nm under the irradiation of 980nm infrared light by using a fluorescence spectrophotometer. On the basis, the UCNP is subjected to amino modification by adopting a ligand exchange method: dispersing 200mg of 2-aminoethyl dihydrogen phosphate (AEP) in 10ml of a mixed solution of deionized water and ethanol (deionized water: ethanol: 3:1, v/v), dropwise adding 5ml of UCNP cyclohexane dispersion (2mg/ml) into the mixed solution, and stirring at room temperature for reaction for 48 hours; centrifuging and taking the precipitate to obtain the UCNP modified by the amino.
2. Synthesis of Poly (2-hydroxyethyl methacrylate): 0.56g of 2-cyano-2-propylbenzodithiol, 0.01g of 4, 4' -azobis (4-cyanopentanoic acid), 0.95ml of 2-hydroxyethyl methacrylate (HEMA) and 2.56ml of dioxane were weighed precisely, the above mixture was charged into a 25ml three-necked flask containing a magnetic stirrer, nitrogen was pumped in for 30min to remove oxygen in the system, and then the flask was put into an oil bath preheated to 80 ℃ in N2The reaction was left under protection for 12h, and then the reaction was cooled to room temperature by exposure to air. And finally, adding 10 times of precooled ether into the reaction liquid to precipitate a product, centrifugally cleaning the precipitate for 3 times by using ether, and drying the obtained solid precipitate in a vacuum drying oven at 50 ℃ for 24 hours to obtain poly (2-hydroxyethyl methacrylate) solid powder. Determination of Poly (2-hydroxyethyl methacrylate) by gel permeation chromatographyHas an average molecular weight of 1kDa.
3. Synthesis of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft: 40mg of cinnamic acid, Dicyclohexylcarbodiimide (DCC) with the mole number 5 times that of the cinnamic acid and 4-Dimethylaminopyridine (DMAP) are precisely weighed and placed in a 15ml three-necked bottle, 5ml of anhydrous DMSO is added for ultrasonic dissolution, stirring is carried out for 0.5h at 60 ℃ to activate carboxyl, 50mg of poly (2-hydroxyethyl methacrylate) dissolved by 2ml of anhydrous DMSO is added, and the reaction system is stirred and reacted for 24h at 60 ℃. After the final reaction solution was cooled to room temperature, it was transferred to a dialysis bag (MWCO:1kDa) and continuously dialyzed with pure water for 48 hours to remove by-products and unreacted DCC and DMAP. And (3) centrifuging the liquid in the dialysis bag (2000rpm,15min), collecting the supernatant, and freeze-drying to obtain the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft powder. The grafting rate of the cinnamic acid is determined to be 50 percent by nuclear magnetic resonance hydrogen spectrum.
4. Synthesis of an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: accurately weighing 50mg of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, and dissolving in 2ml of DMSO; 1- (3-dimethylaminopropyl) -3-Ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS) in an amount of 6 times the molar amount of the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer were dissolved in 2ml of DMSO. The above two solutions were mixed, stirred at 60 ℃ for 0.5h to activate the carboxyl group, and then 5ml (2mg/ml) of aminated upconverting nanoparticles uniformly dispersed in DMSO were added. Stirring the reaction system at 60 ℃ for reaction for 48h, centrifuging the final reaction solution at 14000rpm/min for 15min, and taking the precipitate. And adding deionized water, centrifuging at 14000rpm/min for 15min, repeating for 3 times, and removing by-products, unreacted EDC and NHS. Freeze drying to obtain the upconversion nanometer particle modified poly (2-hydroxy ethyl methacrylate) -cinnamic acid graft copolymer powder.
Synthesizing an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: performing ammonolysis on thioester bond at the other end of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer by using cyclohexylamine to generate sulfydryl, and modifying polyethylene by maleimide at two endsDiol (Mal-PEG-Mal) is used as a linking agent, and a mercapto-modified CD20 targeting Aptamer is modified at the tail end of a polymer chain through Michael addition reaction of mercapto and maleimide, so that the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid-grafted copolymer is obtained. Precisely weighing 50mg of upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, dispersing with 5ml of anhydrous Tetrahydrofuran (THF), adding excessive cyclohexylamine relative to thioester bond, and adding N2Reacting at room temperature for 12h under protection, precipitating the final reaction solution with 10 times of excessive precooled n-hexane, centrifuging (14000rpm/min, 15min), washing the precipitate with n-hexane for 3 times, drying the precipitate in a vacuum drying oven, and storing in a refrigerator at-20 ℃ for later use. After dissolving 0.1. mu.M of Mal-PEG-Mal in 1ml of TE buffer (pH 8), 0.02. mu.M of 5' -SH-Aptamer dissolved in 1ml of TE buffer was slowly added dropwise to the above solution, and tris (2-chloroethyl) phosphate (TCEP) was added thereto to a final concentration of 1mM to prevent oxidation of thiol, and the reaction was carried out at 37 ℃ for 12 hours with stirring. The mixed solution was dialyzed continuously with deionized water in a dialysis bag having a molecular weight of 3.5kDa for 24 hours to remove unreacted Mal-PEG-Mal. And collecting the dialysate, slowly dropwise adding 10mg of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer dispersion liquid dispersed in 5ml of deionized water into the solution, and stirring and reacting for 24 hours at room temperature. And centrifuging the final reaction solution at a high speed to obtain the Aptamer and up-conversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer powder.
Example three: preparation of Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer
1. Synthesis and amination modification of upconversion nanoparticle UCNP: taking rare earth chloride as a raw material, and preparing upconversion nanoparticles (UCNP) by a solvothermal method: 1mmol of rare earth chloride RECl3 & 6H2O (RE is 79.5% Y, 20% Yb, 0.5% Tm), 15ml of octadecene and 6ml of Oleic Acid (OA) are placed into a 100ml three-neck flask, and under the protection of argon gas, the temperature is raised to 160 ℃ for 40min, so as to ensure that the solid substances are completely dissolved. Then naturally cooling the temperature of the system to room temperature, slowly dropwise adding 10mL of anhydrous methanol mixed solution dissolved with 0.15g of ammonium fluoride and 0.1g of sodium hydroxide into a three-neck flask, reacting for 30min under the condition of vigorous stirring at 50 ℃, and then removing the methanol in the reaction mixed solution under reduced pressure under the protection of argon; after the methanol is removed, quickly heating to 300 ℃, and keeping the temperature for 90 min; and naturally cooling to room temperature after the reaction is finished, precipitating the product by using excessive absolute ethyl alcohol, and centrifugally washing the obtained precipitate for 3 times by using the absolute ethyl alcohol to obtain the upconversion nanoparticle UCNP. The average particle size of UCNP was measured to be 41.5nm by dynamic light scattering; the UCNP can emit ultraviolet light of 280-380nm under the irradiation of 980nm infrared light by using a fluorescence spectrophotometer. On the basis, the UCNP is subjected to amino modification by adopting a ligand exchange method: dispersing 200mg of 2-aminoethyl dihydrogen phosphate (AEP) in 10ml of a mixed solution of deionized water and ethanol (deionized water: ethanol: 3:1, v/v), dropwise adding 5ml of UCNP cyclohexane dispersion (2mg/ml) into the mixed solution, and stirring at room temperature for reaction for 48 hours; centrifuging and taking the precipitate to obtain the UCNP modified by the amino.
2. Synthesis of Poly (2-hydroxyethyl methacrylate): 0.42g of 2-cyano-2-propylbenzodithio, 0.01g of 4, 4' -azobis (4-cyanopentanoic acid) were weighed precisely, 0.95ml of 2-hydroxyethyl methacrylate (HEMA) and 2.56ml of dioxane were measured, the above mixture was charged into a 25ml three-necked flask containing a magnetic stirrer, nitrogen was pumped in for 30min to remove oxygen in the system, and then the flask was put into an oil bath preheated to 80 ℃ in N2The reaction was left under protection for 12h, and then the reaction was cooled to room temperature by exposure to air. And finally, adding 10 times of precooled ether into the reaction liquid to precipitate a product, centrifugally cleaning the precipitate for 3 times by using ether, and drying the obtained solid precipitate in a vacuum drying oven at 50 ℃ for 24 hours to obtain poly (2-hydroxyethyl methacrylate) solid powder. The average molecular weight of the poly (2-hydroxyethyl methacrylate) was determined to be 32kDa by gel permeation chromatography.
3. Synthesis of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft: 17.63mg of cinnamic acid, Dicyclohexylcarbodiimide (DCC) with the mole number 5 times that of the cinnamic acid and 4-Dimethylaminopyridine (DMAP) are precisely weighed and placed in a 15ml three-necked bottle, 5ml of anhydrous DMSO is added for ultrasonic dissolution, stirring is carried out for 0.5h at 60 ℃ to activate carboxyl, 50mg of poly (2-hydroxyethyl methacrylate) dissolved by 2ml of anhydrous DMSO is added, and the reaction system is stirred and reacted for 24h at 60 ℃. After the final reaction solution was cooled to room temperature, it was transferred to a dialysis bag (MWCO:1kDa) and continuously dialyzed with pure water for 48 hours to remove by-products and unreacted DCC and DMAP. And (3) centrifuging the liquid in the dialysis bag (2000rpm,15min), collecting the supernatant, and freeze-drying to obtain the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft powder. The grafting rate of the cinnamic acid is measured to be 12.5 percent by nuclear magnetic resonance hydrogen spectrum.
4. Synthesis of an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: accurately weighing 50mg of poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, and dissolving in 2ml of DMSO; 1- (3-dimethylaminopropyl) -3-Ethylcarbodiimide (EDC) and N-hydroxysuccinimide (NHS) in an amount of 6 times the molar amount of the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer were dissolved in 2ml of DMSO. The above two solutions were mixed, stirred at 60 ℃ for 0.5h to activate the carboxyl group, and then 5ml (2mg/ml) of aminated upconverting nanoparticles uniformly dispersed in DMSO were added. Stirring the reaction system at 60 ℃ for reaction for 48h, centrifuging the final reaction solution at 14000rpm/min for 15min, and taking the precipitate. And adding deionized water, centrifuging at 14000rpm/min for 15min, repeating for 3 times, and removing by-products, unreacted EDC and NHS. Freeze drying to obtain the upconversion nanometer particle modified poly (2-hydroxy ethyl methacrylate) -cinnamic acid graft copolymer powder.
Synthesizing an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer: performing ammonolysis on a thioester bond at the other end of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer by using cyclohexylamine to generate a sulfydryl group, modifying a sulfydryl group modified CD20 targeting Aptamer at the tail end of a polymer chain by using polyethylene glycol (Mal-PEG-Mal) modified by maleimide at two ends as a linking agent through Michael addition reaction of the sulfydryl group and the maleimide to obtain the Aptamer and the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid-a graft copolymer. Precisely weighing 50mg of upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer, dispersing with 5ml of anhydrous Tetrahydrofuran (THF), adding excessive cyclohexylamine relative to thioester bond, and adding N2Reacting at room temperature for 12h under protection, precipitating the final reaction solution with 10 times of excessive precooled n-hexane, centrifuging (14000rpm/min, 15min), washing the precipitate with n-hexane for 3 times, drying the precipitate in a vacuum drying oven, and storing in a refrigerator at-20 ℃ for later use. After dissolving 0.1. mu.M of Mal-PEG-Mal in 1ml of TE buffer (pH 8), 0.02. mu.M of 5' -SH-Aptamer dissolved in 1ml of TE buffer was slowly added dropwise to the above solution, and tris (2-chloroethyl) phosphate (TCEP) was added thereto to a final concentration of 1mM to prevent oxidation of thiol, and the reaction was carried out at 37 ℃ for 12 hours with stirring. The mixed solution was dialyzed continuously with deionized water in a dialysis bag having a molecular weight of 3.5kDa for 24 hours to remove unreacted Mal-PEG-Mal. And collecting the dialysate, slowly dropwise adding 10mg of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer dispersion liquid dispersed in 5ml of deionized water into the solution, and stirring and reacting for 24 hours at room temperature. And centrifuging the final reaction solution at a high speed to obtain the Aptamer and up-conversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer powder.
Example four:
1. in-vitro crosslinking research of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer.
4mg of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer obtained in the third example was precisely weighed, dispersed in 5ml of deionized water (800. mu.g/ml), and then treated with 980nm near infrared light (power: 2W/cm)2) Irradiating for 30min, and observing the form of the poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer modified by the up-conversion nanoparticles before and after near-infrared illumination by using a transmission electron microscope. As shown in FIG. 2, after near-infrared illumination, the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer is crosslinked, the average particle size is about 300nm, and the particle size is significantly increased.
Research on antitumor treatment effect of Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer
(1) In-vitro anti-tumor efficacy investigation of Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer
5mg of the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer obtained in example three was precisely weighed and dispersed in 1ml of deionized water (5 mg/ml). The human B cell lymphoma Raji cell positive to CD20 receptor is used as model cell and inoculated in 96-well plate at the inoculation density of 5x103Well in incubator (37 ℃, 5% CO)2) The culture was carried out overnight. Then, the prepared upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer dispersion liquid is added into each hole, so that the final concentrations of the dispersion liquid in cells are respectively 50, 100, 200, 400, 800 and 1000 mug/mL (each group of concentration is provided with 6 multiple holes). Incubating in incubator for 6h, irradiating cells with 980nm infrared laser for 30min (power: 2W/cm)25min at intervals of 10min every time of irradiation to prevent the culture medium from overheating), and after continuously incubating for 24h, detecting the cell survival rate by adopting a CCK8 method: adding 10 mu L of CCK-8 solution into each test hole, placing the culture plate in an incubator for further incubation for 4h, detecting the absorbance value at the wavelength of 450nm by using a multifunctional microplate reader, and calculating the cell growth inhibition rate according to the following formula:
cell growth inhibition (%) - (1-A)T/AC)×100％
In the formula, ATAbsorbance at 450nm of the experimental group, ACAbsorbance at 450nm for the blank. The results are shown in fig. 3, compared with the control group, the cell survival rate of the experimental group is significantly reduced, and the cell growth inhibition rate is about 77%, which indicates that the up-conversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer has good anti-tumor activity in vitro under 980nm infrared illumination.
(2) And (3) observing the in-vivo anti-tumor curative effect of the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer.
And (3) carrying out intratumoral injection by using the Aptamer and the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer obtained in the example III to investigate the in vivo anti-tumor curative effect. Constructing a nude mouse transplantation tumor model of the Holraji lymphoma, and when the tumor volume is about 100mm3At the time, the mice were randomly divided into 4 groups of 6 mice each. Treatment was carried out as follows, with day 0 being recorded at the start of treatment. Group A: control group (100. mu.l of physiological saline for intratumoral injection into each nude mouse on days 0, 7, and 13); group B: 980nm infrared light (in 1, 8, 14 days, 980nm infrared light is applied to local irradiation of tumor part for 30min, power is 2W/cm25min at 10min intervals per irradiation to prevent overheating of the skin); group C: the method comprises the following steps of (1) injecting an Aptamer and an upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer into tumors of each nude mouse on days 0, 7 and 13, wherein the total dose of the Aptamer and the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer is 1 mg; group D: the method comprises the steps of adding 980nm near-infrared illumination to an Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer (injecting 1mg of the total dose of the Aptamer and upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer into the tumor of each nude mouse in days 0, 7 and 13, and locally irradiating the tumor part with 980nm infrared light for 30min in days 1, 8 and 14, wherein the power is 2W/cm25min apart every 10min of irradiation to prevent overheating of the skin). Tumor-bearing nude mice were monitored for 27 days, and tumor volumes were measured every other day to prepare tumor volume growth curves. The result is shown in fig. 4, compared with the control group, the tumor growth rate of the group of the Aptamer and the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer with 980nm infrared light is significantly slowed down, and the tumor inhibition rate is about 83.1%, which indicates that the Aptamer and the upconversion nanoparticle modified poly (2-hydroxyethyl methacrylate) -cinnamic acid graft copolymer have good in vivo anti-tumor efficacy under 980nm infrared light irradiation.
Sequence listing
<110> Zhejiang university
<120> Aptamer and upconversion nanoparticle modified copolymer, synthesis and application
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 100
<212> DNA
<213> oligonucleotide sequence (artificial sequence) specifically targeting CD20 receptor designed according to high expression CD20 receptor on surface of Raji cell of human B cell lymphoma
<400> 1
ctcctctgac tgtaaccacg ccgtatgtcc gaaatacgga gaacagcact catatgcaag 60
ccatacgcgg aggtgcacgc gcataggtag tccagaagcc 100