阅读说明：本技术 一种构建麦角硫因生产菌的方法 (Method for constructing ergothioneine producing strain ) 是由 范文超 高书良 王金刚 任亮 俞想 于 2020-06-24 设计创作，主要内容包括：本发明公开了一种圆红酵母工程菌及其构建方法,该圆红酵母工程菌能够表达外源的egt1酶,从而提高生产麦角硫因的能力,发酵后麦角硫因产量接近1.5g/L,且工程菌遗传性状稳定,具有工业化应用前景。(The rhodotorula toruloides engineering bacteria can express exogenous egt1 enzyme, so that the capacity of producing ergothioneine is improved, the yield of the ergothioneine after fermentation is close to 1.5g/L, the genetic character of the engineering bacteria is stable, and the rhodotorula toruloides engineering bacteria have industrial application prospect.)

1. An EGT1 gene expression cassette selected from SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3.

2. An EGT1 gene expression plasmid obtained by cloning the gene expression cassette of claim 1 on a pUC57 plasmid, designated as Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t, Puc57-Pgpd-RmEGT1-ScCYC1t, respectively.

3. An ergothioneine functional gene expression plasmid constructed by a method comprising the steps of:

1) the EGT1 gene expression plasmid Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t are subjected to enzyme digestion by using restriction enzyme XbaI/PmeI, and 3.7kb, 3.6kb and 4.9kb fragments are respectively recovered by gel to obtain an EGT1 gene expression fragment;

2) carrying out enzyme digestion on plasmid pZPK-PGPD-Hyg-Tnos with the nucleotide sequence of SEQ ID NO. 4 by using restriction enzyme XbaI/PmeI, and carrying out gel recovery on an 8.3kb fragment to obtain a plasmid skeleton;

3) connecting the EGT1 gene expression fragment obtained in the step 1) with the plasmid skeleton obtained in the step 2) to obtain an ergothioneine functional gene expression plasmid.

4. A method for constructing an ergothioneine-producing bacterium, comprising transforming the ergothioneine-functional gene expression plasmid according to claim 3 into a bacterial strain capable of producing ergothioneine to obtain a positive clone.

5. The method of claim 4, wherein said strain is Rhodotorula toruloides.

6. The method according to claim 5, wherein the ergothioneine functional gene expression plasmid according to claim 3 is used for Agrobacterium-mediated transfection of Rhodotorula toruloides to obtain positive transformants.

7. The method of claim 6, comprising the steps of:

A. transforming the ergothioneine functional gene expression plasmid of claim 3 into Agrobacterium-infected competent cells to obtain Agrobacterium-engineered bacteria;

B. and mixing the agrobacterium engineering bacteria liquid with the rhodotorula toruloides liquid, carrying out resistance screening, and obtaining a positive transformant through phenotype and PCR verification.

8. An ergothioneine-producing bacterium constructed by the method of any one of claims 4 to 7.

9. The ergothioneine-producing strain of claim 8, which is Rhodotorula toruloides.

10. Use of the ergothioneine-producing bacteria as claimed in claim 8 or 9 in the fermentative production of ergothioneine.

Technical Field

The invention belongs to the field of genetic engineering, relates to a method for constructing ergothioneine-producing bacteria, and particularly relates to a method for constructing rhodotorula toruloides for producing ergothioneine.

Background

Ergothioneine (L-ergothinine, EGT) with the chemical name of 2-sulfhydryl histidine trimethyl inner salt has the following structural formula:

ergothioneine is the only natural 2-thioimidazole amino acid known to date. Ergothioneine has antioxidant, antiinflammatory, cell life cycle prolonging or anti-cell aging activity, and nerve cell generation improving effects. Meanwhile, the traditional Chinese medicine composition has better effects of protecting cells and resisting damage in various disease models including complications of Alzheimer disease, diabetes and the like, and has wide market application prospect.

At present, ergothioneine can be obtained by chemical synthesis, edible fungus extraction and microbial fermentation production. A variety of microorganisms have been demonstrated to have ergothioneine synthesis ability, including various microorganisms such as mycobacteria, Streptomyces, molds and yeasts. There are many patent technologies relating to the production of ergothioneine by microbial fermentation, such as CN102978121B, which discloses that edible mushroom Pleurotus nebrodensis catalyzes histidine substrate to produce ergothioneine, the substrate conversion rate can reach 70%, and the product yield is not reported; CN103184246A discloses that the yield of ergothioneine is 51mg/L after the fermentation of the large filamentous fungus Lepista sordida in a shake flask for 10 days; WO2017150304A1 discloses that the yield of ergothioneine is 900mg/L after fermentation of Streptomyces lividans for 7 days; WO2015180492A1 discloses Pleurotus ostreatus with an ergothioneine yield of 352mg/L when fermented in a 75L fermenter for 14 days; CN103734022 discloses that edible fungus Pleurotus ostreatus is fermented for 7-15 days, and the highest yield of ergothioneine reaches 143.7 mg/L; CN107250347 discloses genetically engineered aspergillus including Aspergillus oryzae, Aspergillus sojae and Aspergillus niger, which are genetically engineered to achieve a fermentation yield of 438 mg/L; e.coli is transformed by genetic engineering, the ergothioneine gene of the heterologous expression mycobacterium is clustered, and the yield of the ergothioneine is 640 mg/L; CN106661585 discloses that Escherichia coli is transformed by genetic engineering, the ergothioneine gene of the heterologously expressed mycobacteria is synthesized into clusters, and the yield of the ergothioneine is 12mg/L by fermentation of engineering bacteria; CN105296559A discloses Pleurotus ostreatus edible fungus, which is fermented for at least 6 days by adjusting the components of the multiple fermentation formula, and the highest yield of ergothioneine is 315.7 mg/L; CN201910664772.8A discloses that the yield of ergothioneine of the constructed genetically engineered bacterium reaches 568.4mg/L by using bacillus subtilis 168 as a host to express exogenous genes.

Literature (Takusagawa, S., Y.Satoh, I.Ohtsu and T.Dairi (2018). "Ergotheioneproduction with Aspergillus oryzae".Bioscience,Biotechnology,and Biochemistry1-4.) discloses that Aspergillus oryzae has been genetically engineered to produce an ergothioneine yield of 231 mg/L. In addition, the highest yield of microbial fermentation ergothioneine is currently in the literature (Tanaka, n., y.kawano, y.satoh, t.dairi and i.ohtsu (2019). "Gram-scale fermentation production driven by organic production of cysteine in Escherichia coli"Scientific reports1895-1895), which utilizes genetic engineering means to heterologously express the synthesis of ergothioneine from mycobacteria in Escherichia coli, to study and obtain engineering bacteria, to culture in a fermentation tank, to induce and open a synthesis switch by adding IPTG, to continuously supplement precursor histidine, to ferment for 9 days as long as 216h, and finally to obtain the yield of 1.3g/L ergothioneine. But as a conditional pathogen and a transgenic strain, the product application prospect is worried about. The method is particularly important for solving the problem of high-efficiency production of ergothioneine by searching for microorganisms with natural sources and food source safety attributes and developing a proper production process. Literature (van der Hoek, s.a., b.darbani, k.e.zugaj, b.k.prabhala, m.b.bion, m.randelovic, j.b.medina, d.b.kell and i.borodina (2019). "engineering the year&lt；em&gt；Saccharomyces cerevisiae&lt；/em&gt；for the production ofL-(+)-ergothioneine."bioRxiv667592.) discloses genetically engineering a foreign gene with Saccharomyces cerevisiaeThe ergothioneine can be synthesized by expression, and the yield can reach 630 mg/L.

Disclosure of Invention

In order to explore an industrial approach for producing ergothioneine by using food-source safe microorganisms through a fermentation method, the invention utilizes a genetic engineering technology to carry out genetic transformation on natural Rhodotorula toruloides (or Rhodotorula toruloides) so as to construct a strain with high yield of the ergothioneine. Specifically, the invention comprises the following technical scheme:

an EGT1 gene expression cassette selected from SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 3.

Wherein SEQ ID NO. 1 comprises promoter pGPD, gene NcEGT1 coding for enzyme egt1 derived from Neurospora crassa and a Saccharomyces cerevisiae-derived CYC1t terminator, XbaI cleavage sites and PmeI cleavage sites are respectively added from head to tail for subsequent plasmid construction, and the sequence is named Pgpd-NcEGT1-ScCYC1 t;

2 contains promoter pGPD, coding gene CpEGT1 of enzyme egt1 derived from Claviceps purpurea of rye ergot bacteria and CYC1t terminator derived from saccharomyces cerevisiae, adds XbaI and PmeI restriction sites from head to tail respectively for subsequent plasmid construction, and is named Pgpd-CpEGT1-ScCYC1t in the text;

SEQ ID NO 3 contains promoter pGPD, gene RmEGT1 encoding enzyme egt1 derived from Rhodotorula mucilaginosa and Saccharomyces cerevisiae-derived CYC1t terminator, and XbaI and PmeI cleavage sites are added head and tail respectively for the subsequent plasmid construction, herein named Pgpd-RmEGT1-ScCYC1 t.

According to a second aspect of the present invention, there is provided an EGT1 gene expression plasmid obtained by cloning the above-described gene expression cassette on Puc57 plasmid. Corresponding to the names of the gene expression cassettes, the gene expression cassettes are named as Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1 t.

According to a third aspect of the present invention, there is provided an ergothioneine functional gene expression plasmid (or EGT1 gene transformation plasmid) constructed by a method comprising the steps of:

1) the EGT1 gene expression plasmid Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t are subjected to enzyme digestion by using restriction enzyme XbaI/PmeI, and 3.7kb, 3.6kb and 4.9kb fragments are respectively recovered by gel to obtain an EGT1 gene expression fragment;

2) carrying out enzyme digestion on plasmid pZPK-PGPD-Hyg-Tnos with the nucleotide sequence of SEQ ID NO. 4 by using restriction enzyme XbaI/PmeI, and carrying out gel recovery on an 8.3kb fragment to obtain a plasmid skeleton;

3) connecting the EGT1 gene expression fragment obtained in the step 1) with the plasmid skeleton obtained in the step 2) to obtain an ergothioneine functional gene expression plasmid. The ergothioneine functional gene expression plasmids are pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1 plasmids corresponding to the plasmids Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1 t.

The plasmid pZPK-PGPD-Hyg-Tnos described above is described in "Functional integration of multiple genes of the genes," FEMS Yeast research 14(4):547-555 (Lin, X., et al (2014) ".

According to a fourth aspect of the present invention, there is provided a method of constructing an ergothioneine-producing bacterium, comprising the steps of: the above-mentioned ergothioneine functional gene expression plasmids (pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1) were transformed into a strain capable of producing ergothioneine to obtain a positive clone.

The strain can be Rhodotorula toruloides (or Rhodotorula toruloides).

In one embodiment, the above method is to transfect rhodotorula toruloides with Agrobacterium mediated transformation of ergothioneine functional gene expression plasmids (pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1) to obtain positive transformants.

For example, the method may specifically include the following steps:

A. transforming the ergothioneine functional gene expression plasmids (pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1) into agrobacterium-infected cells to obtain agrobacterium engineering bacteria; preferably the agrobacterium is agrobacterium tumefaciens;

B. the liquid phase of the agrobacterium engineering bacteria is mixed with the rhodotorula toruloides, resistance screening is carried out, and positive transformants are obtained through phenotype and PCR verification, so that agrobacterium-mediated transfection of rhodotorula toruloides is realized.

According to a fifth aspect of the present invention, there is provided an ergothioneine-producing bacterium obtained by the method of constructing the ergothioneine-producing bacterium.

In one embodiment, the ergothioneine-producing bacteria is Rhodotorula toruloides2.1389, preferably Rhodotorula toruloides 2.1389.

The ergothioneine-producing bacteria can be used for producing ergothioneine by fermentation.

The invention carries out genetic modification on natural rhodotorula toruloides by means of genetic engineering to obtain the ergothioneine high-yield strain with food source safety. Fermentation verifies that the yield of the ergothioneine can reach about 1.5g/L, and the constructed engineering strain has relatively stable genetic characters after multiple passages and has better industrial application potential.

Drawings

FIG. 1 is a map structure diagram of plasmid pZPK-PGPD-Hyg-Tnos constructed by the invention.

Detailed Description

egt1 is a multifunctional enzyme that catalyzes the formation of S- (hercyn-2-yl) -L-cysteine S-oxide (S- (hercyn-2-yl) -L-cysteine S-oxide), the ergothioneine precursor, by catalyzing the substrate histidine. It was found that the ergothioneine production could be promoted by expressing the egt1 gene in a strain producing ergothioneine.

For the sake of simplicity of description herein, a protein such as egt1 will sometimes be used in combination with its encoding gene (DNA) name, and one skilled in the art will understand that they will represent different substances at different instances of description. Their meaning will be readily understood by those skilled in the art based on the context and context. For example, for egt1, when used to describe an enzyme function or class, refers to a protein; when described as a gene, refers to the gene encoding the enzyme.

We screened three microbial sources of egt1 enzymes, respectively from Neurospora crassa, Claviceps purpurea and Rhodotorula mucilaginosa, encoding genes NcEGT1, CpEGT1 and RmEGT 1.

The gene NcEGT1 can obtain the following base sequences through codon optimization according to the NCBI database, Genbank access: XP-956324.3 sequence:

atgccatccgctgagtcgatgaccccgtcctccgctttgggccagctcaaagccaccggccagcacgtcctctcgaagctccagcagcaaacttcgaacgccgacatcatcgacattcgccgcgtcgctgttgagatcaacctcaagaccgagatcacctcgatgttcagaccgaaggacggtccgagacaactcccgactttgctcttgtacaatgagcgcggcctccaattgtttgagcgcattacctatttggaggagtactacctcactaatgatgagattaagatcctcaccaagcacgctaccgaaatggcctcgtttatcccgtccggcgccatgatcatcgagctcggttcgggtaacttgcgcaaggttaacttgctcctcgaggccctcgataacgctggtaaggccatcgactactacgctctcgacttgtcgcgcgaggaattggagcgcactctcgctcaagtcccgtcgtacaagcacgttaagtgccacggtctcctcggcacctacgacgatggccgcgactggctcaaggccccagagaacatcaacaaacagaagtgcatcctccacttgggctcctccattggcaactttaaccgctccgacgctgccacttttttgaagggcttcactgacgtcctcggtccgaacgacaaaatgctcatcggtgtcgatgcttgcaatgacccggcccgcgtctaccatgcctacaacgacaaagtcggcatcacccacgaattcatcttgaacggcttgcgcaacgccaacgagattatcggcgagaccgcctttatcgaaggcgactggagagtcatcggcgaatacgtctacgacgaggagggtggtcgccaccaagccttctatgccccaactcgcgatactatggtcatgggcgagctcatcagatcccacgatcgcatccagatcgagcagtccctcaagtactccaaggaggagtccgagcgcctctggtcgactgctggtctcgaacaagtctccgaatggacctacggcaacgaatacggtctccatttgctcgccaaatccagaatgtcgttctccctcatcccgtcggtctatgcccgctcggctctcccaactctcgacgattgggaagccttgtgggccacttgggacgtcgtcaccagacagatgttgccgcaagaggaactcctcgagaagccgatcaagctccgcaacgcttgcatcttctacctcggccacattccaaccttcctcgacatccagttgaccaagaccaccaaacaagccccgtccgagccagctcacttctgcaagatcttcgagcgcggtatcgacccggatgtcgataatccggagctctgccacgctcactccgagatcccggacgagtggccaccagtcgaggagatcctcacctatcaagagaccgttcgctcgcgcttgcgcggtttgtacgcccacggtattgctaacatcccgcgcaacgttggtagagctatttgggtcggtttcgagcacgagctcatgcacatcgagaccctcctctacatgatgttgcagtcggacaagaccctcattccgacccatattccacgcccggacttcgataagttggcccgcaaggctgaatcggagagagtcccgaaccagtggttcaagatcccggcccaagagatcactatcggtctcgacgacccggaggacggttccgacatcaataaacactacggctgggataacgagaagccaccgcgcagagttcaagtcgccgcctttcaagcccaaggtagaccaatcactaacgaggagtacgcccaatacttgctcgagaagaacatcgacaaactcccagcctcgtgggctcgcttggacaatgagaacatctccaacggcaccaccaattccgtttccggtcaccactccaaccgcacctccaagcagcagctcccgtcctcgttcttggagaaaaccgccgtcagaaccgtttatggtttggttccactcaagcacgccctcgactggccggtcttcgcttcgtatgacgaactcgctggttgcgccgcttacatgggcggtcgcatcccgactttcgaagagacccgctccatctatgcctatgccgacgccctcaagaaaaagaaggaagctgaacgccagttgggtcgcaccgtcccagctgttaacgcccacctcaccaataacggcgttgaaatcaccccgccgtcgtcgccgtcgtccgaaaccccggccgaatcctcctccccgtcggattcgaacaccactctcatcaccactgaggacttgttctcggacctcgacggcgccaacgtcggcttccataactggcacccgatgccaatcacctcgaagggtaacactctcgtcggtcaaggtgagctcggcggtgtctgggaatggacctcgtcggtcctccgcaagtgggagggcttcgagccgatggagctctatccgggctacactgctgacttcttcgacgaaaagcacaatatcgtcctcggcggttcgtgggctacccacccaagaatcgccggccgcaagtcctttgtcaactggtaccagcgcaactacccgtatgcttgggtcggcgccagagttgtcagagacctctaa；

CpEGT1 sequence reference van der Hoek, S.A., et al (2019). "Engineering the yeast Saccharomyces cerevisiae for the production of L- (+) -Ergothioeine." bioRxiv:667592. it is

atgactgccgttaagcaaattcctgaaagaaaggtgttgatagattcaaatcataagtctccatcaaaaccgggtaaacatcctaattctgtcattgatatcaggtctaataaggacgatttaaatttacgtcatgccctagtctcatcttttaatccacacgatggaaaacctaggtggctacctactatgttattgtacgacgaaaaaggtttacaattgtttgaagatataacttacttagatgagtattatttgactggctacgaaattgaattattgaagaaacattcagcagaaattgcagctgctattcctgatggttctatggtcatcgaattgggctctggtaatttgagaaagatctgtttgttgttacaagcctttgaggattcacataagtctatcgactactatgcattagatttatcacaaaaggaattagaaagaactttgagccatgttcctgactttaaatatgtctcttgtcatggactgctaggtacatatgatgatggtgttacatggttgaaacaaccaggtatagtcaataagactaagtgcatcatccatcttggttcgtctattgggaattttcatagaaatgaagctgccgatttcctgcagacatttgctgatgtaatgaaaccagacgactctatggttattggtcttgattcatgcggtaatccagagatgtctcgcattcaaagattcattttgaacggcttatccaatgctaatagcgtttatggcaaggaaatattctatgttccagattggagagtaattggtgaatatgtttacgatgatgaaggtggcagacaccaggcttttatttcacctttgaaagaagtcactgctttagggtctgttattaaagcccatgaaagaattaaaattgaacaatctttgaagtactctaaggcctcagctgacgatttatggagaaatgctggctttcgagaaactcaaacttggacgagaaacggtgaatatggactacatatgttgcaaagagctgatccgcccttctctaaggctccttctttgtatgcagctaatactcttccctctctttctgattggagagcattgtggtgtgcctgggatattgtcactagagctatgttgccacaacaggaattgactgagaaacctatagagttaagacatgcctacatcttttaccttggtcatattcctaccttcttagacatccagttaaccaaaacatcagcatgggctccaacctctccagtttcttatcatgccattttcgagcgcggcattgatcccgatgttgataacccagaaaagtgtcatgatcactcagagattccagatgaatggccaccagtcgaagaaattattgcttatcaagatagggtgcgtgttagattgacagaactgtataaacagggtgtgcacacaattacaagaaaggctgctagagctatctgggtttcatttgaacatgaagctatgcatttggaaaccttgttgtatatgatgctacaaagtgataaagtgttgccacctccacacactggcgttccagactttgaaagaatggcaactaaggctttcgaagctcgtacgcaaaatatgtggttcgaaattccagaacagactattagtcttggaacagatgatccagaagatggggatgaagacgttcattttggatgggacaacgaaaaaccagttagaagagttaaggttcacgcgttgcaagctcaaggaagaccaattacaaatgaggaatacgcattatatatttaccataccaactcttctaaactgccagcatcttggagttcgtccccttcatcttctctgtctaacggcgtgtctcatcccagctcccataacaagcatattccaactgatttgcctcattccttcttgcaaggtaagtttgttagaaccgtatatggtttgatacctttatctttggcgttggattggcctgttcaagcttcttatgatgaattagctgactgtgcattatggatgggtggaagaattccaaccttagaggaagccagatcaatctatgcctttgttgaatctaaaacgcaaatagcaacaggtaacacattggtcaagaaagttcctgctgttaatggacacttggttaataacggagttgaggaaactccaccacatgaatcctcttcggcagttgagaattctttattcatcgacttagccggtttgaacgtgggttttaaaagttggaatcctgaacctgttacatcttctggtacgtctttggctggacaatcctctatgggtggtgtatgggagtggacctcttctgttttaagaccacatgaagggttccacccaatggagttgtatcctggttatacagccgatttctttgatgaaaaacataatattgttctcggaggatcatgggctactcatccaagaatagcgggtagaaaaagctttgttaactggtatcaaagaaactatccgtacgcctgggctggtgccagacttgttaaagatgcttga；

RmEGT1, using the NcEGT1 protein sequence, in the NCBI database blastp tool, to define the Rhodotorula mucilaginosa Rhodotorula muscilaginosa genome, and performing sequence alignment to obtain the following egt1 sequence:

atgccagacgccgcctcaaccgccgctgttcagcctccgcccttcatcctcgacctgcggaaccgctcgccgccgacctcgccgagccaggtcgcctccgatgccgctcgctcgtcctctccgtcgtccctgggcgaatcggagggcactacctcgaccaatgctacccccgaggccccctccgatccgctccgcgagcagatcatcgccggcttgatcggatcgcccaagcccaccgttccaggcaagacggaaaaggatcgcgcgtatgcgtaccgccgcacgatcccgaccatgacactgtacagcgagcgtggcctgtctatctacgaggaaatcaccaagaccaaggtatgctcggccctttccgtccgctttggttcacgaggggccaatgctttctcagcaggccctcgcgcgccgtcggccccacttgccctacggcgtgcgggctctccttcggactaggtggctggcaagcatcccctttgcagacgcactgacctcgtctttgcgtttcgattcaggcctactacccattcgaagccgaaaaggagattctcgaaaagtatggagacgaaattgcctgccgcatgtttggactgccgtcggccttgctcgtcccggacgacgtagtccgtggcaaagacgaccagtacgaaccctctccggcttcaaacatcggcgcgaagaaggagaagtggtgagccggcgttcggaactataacggctcctcatccgcggtacaggcgctgacgcactgcttacaggggcgacgtcgctgtcggtctccacaactacggtgtcaacggctctgcgaacctcgcgcagaacaatgtcgtcgccacgcagggcctcgcggtcgagcttggctcgggctcgctcgacaagacccgtcatctcctccgctctatggccaagctgttgcagtctcgcgacgagggcagctgcccggtctctcctctgcgctccattgactacaaagcagtgcgtttggcgaaacctccgcgagtataggaaatcaatactgacctcccacgtctgccgctgaacagctcgaccttgaagcggcgtcgctctactcgacactgtcctcgcttgcatcggtcgaaggcgattgcgtcacgacggcggtcgacggacagccaaacgcgacgaaacgccgcgtttcggtctcgggtcttcacgccacctacgacgagggcctcgccttcttgaaggcgcagaacgatgctggcagcccgtcgagcgtcttctcagacctccccgacttgcccacgagtccaaagtcggttccgactaccttgtccagtgtcctggaggacgacagcgacgaaggcgagaccgctcaagcgtctcgcggcgagaacgctgcggaacgccgcgcgacttcgatcatgtggctcggttcctcgtgcggcaactacacccgcgaggaagcggtgcagttcctccgcaacatcgagctgcgcgagggcgataccatgctgatcggcatcgacggctgcgcggacgaacctcgtatcgagactgcctacaacgacccgcaggtgagtctgatgtcctgccaaactgaccagtatgagctgctctgacccttgtttgccgctgatcctccagggcgtcacccgcgcgttcattctcgagggcatcgatgtcgcaggccgcaccctcggcggagacgcggccgaagtgctgcagcagaagaactttgactatgtcaaccgctggaacgccgagctcggaaggcacgaggtgagctgccttccgctgtccagaggagagcagcctgagttgcaccggcagccctgttctgacccgtccccgcgacaccctcgcaggcttacgtccgcgccaacaaagatctcacaatcccgatcacgggcgcagacgacgtcaccgaggtcaagctcgaagagggagagtaagtcccgcacttttgcgcgttgagccggtgccatcacaagagcccttcctgacgtttcctctcgcaccaggctcctcaacattgaagtctcttacaagtacacctatgcggaggcggcggcgctcttccacttggcgggcttccggctcatccagcactggaccgactcgtcgcgctcgcattacctctacctggtcgaaaagccccgcatgtggttcccgtcgacgaccgagagcgctgccaagatgctcggtatcgaggtcgagcccgaggagaaggagaccgactacggtgtcccgactctggaaaagtgggaagaaatgtggcgggcgtgggacggcttgatggtgaggatgccctcgtcggcgaaggaattccgcaagcgatgagtggacgctcacctgaaaccgcttcttctaccagctcgagatcatccccaagtcgctgcacttccagaagccgatcccgctccgccacatcccgctcttctacgtcgggcacatacccgctttccgggatattcacctcgcgaggtacttcaacgagccgctgaccgaaccggcaaagtttgccgacatcttcgagcgcggaatcgatccctgtgtcgacgaccccgagaccgtcacgcactggcactcggaagtcccgaaggacgaagcgtgctggccttctctccaggagattacggcgtacgaagcgtccgttcgcgatcgcgtccgcaaggtgtacgccgaacacgagggcaagtggacgaccaagctcgcccgtgtgctgatgatgacttttgagcacgagatgtgcgtccttcctgcttcgggctgattcggtacccatgtcatcactcgactcactcatcctcttgggtccccttgggccccacaggatgcactgggagacctccgtctacatctgtctccaagccgcgagctcgctcaaccttccgccgggaacggcgattcctgatttccgctcgctggcacgtcaagcaaaacgtgatctgcatcagaacggcggcggacagcgactctccttccccgctcaggaggtcacagtcggtcacgacgacgacgataccatcgacgaccagacgccgtttgaccctgcccgagaatacggctgggatgtcgagcaccctcgccgccagcttcgcgtcgacgcattcgagatcgaggtcctcccgatctcgaacggagagtacaaaacctggcttaccgagacgcagcaactctcgaacaaggcgctcatcccgtcgagctggacggacgagactggcgaactctgcgtgaaaacgttgttcggcttggtccccctcactctcgccgaggagtggcccgtggctgcgagcgcggaacagctcgagaagtttgccaaggtgggtatcctttgctcgagcaagaatagggaccgaagaagactgactcgtaactttctgcactcgacaggccaaaggaggacgcttgccgacgttcggcgagctgtcggcgttcaaccagcacaaccctagctctacgcctctcgccaacatcggcctcgcaaacctgcatccggttgccccttcggtacccgggaaagcgcgtgacggcagccagctcccgatcaccgacggaggcctgtggcaatggacctcgacggtcctcgagccctgggctggttacagcggatcggttctttaccctggttactccagtgacgtgagtcgagtgcgactgtgaatgaagtgagatggggcaactgacattaagcgccctctcttccctctagttcttcgacggcaaacaccacatcgtgctgggcgcgagctacgcgagtcctcgtcgcttggcccgcccttctttcctgaactggtaccagaagaactgtgcgtttctggcgctcttccaaggaccgttgccgccagatccccgtactgacatgctctgccgcagaccctttcatgctcggcggcgctcgtgtggcgtacgatgtgtga。

in the engineered bacteria constructed by the invention, the egt1 gene exists in the form of a gene expression cassette. The terms "egt 1 gene expression cassette", "gene expression cassette" and "expression cassette" are used herein in the same sense and are used interchangeably.

Using NcEGT1, CpEGT1 and RmEGT1 as the target genes, three egt1 gene expression cassettes, Pgpd-NcEGT1-ScCYC1t (SEQ ID NO:1), Pgpd-CpEGT1-ScCYC1t (SEQ ID NO:2) and Pgpd-RmEGT1-ScCYC1t (SEQ ID NO:3) were constructed. XbaI and PmeI restriction sites are respectively designed and added at the head and the tail of the three expression cassettes for subsequent plasmid construction.

The element sequence of the gene expression cassette is sent to Jinzhi biotechnology company of Suzhou to be synthesized, and plasmids of Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t are respectively obtained and are used for subsequent restriction enzyme ligation cloning construction.

The ability of Rhodotorula toruloides to produce ergothioneine is increased by expressing the egt1 gene in a suitable host such as certain Rhodotorula toruloides. When the constructed rhodotorula toruloides engineering bacteria are used for producing the ergothioneine through fermentation, a large amount of the ergothioneine can be produced without adding histidine betaine, histidine or cysteine and the like into a culture solution.

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.