Gene constructs for the treatment of neurodegenerative disorders or stroke
阅读说明：本技术 用于神经退行性病症或中风的治疗的基因构建体 (Gene constructs for the treatment of neurodegenerative disorders or stroke ) 是由 彼得·威多森 基思·马丁 于 2018-03-28 设计创作，主要内容包括：本发明提供了基因构建体和包含此类构建体的重组载体。所述构建体和载体可在用于治疗、预防或改善神经退行性病症(包括阿尔茨海默氏病、帕金森氏病、亨廷顿氏病、运动神经元疾病),或用于治疗中风,或用于促进神经再生和/或存活的基因疗法中使用。(The invention provides genetic constructs and recombinant vectors comprising such constructs. The constructs and vectors may be used in gene therapy for the treatment, prevention or amelioration of neurodegenerative disorders including alzheimer's disease, parkinson's disease, huntington's disease, motor neuron disease, or for the treatment of stroke, or for promoting nerve regeneration and/or survival.)
1. A genetic construct for use in the treatment, prevention or amelioration of a neurodegenerative disorder or stroke, said genetic construct comprising: a promoter operably linked to a first coding sequence encoding tyrosine kinase receptor b (trkb); and a second coding sequence encoding an agonist of the TrkB receptor.
2. A genetic construct for use according to claim 1, wherein the genetic construct comprises a nucleotide sequence encoding a woodchuck hepatitis virus post-transcriptional regulatory element (WHPE), optionally wherein the WHPE comprises a nucleic acid sequence substantially as shown in SEQ ID No 57 or SEQ ID No 58, or a fragment or variant thereof.
3. A genetic construct for use according to claim 1 or claim 2, wherein the construct comprises a nucleotide sequence encoding a polyA tail, optionally wherein the polyA tail comprises a nucleic acid sequence substantially as shown in SEQ ID No. 59, or a fragment or variant thereof.
4. A genetic construct for use according to any preceding claim, wherein the promoter is a human synapsin i (syn i) promoter, optionally wherein the promoter comprises a nucleotide sequence substantially as shown in SEQ ID No:1, or a fragment or variant thereof.
5. A genetic construct for use according to any one of claims 1 to 3, wherein the promoter is a CAG promoter, optionally wherein the promoter comprises a nucleotide sequence substantially as shown in SEQ ID No.2, SEQ ID No.3 or SEQ ID No.48, or a fragment or variant thereof.
6. A genetic construct for use according to any preceding claim, wherein the genetic construct comprises a spacer sequence disposed between the first and second coding sequences, the spacer sequence encoding a peptide spacer configured to be digested, thereby generating the TrkB receptor and agonist as separate molecules.
7. A genetic construct for use according to claim 6, wherein the spacer sequence comprises and encodes a viral peptide spacer sequence, more preferably a viral 2A peptide spacer sequence.
8. A genetic construct for use according to claim 6 or claim 7, wherein the peptide spacer sequence comprises an amino acid sequence substantially as shown in SEQ ID No.4, or a fragment or variant thereof.
9. A genetic construct for use according to any one of claims 6 to 8, wherein the spacer sequence comprises a nucleotide sequence substantially as shown in SEQ ID No.5, or a fragment or variant thereof.
10. A genetic construct for use according to claim 9, wherein the peptide spacer sequence comprises an amino acid sequence substantially as shown in SEQ id No.6, or a fragment or variant thereof.
11. A genetic construct for use according to any one of claims 6 to 8, wherein the spacer sequence comprises a nucleotide sequence substantially as shown in SEQ ID No.7, or a fragment or variant thereof.
12. A genetic construct for use according to claim 11, wherein the peptide spacer sequence comprises an amino acid sequence substantially as shown in seq id No.8, or a fragment or variant thereof.
13. A genetic construct for use according to any preceding claim, wherein the first coding sequence comprises a nucleotide sequence encoding the human canonical isoform of TrkB, optionally wherein the canonical isoform of TrkB comprises an amino acid sequence substantially as shown in seq id No.9, or a fragment or variant thereof.
14. A genetic construct for use according to claim 13, wherein the first coding sequence comprises a nucleotide sequence substantially as shown in seq id No.10, or a fragment or variant thereof.
15. A genetic construct for use according to any preceding claim, wherein the first coding sequence comprises a nucleotide sequence encoding isoform 4 of TrkB.
16. A genetic construct for use according to claim 16, wherein the isoform 4 of TrkB comprises an amino acid sequence substantially as set forth in SEQ ID No.11, or a fragment or variant thereof.
17. A genetic construct for use according to claim 16 or 17, wherein the first coding sequence comprises a nucleotide sequence substantially as set forth in SEQ ID No.12, or a fragment or variant thereof.
18. A genetic construct for use according to any preceding claim, wherein the first coding sequence comprises a nucleotide sequence encoding a mutated form of the TrkB receptor, wherein one or more tyrosine residues at positions 516, 701, 705, 706 and/or 816 of SEQ ID No:9 are modified or mutated.
19. A genetic construct for use according to claim 19, wherein at least two, three or four tyrosine residues at positions 516, 701, 705, 706 and/or 816 of SEQ ID No.9 are modified.
20. A genetic construct for use according to claim 20, wherein all five tyrosine residues at positions 516, 701, 705, 706 and/or 816 of SEQ ID No 9 are modified.
21. A genetic construct for use according to any one of claims 19 to 21, wherein the or each tyrosine residue is modified to glutamate.
22. A genetic construct for use according to any one of claims 19 to 22, wherein the modified form of the TrkB receptor comprises an amino acid sequence substantially as set out in SEQ ID No.13, or a fragment or variant thereof.
23. A genetic construct for use according to claim 23, wherein the first coding sequence comprises a nucleotide sequence substantially as shown in seq id No.14, or a fragment or variant thereof.
24. A genetic construct for use according to any preceding claim, wherein the second coding sequence encodes an agonist of the TrkB receptor which is a member of the neurotrophin family of trophic factors, optionally wherein the agonist is selected from the group of agonists consisting of: brain Derived Neurotrophic Factor (BDNF); nerve Growth Factor (NGF); neurotrophin-3 (NT-3); neurotrophin-4 (NT-4); and neurotrophin-5 (NT-5); or a fragment thereof.
25. The genetic construct for use according to claim 25, wherein the second coding sequence encodes neurotrophin-4 (NT-4), said NT-4 comprising an amino acid sequence substantially as shown in SEQ ID No.49 or SEQ ID No.55, or a fragment or variant thereof, and/or said second coding sequence comprises a nucleotide sequence substantially as shown in SEQ ID No.50 or SEQ ID No.56, or a fragment or variant thereof.
26. A genetic construct for use according to any preceding claim, wherein the agonist of the TrkB receptor is a prepro-brain derived neurotrophic factor (pre-pro-BDNF), pro-BDNF or mature BDNF (mbdnf).
27. A genetic construct for use according to claim 24, wherein the proBDNF is classical proBDNF, optionally wherein the classical proBDNF comprises an amino acid sequence substantially as shown in SEQ ID No.15, or a fragment or variant thereof, or wherein the second coding sequence comprises a nucleotide sequence substantially as shown in SEQ ID No.16, or a fragment or variant thereof.
28. A genetic construct for use according to claim 27, wherein the proBDNF is isoform 2 of proBDNF, optionally wherein the isoform 2 of proBDNF comprises the amino acid sequence referred to herein as SEQ ID No.17, or a fragment or variant thereof.
29. A genetic construct for use according to claim 27, wherein the second coding sequence comprises a nucleotide sequence encoding mature BDNF.
30. A genetic construct for use according to claim 30, wherein the mature BDNF comprises an amino acid sequence substantially as shown in SEQ id No.18, or a fragment or variant thereof.
31. A genetic construct for use according to claim 31, wherein the second coding sequence comprises a nucleotide sequence substantially as shown in seq id No.19, or a fragment or variant thereof.
32. A genetic construct for use according to any preceding claim, wherein the second coding sequence comprises a nucleotide sequence encoding a signal peptide for an agonist of the TrkB receptor, most preferably a signal peptide for BDNF.
33. A genetic construct for use according to claim 33, wherein the nucleotide sequence encodes a classical signal peptide for BDNF.
34. A genetic construct for use according to claim 34, wherein the second coding sequence comprises a nucleotide sequence encoding a signal peptide comprising an amino acid sequence substantially as set out in SEQ ID No.20, or a fragment or variant thereof.
35. A genetic construct for use according to claim 36, wherein the second coding sequence comprises a nucleotide sequence substantially as shown in seq id No.21, or a fragment or variant thereof.
36. A genetic construct for use according to any preceding claim, wherein the second coding sequence comprises a nucleotide sequence encoding a signal sequence peptide substantially as shown in any one of SEQ ID No.23, SEQ ID No.25, SEQ ID No.27 or SEQ ID No.29, or wherein the signal peptide comprises an amino acid sequence substantially as shown in any one of SEQ ID No.22, SEQ ID No.24, SEQ ID No.26 or SEQ ID No. 28.
37. A genetic construct for use according to any preceding claim, wherein the second coding sequence comprises a nucleotide sequence encoding a signal sequence peptide substantially as shown in any one of SEQ ID No.31, SEQ ID No.33, SEQ ID No.35, SEQ ID No.37, SEQ ID No.39, SEQ ID No.41, SEQ ID No.43, SEQ ID No.45, SEQ ID No.61, SEQ ID No.63, SEQ ID No.65, SEQ ID No.67, SEQ ID No.69, SEQ ID No.71, SEQ ID No.73, SEQ ID No.75, SEQ ID No.77, SEQ ID No.79, SEQ ID No.81, SEQ ID No.83, SEQ ID No.85, SEQ ID No.87, SEQ ID No.89, SEQ ID No.91, SEQ ID No.93, SEQ ID No.95, SEQ ID No.97, SEQ ID No.99, SEQ ID No.101 or SEQ ID No.103, or wherein the signal sequence peptide substantially as shown in any one of SEQ ID No.30 or 30 is as shown, SEQ ID NO.32, SEQ ID NO.34, SEQ ID NO.36, SEQ ID NO.38, SEQ ID NO.40, SEQ ID NO.42, SEQ ID NO.44, SEQ ID NO.60, SEQ ID NO.62, SEQ ID NO.64, SEQ ID NO.66, SEQ ID NO.68, SEQ ID NO.70, SEQ ID NO.72, SEQ ID NO.74, SEQ ID NO.76, SEQ ID NO.78, SEQ ID NO.80, SEQ ID NO.82, SEQ ID NO.84, SEQ ID NO.86, SEQ ID NO.88, SEQ ID NO.90, SEQ ID NO.92, SEQ ID NO.94, SEQ ID NO.96, SEQ ID NO.98, SEQ ID NO.100 or SEQ ID NO. 102.
38. A genetic construct for use according to any preceding claim, wherein the construct comprises a nucleotide sequence substantially as shown in SEQ ID No. 107 or SEQ ID No. 108, or a fragment or variant thereof.
39. A recombinant vector for treating, preventing or ameliorating a neurodegenerative disorder or stroke, comprising the genetic construct according to any one of claims 1 to 39.
40. The recombinant vector for use according to claim 40, wherein the vector is a recombinant AAV (rAAV) vector.
41. The recombinant vector for use according to claim 41, wherein the rAAV is AAV-1, AAV-2, AAV-3A, AAV-3B, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, or AAV-11.
42. The recombinant vector for use according to claim 42, wherein the rAAV is rAAV serotype-2.
43. A pharmaceutical composition comprising the genetic construct according to any one of claims 1-39, or the recombinant vector according to any one of claims 40-43, and a pharmaceutically acceptable vehicle.
44. A method of making the pharmaceutical composition of claim 49, the method comprising contacting the genetic construct of any one of claims 1-39 or the recombinant vector of any one of claims 40-43 with a pharmaceutically acceptable vehicle.
45. A genetic construct or vector for use according to any one of claims 1-43, or a composition according to claim 44, wherein said neurodegenerative disorder is selected from the group consisting of: alexandria, Alper's disease, Alzheimer's disease, Amyotrophic Lateral Sclerosis (ALS), ataxia telangiectasia, neuronal ceroid lipofuscinosis, batten disease, Bovine Spongiform Encephalopathy (BSE), Kanawan's disease, cerebral palsy, Kekahn's syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, frontotemporal lobar degeneration, gaucher disease, Huntington's disease, HIV-related dementia, Kennedy's disease, Krebs's disease, Lewy body dementia, lysosomal storage disease, Neurosis, Marchardo-Joseph disease, motor neuron disease, multiple system atrophy, multiple sclerosis, polythiolesterase deficiency, lipostorage disease, narcolepsy, Nieman's disease type C, Niemann's disease, Parkinson's disease, Pape-Meier's disease, Classner's disease, Pompe's disease, primary lateral sclerosis, and Alzheimer's disease, Prion diseases, progressive supranuclear palsy, refsum disease, sandhoff's disease, schilder's disease, subacute degeneration of the spinal cord secondary to pernicious anemia, tetra disease, spinocerebellar ataxia, spinal muscular atrophy, trisection, tabes dorsalis, and tay-sachs disease.
46. A genetic construct or vector for use according to any one of claims 1 to 43, or a composition according to claim 44, wherein the neurodegenerative disorder is Alzheimer's disease.
47. A genetic construct or vector for use according to claim 46, wherein Tau phosphorylation in neurons is reduced.
Examples
The following examples demonstrate the use of embodiments of the present invention to promote nerve regeneration and/or survival. As disclosed herein, the teachings derivable from the uses, methods and treatments disclosed in the examples are also applicable to the treatment of neurodegenerative disorders and stroke.
Method and material
Molecular cloning and plasmid constructs
Using on-line tools(http://www.idtdna.com/CodonOpt)Codon optimization of the DNA sequence was performed and the DNA blocks were synthesized by Integrated DNA technologies, Inc. (IDT; 9180N. McCormick Boulevard, Skokie, IL60076-2920, USA) or GenScript (860 Centennal Ave, Piscataway, NJ 08854, USA). Cloning was performed using standard molecular biology and cloning techniques to prepare the master plasmid (master plasmid) QTA001PA and subsequent plasmids.
Plasmid amplification (scale up) and purification
After maxi-prep purification, the DNA plasmid was amplified overnight in SURE competent cells (Agilent Technologies; Cat. No. 200238), providing 2.29. mu.g/. mu.l of plasmid. The remaining plasmids were scaled up to the 500 μ g scale and the transduction mass presented minimal endotoxin.
HEK293 culture and cell transduction Using plasmid DNA
HEK293 cells (400,000 cells) were cultured in 6-well plates coated with poly-L-lysine (10. mu.g/mL, Sigma-Aldrich; Cat. No. P1274) in 1.5mL of eagle's minimal essential medium (DMEM) containing 10% Fetal Bovine Serum (FBS), 1% penicillin and 1% streptomycin (1% Pen/Strep) until 80% confluency (confluency) was reached. The medium was then changed to 2mL DMEM (without additives). Two to three hours later, an additional 0.5mL of transfection medium containing 4. mu.g plasmid DNA plus 10. mu.L lipofectamine (4. mu.L/mL; Thermo Fisher Scientific; Cat. No. 12566014) was added to each well, resulting in a total volume of 2.5mL throughout the transfection period and for supernatant collection.
SH-SY5Y culture and cell transfection Using rAAV2 viral vector
SH-SY5Y cells were cultured in 6-well plates (300,000 cells), 96-well plates (10,000 cells) or on 13mm glass coverslips (100,000 cells) coated with poly-L-lysine (10. mu.g/mL, Sigma product number P1274). Cells were cultured to 80% confluency at 37 ℃ using eagle's minimal essential medium (DMEM) containing 10% Fetal Bovine Serum (FBS), 1% penicillin, and 1% streptomycin (1% Pen/Strep), and then replaced with DMEM without additives, followed by transfection. DMEM volumes used were 6 well plates (2mL), 96 well plates (100. mu.L) and coverslips (500. mu.L). The diluted vector in PBS was diluted at 1.0X 1010(VP)/mL was added directly to the medium at final concentration and incubated at 37 ℃ for 48 hours.
Hydrogen peroxide induced SH-SY5Y cell death and TUNEL staining
48 hours after SH-SY5Y cell transfection,the medium was changed to fresh DMEM (without additives). Hydrogen peroxide (H)2O2) (Thermo Fisher Scientific; product No. BP2633500, batch No. 1378087) was diluted in filtered water (to a concentration of 0.1mM or l.0mM) and added in equal volumes to each well or plate and left for an additional 24 hours. Filtered water served as vehicle control. The coverslips were washed twice in PBS and fixed in 4% paraformaldehyde in 1M Phosphate Buffered Saline (PBS) for 30 minutes at room temperature. After three more washes in PBS, cells were blocked and permeabilized by incubation for 60 minutes at room temperature in 5% Normal Goat Serum (NGS), 3% Bovine Serum Albumin (BSA) and 0.3% Triton X-100 in PBS. The cells were then incubated with commercially available rabbit polyclonal anti-TrkB antibody (Abeam; product No. ab33655, batch No. GR232306-1, diluted 1:500), rabbit polyclonal anti-BDNF antibody (Santa Cruz Biotechnology Inc; product No. sc-546; batch No. CO915, diluted 1:300) or p-Tyr diluted in blocking solution515TrkB (Abeam, product No. ab 109684; batch No. GR92849-4, 1:750) was incubated together overnight at 4 ℃. Anti-rabbit secondary antibodies conjugated to alexa fluor 488(Life Technologies; product No. A11034, 1:1000) were used to stain for 2 hours at room temperature. For TUNEL staining (Promega; product No. G3250; batch No. 0000215719), cells were washed three times in PBS and immersed in TUNEL equilibration buffer for 10 min. The TUNEL reaction mixture was prepared according to the manufacturer's protocol and 100. mu.L/coverslip of the TUNEL reaction mixture was added to the cells and held at 37 ℃ for 1 hour. The reaction was stopped by incubation in 1X Standard Citrate Solution (SCS) for 15 minutes. Nuclei were counterstained with 1. mu.g/mL DAPI (Thermo Scientific; product No. D1306, 1: 8000). Cells were washed three additional times and then with fluorosaveTMReagents (Calbiochem/EMD Chemicals inc., Gibbstown, NJ, USA) were fixed before imaging. Imaging was performed using a 20X objective and a Leica DM6000 epifluorescence microscope (Leica Microsystems, Wetzlar, germany).
BDNF measurement by ELISA
24 hours after transfection, the amount of BDNF secreted from HEK293 cells was measured in cell culture medium. The medium was centrifuged to remove debris and measured using a commercially available human BDNF ELISA kit (Sigma-Aldrich, product number RAB 0026). BDNF concentration was determined by comparing the samples to a freshly prepared BDNF standard.
Western blot of BDNF and TrkB receptors
The amount of BDNF and TrkB immunoreactivity in HEK293 cells was measured by: DMEM incubation medium was removed, cells were washed in cold phosphate buffered saline and 350. mu.L of freshly prepared Lysis buffer (10ml Lysis-M reagent +1 plate of complete Mini Protease inhibitor cocktail, Roche; Cat. No. 04719964001, + 100. mu.l of a stophosphate inhibitor cocktail (100X), Thermo Scientific; Cat. No. 78428) was added to each well. After cell homogenization, protein suspensions were quantified using the BCA assay (Pierce BCA protein assay kit, Thermo Scientific; Cat. No. 23227). Between 6 and 15 μ g of HEK293 cell lysate protein/lane was electrophoresed along Bis-Tris gel (12% NuPAGE Novex; catalog No. NPo342BOX, Thermo Scientific) and examined by Western blotting overnight using rabbit polyclonal anti-BDNF primary antibody (Santa Cruz Biotechnology Inc; product No. sc-546; diluted 1:500), rabbit polyclonal anti-TrkB primary antibody (Abeam; catalog No. ab33655, used at a dilution of 1: 2000) or eGFP antibody (Abeam product No. ab-290, used at 1: 500). Primary antibodies were visualized using HRP-conjugated anti-rabbit antibodies (Vector Laboratories; catalog number PI-1000, 1:8000) and signal detection using ECL Prime (Amersham, GE Healthcare, UK) and Alliance Western blot imaging System (UVTtec Ltd, Cambridge, UK). For western blotting of mouse retinas, eyes from vehicle-treated animals were homogenized in 500 μ L of freshly prepared Lysis buffer (10ml Lysis-M reagent +1 intact mini protease inhibitor cocktail, Roche product No. 04719964001+100 μ L stop phosphatase inhibitor cocktail (100X), Thermo Scientific product No. 78428). The tissue was disrupted for 1 minute (Qiagen, tissue Ruptor product No. 9001273) and then kept on ice for an additional 15 minutes. The proteins were then analyzed by western blotting as described above.
Immunocytochemistry analysis (Immunocytochemistry)
HEK293 cells (70,000) were seeded on poly-L-lysine coated 13mm coverslips in 4-well plates and incubated with 0.5ml of medium in DMEM containing 10% FBS and 1% Pen/Strep. Once the cells were grown to 80% confluence, the medium was changed to 0.4mL DMEM (without additives) for 2-3 hours, then another 0.1mL transfection medium (0.8. mu.g
For immunocytochemical analysis of retinal structures and optic nerves from control or vehicle-treated animals (between 3 or 4 weeks post-injection), carefully dissected eyes were fixed overnight in 4% paraformaldehyde/0.1% PBS (pH 7.4) and dehydrated in 30% sucrose/0.1% PBS at 4 ℃ (24 hours). The eye is then embedded in a solution containing an optimal cutting temperature compound (OCT) (Sak)ura Finetek, Zoeterwoude, the netherlands) and frozen on dry ice. Using a
Intravitreal injection
After an adaptation period of 7-10 days, 12-week-old C57/BL.6 or 16-week-old P301S (Harlan labs, Bicester, U.K.) mice were randomized to each study group. They were then anesthetized by intraperitoneal injection of ketamine (50mg/kg) and xylazine (5 g/kg). Topical 1% tetracaine eye drops were administered on
Optic nerve clamp injury (ONC)
Three weeks (21 days) after vehicle administration, mice were subjected to the ONC procedure, either no treatment or sham-cured. In the context of binocular surgery, spring scissors (spring sciensors) are used to create small incisions in the conjunctiva from beneath the eyeball (globe) and around the eye temporarily. This exposes the posterior side of the eyeball, thereby visualizing the optic nerve. Exposed optic nerves were clamped with a bite-block (Dumont No. N7, catalog No. RS-5027; Roboz) about 1-3mm from the eye for 10s, using only pressure from the self-clamping (self-clamping) action to press on the nerves. After 10s the optic nerve was released and the forceps removed and the eye rotated back into place. 7 days after ONC, animals were culled and sacrificed (culled). Both eyes from each group were fixed by the following method: organs were placed in 4% paraformaldehyde/0.1% PBS (pH 7.4) overnight. Then, after the posterior ocular structures were cut from the cornea and the lens was removed, flat-mounts (retinas) were prepared. The retinal plain sections were post-fixed in 4% paraformaldehyde/0.1% PBS for 30 min, then washed in 0.5% Triton X-100 in PBS. The retinas were frozen at-80 ℃ for 10 min to penetrate nuclear membranes and improve antibody penetration, and then blocked in 10% Normal Donkey Serum (NDS), 2% Bovine Serum Albumin (BSA), and 2% Triton X-100 in PBS for 60 min at room temperature. RGCs were counterstained with anti-Brn 3A antibody (1:200Santa Cruz, accession number sc-31984) and visualized under a fluorescent microscope using a 20X objective and a Leica DM6000 epifluorescent microscope (Leica Microsystems, Wetzlar, Germany). Using a Leica SP5 equipped with a 40X oil objectiveFocusing microscopes (Leica Microsystems) obtain higher resolution images using 1.5X digital zoom and 0.5-0.8 sequential scanning of the z-steps. RGC cell counts were measured by ImageJ using an image-based tool insert for nuclear counting (ITCN) and are expressed as RGC/mm2The density of (c).
Constructs and vectors
The inventors of the present invention have generated a genetic construct as shown in figure 1 which can be used to treat a subject suffering from an optic neuropathy, such as glaucoma, or a cochlear condition, or to promote nerve regeneration and/or survival. The constructs are designed to maintain or increase the density of TrkB receptors on the cell surface of RGCs and to maintain or increase signaling through the TrkB receptor pathway through the concomitant production and local release of mBDNF.
The construct comprises a transgene encoding the TrkB receptor and its agonist mature brain-derived neurotrophic factor. These transgenes are operably linked to a single promoter, which is a human synapsin i (syn i) promoter or a CAG promoter. Advantageously, the construct of fig. 1 can be placed in a rAAV2 vector without being hindered by the size of the transgene it encodes. This is because the construct is oriented such that the first transgenic TrkB is linked to the viral 2A peptide sequence, followed by the BDNF signal peptide, and then the mature protein. This orientation also minimizes the risk of immunogenicity, as the short N-terminal amino acid sequence of the viral 2A peptide remains attached to the intracellular portion of the TrkB receptor, while the residual proline amino acid from the C-terminal viral 2A sequence remains attached to the N-terminal BDNF signal peptide and is eventually removed from the mBDNF protein after cleavage. The carrier may be placed in a pharmacologically acceptable buffer solution that can be administered to a subject.
Fig. 2-5 illustrate various embodiments of expression vectors. FIG. 2 shows a vector called "plasmid QTA001 PA" which contains the classical signal sequence (blue) (i.e. MTILFLTMVISYFGCMKA [ SEQ ID NO:20]) plus proBDNF (red) and mBDNF (black). Figure 3 shows a vector called "plasmid QTA 002P". This vector does not encode proBDNF, but only mBDNF is produced, and encodes the same signal sequence as QTA001PA (blue). Figure 4 shows a vector called "plasmid QTA 003P", which also does not encode proBDNF, but only produces mBDNF. Instead of the classical signal sequence of mBDNF, the vector contains the IL-2 signal sequence (blue). Finally, figure 5 shows the vector called "plasmid QTA 004P". The vector does not encode proBDNF, but instead produces only mBDNF. The vector also encodes a novel signal sequence (blue) [ SEQ ID NO:32 ].
The inventors of the present invention have prepared and studied constructs and vectors related to the concept of glaucoma gene therapy starting from the mature bdnf (mbdnf) element. They have clearly demonstrated that mBDNF is produced and released from HEK293 cells (see fig. 7) following lipofection of amine transduction with a plasmid containing the BDNF sequence without the proBDNF coding region (QTA002P, see fig. 3). The mBDNF released from the cells was the predicted 14kDa monomer (measured using western blotting and commercially available anti-BDNF antibodies), and there was no evidence of protein aggregation, as has been reported by some groups that attempted to produce commercial quantities of mBDNF using yeast and other cell-based manufacturing methods1. Thus, mBDNF is released in a form that allows the protein molecule to form a non-covalent dimer in order to activate the TrkB receptor.
By using ELISA against BDNF (which does not distinguish mBDNF from the more extended proBDNF protein), the inventors of the present invention have also demonstrated that the following is feasible: following lipofection of the cells with plasmids containing the BDNF gene, the DNA sequence encoding the endogenous classical 18 amino acid signal peptide sequence (MTILFLTMVISYFGCMKA) was replaced with the new peptide sequence (QTA 004P-see fig. 5) and equivalent levels of BDNF were released into HEK293 medium (see fig. 7).
Replacement of the endogenous signal peptide (QTA 003P-see fig. 4) with a sequence encoding an interleukin-2 signal peptide was less effective in releasing BDNF from the medium. The level of BDNF released into the culture medium is currently about 1-2nM, and the concentration of this agonist is sufficient to maximally activate the specific TrkB receptor (IC50 is about 0.9 nM). The BDNF release level was increased about 35 fold (876 ± 87ng/mL BDNF) using plasmid QTA001PA (see fig. 2) containing a combination of proBDNF and mBDNF sequences and further comprising an 18 amino acid canonical signal peptide compared to plasmids QTA002P (see fig. 3) and QTA004P (see fig. 5).
Measurement of the remaining BDNF in the cells by quantitative western blot 24 hours after lipofectamine plasmid transduction showed that the remaining concentration of BDNF was lower using QTA001PA than using QTA002P and QTA004P (see figure 8).
Furthermore, about half of the BDNF immunoreactivity in cell lysates transduced with QTA001PA was in the form of proBDNF (molecular weight band at 32 kDa), whereas the proBDNF band was absent in cell lysates transduced with QTA002P, QTA003P and QTA004P (see fig. 9), probably because these plasmids did not contain the proBDNF extension coding sequence.
By using an ELISA specific for proBDNF, the inventors were able to demonstrate that about 70ng/mL (2.2nM or 3.5%) of BDNF immunoreactivity released from cells transduced with QTA001PA was a proBDNF form, while most (96.5% or 876ng/mL/63nM) were released as mBDNF (see figure 10). proBDNF immunoreactivity was not detected from cells transduced with QTA002P, QTA003P or QTA004P, which QTA002P, QTA003P or QTA004P did not contain a coding sequence for expanding proBDNF.
Thus, it is clear that all plasmids are capable of producing 14kDa mBDNF protein, but the amount of mBDNF released from HEK293 cells depends to a large extent on the efficiency of protein storage and packaging into secretory vesicles. Thus, the expanded form of the protein containing the combination of proBDNF and mBDNF sequences produced with plasmid QTA001PA (fig. 2) was packaged into secretory vesicles and released into the incubation medium much more efficiently than when smaller mBDNF sequences were used, which appeared to accumulate within the cell.
Referring to figure 11, it is shown that replacing the coding of the endogenous classical signal peptide sequence represented in plasmid QTA002P with the new sequence contained in plasmids QTA009P to QTA013P increased the BDNF concentration in HEK293 cells 24 hours after transduction with the plasmid. Figure 12 shows that replacement of the endogenous classical signal peptide coding sequence contained in plasmid QTA002P with the new sequence (plasmid QTA009P to QTA013P) increased the release of BDNF from HEK293 cells (as measured by ELISA), as measured 24 hours after transduction with the plasmid.
As shown in fig. 13, the addition of the virus-2A peptide sequence resulted in efficient processing of the coding sequence of the large precursor protein into two transgenic eGFP and BDNF. Western blot shows HEK293 cells 24 hours after transduction of HEK293 cells with the following plasmids: (i) QTA015P (expressing BDNF and eGFP separated by IRES spacer); (ii) QTA021P (expressing BDNF followed by eGFP, which are separated by a functional viral-2A peptide sequence); (iii) QTA022P (expressing BDNF followed by eGFP, separated by a non-functional viral-2A peptide sequence); and (iv) QTA023P (expressing eGFP followed by encoding BDNF, which are separated by a functional viral-2A peptide sequence).
The coding sequence of QTA021P (a plasmid containing the codon-optimized sequence for mBDNF-virus-2A peptide-eGFP) is referred to herein as SEQ ID No:104, as shown below:
ATGACTATCCTGTTTCTGACAATGGTTATTAGCTATTTCGGTTGCATGAAGGCTCACAGTGATCCCGCACGCCGCGGAGAACTTAGCGTGTGCGACAGCATCAGCGAGTGGGTCACCGCCGCCGATAAGAAGACCGCTGTGGATATGTCCGGCGGGACCGTCACTGTACTCGAAAAAGTTCCAGTGAGCAAAGGCCAACTGAAACAATATTTCTATGAAACTAAGTGCAACCCCATGGGGTACACCAAGGAGGGCTGCCGGGGAATCGACAAGAGACACTGGAATTCCCAGTGCCGGACCACTCAGAGCTACGTCCGCGCCTTGACGATGGATTCAAAGAAGCGCATCGGATGGCGGTTCATAAGAATCGACACCAGTTGTGTGTGCACGCTGACGATAAAACGGGGGCGGGCCCCCGTGAAGCAGACCCTGAACTTTGATTTGCTCAAGTTGGCGGGGGATGTGGAAAGCAATCCCGGGCCAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTTGTGCCAATACTGGTTGAGTTGGATGGCGATGTCAACGGACACAAATTTAGCGTAAGCGGGGAGGGAGAGGGCGACGCCACATATGGCAAGCTGACCCTGAAGTTCATTTGCACGACCGGCAAATTGCCCGTCCCTTGGCCCACACTTGTGACGACCCTGACTTATGGCGTACAGTGCTTCAGCAGGTACCCTGATCATATGAAGCAACACGACTTCTTTAAGAGTGCCATGCCAGAGGGATACGTCCAGGAAAGAACCATATTCTTCAAAGATGATGGAAATTACAAAACCCGGGCAGAGGTCAAGTTTGAAGGCGACACCCTGGTGAACAGGATCGAACTCAAAGGCATCGATTTCAAAGAGGACGGAAACATCCTCGGACACAAACTGGAATACAATTACAACAGCCACAACGTCTACATCATGGCAGATAAACAAAAGAACGGTATTAAAGTGAACTTCAAGATCCGGCACAACATCGAAGACGGCTCCGTCCAGCTTGCCGACCACTACCAGCAAAATACCCCGATCGGCGACGGCCCCGTTCTCCTCCCCGATAATCACTACCTGAGTACACAGTCAGCCTTGAGCAAAGACCCTAATGAAAAGCGGGACCACATGGTTTTGCTGGAGTTCGTTACCGCAGCGGGTATTACGCTGGGTATGGACGAGCTTTACAAGTAA
[SEQ ID No:104]
the coding sequence of QTA022P (a plasmid containing the codon optimized sequence for mBDNF-non-functional virus-2A peptide-eGFP) is referred to herein as SEQ ID No:105, as shown below: ATGACTATCCTGTTTCTGACAATGGTTATTAGCTATTTCGGTTGCATGAAGGCTCACAGTGATCCCGCACGCCGCGGAGAACTTAGCGTGTGCGACAGCATCAGCGAGTGGGTCACCGCCGCCGATAAGAAGACCGCTGTGGATATGTCCGGCGGGACCGTCACTGTACTCGAAAAAGTTCCAGTGAGCAAAGGCCAACTGAAACAATATTTCTATGAAACTAAGTGCAACCCCATGGGGTACACCAAGGAGGGCTGCCGGGGAATCGACAAGAGACACTGGAATTCCCAGTGCCGGACCACTCAGAGCTACGTCCGCGCCTTGACGATGGATTCAAAGAAGCGCATCGGATGGCGGTTCATAAGAATCGACACCAGTTGTGTGTGCACGCTGACGATAAAACGGGGGCGGGCCCCTGTCAAACAAACCCTCAATTTTGACTTGCTGAAGCTTGCTGGGGATGTCGAGTCCGCTGCCGCGGCTATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTTGTGCCAATACTGGTTGAGTTGGATGGCGATGTCAACGGACACAAATTTAGCGTAAGCGGGGAGGGAGAGGGCGACGCCACATATGGCAAGCTGACCCTGAAGTTCATTTGCACGACCGGCAAATTGCCCGTCCCTTGGCCCACACTTGTGACGACCCTGACTTATGGCGTACAGTGCTTCAGCAGGTACCCTGATCATATGAAGCAACACGACTTCTTTAAGAGTGCCATGCCAGAGGGATACGTCCAGGAAAGAACCATATTCTTCAAAGATGATGGAAATTACAAAACCCGGGCAGAGGTCAAGTTTGAAGGCGACACCCTGGTGAACAGGATCGAACTCAAAGGCATCGATTTCAAAGAGGACGGAAACATCCTCGGACACAAACTGGAATACAATTACAACAGCCACAACGTCTACATCATGGCAGATAAACAAAAGAACGGTATTAAAGTGAACTTCAAGATCCGGCACAACATCGAAGACGGCTCCGTCCAGCTTGCCGACCACTACCAGCAAAATACCCCGATCGGCGACGGCCCCGTTCTCCTCCCCGATAATCACTACCTGAGTACACAGTCAGCCTTGAGCAAAGACCCTAATGAAAAGCGGGACCACATGGTTTTGCTGGAGTTCGTTACCGCAGCGGGTATTACGCTGGGTATGGACGAGCTTTACAAGTAA
[SEQ ID No:105]
The coding sequence of QTA023P (plasmid containing the codon optimized sequence for eGFP-virus-2A peptide-mBDNF) is referred to herein as SEQ ID No:106, as shown below:
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGCTCCCGTTAAACAAACTCTGAACTTCGACCTGCTGAAGCTGGCTGGAGACGTGGAGTCCAACCCTGGACCTATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCGGTTGCATGAAGGCGCACTCCGACCCTGCCCGCCGTGGGGAGCTGAGCGTGTGTGACAGTATTAGCGAGTGGGTCACAGCGGCAGATAAAAAGACTGCAGTGGACATGTCTGGCGGGACGGTCACAGTCCTAGAGAAAGTCCCGGTATCCAAAGGCCAACTGAAGCAGTATTTCTACGAGACCAAGTGTAATCCCATGGGTTACACCAAGGAAGGCTGCAGGGGCATAGACAAAAGGCACTGGAACTCGCAATGCCGAACTACCCAATCGTATGTTCGGGCCCTTACTATGGATAGCAAAAAGAGAATTGGCTGGCGATTCATAAGGATAGACACTTCCTGTGTATGTACACTGACCATTAAAAGGGGAAGATAG
[SEQ ID No:106]
referring to fig. 14A, a western blot of HEK293 cell homogenate 48 hours after transfection with the QTA020V vector is shown. It shows efficient processing of the large precursor coding region, which includes the TrkB receptor and BDNF separated by a viral 2A-peptide sequence. The two TrkB and mBDNF immunoreactive transgenes were within the predicted correct molecular weight size. It should be noted that there was no staining of the large precursor protein above the TrkB receptor band, indicating nearly complete or complete processing of the precursor protein in five repeats. Fig. 14B and 14C show that after processing, the transgenic proteins produced after viral-2A peptide cleavage have been transported to the correct intracellular compartment in HEK293 cells (TrkB receptor is transported to the cell surface and BDNF is transported to storage vesicles before release).
Figure 15 shows that the addition of a viral-2A peptide sequence separating the two coding regions of TrkB receptor and BDNF resulted in efficient processing into two transgenes in the mouse retina after intravitreal injection of rAAV2 vector QTA 020V.
Figure 16 shows the expression of the transgene in the mouse retinal ganglion cell layer as shown by immunocytochemistry after injection of QTA020V, which is a rAAV2 vector containing the TrkB receptor and BDNF codes separated by a viral-2A peptide sequence. The target retinal ganglion cell bodies were stained red by anti-Brn 3A antibody and the nuclei were counterstained blue by DAPI to distinguish between retinal layers.
Referring to FIG. 17, it is shown that in control animals and mice treated with rAAV2-CAG-eGFP vector, injection via intravitreal injection (2. mu.l of
Neuroprotective Effect of constructs
Referring to fig. 18, expression of BDNF transgene (see fig. 18A) and TrkB transgene ((see fig. 18B)) in undifferentiated human SH-SY5Y neuroblastoma cell homogenate by western blotting after transfection with a rAAV2 viral vector not expressing the transgene (Null virus), a rAAV2 viral vector expressing only BDNF (QTA027V), a rAAV2 viral vector expressing only TrkB (QTA025V), and a rAAV2 viral vector expressing both BDNF and TrkB (QTA020V) is shown.
Referring to fig. 18C, the level of activated phosphorylated TrkB receptor in SH-SY5Y cells in western blots after transfection with viral vectors Null, QTA020V, QTA025V or QTA027V is shown. It was found that only the QTA020V vector expressing both BDNF and TrkB significantly increased TrkB receptor activation compared to untransfected cells. Thus, it has been shown that the constructs of the invention efficiently express both transgenes and result in activated phosphorylated TrkB receptors in neuroblastoma SH-SY5Y cells, indicating the ability to treat neurodegenerative disorders (such as alzheimer's disease) or stroke.
Referring to FIG. 19, there is shown exposure to hydrogen peroxide (0.1mM or 1.0mM H)2O2) The level of apoptotic cell death of undifferentiated neuroblastoma SH-SY5Y cells in culture was measured by TUNEL staining following the oxidative stress generated. It was surprisingly found that cells transfected with rAAV2 vector QTA020V expressing both BDNF and TrkB receptors prior to addition of hydrogen peroxide significantly protected against apoptosis compared to untreated cells. Again, these data support the notion that the constructs of the invention can be used to treat, prevent or ameliorate neurodegenerative disorders or stroke.
Referring now to fig. 20, representative immunocytochemical images of optic nerves obtained from P301S mutant human Tau transgenic mice and stained with antibodies recognizing phosphorylated Tau AT positions serine 396/serine 404(PHF-1) or serine 202/serine 205(AT8) are shown.
P301S transgenic mice developed neuronal loss and brain atrophy primarily in the hippocampus over eight months, but spread to other brain regions, including the neocortex and entorhinal cortex. They develop extensive neurofibrillary tangle-like inclusions (inclusions) in the neocortex, amygdala, hippocampus, brainstem and spinal cord. Tangle pathology was accompanied by microglial and astrocytic hyperplasia, but no amyloid plaques [56,57,58 ].
Mice were treated by intravitreal injection of QTA020V, which QTA020V expresses TrkB receptor and BDNF in target retinal ganglion cells and their axons. The images in FIG. 20 demonstrate that the degree of Tau hyperphosphorylation is significantly reduced in the axons constituting the optic nerve by using PHF-1 and AT-8. These in vivo data indicate that increasing expression of TrkB and BDNF using the constructs of the invention can significantly reduce Tau phosphorylation in neurons, which is one of the pathophysiological features associated with alzheimer's brain.
Conclusion
It will be appreciated that for Alzheimer's disease there is no single preclinical model which is generally considered as a surrogate for the disease and in which the degree of predictability of gene therapy for clinical outcome can be tested however, there are animal models available in which modification of their genome has led to the introduction into rodents of one of the defined genetic/neurochemical or biochemical changes which have been identified in humans with the disease these changes include overproduction of A β and plaque formation [59], generation of hyperphosphorylated tau proteins in neuronal cell bodies and axons thought to mediate axonal transport [60], and reduction of both BDNF and its cognate receptor TrkB [11-14,27]
Thus, the presence of neuronal fibrillar tangles associated with hyperphosphorylated tau and loss of BDNF signaling in the widely described postmortem changes in human brain diagnosed with Alzheimer's disease are the only untested approaches to restore or slow down pathophysiological changes associated with this neurological condition, based on human postmortem tissue and the ability to successfully remove β -amyloid from two experimental animals by blocking the BACE-1 enzyme responsible for β -amyloid production (verubestat; Merck) or by antibody neutralization (e.g., solelezumab; Eli Lilly and bapineuzumab; Pfizer/J & J).
Through significant inventive efforts, the inventors of the present invention have solved the problem of overcoming the loss of BDNF signaling using novel constructs capable of simultaneously expressing and upregulating both TrkB receptor and BDNF, both of which are reported to be reduced in the disease (see references cited above).
Due to the short half-life of BDNF, regular administration of recombinant BDNF, which may require several injections into the brain per day or by continuous infusion, is not clinically feasible and may be associated with TrkB receptor down-regulation. Furthermore, the inventors of the present invention have also demonstrated in fig. 18C that in SHSY-5Y cells rAAV2 expressing only the TrkB receptor is insufficient to significantly increase the activity of the receptor, such as by active p-Y515-level of TrkB staining. The constructs of the invention are particularly usefulDesigned to accommodate the large coding sequences of both TrkB receptor and BDNF by a number of inventive steps including: (i) deletion of the Pro-BDBF coding, (ii) introduction of new signal peptides to overcome the problems associated with intracellular transport of BDNF and normal protein folding due to lack of an important Pro-BDNF sequence, (iii) construction of a single transgene containing a viral-2A peptide sequence that facilitates translational "hopping" between TrkB and BDNF sequence ribosome production, and (iv) finally short WPRE and polyA sequences. Thus, the inventors provide evidence that the new constructs expressing both transgenes (i.e. BDNF and its cognate receptor BDNF) are far superior to upregulating the TrkB receptor alone. The inventors have also demonstrated that, as has been demonstrated previously, novel gene therapy constructs are capable of providing optimal activity [56]Without the need for additional (regular) BDNF injections.
The main objective of the inventors was to develop a gene therapy capable of addressing low levels of BDNF/TrkB signaling, as clearly demonstrated by the examples provided. Unexpectedly, this novel gene therapy construct was able to greatly reduce the density of over-phosphorylated Tau protein (measured using two antibodies that recognize several phosphorylated serine residues along the length of Tau protein), as shown in figure 20. Tau is a ubiquitous protein found in the brain and other neural tissues, such as the optic nerve. By using the optic nerve as a model system, it was found that an increase in BDNF signaling in the eye would decrease the proposed pathological level of this protein isoform. Thus, the ability to upregulate BDNF/TrkB signaling in P301S transgenic mouse strains and observe such a large reduction in the density of phosphorylated Tau was not expected.
Reference to the literature
1.Brookmeyer R,Johnson E,Ziegler-Graham K,Arrighi HM.Forecasting theglobal burden of Alzheimer's disease(2007).Alzheimers.Dement.,vol.3(3)PP:186–191.
2.Braak H,Braak E.(1991).Neuropathological stageing of Alzheimer-related changes.Acta Neuropathol.,vol.82(4),PP:239–259.
3.Dekosky ST,Scheff SW.(1990).Synapse loss in frontal cortex biopsiesin Alzheimer's disease:correlation with cognitive severity.Ann.Neurol.,vol.27(5),PP:457–464.
4.Chao MV(2003).Neurotrophins and their receptors:A convergence pointfor many signalling pathways.Nature Rev.Neurosci.vol.4,PP:299-309.
5.Dawbarn D,Allen SJ,(2003).Neurotrophins and neurodegeneration.Neuropathol.Appl.Neurobiol.,vol.29,PP:211-230.
6.Phillips HS,Hains JM,Laramee GR,Rosenthal A,Winslow JW(1990).Widespread expression of BDNF but not NT3 by target areas of basal forebraincholinergic neurons.Science,vol.250(4978),PP:290–294.
7.Wetmore C,Ernfors P,Persson H,Olson L,(1990).Localization of brain-derived neurotrophic factor mRNA to neurons in the brain by in situhybridization.Exp.Neurol.,vol.109(2),PP:141–152
8.Ghosh A,Carnahan J,Greenberg ME,(1994).Requirement for BDNF inactivity-dependent survival of cortical neurons.Science,vol.263(5153),PP:1618–1623.
9.Phillips HS,Hains JM,Armanini M,Laramee GR,Johnson SA,Winslow JW,(1991).BDNF mRNA is decreased in the hippocampus of individuals withAlzheimer's disease.Neuron,vol.7(5),PP:695–702.
10.Holsinger RM,Schnarr J,Henry P,Castelo VT,Fahnestock M,(2000).Quantitation of BDNF mRNA in human parietal cortex by competitive reversetranscription-polymerase chain reaction:decreased levels in Alzheimer'sdisease.Brain Res.Mol.Brain Res.,vol.76(2),PP:347–354.
11.Narisawa-Saito M,Wakabayashi K,Tsuji S,Takahashi H,Nawa H,(1996).Regional specificity of alterations in NGF,BDNF and NT-3 levels inAlzheimer's disease.Neuroreport,vol.7(18),PP:2925–2928.
12.Connor B,Young D,Yan Q,Faull R L,Synek B,Dragunow M,(1997).Brain-derived neurotrophic factor is reduced in Alzheimer's disease.BrainRes.Mol.Brain Res.,vol.49(1-2),PP:71–81.
13.Ferrer I,Marin C,Rey M J,Ribalta T,Goutan E,Blanco R,Tolosa E,Marti E,(1999).BDNF and full-length and truncated TrkB expression inAlzheimer disease.Implications in therapeutic strategies.J.Neuropathol.Exp.Neurol.,vol.58(7),PP:729–739.
14.Savaskan E,Muller-Spahn F,Olivieri G,Bruttel S,Otten U,RosenbergC,Hulette C,Hock C,(2000).Alterations in trk A,trk B and trk C receptorimmunoreactivities in parietal cortex and cerebellum in Alzheimer'sdisease.Eur.Neurol.,vol.44(3),PP:172–180.
15.Peng S,Wuu J,Mufson E J,Fahnestock M,(2005).Precursor form ofbrain-derived neurotrophic factor and mature brain-derived neurotrophicfactor are decreased in the pre-clinical stages of Alzheimer'sdisease.J.Neurochem.,vol.93(6)PP:1412–1421.
16.Michalski B,Fahnestock M,(2003).Pro-brain-derived neurotrophicfactor is decreased in parietal cortex in Alzheimer's disease.BrainRes.Mol.Brain Res.,vol.111(1-2),PP:148–154.
17.Qin XY,Cao C,Cawley NX,Liu TT,Yuan J,Loh YP,Cheng Y,(2016).Decreased peripheral brain-derived neurotrophic factor levels in Alzheimer’sdisease:A meta-analysis study(N＝7277).Mol.Psychiatry,vol.22,PP:312–320.
18.Forlenza OV,Diniz BS,Teixeira AL,Radanovic M,Talib LL,Rocha NP,Gattaz WF,(2015).Lower Cerebrospinal Fluid Concentration of Brain-DerivedNeurotrophic Factor Predicts Progression from Mild Cognitive Impairment toAlzheimer's Disease.Neuromolecular Med.,vol.17(3),PP:326-332.
19.Feher A,Juhasz A,Rimanoczy A,Kalman J,Janka Z,(2009).Associationbetween BDNF Val66Met polymorphism and Alzheimer disease,dementia with Lewybodies,and Pick disease.Alzheimer Dis.Assoc.Disord.,vol.23(3)PP:224–228.
20.Peng S,Wuu J,Mufson EJ,Fahnestock M,(2005).Precursor form ofbrain-derived neurotrophic factor and mature brain-derived neurotrophicfactor are decreased in the pre-clinical stages of Alzheimer’sdisease.J.Neurochem.,vol.93,PP:1412–1421.
21.Michalski B,Corrada MM,Kawas CH,Fahnestock M,(2015).Brain-derivedneurotrophic factor and TrkB expression in the“oldest-old”,the 90+study:Correlation with cognitive status and levels of soluble amyloid-β.Neurobiol.Aging,vol.36,PP:3130–3139.
22.Elliott E,Atlas R,Lange A,Ginzburg I,(2005).Brain-derivedneurotrophic factor induces a rapid dephosphorylation of tau protein througha PI-3 kinase signalling mechanism.Eur.J.Neurosci.,vol.22,PP:1081–1089.
23.Jiao S-S,Shen L-L,Zhu C,Bu X-L,Liu Y-H,Liu C-H,Yao X-Q,Zhang L-L,Zhou H-D,Walker DG,Tan J,Gortz J,Zhou X-F,Wang Y-J,(2016).Brain-derivedneurotrophic factor protects against tau-related neurodegeneration ofAlzheimer’s disease.Transl.Psychiatry,vol.6,e907.
24.Rosa E,Mahendram S,Ke YD,Ittner LM,Ginsberg SD,Fahnestock M,(2016).Tau downregulates BDNF expression in animal and cellular models ofAlzheimer's disease.Neurobiol.Aging,vol.48,PP:135-142.
25.Lim JY,Reighard CP,Crowther DC,(2015).The pro-domains ofneurotrophins,including BDNF,are linked to Alzheimer’s disease through atoxic synergy with Aβ.Hum.Mol.Genet.,vol.,24(14)PP:3929-3938.
26.Hashimoto R,Hirata Y,Asada T,Yamashita F,Nemoto K,Mori T,MoriguchiY,Kunugi H,Arima K,Ohnishi T,(2009).Effect of the brain-derived neurotrophicfactor and the apolipoprotein E polymorphisms on disease progression inpreclinical Alzheimer's disease.Genes Brain Behav.,vol.8(1)PP:43–52.
27.Allen S J,Wilcock G K,Dawbarn D,(1999).Profound and selective lossof catalytic TrkB immunoreactivity in Alzheimer's disease.Biochem.Biophys.Res.Commun.,vol.264(3)PP:648–651.
28.Kemppainen S,Rantamaki T,Jeronimo-Santos A,Lavasseur G,Autio H,Karpova N,Karkkainen E,Staven S,Vicente Miranda H,Outeiro TF,Diógenes MJ,Laroche S,Davis S,
29.Devi L,Ohno M(2015)TrkB reduction exacerbates Alzheimer’s disease-like signalling aberrations andmemory deficits without affectingβ-amyloidosis in 5XFAD mice.Transl.Psychiatry,vol.5,e562.
30.Tong L,Balazs R,Thornton PL,Cotman CW,(2004).β-Amyloid peptide atsublethal concentrations downregulates brain-derived neurotrophic factorfunctions in cultured cortical neurons.J.Neurosci.,vol.24,PP:6799–6809.
31.Liu XH,Geng Z,Yan J,Li T,Chen Q,Zhang QY,Chen ZY,(2015).BlockingGSK3β-mediated dynamin1 phosphorylation enhances BDNF-dependent TrkBendocytosis and the protective effects of BDNF in neuronal and mouse modelsof Alzheimer’s disease.Neurobiol.Dis.,vol.74,PP:377–391.
32.Poon WW,Blurton-Jones M,Tu CH,Feinberg LM,Chabrier MA,Harris JW,Jeon NL,Cotman CW,(2011).β-amyloid impairs axonal BDNF retrogradetrafficking.Neurobiol.Aging,vol.32,PP:821–833.
33.Gong B,Cao Z,Zheng P,Vitolo OV,Liu S,Staniszewski A,Moolman D,Zhang H,Shelanski M,Arancio O,(2006).Ubiquitin hydrolase Uch-L1 rescuesβ-amyloid-induced decreases in synaptic function and contextual memory.Cell,vol.126,PP:775–788.
34.Gan KJ,Silverman MA,(2015).Dendritic and axonal mechanisms of Ca2+elevation impair BDNF transport in aβoligomer-treated hippocampalneurons.Mol.Biol.Cell,vol.26,PP:1058–1071.
35.Zhang L,Fang Y,Lian Y,Chen Y,Wu T,Zheng Y,Zong H,Sun L,Zhang R,Wang Z,Xu Y,(2015).Brain-derived neurotrophic factor ameliorates learningdeficits in a rat model of Alzheimer's disease induced by aβ1-42.,PLoS One,vol.10(4),e0122415.
36.Wu Y,Luo X,Liu X,Liu D,Wang X,Guo Z,Zhu L,Tian Q,Yang X,Wang JZ,(2015).Intraperitoneal Administration of a Novel TAT-BDNFPeptide AmelioratesCognitive Impairments via Modulating Multiple Pathways in Two Alzheimer'sRodent Models.Sci.Rep.,vol.5,PP:15032.
37.Nagahara AH,Merrill DA,Coppola G,Tsukada S,Schroeder BE,Shaked GM,Wang L,Blesch A,Kim A,Conner JM,Rockenstein E,Chao MV,Koo EH,Geschwind D,Masliah E,Chiba AA,Tuszynski MH,(2009).Neuroprotective effects of brain-derived neurotrophic factor in rodent and primate models of Alzheimer’sdisease.Nat.Med.,vol.15(3),PP:331-337.
38.Mey J,Thanos S,(1993).Intravitreal injections of neurotrophicfactors support the survival of axotomized retinal ganglion cells in adultrats in vivo.Brain Res.,vol.602,PP:304-317.
39.Mansour-Rabaey S,Clarke DB,Wang Y-C,Bray GM,Aguayo AJ,(1994).Effects of ocular injury and administration of brain-derived neurotrophicfactor on survival and regrowth of axotomized retinal ganglioncells.Proc.Natl.Acad.Sci.USA.,vol.91,PP:1632-1636.
40.Peinado-Ramon P,Salvador M,
41.Di Polo A,Aigner LJ,Dunn RJ,Bray GM,Aguayo AJ,(1998).Prolongeddelivery of brain-derived neurotrophic factor by adenovirus-infected Müllercells temporarily rescues injured retinal ganglioncells.Proc.Natl.Acad.Sci.USA.,vol.95,PP:3978-3983.
42.Klocker N,Kermer P,Weishaupt JH,Labes M,Ankerhold R,(2000).Brain-derived neurotrophic factor-mediated neuroprotection of adultrat retinal ganglion cells in vivo does not exclusively depend onphosphatidyl-inositol-3'-kinase/protein kinase B signaling.J.Neurosci.,vol.20,PP:6962-6967.
43.Ko ML,Hu DN,Ritch R,Sharma SC,Chen CF,(2001).Patterns of retinalganglion cell survival after brain-derived neurotrophic factor administrationin hypertensive eyes of rats.Neurosci.Lett.,vol.305,PP:139-142.
44.Chen H,Weber AJ,(2001).BDNF enhances retinal ganglion cellsurvival in cats with optic nerve damage.Invest Ophthamol.Vis.Sci.,vol.42,PP:966-974.
45.Pórez MTR,Caminos E,(1995).Expression of brain-derivedneurotrophic factor and its functional receptor in neonatal and adult ratretina.Neurosci.Lett.,vol.183,PP:96-99.
46.Vecino E,Ugarte M,Nash MS,Osborne NN.(1999).NMDA induces BDNFexpression in the albino rat retina in vivo.Neuroreport.,vol.10,PP:1103-1106.
47.Mowla SJ,Farhadi HF,Pareek S,Atwal JK,Morris SJ,Seidah NG,MurphyRA,(2001).Biosynthesis and post-translational processing of the precursor tobrain-derived neurotrophic factor.J.Biol.Chem.,,vol.276,PP:12660-12666.
48.Gupta VK,You Y,Gupta VB,Klistorner A,Graham SL,(2013).TrkBreceptor signalling:Implications in neurodegenerative,psychiatric andproliferative disorders.Int.J.Mol.Sci.,vol.14,PP:10122-10142
49.Teng HK,Teng KK,Lee R,Wright S,Tevar S,Almeida RD,Kermani P,TorkinR,Chen ZY,Lee FS,Kraemer RT,Nykjaer A,Hempstead BL,(2005).ProBDNF inducesneuronal apoptosis via activation of a receptor complex of p75NTR andsortilin.J.Neurosci.,vol.25,PP:5455-5463.
50.Wei Y,Zhang F,Zao J,Jiang X,Lu Q,Gao E,Wand N,(2012).Enhancedprotein expression of proBDNF and proNGF in elevated intraocular pressure-induced rat retinal ischemia.Chin.Med.J.,vol.125,PP:3875-3879.
51.Woo NH,Teng HK,Siao C-J,Chiaruttini C,Pang PT,Milner TA,HempsteadBL,Lu B,(2005).Activation of p75NTRby proBDNF facilitates hippocampal long-term depression.Nature Neurosci.,vol.8,PP:1069-1077.
52.Lebrun-Julien F,Bertrand MJ,De Backer O,Stellwagen D,Morales CR,DiPolo A,Barker PA,(2010).ProNGF induces TNFalpha-dependent death of retinalganglion cells through a p75NTR non-cell-autonomous signalingpathway.Proc.Natl.Acad.Sci.U S A.,vol.107,PP:3817-3822.
53.Quigley HA,McKinnon SJ,Zack DJ,Pease ME,Kerrigan-Baumrind LA,Kerrigan DF,Mitchell RS,(2000).Retrograde axonal transport of BDNF in retinalganglion cells is blocked by acute IOP elevation inrats.Invest.Ophthalmol.Vis.Sci.,vol.41,PP:3460–3466.
54.Pease ME McKinnon SJ,Quigley HA,Kerrigan-Baumrind LA,Zack DJ,(2000).Obstructed axonal transport of BDNF and its receptor TRKB inexperimental glaucoma.Invest.Ophthalmol.Vis.Sci.,vol.41,PP:764-774.
55.Wei Y,Wang N,Lu Q,Zhang N,Zheng D,Li J,(2007).Enhanced proteinexpressions of sortilin and p75NTR in retina of rat following elevatedintraocular pressure-induced retinal ischemia.Neurosci.Lett.,vol.429,PP:169-174.
56.Cheng L,Sapieha P,Kittlerova P,Hauswith WW,Di Polo A,(2002).TrkBgene transfer protects retinal ganglion cells from axotomy-induced death invivo.J.Neurosci.,vol.22(10),PP:3977-3986.
57.YoshiyamaY,Higuchi M,Zhang B,Huang SM,Iwata N,Saido TC,Maeda J,Suhara T,Trojanowski TC,Lee VM,(2007)..Synapse loss and microglial activationprecede tangles in a P301S Tauopathy mouse model.Neuron,vol.53,PP:337-351.
58.Takeuchi H,Iba M,Inoue H,Higuchi M,Takao K,Tsukita K,Karatsu Y,Iwamoto Y,Miyakama T,Suhara T,Trojanowski JQ,Lee VM,Takahashi R,(2011).P301Smutant human Tau transgenic mice manifest early symptoms of human tauopathieswith dementia and altered sensorimotor gating.PLoS One,vol.6(6),e21050.
59.Hardy J,Allsop D,(1991).Amyloid deposition as the central event inthe aetiology of Alzheimer's disease,Trends Pharmacol.Sci.,vol.12(10),PP:383–388.
60.Mudher A,Lovestone S,(2002).Alzheimer's disease-do tauists andbaptists finally shake hands？.Trends Neurosci.,vol.25(1),PP:22–26.
Sequence listing
<110> Quisila Limited
<120> Gene construct for the treatment of neurodegenerative disorders or stroke
<130>83344PCT1
<160>108
<170>PatentIn version 3.5
<210>1
<211>469
<212>DNA
<213>Homo sapiens
<400>1
ctgcagaggg ccctgcgtat gagtgcaagt gggttttagg accaggatga ggcggggtgg 60
gggtgcctac ctgacgaccg accccgaccc actggacaag cacccaaccc ccattcccca 120
aattgcgcat cccctatcag agagggggag gggaaacagg atgcggcgag gcgcgtgcgc 180
actgccagct tcagcaccgc ggacagtgcc ttcgcccccg cctggcggcg cgcgccaccg 240
ccgcctcagc actgaaggcg cgctgacgtc actcgccggt cccccgcaaa ctccccttcc 300
cggccacctt ggtcgcgtcc gcgccgccgc cggcccagcc ggaccgcacc acgcgaggcg 360
cgagataggg gggcacgggc gcgaccatct gcgctgcggc gccggcgact cagcgctgcc 420
tcagtctgcg gtgggcagcg gaggagtcgt gtcgtgcctg agagcgcag 469
<210>2
<211>1733
<212>DNA
<213>Homo sapiens
<400>2
ctcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60
gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120
ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180
ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 240
atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300
cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360
tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc actctcccca 420
tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta ttttgtgcag 480
cgatgggggc gggggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc 540
ggggcggggc gaggcggaga ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt 600
ttccttttat ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc gcgcggcggg 660
cgggagtcgc tgcgcgctgc cttcgccccg tgccccgctc cgccgccgcc tcgcgccgcc 720
cgccccggct ctgactgacc gcgttactcc cacaggtgag cgggcgggac ggcccttctc 780
ctccgggctg taattagcgc ttggtttaat gacggcttgt ttcttttctg tggctgcgtg 840
aaagccttga ggggctccgg gagggccctt tgtgcggggg gagcggctcg gggggtgcgt 900
gcgtgtgtgt gtgcgtgggg agcgccgcgt gcggctccgc gctgcccggc ggctgtgagc 960
gctgcgggcg cggcgcgggg ctttgtgcgc tccgcagtgt gcgcgagggg agcgcggccg 1020
ggggcggtgc cccgcggtgc ggggggggct gcgaggggaa caaaggctgc gtgcggggtg 1080
tgtgcgtggg ggggtgagca gggggtgtgg gcgcgtcggt cgggctgcaa ccccccctgc 1140
acccccctcc ccgagttgct gagcacggcc cggcttcggg tgcggggctc cgtacggggc 1200
gtggcgcggg gctcgccgtg ccgggcgggg ggtggcggca ggtgggggtg ccgggcgggg 1260
cggggccgcc tcgggccggg gagggctcgg gggaggggcg cggcggcccc cggagcgccg 1320
gcggctgtcg aggcgcggcg agccgcagcc attgcctttt atggtaatcg tgcgagaggg 1380
cgcagggact tcctttgtcc caaatctgtg cggagccgaa atctgggagg cgccgccgca 1440
ccccctctag cgggcgcggg gcgaagcggt gcggcgccgg caggaaggaa atgggcgggg 1500
agggccttcg tgcgtcgccg cgccgccgtc cccttctccc tctccagcct cggggctgtc 1560
cgcgggggga cggctgcctt cgggggggac ggggcagggc ggggttcggc ttctggcgtg 1620
tgaccggcgg ctctagagcc tctgctaacc atgttcatgc cttcttcttt ttcctacagc 1680
tcctgggcaa cgtgctggtt attgtgctgt ctcatcattt tggcaaagaa ttg 1733
<210>3
<211>664
<212>DNA
<213>Homo sapiens
<400>3
ctagatctga attcggtacc ctagttatta atagtaatca attacggggt cattagttca 60
tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc 120
gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat 180
agggactttc cattgacgtc aatgggtgga ctatttacgg taaactgccc acttggcagt 240
acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc 300
cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta 360
cgtattagtc atcgctatta ccatggtcga ggtgagcccc acgttctgct tcactctccc 420
catctccccc ccctccccac ccccaatttt gtatttattt attttttaat tattttgtgc 480
agcgatgggg gcgggggggg ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg 540
gcggggcggg gcgaggcgga gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa 600
gtttcctttt atggcgaggc ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg 660
ggcg 664
<210>4
<211>11
<212>PRT
<213>Homo sapiens
<400>4
Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro
1 5 10
<210>5
<211>63
<212>DNA
<213>Homo sapiens
<400>5
ggaagcggag ctactaactt cagcctgctg aaggctggag acgtggagga gaaccctgga 60
cct 63
<210>6
<211>21
<212>PRT
<213>Homo sapiens
<400>6
Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Gln Ala Gly Asp Val Glu
1 5 10 15
Glu Asn Pro Gly Pro
20
<210>7
<211>63
<212>DNA
<213>Homo sapiens
<400>7
agcggagcta ctaacttcag cctgctgaag caggctggag acgtggagga gaaccctgga 60
cct 63
<210>8
<211>21
<212>PRT
<213>Homo sapiens
<400>8
Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu
1 5 10 15
Glu Asn Pro Gly Pro
20
<210>9
<211>822
<212>PRT
<213>Homo sapiens
<400>9
Met Ser Ser Trp Ile Arg Trp His Gly Pro Ala Met Ala Arg Leu Trp
1 5 10 15
Gly Phe Cys Trp Leu Val Val Gly Phe Trp Arg Ala Ala Phe Ala Cys
20 25 30
Pro Thr Ser Cys Lys Cys Ser Ala Ser Arg Ile Trp Cys Ser Asp Pro
35 40 45
Ser Pro Gly Ile Val Ala Phe Pro Arg Leu Glu Pro Asn Ser Val Asp
50 55 60
Pro Glu Asn Ile Thr Glu Ile Phe Ile Ala Asn Gln Lys Arg Leu Glu
65 70 75 80
Ile Ile Asn Glu Asp Asp Val Glu Ala Tyr Val Gly Leu Arg Asn Leu
85 90 95
Thr Ile Val Asp Ser Gly Leu Lys Phe Val Ala His Lys Ala Phe Leu
100 105 110
Lys Asn Ser Asn Leu Gln His Ile Asn Phe Thr Arg Asn Lys Leu Thr
115 120 125
Ser Leu Ser Arg Lys His Phe Arg His Leu Asp Leu Ser Glu Leu Ile
130 135 140
Leu Val Gly Asn Pro Phe Thr Cys Ser Cys Asp Ile Met Trp Ile Lys
145 150 155 160
Thr Leu Gln Glu Ala Lys Ser Ser Pro Asp Thr Gln Asp Leu Tyr Cys
165 170 175
Leu Asn Glu Ser Ser Lys Asn Ile Pro Leu Ala Asn Leu Gln Ile Pro
180 185 190
Asn Cys Gly Leu Pro Ser Ala Asn Leu Ala Ala Pro Asn Leu Thr Val
195 200 205
Glu Glu Gly Lys Ser Ile Thr Leu Ser Cys Ser Val Ala Gly Asp Pro
210 215 220
Val Pro Asn Met Tyr Trp Asp Val Gly Asn Leu Val Ser Lys His Met
225 230 235 240
Asn Glu Thr Ser His Thr Gln Gly Ser Leu Arg Ile Thr Asn Ile Ser
245 250 255
Ser Asp Asp Ser Gly Lys Gln Ile Ser Cys Val Ala Glu Asn Leu Val
260 265 270
Gly Glu Asp Gln Asp Ser Val Asn Leu Thr Val His Phe Ala Pro Thr
275 280 285
Ile Thr Phe Leu Glu Ser Pro Thr Ser Asp His His Trp Cys Ile Pro
290 295 300
Phe Thr Val Lys Gly Asn Pro Lys Pro Ala Leu Gln Trp Phe Tyr Asn
305 310 315 320
Gly Ala Ile Leu Asn Glu Ser Lys Tyr Ile Cys Thr Lys Ile His Val
325 330 335
Thr Asn His Thr Glu Tyr His Gly Cys Leu Gln Leu Asp Asn Pro Thr
340 345 350
His Met Asn Asn Gly Asp Tyr Thr Leu Ile Ala Lys Asn Glu Tyr Gly
355 360 365
Lys Asp Glu Lys Gln Ile Ser Ala His Phe Met Gly Trp Pro Gly Ile
370 375 380
Asp Asp Gly Ala Asn Pro Asn Tyr Pro Asp Val Ile Tyr Glu Asp Tyr
385 390 395 400
Gly Thr Ala Ala Asn Asp Ile Gly Asp Thr Thr Asn Arg Ser Asn Glu
405 410 415
Ile Pro Ser Thr Asp Val Thr Asp Lys Thr Gly Arg Glu His Leu Ser
420 425 430
Val Tyr Ala Val Val Val Ile Ala Ser Val Val Gly Phe Cys Leu Leu
435 440 445
Val Met Leu Phe Leu Leu Lys Leu Ala Arg His Ser Lys Phe Gly Met
450 455 460
Lys Gly Pro Ala Ser Val Ile Ser Asn Asp Asp Asp Ser Ala Ser Pro
465 470 475 480
Leu His His Ile Ser Asn Gly Ser Asn Thr Pro Ser Ser Ser Glu Gly
485 490 495
Gly Pro Asp Ala Val Ile Ile Gly Met Thr Lys Ile Pro Val Ile Glu
500 505 510
Asn Pro Gln Tyr Phe Gly Ile Thr Asn Ser Gln Leu Lys Pro Asp Thr
515 520 525
Phe Val Gln His Ile Lys Arg His Asn Ile Val Leu Lys Arg Glu Leu
530 535 540
Gly Glu Gly Ala Phe Gly Lys Val Phe Leu Ala Glu Cys Tyr Asn Leu
545 550 555 560
Cys Pro Glu Gln Asp Lys Ile Leu Val Ala Val Lys Thr Leu Lys Asp
565 570 575
Ala Ser Asp Asn Ala Arg Lys Asp Phe His Arg Glu Ala Glu Leu Leu
580 585 590
Thr Asn Leu Gln His Glu His Ile Val Lys Phe Tyr Gly Val Cys Val
595 600 605
Glu Gly Asp Pro Leu Ile Met Val Phe Glu Tyr Met Lys His Gly Asp
610 615 620
Leu Asn Lys Phe Leu Arg Ala His Gly Pro Asp Ala Val Leu Met Ala
625 630 635 640
Glu Gly Asn Pro Pro Thr Glu Leu Thr Gln Ser Gln Met Leu His Ile
645 650 655
Ala Gln Gln Ile Ala Ala Gly Met Val Tyr Leu Ala Ser Gln His Phe
660 665 670
Val His Arg Asp Leu Ala Thr Arg Asn Cys Leu Val Gly Glu Asn Leu
675 680 685
Leu Val Lys Ile Gly Asp Phe Gly Met Ser Arg Asp Val Tyr Ser Thr
690 695 700
Asp Tyr Tyr Arg Val Gly Gly His Thr Met Leu Pro Ile Arg Trp Met
705 710 715 720
Pro Pro Glu Ser Ile Met Tyr Arg Lys Phe Thr Thr Glu Ser Asp Val
725 730 735
Trp Ser Leu Gly Val Val Leu Trp Glu Ile Phe Thr Tyr Gly Lys Gln
740 745 750
Pro Trp Tyr Gln Leu Ser Asn Asn Glu Val Ile Glu Cys Ile Thr Gln
755 760 765
Gly Arg Val Leu Gln Arg Pro Arg Thr Cys Pro Gln Glu Val Tyr Glu
770 775 780
Leu Met Leu Gly Cys Trp Gln Arg Glu Pro His Met Arg Lys Asn Ile
785 790 795 800
Lys Gly Ile His Thr Leu Leu Gln Asn Leu Ala Lys Ala Ser Pro Val
805 810 815
Tyr Leu Asp Ile Leu Gly
820
<210>10
<211>2466
<212>DNA
<213>Homo sapiens
<400>10
atgtcgtcct ggataaggtg gcatggaccc gccatggcgc ggctctgggg cttctgctgg 60
ctggttgtgg gcttctggag ggccgctttc gcctgtccca cgtcctgcaa atgcagtgcc 120
tctcggatct ggtgcagcga cccttctcct ggcatcgtgg catttccgag attggagcct 180
aacagtgtag atcctgagaa catcaccgaa attttcatcg caaaccagaa aaggttagaa 240
atcatcaacg aagatgatgt tgaagcttat gtgggactga gaaatctgac aattgtggat 300
tctggattaaaatttgtggc tcataaagca tttctgaaaa acagcaacct gcagcacatc 360
aattttaccc gaaacaaact gacgagtttg tctaggaaac atttccgtca ccttgacttg 420
tctgaactga tcctggtggg caatccattt acatgctcct gtgacattat gtggatcaag 480
actctccaag aggctaaatc cagtccagac actcaggatt tgtactgcct gaatgaaagc 540
agcaagaata ttcccctggc aaacctgcag atacccaatt gtggtttgcc atctgcaaat 600
ctggccgcac ctaacctcac tgtggaggaa ggaaagtcta tcacattatc ctgtagtgtg 660
gcaggtgatc cggttcctaa tatgtattgg gatgttggta acctggtttc caaacatatg 720
aatgaaacaa gccacacaca gggctcctta aggataacta acatttcatc cgatgacagt 780
gggaagcaga tctcttgtgt ggcggaaaat cttgtaggag aagatcaaga ttctgtcaac 840
ctcactgtgc attttgcacc aactatcaca tttctcgaat ctccaacctc agaccaccac 900
tggtgcattc cattcactgt gaaaggcaac cccaaaccag cgcttcagtg gttctataac 960
ggggcaatat tgaatgagtc caaatacatc tgtactaaaa tacatgttac caatcacacg 1020
gagtaccacg gctgcctcca gctggataat cccactcaca tgaacaatgg ggactacact 1080
ctaatagcca agaatgagta tgggaaggat gagaaacaga tttctgctca cttcatgggc 1140
tggcctggaa ttgacgatgg tgcaaaccca aattatcctg atgtaattta tgaagattat 1200
ggaactgcag cgaatgacat cggggacacc acgaacagaa gtaatgaaat cccttccaca 1260
gacgtcactg ataaaaccgg tcgggaacat ctctcggtct atgctgtggt ggtgattgcg 1320
tctgtggtgg gattttgcct tttggtaatg ctgtttctgc ttaagttggc aagacactcc 1380
aagtttggca tgaaaggccc agcctccgtt atcagcaatg atgatgactc tgccagccca 1440
ctccatcaca tctccaatgg gagtaacact ccatcttctt cggaaggtgg cccagatgct 1500
gtcattattg gaatgaccaa gatccctgtc attgaaaatc cccagtactt tggcatcacc 1560
aacagtcagc tcaagccaga cacatttgtt cagcacatca agcgacataa cattgttctg 1620
aaaagggagc taggcgaagg agcctttgga aaagtgttcc tagctgaatg ctataacctc 1680
tgtcctgagc aggacaagat cttggtggca gtgaagaccc tgaaggatgc cagtgacaat 1740
gcacgcaagg acttccaccg tgaggccgag ctcctgacca acctccagca tgagcacatc 1800
gtcaagttct atggcgtctg cgtggagggc gaccccctca tcatggtctt tgagtacatg 1860
aagcatgggg acctcaacaa gttcctcagg gcacacggcc ctgatgccgt gctgatggct 1920
gagggcaacc cgcccacgga actgacgcag tcgcagatgc tgcatatagc ccagcagatc 1980
gccgcgggca tggtctacct ggcgtcccag cacttcgtgc accgcgattt ggccaccagg 2040
aactgcctgg tcggggagaa cttgctggtg aaaatcgggg actttgggat gtcccgggac 2100
gtgtacagca ctgactacta cagggtcggt ggccacacaa tgctgcccat tcgctggatg 2160
cctccagaga gcatcatgta caggaaattc acgacggaaa gcgacgtctg gagcctgggg 2220
gtcgtgttgt gggagatttt cacctatggc aaacagccct ggtaccagct gtcaaacaat 2280
gaggtgatag agtgtatcac tcagggccga gtcctgcagc gaccccgcac gtgcccccag 2340
gaggtgtatg agctgatgct ggggtgctgg cagcgagagc cccacatgag gaagaacatc 2400
aagggcatcc ataccctcct tcagaacttg gccaaggcat ctccggtcta cctggacatt 2460
ctaggc 2466
<210>11
<211>838
<212>PRT
<213>Homo sapiens
<400>11
Met Ser Ser Trp Ile Arg Trp His Gly Pro Ala Met Ala Arg Leu Trp
1 5 10 15
Gly Phe Cys Trp Leu Val Val Gly Phe Trp Arg Ala Ala Phe Ala Cys
20 25 30
Pro Thr Ser Cys Lys Cys Ser Ala Ser Arg Ile Trp Cys Ser Asp Pro
35 40 45
Ser Pro Gly Ile Val Ala Phe Pro Arg Leu Glu Pro Asn Ser Val Asp
50 55 60
Pro Glu Asn Ile Thr Glu Ile Phe Ile Ala Asn Gln Lys Arg Leu Glu
65 70 75 80
Ile Ile Asn Glu Asp Asp Val Glu Ala Tyr Val Gly Leu Arg Asn Leu
85 90 95
Thr Ile Val Asp Ser Gly Leu Lys Phe Val Ala His Lys Ala Phe Leu
100 105 110
Lys Asn Ser Asn Leu Gln His Ile Asn Phe Thr Arg Asn Lys Leu Thr
115120 125
Ser Leu Ser Arg Lys His Phe Arg His Leu Asp Leu Ser Glu Leu Ile
130 135 140
Leu Val Gly Asn Pro Phe Thr Cys Ser Cys Asp Ile Met Trp Ile Lys
145 150 155 160
Thr Leu Gln Glu Ala Lys Ser Ser Pro Asp Thr Gln Asp Leu Tyr Cys
165 170 175
Leu Asn Glu Ser Ser Lys Asn Ile Pro Leu Ala Asn Leu Gln Ile Pro
180 185 190
Asn Cys Gly Leu Pro Ser Ala Asn Leu Ala Ala Pro Asn Leu Thr Val
195 200 205
Glu Glu Gly Lys Ser Ile Thr Leu Ser Cys Ser Val Ala Gly Asp Pro
210 215 220
Val Pro Asn Met Tyr Trp Asp Val Gly Asn Leu Val Ser Lys His Met
225 230 235 240
Asn Glu Thr Ser His Thr Gln Gly Ser Leu Arg Ile Thr Asn Ile Ser
245 250 255
Ser Asp Asp Ser Gly Lys Gln Ile Ser Cys Val Ala Glu Asn Leu Val
260 265 270
Gly Glu Asp Gln Asp Ser Val Asn Leu Thr Val His Phe Ala Pro Thr
275 280285
Ile Thr Phe Leu Glu Ser Pro Thr Ser Asp His His Trp Cys Ile Pro
290 295 300
Phe Thr Val Lys Gly Asn Pro Lys Pro Ala Leu Gln Trp Phe Tyr Asn
305 310 315 320
Gly Ala Ile Leu Asn Glu Ser Lys Tyr Ile Cys Thr Lys Ile His Val
325 330 335
Thr Asn His Thr Glu Tyr His Gly Cys Leu Gln Leu Asp Asn Pro Thr
340 345 350
His Met Asn Asn Gly Asp Tyr Thr Leu Ile Ala Lys Asn Glu Tyr Gly
355 360 365
Lys Asp Glu Lys Gln Ile Ser Ala His Phe Met Gly Trp Pro Gly Ile
370 375 380
Asp Asp Gly Ala Asn Pro Asn Tyr Pro Asp Val Ile Tyr Glu Asp Tyr
385 390 395 400
Gly Thr Ala Ala Asn Asp Ile Gly Asp Thr Thr Asn Arg Ser Asn Glu
405 410 415
Ile Pro Ser Thr Asp Val Thr Asp Lys Thr Gly Arg Glu His Leu Ser
420 425 430
Val Tyr Ala Val Val Val Ile Ala Ser Val Val Gly Phe Cys Leu Leu
435 440445
Val Met Leu Phe Leu Leu Lys Leu Ala Arg His Ser Lys Phe Gly Met
450 455 460
Lys Asp Phe Ser Trp Phe Gly Phe Gly Lys Val Lys Ser Arg Gln Gly
465 470 475 480
Val Gly Pro Ala Ser Val Ile Ser Asn Asp Asp Asp Ser Ala Ser Pro
485 490 495
Leu His His Ile Ser Asn Gly Ser Asn Thr Pro Ser Ser Ser Glu Gly
500 505 510
Gly Pro Asp Ala Val Ile Ile Gly Met Thr Lys Ile Pro Val Ile Glu
515 520 525
Asn Pro Gln Tyr Phe Gly Ile Thr Asn Ser Gln Leu Lys Pro Asp Thr
530 535 540
Phe Val Gln His Ile Lys Arg His Asn Ile Val Leu Lys Arg Glu Leu
545 550 555 560
Gly Glu Gly Ala Phe Gly Lys Val Phe Leu Ala Glu Cys Tyr Asn Leu
565 570 575
Cys Pro Glu Gln Asp Lys Ile Leu Val Ala Val Lys Thr Leu Lys Asp
580 585 590
Ala Ser Asp Asn Ala Arg Lys Asp Phe His Arg Glu Ala Glu Leu Leu
595 600 605
Thr Asn Leu Gln His Glu His Ile Val Lys Phe Tyr Gly Val Cys Val
610 615 620
Glu Gly Asp Pro Leu Ile Met Val Phe Glu Tyr Met Lys His Gly Asp
625 630 635 640
Leu Asn Lys Phe Leu Arg Ala His Gly Pro Asp Ala Val Leu Met Ala
645 650 655
Glu Gly Asn Pro Pro Thr Glu Leu Thr Gln Ser Gln Met Leu His Ile
660 665 670
Ala Gln Gln Ile Ala Ala Gly Met Val Tyr Leu Ala Ser Gln His Phe
675 680 685
Val His Arg Asp Leu Ala Thr Arg Asn Cys Leu Val Gly Glu Asn Leu
690 695 700
Leu Val Lys Ile Gly Asp Phe Gly Met Ser Arg Asp Val Tyr Ser Thr
705 710 715 720
Asp Tyr Tyr Arg Val Gly Gly His Thr Met Leu Pro Ile Arg Trp Met
725 730 735
Pro Pro Glu Ser Ile Met Tyr Arg Lys Phe Thr Thr Glu Ser Asp Val
740 745 750
Trp Ser Leu Gly Val Val Leu Trp Glu Ile Phe Thr Tyr Gly Lys Gln
755 760 765
Pro Trp Tyr Gln Leu Ser Asn Asn Glu Val Ile Glu Cys Ile Thr Gln
770 775 780
Gly Arg Val Leu Gln Arg Pro Arg Thr Cys Pro Gln Glu Val Tyr Glu
785 790 795 800
Leu Met Leu Gly Cys Trp Gln Arg Glu Pro His Met Arg Lys Asn Ile
805 810 815
Lys Gly Ile His Thr Leu Leu Gln Asn Leu Ala Lys Ala Ser Pro Val
820 825 830
Tyr Leu Asp Ile Leu Gly
835
<210>12
<211>2514
<212>DNA
<213>Homo sapiens
<400>12
atgtcgtcct ggataaggtg gcatggaccc gccatggcgc ggctctgggg cttctgctgg 60
ctggttgtgg gcttctggag ggccgctttc gcctgtccca cgtcctgcaa atgcagtgcc 120
tctcggatct ggtgcagcga cccttctcct ggcatcgtgg catttccgag attggagcct 180
aacagtgtag atcctgagaa catcaccgaa attttcatcg caaaccagaa aaggttagaa 240
atcatcaacg aagatgatgt tgaagcttat gtgggactga gaaatctgac aattgtggat 300
tctggattaa aatttgtggc tcataaagca tttctgaaaa acagcaacct gcagcacatc 360
aattttaccc gaaacaaact gacgagtttg tctaggaaac atttccgtca ccttgacttg 420
tctgaactga tcctggtggg caatccattt acatgctcct gtgacattat gtggatcaag 480
actctccaag aggctaaatc cagtccagac actcaggatt tgtactgcct gaatgaaagc 540
agcaagaata ttcccctggc aaacctgcag atacccaatt gtggtttgcc atctgcaaat 600
ctggccgcac ctaacctcac tgtggaggaa ggaaagtcta tcacattatc ctgtagtgtg 660
gcaggtgatc cggttcctaa tatgtattgg gatgttggta acctggtttc caaacatatg 720
aatgaaacaa gccacacaca gggctcctta aggataacta acatttcatc cgatgacagt 780
gggaagcaga tctcttgtgt ggcggaaaat cttgtaggag aagatcaaga ttctgtcaac 840
ctcactgtgc attttgcacc aactatcaca tttctcgaat ctccaacctc agaccaccac 900
tggtgcattc cattcactgt gaaaggcaac cccaaaccag cgcttcagtg gttctataac 960
ggggcaatat tgaatgagtc caaatacatc tgtactaaaa tacatgttac caatcacacg 1020
gagtaccacg gctgcctcca gctggataat cccactcaca tgaacaatgg ggactacact 1080
ctaatagcca agaatgagta tgggaaggat gagaaacaga tttctgctca cttcatgggc 1140
tggcctggaa ttgacgatgg tgcaaaccca aattatcctg atgtaattta tgaagattat 1200
ggaactgcag cgaatgacat cggggacacc acgaacagaa gtaatgaaat cccttccaca 1260
gacgtcactg ataaaaccgg tcgggaacat ctctcggtct atgctgtggt ggtgattgcg 1320
tctgtggtgg gattttgcct tttggtaatg ctgtttctgc ttaagttggc aagacactcc 1380
aagtttggca tgaaagattt ctcatggttt ggatttggga aagtaaaatc aagacaaggt 1440
gttggcccag cctccgttat cagcaatgat gatgactctg ccagcccact ccatcacatc 1500
tccaatggga gtaacactcc atcttcttcg gaaggtggcc cagatgctgt cattattgga 1560
atgaccaaga tccctgtcat tgaaaatccc cagtactttg gcatcaccaa cagtcagctc 1620
aagccagaca catttgttca gcacatcaag cgacataaca ttgttctgaa aagggagcta 1680
ggcgaaggag cctttggaaa agtgttccta gctgaatgct ataacctctg tcctgagcag 1740
gacaagatct tggtggcagt gaagaccctg aaggatgcca gtgacaatgc acgcaaggac 1800
ttccaccgtg aggccgagct cctgaccaac ctccagcatg agcacatcgt caagttctat 1860
ggcgtctgcg tggagggcga ccccctcatc atggtctttg agtacatgaa gcatggggac 1920
ctcaacaagt tcctcagggc acacggccct gatgccgtgc tgatggctga gggcaacccg 1980
cccacggaac tgacgcagtc gcagatgctg catatagccc agcagatcgc cgcgggcatg 2040
gtctacctgg cgtcccagca cttcgtgcac cgcgatttgg ccaccaggaa ctgcctggtc 2100
ggggagaact tgctggtgaa aatcggggac tttgggatgt cccgggacgt gtacagcact 2160
gactactaca gggtcggtgg ccacacaatg ctgcccattc gctggatgcc tccagagagc 2220
atcatgtaca ggaaattcac gacggaaagc gacgtctgga gcctgggggt cgtgttgtgg 2280
gagattttca cctatggcaa acagccctgg taccagctgt caaacaatga ggtgatagag 2340
tgtatcactc agggccgagt cctgcagcga ccccgcacgt gcccccagga ggtgtatgag 2400
ctgatgctgg ggtgctggca gcgagagccc cacatgagga agaacatcaa gggcatccat 2460
accctccttc agaacttggc caaggcatct ccggtctacc tggacattct aggc 2514
<210>13
<211>822
<212>PRT
<213>Homo sapiens
<400>13
Met Ser Ser Trp Ile Arg Trp His Gly Pro Ala Met Ala Arg Leu Trp
1 5 10 15
Gly Phe Cys Trp Leu Val Val Gly Phe Trp Arg Ala Ala Phe Ala Cys
20 25 30
Pro Thr Ser Cys Lys Cys Ser Ala Ser Arg Ile Trp Cys Ser Asp Pro
35 40 45
Ser Pro Gly Ile Val Ala Phe Pro Arg Leu Glu Pro Asn Ser Val Asp
50 55 60
Pro Glu Asn Ile Thr Glu Ile Phe Ile Ala Asn Gln Lys Arg Leu Glu
65 70 75 80
Ile Ile Asn Glu Asp Asp Val Glu Ala Tyr Val Gly Leu Arg Asn Leu
85 90 95
Thr Ile Val Asp Ser Gly Leu Lys Phe Val Ala His Lys Ala Phe Leu
100 105 110
Lys Asn Ser Asn Leu Gln His Ile Asn Phe Thr Arg Asn Lys Leu Thr
115 120 125
Ser Leu Ser Arg Lys His Phe Arg His Leu Asp Leu Ser Glu Leu Ile
130135 140
Leu Val Gly Asn Pro Phe Thr Cys Ser Cys Asp Ile Met Trp Ile Lys
145 150 155 160
Thr Leu Gln Glu Ala Lys Ser Ser Pro Asp Thr Gln Asp Leu Tyr Cys
165 170 175
Leu Asn Glu Ser Ser Lys Asn Ile Pro Leu Ala Asn Leu Gln Ile Pro
180 185 190
Asn Cys Gly Leu Pro Ser Ala Asn Leu Ala Ala Pro Asn Leu Thr Val
195 200 205
Glu Glu Gly Lys Ser Ile Thr Leu Ser Cys Ser Val Ala Gly Asp Pro
210 215 220
Val Pro Asn Met Tyr Trp Asp Val Gly Asn Leu Val Ser Lys His Met
225 230 235 240
Asn Glu Thr Ser His Thr Gln Gly Ser Leu Arg Ile Thr Asn Ile Ser
245 250 255
Ser Asp Asp Ser Gly Lys Gln Ile Ser Cys Val Ala Glu Asn Leu Val
260 265 270
Gly Glu Asp Gln Asp Ser Val Asn Leu Thr Val His Phe Ala Pro Thr
275 280 285
Ile Thr Phe Leu Glu Ser Pro Thr Ser Asp His His Trp Cys Ile Pro
290295 300
Phe Thr Val Lys Gly Asn Pro Lys Pro Ala Leu Gln Trp Phe Tyr Asn
305 310 315 320
Gly Ala Ile Leu Asn Glu Ser Lys Tyr Ile Cys Thr Lys Ile His Val
325 330 335
Thr Asn His Thr Glu Tyr His Gly Cys Leu Gln Leu Asp Asn Pro Thr
340 345 350
His Met Asn Asn Gly Asp Tyr Thr Leu Ile Ala Lys Asn Glu Tyr Gly
355 360 365
Lys Asp Glu Lys Gln Ile Ser Ala His Phe Met Gly Trp Pro Gly Ile
370 375 380
Asp Asp Gly Ala Asn Pro Asn Tyr Pro Asp Val Ile Tyr Glu Asp Tyr
385 390 395 400
Gly Thr Ala Ala Asn Asp Ile Gly Asp Thr Thr Asn Arg Ser Asn Glu
405 410 415
Ile Pro Ser Thr Asp Val Thr Asp Lys Thr Gly Arg Glu His Leu Ser
420 425 430
Val Tyr Ala Val Val Val Ile Ala Ser Val Val Gly Phe Cys Leu Leu
435 440 445
Val Met Leu Phe Leu Leu Lys Leu Ala Arg His Ser Lys Phe Gly Met
450455 460
Lys Gly Pro Ala Ser Val Ile Ser Asn Asp Asp Asp Ser Ala Ser Pro
465 470 475 480
Leu His His Ile Ser Asn Gly Ser Asn Thr Pro Ser Ser Ser Glu Gly
485 490 495
Gly Pro Asp Ala Val Ile Ile Gly Met Thr Lys Ile Pro Val Ile Glu
500 505 510
Asn Pro Gln Glu Phe Gly Ile Thr Asn Ser Gln Leu Lys Pro Asp Thr
515 520 525
Phe Val Gln His Ile Lys Arg His Asn Ile Val Leu Lys Arg Glu Leu
530 535 540
Gly Glu Gly Ala Phe Gly Lys Val Phe Leu Ala Glu Cys Tyr Asn Leu
545 550 555 560
Cys Pro Glu Gln Asp Lys Ile Leu Val Ala Val Lys Thr Leu Lys Asp
565 570 575
Ala Ser Asp Asn Ala Arg Lys Asp Phe His Arg Glu Ala Glu Leu Leu
580 585 590
Thr Asn Leu Gln His Glu His Ile Val Lys Phe Tyr Gly Val Cys Val
595 600 605
Glu Gly Asp Pro Leu Ile Met Val Phe Glu Tyr Met Lys His Gly Asp
610 615620
Leu Asn Lys Phe Leu Arg Ala His Gly Pro Asp Ala Val Leu Met Ala
625 630 635 640
Glu Gly Asn Pro Pro Thr Glu Leu Thr Gln Ser Gln Met Leu His Ile
645 650 655
Ala Gln Gln Ile Ala Ala Gly Met Val Tyr Leu Ala Ser Gln His Phe
660 665 670
Val His Arg Asp Leu Ala Thr Arg Asn Cys Leu Val Gly Glu Asn Leu
675 680 685
Leu Val Lys Ile Gly Asp Phe Gly Met Ser Arg Asp Val Glu Ser Thr
690 695 700
Asp Glu Glu Arg Val Gly Gly His Thr Met Leu Pro Ile Arg Trp Met
705 710 715 720
Pro Pro Glu Ser Ile Met Tyr Arg Lys Phe Thr Thr Glu Ser Asp Val
725 730 735
Trp Ser Leu Gly Val Val Leu Trp Glu Ile Phe Thr Tyr Gly Lys Gln
740 745 750
Pro Trp Tyr Gln Leu Ser Asn Asn Glu Val Ile Glu Cys Ile Thr Gln
755 760 765
Gly Arg Val Leu Gln Arg Pro Arg Thr Cys Pro Gln Glu Val Tyr Glu
770 775780
Leu Met Leu Gly Cys Trp Gln Arg Glu Pro His Met Arg Lys Asn Ile
785 790 795 800
Lys Gly Ile His Thr Leu Leu Gln Asn Leu Ala Lys Ala Ser Pro Val
805 810 815
Glu Leu Asp Ile Leu Gly
820
<210>14
<211>2466
<212>DNA
<213>Homo sapiens
<400>14
atgtcgtcct ggataaggtg gcatggaccc gccatggcgc ggctctgggg cttctgctgg 60
ctggttgtgg gcttctggag ggccgctttc gcctgtccca cgtcctgcaa atgcagtgcc 120
tctcggatct ggtgcagcga cccttctcct ggcatcgtgg catttccgag attggagcct 180
aacagtgtag atcctgagaa catcaccgaa attttcatcg caaaccagaa aaggttagaa 240
atcatcaacg aagatgatgt tgaagcttat gtgggactga gaaatctgac aattgtggat 300
tctggattaa aatttgtggc tcataaagca tttctgaaaa acagcaacct gcagcacatc 360
aattttaccc gaaacaaact gacgagtttg tctaggaaac atttccgtca ccttgacttg 420
tctgaactga tcctggtggg caatccattt acatgctcct gtgacattat gtggatcaag 480
actctccaag aggctaaatc cagtccagac actcaggatt tgtactgcct gaatgaaagc 540
agcaagaata ttcccctggc aaacctgcag atacccaatt gtggtttgcc atctgcaaat 600
ctggccgcac ctaacctcac tgtggaggaa ggaaagtcta tcacattatc ctgtagtgtg 660
gcaggtgatc cggttcctaa tatgtattgg gatgttggta acctggtttc caaacatatg 720
aatgaaacaa gccacacaca gggctcctta aggataacta acatttcatc cgatgacagt 780
gggaagcaga tctcttgtgt ggcggaaaat cttgtaggag aagatcaaga ttctgtcaac 840
ctcactgtgc attttgcacc aactatcaca tttctcgaat ctccaacctc agaccaccac 900
tggtgcattc cattcactgt gaaaggcaac cccaaaccag cgcttcagtg gttctataac 960
ggggcaatat tgaatgagtc caaatacatc tgtactaaaa tacatgttac caatcacacg 1020
gagtaccacg gctgcctcca gctggataat cccactcaca tgaacaatgg ggactacact 1080
ctaatagcca agaatgagta tgggaaggat gagaaacaga tttctgctca cttcatgggc 1140
tggcctggaa ttgacgatgg tgcaaaccca aattatcctg atgtaattta tgaagattat 1200
ggaactgcag cgaatgacat cggggacacc acgaacagaa gtaatgaaat cccttccaca 1260
gacgtcactg ataaaaccgg tcgggaacat ctctcggtct atgctgtggt ggtgattgcg 1320
tctgtggtgg gattttgcct tttggtaatg ctgtttctgc ttaagttggc aagacactcc 1380
aagtttggca tgaaaggccc agcctccgtt atcagcaatg atgatgactc tgccagccca 1440
ctccatcaca tctccaatgg gagtaacact ccatcttctt cggaaggtgg cccagatgct 1500
gtcattattg gaatgaccaa gatccctgtc attgaaaatc cccaggaatt tggcatcacc 1560
aacagtcagc tcaagccaga cacatttgtt cagcacatca agcgacataa cattgttctg 1620
aaaagggagc taggcgaagg agcctttgga aaagtgttcc tagctgaatg ctataacctc1680
tgtcctgagc aggacaagat cttggtggca gtgaagaccc tgaaggatgc cagtgacaat 1740
gcacgcaagg acttccaccg tgaggccgag ctcctgacca acctccagca tgagcacatc 1800
gtcaagttct atggcgtctg cgtggagggc gaccccctca tcatggtctt tgagtacatg 1860
aagcatgggg acctcaacaa gttcctcagg gcacacggcc ctgatgccgt gctgatggct 1920
gagggcaacc cgcccacgga actgacgcag tcgcagatgc tgcatatagc ccagcagatc 1980
gccgcgggca tggtctacct ggcgtcccag cacttcgtgc accgcgattt ggccaccagg 2040
aactgcctgg tcggggagaa cttgctggtg aaaatcgggg actttgggat gtcccgggac 2100
gtggaaagca ctgacgaaga aagggtcggt ggccacacaa tgctgcccat tcgctggatg 2160
cctccagaga gcatcatgta caggaaattc acgacggaaa gcgacgtctg gagcctgggg 2220
gtcgtgttgt gggagatttt cacctatggc aaacagccct ggtaccagct gtcaaacaat 2280
gaggtgatag agtgtatcac tcagggccga gtcctgcagc gaccccgcac gtgcccccag 2340
gaggtgtatg agctgatgct ggggtgctgg cagcgagagc cccacatgag gaagaacatc 2400
aagggcatcc ataccctcct tcagaacttg gccaaggcat ctccggtcga actggacatt 2460
ctaggc 2466
<210>15
<211>229
<212>PRT
<213>Homo sapiens
<400>15
Ala Pro Met Lys Glu Ala Asn Ile Arg Gly Gln Gly Gly Leu Ala Tyr
1 5 10 15
Pro Gly Val Arg Thr His Gly Thr Leu Glu Ser Val Asn Gly Pro Lys
20 25 30
Ala Gly Ser Arg Gly Leu Thr Ser Leu Ala Asp Thr Phe Glu His Val
35 40 45
Ile Glu Glu Leu Leu Asp Glu Asp Gln Lys Val Arg Pro Asn Glu Glu
50 55 60
Asn Asn Lys Asp Ala Asp Leu Tyr Thr Ser Arg Val Met Leu Ser Ser
65 70 75 80
Gln Val Pro Leu Glu Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys
85 90 95
Asn Tyr Leu Asp Ala Ala Asn Met Ser Met Arg Val Arg Arg His Ser
100 105 110
Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp Ser Ile Ser Glu
115 120 125
Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Asp Met Ser Gly Gly
130 135 140
Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys Gly Gln Leu Lys
145 150 155 160
Gln Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu
165 170 175
Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser Gln Cys Arg Thr
180 185 190
Thr Gln Ser Tyr Val Arg Ala Leu Thr Met Asp Ser Lys Lys Arg Ile
195 200 205
Gly Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Thr Leu Thr
210 215 220
Ile Lys Arg Gly Arg
225
<210>16
<211>690
<212>DNA
<213>Homo sapiens
<400>16
gcccccatga aagaagcaaa catccgagga caaggtggct tggcctaccc aggtgtgcgg 60
acccatggga ctctggagag cgtgaatggg cccaaggcag gttcaagagg cttgacatca 120
ttggctgaca ctttcgaaca cgtgatagaa gagctgttgg atgaggacca gaaagttcgg 180
cccaatgaag aaaacaataa ggacgcagac ttgtacacgt ccagggtgat gctcagtagt 240
caagtgcctt tggagcctcc tcttctcttt ctgctggagg aatacaaaaa ttacctagat 300
gctgcaaaca tgtccatgag ggtccggcgc cactctgacc ctgcccgccg aggggagctg 360
agcgtgtgtg acagtattag tgagtgggta acggcggcag acaaaaagac tgcagtggac 420
atgtcgggcg ggacggtcac agtccttgaa aaggtccctg tatcaaaagg ccaactgaag 480
caatacttct acgagaccaa gtgcaatccc atgggttaca caaaagaagg ctgcaggggc 540
atagacaaaa ggcattggaa ctcccagtgc cgaactaccc agtcgtacgt gcgggccctt 600
accatggata gcaaaaagag aattggctgg cgattcataa ggatagacac ttcttgtgta 660
tgtacattga ccattaaaag gggaagatag 690
<210>17
<211>229
<212>PRT
<213>Homo sapiens
<400>17
Ala Pro Met Lys Glu Ala Asn Ile Arg Gly Gln Gly Gly Leu Ala Tyr
1 5 10 15
Pro Gly Val Arg Thr His Gly Thr Leu Glu Ser Val Asn Gly Pro Lys
20 25 30
Ala Gly Ser Arg Gly Leu Thr Ser Leu Ala Asp Thr Phe Glu His Met
35 40 45
Ile Glu Glu Leu Leu Asp Glu Asp Gln Lys Val Arg Pro Asn Glu Glu
50 55 60
Asn Asn Lys Asp Ala Asp Leu Tyr Thr Ser Arg Val Met Leu Ser Ser
65 70 75 80
Gln Val Pro Leu Glu Pro Pro Leu Leu Phe Leu Leu Glu Glu Tyr Lys
85 90 95
Asn Tyr Leu Asp Ala Ala Asn Met Ser Met Arg Val Arg Arg His Ser
100 105 110
Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp Ser Ile Ser Glu
115 120 125
Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Asp Met Ser Gly Gly
130 135 140
Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys Gly Gln Leu Lys
145 150 155 160
Gln Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly Tyr Thr Lys Glu
165 170 175
Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser Gln Cys Arg Thr
180 185 190
Thr Gln Ser Tyr Val Arg Ala Leu Thr Met Asp Ser Lys Lys Arg Ile
195 200 205
Gly Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Thr Leu Thr
210 215 220
Ile Lys Arg Gly Arg
225
<210>18
<211>119
<212>PRT
<213>Homo sapiens
<400>18
His Ser Asp Pro Ala Arg Arg Gly Glu Leu Ser Val Cys Asp Ser Ile
1 5 10 15
Ser Glu Trp Val Thr Ala Ala Asp Lys Lys Thr Ala Val Asp Met Ser
20 25 30
Gly Gly Thr Val Thr Val Leu Glu Lys Val Pro Val Ser Lys Gly Gln
35 40 45
Leu Lys Gln Tyr Phe Tyr Glu Thr Lys Cys Asn Pro Met Gly Tyr Thr
50 55 60
Lys Glu Gly Cys Arg Gly Ile Asp Lys Arg His Trp Asn Ser Gln Cys
65 70 75 80
Arg Thr Thr Gln Ser Tyr Val Arg Ala Leu Thr Met Asp Ser Lys Lys
85 90 95
Arg Ile Gly Trp Arg Phe Ile Arg Ile Asp Thr Ser Cys Val Cys Thr
100 105 110
Leu Thr Ile Lys Arg Gly Arg
115
<210>19
<211>744
<212>DNA
<213>Homo sapiens
<400>19
atgaccatcc ttttccttac tatggttatt tcatactttg gttgcatgaa ggctgccccc 60
atgaaagaag caaacatccg aggacaaggt ggcttggcct acccaggtgt gcggacccat 120
gggactctgg agagcgtgaa tgggcccaag gcaggttcaa gaggcttgac atcattggct 180
gacactttcg aacacgtgat agaagagctg ttggatgagg accagaaagt tcggcccaat 240
gaagaaaaca ataaggacgc agacttgtac acgtccaggg tgatgctcag tagtcaagtg 300
cctttggagc ctcctcttct ctttctgctg gaggaataca aaaattacct agatgctgca 360
aacatgtcca tgagggtccg gcgccactct gaccctgccc gccgagggga gctgagcgtg 420
tgtgacagta ttagtgagtg ggtaacggcg gcagacaaaa agactgcagt ggacatgtcg 480
ggcgggacgg tcacagtcct tgaaaaggtc cctgtatcaa aaggccaact gaagcaatac 540
ttctacgaga ccaagtgcaa tcccatgggt tacacaaaag aaggctgcag gggcatagac 600
aaaaggcatt ggaactccca gtgccgaact acccagtcgt acgtgcgggc ccttaccatg 660
gatagcaaaa agagaattgg ctggcgattc ataaggatag acacttcttg tgtatgtaca 720
ttgaccatta aaaggggaag atag 744
<210>20
<211>18
<212>PRT
<213>Homo sapiens
<400>20
Met Thr Ile Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly Cys Met
1 5 10 15
Lys Ala
<210>21
<211>54
<212>DNA
<213>Homo sapiens
<400>21
atgaccatcc ttttccttac tatggttatt tcatacttcg gttgcatgaa ggcg 54
<210>22
<211>26
<212>PRT
<213>Homo sapiens
<400>22
Met Phe His Gln Val Arg Arg Val Met Thr Ile Leu Phe Leu Thr Met
1 5 10 15
Val Ile Ser Tyr Phe Gly Cys Met Lys Ala
20 25
<210>23
<211>78
<212>DNA
<213>Homo sapiens
<400>23
atgttccacc aggtgagaag agtgatgacc atccttttcc ttactatggt tatttcatac 60
ttcggttgca tgaaggcg 78
<210>24
<211>33
<212>PRT
<213>Homo sapiens
<400>24
Met Gln Ser Arg Glu Glu Glu Trp Phe His Gln Val Arg Arg Val Met
1 5 10 15
Thr Ile Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly Cys Met Lys
20 25 30
Ala
<210>25
<211>99
<212>DNA
<213>Homo sapiens
<400>25
atgcagagcc gggaagagga atggttccac caggtgagaa gagtgatgac catccttttc 60
cttactatgg ttatttcata cttcggttgc atgaaggcg 99
<210>26
<211>47
<212>PRT
<213>Homo sapiens
<400>26
Met Leu Cys Ala Ile Ser Leu Cys Ala Arg Val Arg Lys Leu Arg Ser
1 5 10 15
Ala Gly Arg Cys Gly Lys Phe His Gln Val Arg Arg Val Met Thr Ile
20 25 30
Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly Cys Met Lys Ala
35 40 45
<210>27
<211>141
<212>DNA
<213>Homo sapiens
<400>27
atgctctgtg cgatttcatt gtgtgctcgc gttcgcaagc tccgtagtgc aggaaggtgc 60
gggaagttcc accaggtgag aagagtgatg accatccttt tccttactat ggttatttca 120
tacttcggtt gcatgaaggc g 141
<210>28
<211>100
<212>PRT
<213>Homo sapiens
<400>28
Met Cys Gly Ala Thr Ser Phe Leu His Glu Cys Thr Arg Leu Ile Leu
1 5 10 15
Val Thr Thr Gln Asn Ala Glu Phe Leu Gln Lys Gly Leu Gln Val His
20 25 30
Thr Cys Phe Gly Val Tyr Pro His Ala Ser Val Trp His Asp Cys Ala
35 40 45
Ser Gln Lys Lys Gly Cys Ala Val Tyr Leu His Val Ser Val Glu Phe
50 55 60
Asn Lys Leu Ile Pro Glu Asn Gly Phe Ile Lys Phe His Gln Val Arg
65 70 75 80
Arg Val Met Thr Ile Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly
85 90 95
Cys Met Lys Ala
100
<210>29
<211>300
<212>DNA
<213>Homo sapiens
<400>29
atgtgtggag ccaccagttt tctccatgag tgcacaaggt taatccttgt tactactcag 60
aatgctgagt ttctacagaa agggttgcag gtccacacat gttttggcgt ctacccacac 120
gcttctgtat ggcatgactg tgcatcccag aagaagggct gtgctgtgta cctccacgtt 180
tcagtggaat ttaacaaact gatccctgaa aatggtttca taaagttcca ccaggtgaga 240
agagtgatga ccatcctttt ccttactatg gttatttcat acttcggttg catgaaggcg 300
<210>30
<211>20
<212>PRT
<213>Homo sapiens
<400>30
Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu
1 5 10 15
Val Thr Asn Ser
20
<210>31
<211>60
<212>DNA
<213>Homo sapiens
<400>31
atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacaaacagt 60
<210>32
<211>22
<212>PRT
<213>Homo sapiens
<400>32
Met Lys Arg Arg Val Met Ile Ile Leu Phe Leu Thr Met Val Ile Ser
1 5 10 15
Tyr Phe Gly Cys Met Lys
20
<210>33
<211>70
<212>DNA
<213>Homo sapiens
<400>33
atgaaaagaa gagtgatgat catccttttc cttactatgg ttatttcata cttcggttgc 60
<210>34
<211>20
<212>PRT
<213>Homo sapiens
<400>34
Met Arg Arg Met Gln Leu Leu Leu Leu Ile Ala Leu Ser Leu Ala Leu
1 5 10 15
Val Thr Asn Ser
20
<210>35
<211>60
<212>DNA
<213>Homo sapiens
<400>35
atgaggagga tgcaactcct gctcctgatt gcactaagtc ttgcacttgt cacaaacagt 60
<210>36
<211>21
<212>PRT
<213>Homo sapiens
<400>36
Met Arg Arg Met Gln Leu Leu Leu Leu Thr Met Val Ile Ser Tyr Phe
1 5 10 15
Gly Cys Met Lys Ala
20
<210>37
<211>63
<212>DNA
<213>Homo sapiens
<400>37
atgaggagga tgcaactcct gctcctgact atggttattt catacttcgg ttgcatgaag 60
gcg 63
<210>38
<211>18
<212>PRT
<213>Homo sapiens
<400>38
Met Arg Ile Leu Leu Leu Thr Met Val Ile Ser Tyr Phe Gly Cys Met
1 5 10 15
Lys Ala
<210>39
<211>54
<212>PRT
<213>Homo sapiens
<400>39
Ala Thr Gly Ala Gly Ala Ala Thr Cys Cys Thr Thr Cys Thr Thr Cys
1 5 10 15
Thr Thr Ala Cys Thr Ala Thr Gly Gly Thr Thr Ala Thr Thr Thr Cys
20 25 30
Ala Thr Ala Cys Thr Thr Cys Gly Gly Thr Thr Gly Cys Ala Thr Gly
35 40 45
Ala Ala Gly Gly Cys Gly
50
<210>40
<211>19
<212>PRT
<213>Homo sapiens
<400>40
Met Arg Arg Ile Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly Cys
1 5 10 15
Met Lys Ala
<210>41
<211>57
<212>DNA
<213>Homo sapiens
<400>41
atgagaagaa tccttttcct tactatggtt atttcatact tcggttgcat gaaggcg 57
<210>42
<211>18
<212>PRT
<213>Homo sapiens
<400>42
Met Arg Arg Phe Leu Phe Leu Leu Val Ile Ser Tyr Phe Gly Cys Met
1 5 10 15
Lys Ala
<210>43
<211>54
<212>DNA
<213>Homo sapiens
<400>43
atgaggaggt tccttttcct tcttgttatt tcatacttcg gttgcatgaa ggcg 54
<210>44
<211>15
<212>PRT
<213>Homo sapiens
<400>44
Met Arg Arg Phe Leu Phe Leu Leu Tyr Phe Gly Cys Met Lys Ala
1 5 10 15
<210>45
<211>45
<212>DNA
<213>Homo sapiens
<400>45
atgaggaggt tccttttcct tctttacttc ggttgcatga aggcg 45
<210>46
<211>130
<212>DNA
<213>Homo sapiens
<400>46
cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt 60
ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact 120
aggggttcct 130
<210>47
<211>141
<212>DNA
<213>Homo sapiens
<400>47
aggaacccct agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60
ccgggcgacc aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc 120
gagcgcgcag ctgcctgcag g 141
<210>48
<211>584
<212>DNA
<213>Homo sapiens
<400>48
gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat 60
tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc 120
aatgggtgga ctatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 180
caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt 240
acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 300
ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 360
ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 420
ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 480
gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 540
ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcg 584
<210>49
<211>210
<212>PRT
<213>Homo sapiens
<400>49
Met Leu Pro Leu Pro Ser Cys Ser Leu Pro Ile Leu Leu Leu Phe Leu
1 5 10 15
Leu Pro Ser Val Pro Ile Glu Ser Gln Pro Pro Pro Ser Thr Leu Pro
20 25 30
Pro Phe Leu Ala Pro Glu Trp Asp Leu Leu Ser Pro Arg Val Val Leu
35 40 45
Ser Arg Gly Ala Pro Ala Gly Pro Pro Leu Leu Phe Leu Leu Glu Ala
50 55 60
Gly Ala Phe Arg Glu Ser Ala Gly Ala Pro Ala Asn Arg Ser Arg Arg
65 70 75 80
Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val
85 90 95
Cys Asp Ala Val Ser Gly Trp Val Thr Asp Arg Arg Thr Ala Val Asp
100 105 110
Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu Val Pro Ala Ala Gly
115 120 125
Gly Ser Pro Leu Arg Gln Tyr Phe Phe Glu Thr Arg Cys Lys Ala Asp
130 135 140
Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly
145 150 155 160
Val Asp Arg Arg His Trp Val Ser Glu Cys Lys Ala Lys Gln Ser Tyr
165 170 175
Val Arg Ala Leu Thr Ala Asp Ala Gln Gly Arg Val Gly Trp Arg Trp
180 185 190
Ile Arg Ile Asp Thr Ala Cys Val Cys Thr Leu Leu Ser Arg Thr Gly
195 200 205
Arg Ala
210
<210>50
<211>630
<212>DNA
<213>Homo sapiens
<400>50
atgctccctc tcccctcatg ctccctcccc atcctcctcc ttttcctcct ccccagtgtg 60
ccaattgagt cccaaccccc accctcaaca ttgccccctt ttctggcccc tgagtgggac 120
cttctctccc cccgagtagt cctgtctagg ggtgcccctg ctgggccccc tctgctcttc 180
ctgctggagg ctggggcctt tcgggagtca gcaggtgccc cggccaaccg cagccggcgt 240
ggggtgagcg aaactgcacc agcgagtcgt cggggtgagc tggctgtgtg cgatgcagtc 300
agtggctggg tgacagaccg ccggaccgct gtggacttgc gtgggcgcga ggtggaggtg 360
ttgggcgagg tgcctgcagc tggcggcagt cccctccgcc agtacttctt tgaaacccgc 420
tgcaaggctg ataacgctga ggaaggtggc ccgggggcag gtggaggggg ctgccgggga 480
gtggacagga ggcactgggt atctgagtgc aaggccaagc agtcctatgt gcgggcattg 540
accgctgatg cccagggccg tgtgggctgg cgatggattc gaattgacac tgcctgcgtc 600
tgcacactcc tcagccggac tggccgggcc 630
<210>51
<211>24
<212>PRT
<213>Homo sapiens
<400>51
Met Leu Pro Leu Pro Ser Cys Ser Leu Pro Ile Leu Leu Leu Phe Leu
1 5 10 15
Leu Pro Ser Val Pro Ile Glu Ser
20
<210>52
<211>72
<212>DNA
<213>Homo sapiens
<400>52
atgctccctc tcccctcatg ctccctcccc atcctcctcc ttttcctcct ccccagtgtg 60
ccaattgagt cc 72
<210>53
<211>56
<212>PRT
<213>Homo sapiens
<400>53
Gln Pro Pro Pro Ser Thr Leu Pro Pro Phe Leu Ala Pro Glu Trp Asp
1 5 10 15
Leu Leu Ser Pro Arg Val Val Leu Ser Arg Gly Ala Pro Ala Gly Pro
20 25 30
Pro Leu Leu Phe Leu Leu Glu Ala Gly Ala Phe Arg Glu Ser Ala Gly
35 40 45
Ala Pro Ala Asn Arg Ser Arg Arg
50 55
<210>54
<211>168
<212>DNA
<213>Homo sapiens
<400>54
caacccccac cctcaacatt gccccctttt ctggcccctg agtgggacct tctctccccc 60
cgagtagtcc tgtctagggg tgcccctgct gggccccctc tgctcttcct gctggaggct 120
ggggcctttc gggagtcagc aggtgccccg gccaaccgca gccggcgt 168
<210>55
<211>130
<212>PRT
<213>Homo sapiens
<400>55
Gly Val Ser Glu Thr Ala Pro Ala Ser Arg Arg Gly Glu Leu Ala Val
1 5 10 15
Cys Asp Ala Val Ser Gly Trp Val Thr Asp Arg Arg Thr Ala Val Asp
20 25 30
Leu Arg Gly Arg Glu Val Glu Val Leu Gly Glu Val Pro Ala Ala Gly
35 40 45
Gly Ser Pro Leu Arg Gln Tyr Phe Phe Glu Thr Arg Cys Lys Ala Asp
50 55 60
Asn Ala Glu Glu Gly Gly Pro Gly Ala Gly Gly Gly Gly Cys Arg Gly
65 70 75 80
Val Asp Arg Arg His Trp Val Ser Glu Cys Lys Ala Lys Gln Ser Tyr
85 90 95
Val Arg Ala Leu Thr Ala Asp Ala Gln Gly Arg Val Gly Trp Arg Trp
100 105 110
Ile Arg Ile Asp Thr Ala Cys Val Cys Thr Leu Leu Ser Arg Thr Gly
115 120 125
Arg Ala
130
<210>56
<211>390
<212>DNA
<213>Homo sapiens
<400>56
ggggtgagcg aaactgcacc agcgagtcgt cggggtgagc tggctgtgtg cgatgcagtc 60
agtggctggg tgacagaccg ccggaccgct gtggacttgc gtgggcgcga ggtggaggtg 120
ttgggcgagg tgcctgcagc tggcggcagt cccctccgcc agtacttctt tgaaacccgc 180
tgcaaggctg ataacgctga ggaaggtggc ccgggggcag gtggaggggg ctgccgggga 240
gtggacagga ggcactgggt atctgagtgc aaggccaagc agtcctatgt gcgggcattg 300
accgctgatg cccagggccg tgtgggctgg cgatggattc gaattgacac tgcctgcgtc 360
tgcacactcc tcagccggac tggccgggcc 390
<210>57
<211>592
<212>DNA
<213>Homo sapiens
<400>57
aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60
ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120
atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180
tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240
ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300
attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360
ttgggcactg acaattccgt ggtgttgtcg gggaagctga cgtcctttcc atggctgctc 420
gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480
aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540
cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tg 592
<210>58
<211>247
<212>DNA
<213>Homo sapiens
<400>58
aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60
ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120
atggctttca ttttctcctc cttgtataaa tcctggttag ttcttgccac ggcggaactc 180
atcgccgcct gccttgcccg ctgctggaca ggggctcggc tgttgggcac tgacaattcc 240
gtggtgt 247
<210>59
<211>224
<212>DNA
<213>Homo sapiens
<400>59
agcagacatg ataagataca ttgatgagtt tggacaaacc acaactagaa tgcagtgaaa 60
aaaatgcttt atttgtgaaa tttgtgatgc tattgcttta tttgtaacca ttataagctg 120
caataaacaa gttaacaaca acaattgcat tcattttatg tttcaggttc agggggaggt 180
gtgggaggtt ttttaaagca agtaaaacct ctacaaatgt ggta 224
<210>60
<211>18
<212>PRT
<213>Homo sapiens
<400>60
Met Thr Ile Leu Phe Leu Thr Met Val Ile Ser Tyr Phe Gly Cys Met
1 5 10 15
Lys Ala
<210>61
<211>54
<212>DNA
<213>Homo sapiens
<400>61
atgaccatcc ttttccttac tatggttatt tcatacttcg gttgcatgaa ggcg 54
<210>62
<211>2
<212>PRT
<213>Homo sapiens
<400>62
Met Arg
1
<210>63
<211>6
<212>DNA
<213>Homo sapiens
<400>63
<210>64
<211>3
<212>PRT
<213>Homo sapiens
<400>64
Met Arg Arg
1
<210>65
<211>9
<212>DNA
<213>Homo sapiens
<400>65
atgagaaga 9
<210>66
<211>4
<212>PRT
<213>Homo sapiens
<400>66
Met Arg Arg Arg
1
<210>67
<211>12
<212>DNA
<213>Homo sapiens
<400>67
atgagaagaa ga 12
<210>68
<211>2
<212>PRT
<213>Homo sapiens
<400>68
Met Lys
1
<210>69
<211>6
<212>DNA
<213>Homo sapiens
<400>69
<210>70
<211>3
<212>PRT
<213>Homo sapiens
<400>70
Met Lys Lys
1
<210>71
<211>9
<212>DNA
<213>Homo sapiens
<400>71
atgaaaaka 9
<210>72
<211>4
<212>PRT
<213>Homo sapiens
<400>72
Met Lys Lys Lys
1
<210>73
<211>12
<212>DNA
<213>Homo sapiens
<400>73
atgaaaaaaa aa 12
<210>74
<211>4
<212>PRT
<213>Homo sapiens
<400>74
Met Lys Arg Arg
1
<210>75
<211>12
<212>DNA
<213>Homo sapiens
<400>75
atgaaaagaa ga 12
<210>76
<211>4
<212>PRT
<213>Homo sapiens
<400>76
Met Arg Lys Arg
1
<210>77
<211>12
<212>DNA
<213>Homo sapiens
<400>77
atgagaaaaa ga 12
<210>78
<211>4
<212>PRT
<213>Homo sapiens
<400>78
Met Arg Arg Lys
1
<210>79
<211>12
<212>DNA
<213>Homo sapiens
<400>79
atgagaagaa aa 12
<210>80
<211>4
<212>PRT
<213>Homo sapiens
<400>80
Met Lys Lys Arg
1
<210>81
<211>12
<212>DNA
<213>Homo sapiens
<400>81
atgaaaaaaa ga 12
<210>82
<211>4
<212>PRT
<213>Homo sapiens
<400>82
Phe Leu Phe Leu
1
<210>83
<211>12
<212>DNA
<213>Homo sapiens
<400>83
ttccttttcc tt 12
<210>84
<211>4
<212>PRT
<213>Homo sapiens
<400>84
Phe Phe Phe Leu
1
<210>85
<211>12
<212>DNA
<213>Homo sapiens
<400>85
ttcttcttcc tt 12
<210>86
<211>4
<212>PRT
<213>Homo sapiens
<400>86
Phe Ile Phe Leu
1
<210>87
<211>12
<212>DNA
<213>Homo sapiens
<400>87
ttcatcttcc tt 12
<210>88
<211>4
<212>PRT
<213>Homo sapiens
<400>88
Phe Ile Phe Ile
1
<210>89
<211>12
<212>DNA
<213>Homo sapiens
<400>89
ttcatcttca tc 12
<210>90
<211>4
<212>PRT
<213>Homo sapiens
<400>90
Phe Val Phe Ile
1
<210>91
<211>12
<212>DNA
<213>Homo sapiens
<400>91
ttcgttttca tc 12
<210>92
<211>4
<212>PRT
<213>Homo sapiens
<400>92
Phe Val Phe Val
1
<210>93
<211>12
<212>DNA
<213>Homo sapiens
<400>93
ttcgttttcg tt 12
<210>94
<211>4
<212>PRT
<213>Homo sapiens
<400>94
Phe Leu Phe Val
1
<210>95
<211>12
<212>DNA
<213>Homo sapiens
<400>95
ttccttttcg tt 12
<210>96
<211>4
<212>PRT
<213>Homo sapiens
<400>96
Phe Ile Phe Val
1
<210>97
<211>12
<212>DNA
<213>Homo sapiens
<400>97
ttcatcttcg tt 12
<210>98
<211>4
<212>PRT
<213>Homo sapiens
<400>98
Phe Phe Phe Ile
1
<210>99
<211>12
<212>DNA
<213>Homo sapiens
<400>99
ttcttcttca tc 12
<210>100
<211>4
<212>PRT
<213>Homo sapiens
<400>100
Phe Phe Phe Val
1
<210>101
<211>12
<212>DNA
<213>Homo sapiens
<400>101
ttcttcttcg tt 12
<210>102
<211>5
<212>PRT
<213>Homo sapiens
<400>102
Phe Ile Leu Phe Leu
1 5
<210>103
<211>15
<212>DNA
<213>Homo sapiens
<400>103
<210>104
<211>1203
<212>DNA
<213>Homo sapiens
<400>104
atgactatcc tgtttctgac aatggttatt agctatttcg gttgcatgaa ggctcacagt 60
gatcccgcac gccgcggaga acttagcgtg tgcgacagca tcagcgagtg ggtcaccgcc 120
gccgataaga agaccgctgt ggatatgtcc ggcgggaccg tcactgtact cgaaaaagtt 180
ccagtgagca aaggccaact gaaacaatat ttctatgaaa ctaagtgcaa ccccatgggg 240
tacaccaagg agggctgccg gggaatcgac aagagacact ggaattccca gtgccggacc 300
actcagagct acgtccgcgc cttgacgatg gattcaaaga agcgcatcgg atggcggttc 360
ataagaatcg acaccagttg tgtgtgcacg ctgacgataa aacgggggcg ggcccccgtg 420
aagcagaccc tgaactttga tttgctcaag ttggcggggg atgtggaaag caatcccggg 480
ccaatggtga gcaagggcga ggagctgttc accggcgttg tgccaatact ggttgagttg 540
gatggcgatg tcaacggaca caaatttagc gtaagcgggg agggagaggg cgacgccaca 600
tatggcaagc tgaccctgaa gttcatttgc acgaccggca aattgcccgt cccttggccc 660
acacttgtga cgaccctgac ttatggcgta cagtgcttca gcaggtaccc tgatcatatg 720
aagcaacacg acttctttaa gagtgccatg ccagagggat acgtccagga aagaaccata 780
ttcttcaaag atgatggaaa ttacaaaacc cgggcagagg tcaagtttga aggcgacacc 840
ctggtgaaca ggatcgaact caaaggcatc gatttcaaag aggacggaaa catcctcgga 900
cacaaactgg aatacaatta caacagccac aacgtctaca tcatggcaga taaacaaaag 960
aacggtatta aagtgaactt caagatccgg cacaacatcg aagacggctc cgtccagctt 1020
gccgaccact accagcaaaa taccccgatc ggcgacggcc ccgttctcct ccccgataat 1080
cactacctga gtacacagtc agccttgagc aaagacccta atgaaaagcg ggaccacatg 1140
gttttgctgg agttcgttac cgcagcgggt attacgctgg gtatggacga gctttacaag 1200
taa 1203
<210>105
<211>1203
<212>DNA
<213>Homo sapiens
<400>105
atgactatcc tgtttctgac aatggttatt agctatttcg gttgcatgaa ggctcacagt 60
gatcccgcac gccgcggaga acttagcgtg tgcgacagca tcagcgagtg ggtcaccgcc 120
gccgataaga agaccgctgt ggatatgtcc ggcgggaccg tcactgtact cgaaaaagtt 180
ccagtgagca aaggccaact gaaacaatat ttctatgaaa ctaagtgcaa ccccatgggg 240
tacaccaagg agggctgccg gggaatcgac aagagacact ggaattccca gtgccggacc 300
actcagagct acgtccgcgc cttgacgatg gattcaaaga agcgcatcgg atggcggttc 360
ataagaatcg acaccagttg tgtgtgcacg ctgacgataa aacgggggcg ggcccctgtc 420
aaacaaaccc tcaattttga cttgctgaag cttgctgggg atgtcgagtc cgctgccgcg 480
gctatggtga gcaagggcga ggagctgttc accggcgttg tgccaatact ggttgagttg 540
gatggcgatg tcaacggaca caaatttagc gtaagcgggg agggagaggg cgacgccaca 600
tatggcaagc tgaccctgaa gttcatttgc acgaccggca aattgcccgt cccttggccc 660
acacttgtga cgaccctgac ttatggcgta cagtgcttca gcaggtaccc tgatcatatg 720
aagcaacacg acttctttaa gagtgccatg ccagagggat acgtccagga aagaaccata 780
ttcttcaaag atgatggaaa ttacaaaacc cgggcagagg tcaagtttga aggcgacacc 840
ctggtgaaca ggatcgaact caaaggcatc gatttcaaag aggacggaaa catcctcgga 900
cacaaactgg aatacaatta caacagccac aacgtctaca tcatggcaga taaacaaaag 960
aacggtatta aagtgaactt caagatccgg cacaacatcg aagacggctc cgtccagctt 1020
gccgaccact accagcaaaa taccccgatc ggcgacggcc ccgttctcct ccccgataat 1080
cactacctga gtacacagtc agccttgagc aaagacccta atgaaaagcg ggaccacatg 1140
gttttgctgg agttcgttac cgcagcgggt attacgctgg gtatggacga gctttacaag 1200
taa 1203
<210>106
<211>1203
<212>DNA
<213>Homo sapiens
<400>106
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaag gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaaggct 720
cccgttaaac aaactctgaa cttcgacctg ctgaagctgg ctggagacgt ggagtccaac 780
cctggaccta tgaccatcct tttccttact atggttattt catacttcgg ttgcatgaag 840
gcgcactccg accctgcccg ccgtggggag ctgagcgtgt gtgacagtat tagcgagtgg 900
gtcacagcgg cagataaaaa gactgcagtg gacatgtctg gcgggacggt cacagtccta 960
gagaaagtcc cggtatccaa aggccaactg aagcagtatt tctacgagac caagtgtaat 1020
cccatgggtt acaccaagga aggctgcagg ggcatagaca aaaggcactg gaactcgcaa 1080
tgccgaacta cccaatcgta tgttcgggcc cttactatgg atagcaaaaa gagaattggc 1140
tggcgattca taaggataga cacttcctgt gtatgtacac tgaccattaa aaggggaaga 1200
tag 1203
<210>107
<211>2940
<212>DNA
<213>Homo sapiens
<400>107
atgagcccat ggctgaagtg gcacggacca gcaatggcaa gactgtgggg cctgtgcctg 60
ctggtgctgg gcttctggag agccagcctg gcctgtccaa cctcctgcaa gtgtagctcc 120
gccaggatct ggtgcacaga gccttctcca ggcatcgtgg cctttccccg cctggagcct 180
aacagcgtgg atcccgagaa tatcaccgag atcctgatcg ccaaccagaa gcggctggag 240
atcatcaatg aggacgatgt ggaggcctac gtgggcctga gaaacctgac aatcgtggac 300
tccggcctga agttcgtggc ctataaggcc tttctgaaga actctaatct gaggcacatc 360
aacttcaccc gcaataagct gacatctctg agccggagac actttcggca cctggatctg 420
tccgacctga tcctgaccgg caatccattc acatgctctt gtgacatcat gtggctgaag 480
accctgcagg agacaaagtc tagccccgat acccaggacc tgtactgtct gaacgagtcc 540
tctaagaata tgcctctggc caacctgcag atccctaatt gtggactgcc aagcgcccgg 600
ctggccgcac ctaacctgac agtggaggag ggcaagtccg tgacactgtc ctgttctgtg 660
ggcggcgatc ccctgcctac cctgtattgg gacgtgggca acctggtgtc taagcacatg 720
aatgagacct cccacacaca gggctctctg agaatcacaa atatcagctc cgacgatagc 780
ggcaagcaga tctcttgcgt ggcagagaac ctggtgggag aggatcagga cagcgtgaat 840
ctgaccgtgc acttcgcccc caccatcaca tttctggagt ctcctaccag cgatcaccac 900
tggtgcatcc ccttcacagt gcggggaaac ccaaagcccg ccctgcagtg gttttacaac 960
ggcgccatcc tgaatgagtc caagtatatc tgtaccaaga tccacgtgac caaccacaca 1020
gagtaccacg gctgcctgca gctggataat cccacccaca tgaacaatgg cgactacaca 1080
ctgatggcca agaacgagta tggcaaggac gagaggcaga tcagcgccca cttcatgggc 1140
cgccctggag tggattatga gaccaaccct aattacccag aggtgctgta tgaggactgg 1200
accacaccta ccgatatcgg cgacaccaca aacaagtcta atgagatccc aagcacagat 1260
gtggccgacc agtctaacag ggagcacctg agcgtgtacg cagtggtggt catcgcctcc 1320
gtggtgggct tctgcctgct ggtcatgctg ctgctgctga agctggcccg ccactctaag 1380
tttggcatga agggcccagc ctccgtgatc tctaatgacg atgacagcgc cagccccctg 1440
caccacatca gcaacggctc caatacccct tctagctccg agggcggccc agatgccgtg 1500
atcatcggca tgacaaagat ccccgtgatc gagaaccctc agtacttcgg catcaccaat 1560
tcccagctga agcctgacac atttgtgcag cacatcaagc ggcacaacat cgtgctgaag 1620
agggaactgg gagagggagc cttcggcaag gtgtttctgg ccgagtgcta taacctgtgc 1680
ccagagcagg ataagatcct ggtggccgtg aagaccctga aggatgccag cgacaacgcc 1740
cggaaggact tccacagaga ggccgagctg ctgacaaatc tgcagcacga gcacatcgtg 1800
aagttttacg gcgtgtgcgt ggagggcgac cctctgatca tggtgttcga gtatatgaag 1860
cacggcgatc tgaacaagtt tctgagagca cacggaccag atgccgtgct gatggcagag 1920
ggaaatcccc ctaccgagct gacacagtct cagatgctgc acattgcaca gcagattgca 1980
gcaggaatgg tgtacctggc cagccagcac ttcgtgcaca gggatctggc aaccagaaac 2040
tgcctggtgg gagagaatct gctggtgaag atcggcgact ttggcatgtc ccgggacgtg 2100
tactctaccg actactatag agtgggcggc cacacaatgc tgcccatcag gtggatgcca 2160
cccgagagca tcatgtatcg caagttcacc acagagtctg acgtgtggag cctgggcgtg 2220
gtgctgtggg agatctttac ctacggcaag cagccttggt atcagctgtc caacaatgaa 2280
gtgatcgagt gtattacaca gggacgcgtg ctgcagaggc cacgcacatg cccccaggag 2340
gtgtacgagc tgatgctggg ctgttggcag cgggagccac acaccagaaa gaacatcaag 2400
agcatccacacactgctgca gaatctggcc aaggcctccc ccgtgtatct ggacatcctg 2460
ggcagcggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct 2520
ggacctatga gaatccttct tcttactatg gttatttcat acttcggttg catgaaggcg 2580
cactccgacc ctgcccgccg tggggagctg agcgtgtgtg acagtattag cgagtgggtc 2640
acagcggcag ataaaaagac tgcagtggac atgtctggcg ggacggtcac agtcctagag 2700
aaagtcccgg tatccaaagg ccaactgaag cagtatttct acgagaccaa gtgtaatccc 2760
atgggttaca ccaaggaagg ctgcaggggc atagacaaaa ggcactggaa ctcgcaatgc 2820
cgaactaccc aatcgtatgt tcgggccctt actatggata gcaaaaagag aattggctgg 2880
cgattcataa ggatagacac ttcctgtgta tgtacactga ccattaaaag gggaagatag 2940
<210>108
<211>2943
<212>DNA
<213>Homo sapiens
<400>108
atgtcatctt ggatccgctg gcacgggcca gcgatggccc gattgtgggg cttctgctgg 60
cttgttgtag gcttctggcg cgcggcgttc gcgtgtccga cctcttgcaa atgctcagca 120
agccgaattt ggtgctcaga ccctagtcca ggaattgttg cattcccccg actggaacca 180
aactccgtcg acccggagaa tataactgag atatttattg caaatcaaaa acgccttgaa 240
atcattaacg aggatgacgt ggaggcctac gttggtttga gaaatcttac tattgtcgac 300
tccggactta aatttgtagc tcataaagcc ttcctgaaga actctaatct gcagcacatt 360
aatttcacga gaaataagct gaccagcttg tcccggaagc atttccgcca tctcgacctg 420
agcgagctca tactggtcgg aaacccattt acgtgctcct gtgacatcat gtggatcaaa 480
actctgcaag aggcgaaaag tagtccggat acccaagacc tttactgtct taatgaaagc 540
tcaaaaaata tcccgctggc caacctgcag ataccgaact gcggacttcc tagtgcgaat 600
ttggctgccc caaatcttac cgtcgaagaa ggcaaatcaa tcacgctttc ttgttctgta 660
gctggagatc cagtgcctaa tatgtattgg gacgtgggta acctcgtctc aaaacatatg 720
aacgaaacga gccacaccca gggctctttg cggataacaa acatctcctc tgatgattct 780
ggaaagcaaa tcagttgcgt agctgaaaat ctggttggcg aagatcaaga ttcagtcaat 840
ctgacagtcc atttcgcccc aacgatcacc tttctggaga gcccaactag cgatcaccac 900
tggtgtattc cgtttacggt aaaaggaaat ccaaaacctg cactccaatg gttttataat 960
ggagccatct tgaatgaaag caaatatatc tgtactaaaa tccatgtgac gaatcacacc 1020
gagtatcacg ggtgtcttca attggataat ccaacccata tgaataatgg tgattatact 1080
ttgatagcga agaacgaata cggcaaagac gaaaagcaaa tatccgcaca tttcatgggt 1140
tggcctggca tcgacgacgg tgcgaacccg aactacccag atgttattta cgaggattat 1200
gggactgcgg caaacgacat tggcgacacc acaaaccgaa gcaacgagat accaagtact 1260
gacgtcactg acaaaacggg tcgagagcat ttgtctgttt acgccgttgt tgttatcgcc 1320
tcagttgtcg gattttgcct gttggtcatg cttttcctcc tgaagctcgc gcgacattcc 1380
aagtttggca tgaaggggcc agcaagtgtt atatccaatg atgatgatag cgcttctcca 1440
ttgcaccaca taagtaacgg ctcaaacacg ccgtcatcta gtgaaggtgg accagacgcg 1500
gtcattatag ggatgactaa aattcccgta atcgaaaacc ctcagtactt cggcataacc 1560
aacagtcagc ttaaacccga tactttcgtg cagcacatca aaaggcacaa catagtcctc 1620
aagcgcgaac tcggggaggg agccttcgga aaggtctttc ttgctgagtg ctataatttg 1680
tgtcctgagc aggataaaat tcttgtggct gtaaaaactc tcaaagatgc ttccgacaac 1740
gcacggaagg attttcatcg ggaggccgaa ctgttgacga atttgcagca cgagcatata 1800
gtaaagttct acggggtatg tgttgagggg gacccgttga ttatggtctt cgagtatatg 1860
aagcacgggg acctgaacaa atttttgcgc gcccatgggc ctgatgccgt ccttatggca 1920
gaagggaacc ctccaacaga actcacccag agtcagatgt tgcacatagc gcaacagatc 1980
gcggccggca tggtttacct ggccagtcaa cacttcgtgc atagagatct tgccactcgc 2040
aactgtttgg tcggggagaa ccttctggtt aagattggtg actttggtat gtcacgagat 2100
gtgtattcca ctgactatta cagagttggg ggtcatacaa tgcttcctat tcggtggatg 2160
ccccccgaat ccatcatgta cagaaagttc acgacagaga gtgatgtttg gagtctcggc 2220
gtggtgctct gggaaatttt cacatacgga aagcagccgt ggtatcaact tagcaacaat 2280
gaggtgatag agtgtattac acagggtcgg gtgttgcagc gccctcgaac gtgcccacaa 2340
gaagtatatg aacttatgct cgggtgctgg caaagagaac cacatatgag aaaaaatatc 2400
aaggggatac atacattgct tcagaacttg gccaaggcat cacccgtcta cctcgatata 2460
ctgggcagcg gagctactaa cttcagcctg ctgaagcagg ctggagacgt ggaggagaac 2520
cctggaccta tgagaatcct tcttcttact atggttattt catacttcgg ttgcatgaag 2580
gcgcactccg accctgcccg ccgtggggag ctgagcgtgt gtgacagtat tagcgagtgg 2640
gtcacagcgg cagataaaaa gactgcagtg gacatgtctg gcgggacggt cacagtccta 2700
gagaaagtcc cggtatccaa aggccaactg aagcagtatt tctacgagac caagtgtaat 2760
cccatgggtt acaccaagga aggctgcagg ggcatagaca aaaggcactg gaactcgcaa 2820
tgccgaacta cccaatcgta tgttcgggcc cttactatgg atagcaaaaa gagaattggc 2880
tggcgattca taaggataga cacttcctgt gtatgtacac tgaccattaa aaggggaaga 2940
tag 2943
- 上一篇：一种医用注射器针头装配设备
- 下一篇：新型多价多糖-蛋白轭合物疫苗组合物及其制剂