Compositions and methods for gene editing
阅读说明：本技术 用于基因编辑的组合物和方法 (Compositions and methods for gene editing ) 是由 A.S.伦德伯格 S.库尔卡尼 L.克莱因 H.K.帕马纳班 Y.S.阿拉泰恩 于 2018-02-21 设计创作，主要内容包括：本申请提供了用于治疗患有与ANGPTL3相关的一种或多种病状的患者的离体或体内材料和方法。另外,本申请提供了用于通过基因组编辑来编辑和/或调节ANGPTL3基因在细胞中的表达的材料和方法。(The present application provides ex vivo or in vivo materials and methods for treating patients having one or more conditions associated with ANGPTL 3. In addition, the present application provides materials and methods for editing and/or regulating expression of the ANGPTL3 gene in a cell by genome editing.)
1. A method for producing a population of cells modified with angiopoietin-like 3(ANGPTL3), the method comprising: introducing into a cell (a) a guide RNA (gRNA) or a nucleic acid encoding a gRNA that targets an ANGPTL3 genomic locus and (b) an RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease; and producing a population of cells comprising the modification in the ANGPTL3 gene.
2. The method of claim 1, wherein at least 50% of the cells in the population comprise the modification in the ANGPTL3 gene.
3. The method of claim 2, wherein 50% -70% of the cells in the population comprise the modification in the ANGPTL3 gene.
4. The method of any one of claims 1-3, wherein secretion of ANGPTL3 protein by cells in the population is reduced by at least 2-fold relative to a control.
5. The method of claim 4, wherein secretion of ANGPTL3 protein by cells in the population is reduced by at least 5-fold relative to a control.
6. The method of claim 4 or 5, wherein the control is a population of unmodified cells and/or a population of cells that did not receive the gRNA targeted to the ANGPTL3 gene.
7. The method of any one of claims 1-6, wherein the RNA-guided endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease.
8. The method of claim 7, wherein the Cas9 endonuclease or the Cpf1 endonuclease is selected from Streptococcus pyogenes (S.pyogenenes) Cas9, Staphylococcus aureus (S.aureus) Cas9, Neisseria meningitidis (N.meningiensis) Cas9, Streptococcus thermophilus (S.thermophilus) CRISPR1Cas9, Streptococcus thermophilus CRISPR3Cas9, Treponema tartarum (T.denticola) Cas9, Mucor (L.bacterium) ND2006Cpf1, and Amidococcus sp BV3L6Cpf 1.
9. The method of claim 7 or 8, wherein the RNA-guided endonuclease comprises a sequence selected from the group consisting of SEQ ID NO 1-SEQ ID NO 620.
10. The method according to any one of claims 7 to 9, wherein the RNA-guided endonuclease is a Cas9 endonuclease.
11. The method according to any one of claims 1-10, wherein the gRNA is a single guide rna (sgrna).
12. The method of any one of claims 1-11, wherein the gRNA targets a regulatory element in the ANGPTL3 genomic locus.
13. The method of any one of claims 1-12, wherein the gRNA is cross-reactive to human and cynomolgus monkeys.
14. The method according to any one of claims 1-13, wherein the gRNA is a chemically modified gRNA.
15. The method according to claim 14, wherein the chemically modified gRNA includes phosphorothioated 2' -O-methyl nucleotides at the 3' and 5' ends of the gRNA.
16. The method of any one of claims 1-15, wherein the gRNA includes a spacer sequence selected from table 7.
17. The method according to any one of claims 1-16, wherein the gRNA includes a spacer sequence selected from: CAAAGACCUUCUCCAGACCG (SEQ ID NO: 17071); GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069); and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070).
18. The method of claim 17, wherein the gRNA includes a spacer sequence GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069).
19. The method of any one of claims 1-18, wherein the gRNA and RNA-guided nuclease are formulated as a ribonucleoprotein particle (RNP).
20. The method of any one of claims 1 to 18, wherein the nucleic acid of (a) and/or (b) is present on a viral vector, optionally an adeno-associated viral vector.
21. The method according to any one of claims 1-20, wherein the grnas of (a) or the nucleic acids encoding grnas and/or the RNA-guided endonucleases of (b) or the nucleic acids encoding RNA-guided endonucleases are formulated into liposomes or Lipid Nanoparticles (LNPs).
22. The method of any one of claims 1-21, wherein the cells comprise hepatocytes.
23. The method of any one of claims 1-22, wherein the population of cells is present in a subject having an ANGPTL 3-associated condition.
24. A cross-reactive guide RNA (gRNA) or a nucleic acid encoding a cross-reactive gRNA, comprising a spacer sequence selected from GCCAAUGGCCUCCUUCAGUU (SEQ ID NO:17069) and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070).
Technical Field
In some aspects, the disclosure relates to the field of gene editing, for example, to alterations of the angiopoietin-like 3(ANGPTL3) gene.
Background
Genome engineering refers to strategies and techniques for targeted specific modification of the genetic information (genome) of a living organism. Genome engineering is a very active research area due to the wide range of possible applications, especially in the field of human health. For example, genome engineering can be used to alter (e.g., correct or knock out) genes carrying deleterious mutations or to explore the function of genes. Early techniques developed for inserting transgenes into living cells were often limited by the random nature of inserting new sequences into the genome. Random insertion into the genome may result in disruption of normal regulation of neighboring genes, leading to serious adverse effects. Furthermore, random integration techniques provide little reproducibility, as there is no guarantee that the sequences will be inserted at the same position in two different cells. Recent genome engineering strategies like Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), Homing Endonucleases (HE) and MegaTAL enable modification of specific regions of DNA, thereby improving the accuracy of the changes compared to earlier technologies. These newer platforms provide a greater degree of reproducibility, but still have their limitations.
Despite the continuing efforts of global researchers and medical professionals to try to address genetic disorders and despite the promise of methods of genome engineering, there remains an urgent need to develop safe and effective therapeutic regimens involving ANGPTL 3-related indications.
By using genome engineering tools to produce genomes that can address permanent changes in ANGPTL 3-associated disorders or conditions with a single treatment, the resulting therapy can completely remediate certain ANGPTL 3-associated indications and/or diseases.
Disclosure of Invention
In some aspects, the present disclosure provides efficient gene editing methods for modifying an angiopoietin-like 3(ANGPTL3) gene. For example, in some embodiments, the gene editing methods herein can be used to modify at least 50%, at least 60%, or at least 70% of the cells in a population. Surprisingly, in some embodiments, cells in these modified cell populations exhibit a 5-fold (or greater) reduction in ANGPTL3 protein secretion. Thus, these methods may be particularly useful for treating ANGPTL 3-related indications such as dyslipidemia. Further, in some embodiments, the methods provided herein use a cross-species (cross-reactive) gene editing system that allows experimental data from animal models to humans to be extrapolated more accurately.
In some aspects, provided herein are methods for producing a population of cells modified with angiopoietin-like 3(ANGPTL3), the method comprising: introducing into a cell (a) a guide RNA (gRNA) targeting an ANGPTL3 genomic locus (e.g., SEQ ID NO:5304) or a nucleic acid encoding the gRNA (e.g., as a cross-reactive gRNA) and (b) an RNA-guided endonuclease or a nucleic acid encoding an RNA-guided endonuclease (e.g., Cas 9); and producing a population of cells comprising the modification (e.g., insertion, deletion, or at least one nucleotide mutation) in the ANGPTL3 genomic locus. In some embodiments, the gRNA includes a (20bp) spacer sequence that is complementary to a sequence within the ANPTL3 genomic locus (e.g., within the ANGPTL3 gene, e.g., chromosomes 1:62,597,486 to 1:62,606,304). An insertion is the introduction of at least one nucleotide, a deletion is the removal of at least one nucleotide, and a mutation is a change of at least one nucleotide (e.g., from one nucleotide, such as C, to another nucleotide, such as a).
In some embodiments, at least 50% of the cells in the population comprise a modification (e.g., an insertion, a deletion, or at least one nucleotide mutation) in the ANGPTL3 gene. For example, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the population can include a modification in the AGPTL3 gene. In some embodiments, 50% -100% of the cells in the population comprise the modification in the ANGPTL3 gene. For example, 50% -60%, 50% -65%, 50% -70%, 50% -75%, 50% -80%, 50% -85%, 50% -90%, or 50% -95% of the cells in the population can include a modification in the ANGPTL3 gene. In some embodiments, 50% -70% of the cells in the population comprise the modification in the ANGPTL3 gene.
In some embodiments, secretion of ANGPTL3 protein by cells in the population is reduced by at least 2-fold relative to a control. For example, the ANGPTL3 protein secreted by cells in a population can be reduced by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold relative to a control. In some embodiments, secretion of ANGPTL3 protein by cells in the population is reduced by at least 5-fold relative to a control. In some embodiments, secretion of ANGPTL3 protein by cells in the population is reduced by at least 2-fold to 5-fold relative to a control.
In some embodiments, the control is a population of unmodified cells and/or a population of cells that do not receive the gRNA including a spacer sequence complementary to a region of the ANGPTL3 gene. In some embodiments, the control is a population of cells that receive a gRNA that includes a spacer sequence complementary to a region of a non-ANGPTL 3 gene.
In some embodiments, the RNA-guided endonuclease is a Cas9 endonuclease. In some embodiments, the RNA-guided nuclease is Cpf1 nuclease. Other RNA-guided nucleases can be used. In some embodiments: the Cas9 endonuclease or Cpf1 endonuclease is selected from streptococcus pyogenes (s.pyogenenes) Cas9, staphylococcus aureus (s.aureus) Cas9, neisseria meningitidis (n.meningitis) Cas9, streptococcus thermophilus (s.thermophilus) CRISPR1Cas9, streptococcus thermophilus CRISPR 3Cas9, treponema denticola (t.denticola) Cas9, lachnospira (l.bacterium) ND2006Cpf1 and aminoacidococcus (acinococcus sp.) BV3L6Cpf 1.
In some embodiments, the gRNA is a single guide RNA (sgrna) containing a targeting sequence (crRNA sequence) and an RNA-guided nuclease recruitment sequence (tracrRNA).
In some embodiments, the gRNA targets a regulatory element (e.g., a promoter, enhancer, or other regulatory element) in the ANGPTL3 genomic locus.
In some embodiments, the gRNA is cross-reactive to human and cynomolgus monkey (e.g., the spacer sequence of the gRNA is complementary to a region of the human ANGPTL3 gene and complementary to a region of the cynomolgus monkey ANGPTL3 gene).
In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA includes phosphorothioated 2' -O-methyl nucleotides at the 3' end and the 5' end of the gRNA. In some embodiments, the chemically modified gRNA includes a phosphorothioated 2 '-O-methyl nucleotide at the 3' end of the gRNA. In some embodiments, the chemically modified gRNA includes a phosphorothioated 2 '-O-methyl nucleotide at the 5' end of the gRNA. In some embodiments, the chemically modified gRNA includes three phosphorothioated 2' -O-methyl nucleotides at the 3' end and/or the 5' end of the gRNA.
In some embodiments, the cells comprise hepatocytes.
In some embodiments, the spacer sequence comprises a spacer sequence selected from the group consisting of: CAAAGACCUUCUCCAGACCG (SEQ ID NO: 17071); GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069); and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070). In some embodiments, the spacer sequence comprises GCCAAUGGCCUCCUUCAGUU (SEQ ID NO: 17069). In some embodiments, the spacer sequence comprises GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070). In some embodiments, the spacer sequence comprises CAAAGACCUUCUCCAGACCG (SEQ ID NO: 17071).
In some embodiments, the population of cells is present in a subject having an ANGPTL 3-associated condition. In some embodiments, the ANGPTL 3-associated condition is dyslipidemia (abnormal amounts of lipids (e.g., triglycerides, cholesterol, and/or fatty phospholipids)).
In some embodiments, the gRNA and RNA-guided nuclease are formulated (pre-complexed) into ribonucleoprotein particles (RNPs).
In some embodiments, the nucleic acid of (a) and/or (b) is present on a viral vector, optionally, an adeno-associated virus (AAV) vector.
In some embodiments, the gRNA or the nucleic acid encoding a gRNA of (a) and/or the RNA-guided endonuclease of (b) or the nucleic acid encoding an RNA-guided endonuclease are formulated as a liposome or a Lipid Nanoparticle (LNP).
In some aspects, also provided herein is a cross-reactive guide rna (gRNA) or a nucleic acid encoding a cross-reactive gRNA, comprising a spacer sequence selected from GCCAAUGGCCUCCUUCAGUU (SEQ ID NO:17069) and GGCCUCCUUCAGUUGGGACA (SEQ ID NO: 17070).
Thus, in some aspects, provided herein are cells, ex vivo and in vivo methods for producing permanent changes in the genome by: introducing by genome editing an insertion, deletion or mutation of at least one nucleotide within or near an angiopoietin-like 3(ANGPTL3) gene or other DNA sequence encoding a regulator of an ANGPTL3 gene; and reducing or eliminating expression or function of an ANGPTL3 gene product, the ANGPTL3 gene product may be used to treat an ANGPTL 3-associated condition or disorder, such as dyslipidemia. Also provided herein are components and compositions for performing such methods, as well as carriers.
Also provided herein are methods for editing the ANGPTL3 gene in a cell by genome editing, the methods comprising the step of introducing one or more deoxyribonucleic acid (DNA) endonucleases (e.g., Cas9) into the cell to effect one or more single-strand breaks or double-strand breaks within or near the ANGPTL3 gene or ANGPTL3 regulatory elements that result in one or more permanent insertions, deletions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product. In some embodiments, a gRNA targeting the ANGPTL3 genomic locus is also introduced into the cell.
Drawings
The various aspects of the materials and methods disclosed and described in this specification can be better understood by reference to the drawings, in which:
fig. 1A depicts a type II CRISPR/Cas system.
Fig. 1B is another depiction of a type II CRISPR/Cas system.
Fig. 2, 3 and 4 are graphs showing cleavage efficiency of gRNA with streptococcus pyogenes Cas9 in HEK293T cells targeting the ANGPTL3 gene.
Fig. 5A depicts the cleavage efficiency of grnas targeting ANGPTL3 in primary human hepatocytes.
Fig. 5B depicts the cleavage efficiency of grnas targeting ANGPTL3 in primary hepatocytes isolated from cynomolgus monkeys.
Fig. 6A depicts the cleavage efficiency of grnas targeting ANGPTL3 in primary human hepatocytes.
Fig. 6B depicts the effect of gene editing of grnas on ANGPTL3 protein secretion in primary human hepatocytes.
Fig. 7A depicts the cleavage efficiency of grnas targeting ANGPTL3 in primary human hepatocytes.
Fig. 7B depicts the effect of gene editing of grnas on ANGPTL3 protein secretion in primary human hepatocytes.
Figure 8 depicts the effect of gene editing of gRNA on ANGPTL3 protein secretion in monkey hepatocytes.
Brief description of the sequence listing
1-620 are Cas endonuclease orthologous sequences.
621-631 are intentionally blank.
SEQ ID NO 632-4,715 is a microRNA sequence.
SEQ ID NO 4,716-4,733 was intentionally blanked.
SEQ ID NO 4,734-5,302 is an AAV serotype sequence.
5,303 is an ANGPTL3 nucleotide sequence.
5,304 is a gene sequence comprising 5 kilobase pairs upstream and/or downstream of the ANGPTL3 gene.
5,305-5,398 is a 20bp spacer sequence within or near the other DNA sequence used to target the ANGPTL3 gene or encoding the regulatory elements of the ANGPTL3 gene by the Treponema denticola Cas9 endonuclease.
5,399-.
5,596-6,079 is a 20bp spacer within or near the other DNA sequence used to target the ANGPTL3 gene or encoding regulatory elements of the ANGPTL3 gene by the Staphylococcus aureus Cas9 endonuclease.
6,080-6,633 is a 20bp spacer within or near other DNA sequences used to target the ANGPTL3 gene or encoding regulatory elements of the ANGPTL3 gene by a Neisseria meningitidis Cas9 endonuclease.
6,634-10,171 is a 20bp spacer sequence within or near the other DNA sequence used to target the ANGPTL3 gene or encoding the regulatory elements of the ANGPTL3 gene by the S.pyogenes Cas9 endonuclease.
10,172-17,018 is a 22bp spacer sequence within or near the other DNA sequence used to target the ANGPTL3 gene or to encode the regulatory elements of the ANGPTL3 gene by the amino acid coccus, Lachnospiraceae (Lachnospiraceae) and Francisella noveri (Francisella novicida) Cpf1 endonuclease.
SEQ ID No. 17,019-17,048 is intentionally blank.
17,049 is a sample guide rna (grna) for streptococcus pyogenes Cas9 endonuclease.
The sample sgRNA sequences are shown in SEQ ID NO 17,050 and 17, 052.
SEQ ID Nos. 17,054 and 17,057 show sample guide target sequences.
The sequence of the sgRNA of the sample is shown in SEQ ID NO 17,059-17,066.
17,053 and 17,067 are exemplary unpaired regions of nucleotides within the duplex between the smallest CRISPR RNA and the smallest tracrRNA.
17,068-17,071 are example ANGPTL3gRNA spacer sequences.
Detailed Description
I. Introduction to the design reside in
Genome editing
The present disclosure provides strategies and techniques for targeted specific changes to the genetic information (genome) of a living organism. As used herein, the term "alteration" or "alteration of genetic information" refers to any change in the genome of a cell. In the context of treating a genetic disorder, alterations may include, but are not limited to, insertions, deletions, and corrections. As used herein, the term "insertion" refers to the addition of one or more nucleotides in a DNA sequence. The insertion can range from a small insertion of a few nucleotides to the insertion of a large fragment such as a cDNA or gene. The term "deletion" refers to the loss or removal of one or more nucleotides in a DNA sequence or the loss or removal of the function of a gene. In some cases, a deletion may comprise, for example, a loss of several nucleotides, exons, introns, gene fragments, or the entire sequence of a gene. In some cases, a deletion of a gene refers to an elimination or reduction of function or expression of the gene or its gene product. This may be caused not only by deletions of sequences within or near the gene, but also by other events (e.g., insertions, nonsense mutations) that disrupt gene expression. As used herein, the term "correct" refers to a change in one or more nucleotides of a genome in a cell, whether by insertion, deletion, or substitution. Such corrections may produce more favorable genotypic or phenotypic outcomes that are corrected to genomic sites, whether structurally or functionally. One non-limiting example of "correcting" comprises correcting the mutant or defective sequence to a wild-type sequence that restores structure or function to the gene or one or more gene products thereof. Depending on the nature of the mutation, correction may be achieved via various strategies disclosed herein. In one non-limiting example, missense mutations can be corrected by replacing the region containing the mutation with its wild-type counterpart. As another example, repeated mutations in a gene may be corrected by removing additional sequences (e.g., repeat amplification).
In some aspects, the alteration may further comprise a gene knock-in, knock-out, or knock-down. As used herein, the term "knock-in" refers to the addition of a DNA sequence or fragment thereof to a genome. Such DNA sequences to be knocked in may comprise one or more entire genes, may comprise regulatory sequences associated with the genes or may comprise any portion or fragment of the foregoing. For example, a cDNA encoding a wild-type protein can be inserted into the genome of a cell carrying a mutant gene. The knock-in strategy does not require the replacement of the defective gene in whole or in part. In some cases, the knock-in strategy can further involve replacing an existing sequence with the provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the elimination of a gene or the expression of a gene. For example, a gene may be knocked out by deletion or addition of a nucleotide sequence that results in disruption of the reading frame. As another example, a gene can be knocked out by replacing a portion of the gene with an unrelated sequence. Finally, as used herein, the term "knockdown" refers to a reduction in expression of a gene or one or more gene products thereof. As a result of the gene knockdown, protein activity or function may be reduced or protein levels may be reduced or eliminated.
Genome editing generally refers to the process of modifying the nucleotide sequence of a genome, preferably in an accurate or predetermined manner. Examples of genome editing methods described herein include methods that use site-directed nucleases to cleave deoxyribonucleic acid (DNA) at a precise target location in the genome, thereby creating a single-stranded or double-stranded DNA break at a specific location within the genome. Such breaks can, and often are, repaired by natural endogenous cellular processes such as homeotropic repair (HDR) and non-homologous end joining (NHEJ), as recently reviewed in Cox et al, nature medicine (NatureMedicine) 21(2),121-31 (2015). These two major DNA repair processes consist of a series of alternative pathways. NHEJ is directly ligated to DNA ends created by double strand breaks, sometimes with loss or addition of nucleotide sequences, which may disrupt or enhance gene expression. HDR utilizes homologous or donor sequences as templates for inserting defined DNA sequences at breakpoints. Homologous sequences may be in an endogenous genome such as a sister chromatid. Alternatively, the donor may be an exogenous nucleic acid such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, duplex oligonucleotide, or virus, which has a region of high homology to the nuclease cleavage locus, but may also contain additional sequences or sequence changes, including deletions, that may be incorporated into the cleaved target locus. The third repair mechanism may be microhomology-mediated end joining (MMEJ), also known as "surrogate NHEJ", where the genetic result is similar to NHEJ in that small deletions and insertions may occur at the cleavage site. MMEJ can use several base pairs of homologous sequences flanking the DNA break site to drive more favorable DNA end-joining repair results, and recent reports have further elucidated the molecular mechanism of this process; see, e.g., Cho and Greenberg, Nature 518,174-76 (2015); kent et al, Nature Structural and Molecular Biology (Nature Structural and Molecular Biology), advanced on-line publication of doi (adv. Online doi) 10.1038/nsmb.2961 (2015); Mateos-Gomez et al, Nature 518,254-57 (2015); ceccaldi et al, Nature 528,258-62 (2015). In some cases, it is possible that a possible repair outcome may be predicted based on analysis of potential micro-homology at DNA break sites.
Each of these genome editing mechanisms can be used to produce a desired genome alteration. A step in the genome editing process may be to create one or two DNA breaks in the target locus near the intended mutation site, either as double-stranded breaks or as two single-stranded breaks. This can be achieved by using site-directed polypeptides, as described and illustrated herein.
CRISPR endonuclease system
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) genomic loci are found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, CRISPR loci encode products that serve as the type of immune system used to help defend prokaryotes against foreign invaders such as viruses and bacteriophages. There are three phases of CRISPR locus function: integration of the new sequence into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invader nucleic acids. Five types of CRISPR systems have been identified (e.g., type I, type II, type III, type U, and type V).
CRISPR loci contain multiple short repeat sequences called "repeats. The repeats, when expressed, may form secondary structures (e.g., hairpins) and/or include unstructured single-stranded sequences. The repetitions usually occur in clusters and frequently diverge between species. The repeats are regularly spaced with a unique insertion sequence called "interval" to create a repeat-interval-repeat locus architecture. The interval is identical or has high homology to known foreign invader sequences. The spacer-repeat unit encodes a crisprna (crRNA) that is processed into the mature form of the spacer-repeat unit. crRNA includes "seeds" or spacer sequences involved in targeting a target nucleic acid (in naturally occurring forms of prokaryotes, spacer sequences target foreign invader nucleic acids). The spacer sequence is located at the 5 'end or 3' end of the crRNA.
The CRISPR locus also includes a polynucleotide sequence encoding a CRISPR-associated (Cas) gene. The Cas gene encodes an endonuclease involved in the interference phase of biogenesis and crRNA function in prokaryotes. Some Cas genes include homologous secondary and/or tertiary structures.
Type II CRISPR system
crRNA biogenesis in type II CRISPR systems essentially requires transactivation CRISPR RNA (tracrRNA). Non-limiting examples of type II CRISPR systems are shown in fig. 1A and 1B. tracrRNA can be modified by endogenous RNaseIII and then repeatedly hybridized to crRNA in a precursor crRNA array. Endogenous RNaseIII may be recruited to cleave the precursor crRNA. The cleaved crRNA can be subjected to exoribonuclease cleavage to produce a mature crRNA form (e.g., 5' cleavage). the tracrRNA can remain hybridized to the crRNA, and the tracrRNA and crRNA are associated with a site-directed polypeptide (e.g., Cas 9). The crRNA in the crRNA-tracrRNA-Cas9 complex can direct the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of crRNA to the target nucleic acid can activate Cas9 for target nucleic acid cleavage. The target nucleic acid in a type II CRISPR system is called a Protospacer Adjacent Motif (PAM). In essence, PAM is essential to facilitate binding of site-directed polypeptides (e.g., Cas9) to target nucleic acids. Type II systems (also known as Nmeni or CASS4) are further subdivided into type II-A (CASS4) and type II-B (CASS4 a). Jinek et al, Science 337(6096), 816-821(2012) show that the CRISPR/Cas9 system can be used for RNA programmable genome editing, and international patent application publication No. WO2013/176772 provides many examples and applications of the CRISPR/Cas endonuclease system for site-specific gene editing.
V-type CRISPR system
There are several important differences between type V CRISPR systems and type II systems. For example, Cpf1 is a single RNA-guided endonuclease lacking tracrRNA compared to type II systems. Indeed, Cpf 1-related CRISPR arrays can be processed into mature crRNA without the need for additional transactivation of the tracrRNA. V-type CRISPR arrays can be processed into short mature crrnas of 42-44 nucleotides in length, each mature crRNA starting with 19 nucleotides in a direct repeat, followed by 23-25 nucleotides of a spacer sequence. In contrast, the mature crRNA in a type II system may start with 20-24 nucleotides of the spacer sequence, followed by approximately 22 nucleotides of the direct repeat. Furthermore, Cpf1 may utilize T-rich protospacer-adjacent motifs, allowing Cpf1-crRNA complexes to efficiently cleave target DNA behind short T-rich PAMs, which are in contrast to G-rich PAMs behind target DNA of type II systems. Thus, the V-type system cuts at a point remote from the PAM, while the II-type system cuts at a point adjacent to the PAM. In addition, Cpf1 cleaves DNA via staggered DNA double strand breaks with 4 or 5 nucleotide 5' overhangs compared to type II systems. Type II systems cleave via blunt-end double strand breaks. Similar to the type II system, Cpf1 contains a predicted RuvC-like endonuclease domain, but lacks the second HNH endonuclease domain, in contrast to the type II system.
Cas gene/polypeptide and protospacer adjacent motif
Exemplary CRISPR/Cas polypeptides include Cas9 polypeptides as disclosed in Fonfara et al, Nucleic Acids Research 42:2577-2590 (2014). Since the Cas gene was discovered, the CRISPR/Cas gene naming system has undergone a number of rewrites. Fonfara et al also provide PAM sequences for Cas9 polypeptides from different species (see also SEQ ID NO: 1-620).
Compositions and methods
Provided herein are cellular, ex vivo and in vivo methods for producing permanent changes in the genome using genome engineering tools by deleting or mutating the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene. This method uses an endonuclease such as a CRISPR-associated (Cas9, Cpf1, etc.) nuclease to permanently edit within or near the genomic locus of the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene. In this way, the examples set forth in this disclosure may help reduce or eliminate expression of the ANGPTL3 gene by a single treatment (rather than providing potential treatment over the life of the patient).
Site-directed polypeptide (endonuclease, enzyme)
Site-directed polypeptides are nucleases used in genome editing to cleave DNA. The site-directed polypeptide can be administered to a cell or patient as any one of: one or more polypeptides or one or more mrnas encoding polypeptides. Any of the enzymes or orthologs listed in SEQ ID NO 1-620 or disclosed herein may be used in the methods herein.
In the context of CRISPR/Cas9 or CRISPR/Cpf1 systems, the site-directed polypeptide may bind to a guide RNA that in turn specifies the site in the target DNA to which the polypeptide is directed. In the CRISPR/Cas9 or CRISPR/Cpf1 systems disclosed herein, the site-directed polypeptide can be an endonuclease such as a DNA endonuclease.
Site-directed polypeptides can include multiple nucleic acid cleavage (i.e., nuclease) domains. Two or more nucleic acid cleavage domains may be linked together via a linker. For example, the joint may comprise a flexible joint. The length of the linker may comprise 1,2, 3,4, 5,6, 7,8, 9,10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 30, 35, 40 or more amino acids.
The naturally occurring wild-type Cas9 enzyme includes two nuclease domains: an HNH nuclease domain and a RuvC domain. Herein, the term "Cas 9" refers to both naturally occurring Cas9 and recombinant Cas 9. Cas9 enzymes contemplated herein may include HNH or HNH-like nuclease domains and/or RuvC-like nuclease domains.
The HNH or HNH-like domain comprises an McrA-like fold. The HNH or HNH-like domain comprises two antiparallel beta strands and an alpha helix. The HNH or HNH-like domain includes a metal binding site (e.g., a divalent cation binding site). The HNH or HNH-like domain can cleave one strand of the target nucleic acid (e.g., the complementary strand of the crRNA targeting strand).
The RuvC or RuvC-like domain includes an RNaseH or RNaseH-like fold. The RuvC/RNaseH domain is involved in a diverse array of nucleic acid-based functions, including acting on both RNA and DNA. The RNaseH domain comprises 5 beta strands surrounded by multiple alpha helices. The RuvC/RNaseH-like or RuvC/RNaseH-like domain includes a metal binding site (e.g., a divalent cation binding site). The RuvC/RNaseH-like or RuvC/RNaseH-like domain can cleave one strand of a target nucleic acid (e.g., a non-complementary strand of a double-stranded target DNA).
Site-directed polypeptides can introduce double-stranded breaks or single-stranded breaks in nucleic acids, such as genomic DNA. Double-strand breaks can stimulate endogenous DNA repair pathways of the cell (e.g., homology-dependent repair (HDR) or NHEJ or alternative non-homologous end joining (a-NHEJ) or microhomology-mediated end joining (MMEJ)). NHEJ can repair cleaved target nucleic acids without the need for a cognate template. This may sometimes cause small deletions and insertions (indels) at the cleavage site in the target nucleic acid and may result in disruption or alteration of gene expression. HDR can be performed when a homologous repair template or donor is available. Homologous donor templates can include sequences that are homologous to sequences flanking a target nucleic acid cleavage site. Sister chromatids can be used by cells as repair templates. However, for genome editing purposes, repair templates may be supplied as foreign nucleic acids, such as plasmids, duplex oligonucleotides, single stranded oligonucleotides, or viral nucleic acids. With exogenous donor templates, additional nucleic acid sequences (e.g., transgenes) or modifications (e.g., single or multiple base changes or deletions) can be introduced between homologous flanking regions such that the additional or altered nucleic acid sequences also become incorporated into the target locus. MMEJ may produce similar genetic results as NHEJ, in that small deletions and insertions may occur at the cleavage site. MMEJ can use several base pairs of homologous sequences flanking the cleavage site to drive favorable end-ligated DNA repair results. In some cases, it is possible that a likely repair outcome can be predicted based on analysis of potential micro-homology in the nuclease target region.
Thus, in some cases, homologous recombination can be used to insert an exogenous polynucleotide sequence into a target nucleic acid cleavage site. The exogenous polynucleotide sequence is referred to herein as a "donor polynucleotide" (or donor sequence). The donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide can be inserted into the target nucleic acid cleavage site. The donor polynucleotide can be an exogenous polynucleotide sequence, i.e., a sequence that does not naturally occur at the target nucleic acid cleavage site.
Modifications to the target DNA due to NHEJ and/or HDR may result in, for example, mutations, deletions, alterations, integrations, gene corrections, gene substitutions, gene markers, transgene insertions, nucleotide deletions, gene disruptions, translocations, and/or gene mutations. The process of deleting genomic DNA and integrating non-native nucleic acid into genomic DNA is an example of genome editing.
Site-directed polypeptides can include amino acid sequences having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to wild-type exemplary site-directed polypeptides [ e.g., Cas9 from streptococcus pyogenes, US2014/0068797 sequence ID No. 8 or Sapranauskas et al, Nucleic acid research (Nucleic Acids Res) 39(21):9275-9282(2011) ], and various other site-directed polypeptides. A site-directed polypeptide can include at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra) over 10 contiguous amino acids. A site-directed polypeptide can include up to 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra) within 10 contiguous amino acids. The site-directed polypeptide can include at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra) within 10 contiguous amino acids of the HNH nuclease domain of the site-directed polypeptide. A site-directed polypeptide can include up to 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra) within 10 contiguous amino acids of the HNH nuclease domain of the site-directed polypeptide. A site-directed polypeptide can include at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra) within 10 contiguous amino acids of the RuvC nuclease domain of the site-directed polypeptide. A site-directed polypeptide can include up to 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra) within 10 contiguous amino acids of the RuvC nuclease domain of the site-directed polypeptide.
Site-directed polypeptides can include modified forms of the wild-type exemplary site-directed polypeptides. Modified forms of wild-type exemplary site-directed polypeptides can include mutations that reduce the nucleic acid cleavage activity of the site-directed polypeptide. Modified forms of wild-type exemplary site-directed polypeptides may have less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid cleavage activity of the wild-type exemplary site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra). The modified form of the site-directed polypeptide may not have substantial nucleic acid cleavage activity. When the targeting polypeptide is in a modified form that does not have substantial nucleic acid cleavage activity, it is referred to herein as "enzyme inactivation".
The modified form of the site-directed polypeptide can include a mutation such that the mutation can induce a single-stranded break (SSB) on the target nucleic acid (e.g., by cleaving only one of the sugar-phosphate backbones of the double-stranded target nucleic acid). In some aspects, the mutation may result in less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% nucleic acid cleavage activity of one or more of the plurality of nucleic acid cleavage domains of the wild-type site-directed polypeptide (e.g., Cas9 from streptococcus pyogenes, supra). In some aspects, the mutation can result in one or more of the plurality of nucleic acid cleavage domains retaining the ability to cleave the complementary strand of the target nucleic acid but reducing its ability to cleave the non-complementary strand of the target nucleic acid. The mutation may result in one or more of the plurality of nucleic acid cleavage domains retaining the ability to cleave the non-complementary strand of the target nucleic acid but reducing its ability to cleave the complementary strand of the target nucleic acid. For example, residues such as Asp10, His840, Asn854, and Asn856 in a wild-type exemplary streptococcus pyogenes Cas9 polypeptide are mutated to inactivate one or more of the plurality of nucleic acid cleavage domains (e.g., nuclease domains). The residue to be mutated can correspond to residues Asp10, His840, Asn854, and Asn856 (e.g., as determined by sequence and/or structural alignment) in a wild-type exemplary streptococcus pyogenes Cas9 polypeptide. Non-limiting examples of mutations include D10A, H840A, N854A, or N856A. One skilled in the art will recognize that mutations other than alanine substitutions may be suitable.
In some aspects, the D10A mutation can be combined with one or more of the H840A, N854A, or N856A mutations to produce a site-directed polypeptide that substantially lacks DNA cleavage activity. The H840A mutation may be combined with one or more of the D10A, N854A, or N856A mutations to produce a site-directed polypeptide that substantially lacks DNA cleavage activity. The N854A mutation may be combined with one or more of the H840A, D10A, or N856A mutations to produce a site-directed polypeptide that substantially lacks DNA cleavage activity. The N856A mutation may be combined with one or more of the H840A, N854A, or D10A mutations to produce a site-directed polypeptide that substantially lacks DNA cleavage activity. Site-directed polypeptides that include a substantially inactivated nuclease domain are referred to as "nickases".
The specificity of CRISPR-mediated genome editing can be increased using an RNA-guided endonuclease, e.g., a nickase variant of Cas 9. Wild-type Cas9 is typically guided by a single guide RNA designed to hybridize to a specified-20 nucleotide sequence in the target sequence (e.g., an endogenous genomic locus). However, several mismatches may be tolerated between the guide RNA and the target locus, effectively reducing the length of the desired homology in the target site to, for example, as little as 13nt of homology, and thereby increasing the potential for binding and double-stranded nucleic acid cleavage, also known as off-target cleavage, of the CRISPR/Cas9 complex elsewhere in the target genome. Since the nickase variants of Cas9 each nick only one strand, in order to generate a double strand break, it is necessary to have a pair of nickases bind tightly on opposite strands of the target nucleic acid, thereby generating a pair of nicks equivalent to the double strand break. This requires that two separate guide RNAs-one for each nickase-must be tightly bound on opposite strands of the target nucleic acid. This requirement essentially doubles the minimum length of homology required for a double-strand break to occur, thereby reducing the likelihood that a double-strand cut will occur elsewhere in the genome, where the two guide RNA sites, if present, may not be close enough to each other to enable a double-strand break to form. Nickases may also be used to promote HDR and NHEJ as described in the art. HDR can be used to introduce selected alterations into target sites of a genome by using specific donor sequences that effectively mediate the desired alterations.
Contemplated mutations may comprise substitutions, additions and deletions or any combination thereof. The mutation converts the mutated amino acid into alanine. The mutation converts the mutated amino acid into another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). Mutations convert the mutated amino acid into an unnatural amino acid (e.g., selenomethionine). Mutations convert post-mutation amino acids into amino acid mimetics (e.g., phosphate mimetics). The mutation may be a conservative mutation. For example, the mutation converts the post-mutation amino acid into an amino acid that is similar in size, shape, charge, polarity, conformation, and/or rotamer to the post-mutation amino acid (e.g., cysteine/serine mutation, lysine/asparagine mutation, histidine/phenylalanine mutation). The mutation may shift the reading frame and/or generate a premature stop codon. Mutations may alter the regulatory regions of a gene or the locus that affects the expression of one or more genes.
Site-directed polypeptides (e.g., variants, post-mutation, enzyme-inactivated and/or conditionally enzyme-inactivated site-directed polypeptides) can be targeted to a nucleic acid. Site-directed polypeptides (e.g., variants, post-mutation, enzyme-inactivating, and/or conditional enzyme-inactivating endoribonucleases) can be targeted to DNA. Site-directed polypeptides (e.g., variants, post-mutation, enzyme-inactivating, and/or conditional enzyme-inactivating endoribonucleases) can target RNA.
A site-directed polypeptide can include one or more non-native sequences (e.g., a site-directed polypeptide is a fusion protein).
The site-directed polypeptide can include an amino acid sequence comprising at least 15% amino acid identity to Cas9 from a bacterium (e.g., streptococcus pyogenes), a nucleic acid binding domain, and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain).
The site-directed polypeptide can include an amino acid sequence comprising at least 15% amino acid identity to Cas9 from a bacterium (e.g., streptococcus pyogenes) and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain).
The site-directed polypeptide can include an amino acid sequence comprising at least 15% amino acid identity to Cas9 from a bacterium (e.g., streptococcus pyogenes) and two nucleic acid cleavage domains, wherein one or both of the nucleic acid cleavage domains comprise at least 50% amino acid identity to a nuclease domain of Cas9 from a bacterium (e.g., streptococcus pyogenes).
The site-directed polypeptide can include an amino acid sequence comprising at least 15% amino acid identity to Cas9 from a bacterium (e.g., streptococcus pyogenes), two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), and a non-native sequence (e.g., a nuclear localization signal) or a linker that links the site-directed polypeptide to the non-native sequence.
The site-directed polypeptide can include an amino acid sequence comprising at least 15% amino acid identity to Cas9 from a bacterium (e.g., streptococcus pyogenes), two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), wherein the site-directed polypeptide includes a mutation in one or both of the nucleic acid cleavage domains that reduces cleavage activity of the nuclease domain by at least 50%.
The site-directed polypeptide can include an amino acid sequence comprising at least 15% amino acid identity to Cas9 from a bacterium (e.g., streptococcus pyogenes) and two nucleic acid cleavage domains (i.e., an HNH domain and a RuvC domain), wherein one of the nuclease domains comprises a mutation of
The one or more site-directed polypeptides, e.g., DNA endonucleases, can include two nickases that together effect one double-strand break at a specific locus in the genome or four nickases that together effect or cause two double-strand breaks at a specific locus in the genome. Alternatively, a site-directed polypeptide such as a DNA endonuclease can effect or cause a double-strand break at a specific locus in the genome.
Non-limiting examples of Cas9 homologues from other bacterial strains include, but are not limited to, Cas proteins identified in: cyanobacteria of deep sea unicellular (Acaryochloris marina) MBIC 11017; acetobacter arabinosus (Acetohalobium arabaticum) DSM 5501; acidithiobacillus caldus (Acidithiobacillus caldus); acidithiobacillus ferrooxidans (Acidithiobacillus ferrooxidans) ATCC 23270; alicyclobacillus acidocaldarius (Alicyclobacillus acidocaldarius) LAA 1; alicyclobacillus acidocaldarius (Alicyclobacillus acidocaldarius) DSM 446; heterochromous vinous (allochromyces vinosus) DSM 180; ammoniflex degenesii
In addition to Cas9 orthologs, other Cas9 variants, such as fusion proteins of inactive dCas9 and effector domains with different functions, can serve as platforms for genetic modulation. Any of the foregoing enzymes may be used in the present disclosure.
Additional examples of endonucleases that can be utilized in the present disclosure are given in SEQ ID NO 1-620. These proteins may be modified prior to use or may be encoded in a nucleic acid sequence such as DNA, RNA or mRNA or within a vector construct such as a plasmid or AAV vector as taught herein. Further, these proteins may be codon optimized.
1-620 discloses a non-exhaustive list of endonuclease sequences.
Genome-targeted nucleic acids
The present disclosure provides genomic targeting nucleic acids that can direct the activity of a polypeptide of interest (e.g., a site-directed polypeptide) to a specific target sequence within a target nucleic acid. The genome-targeting nucleic acid may be RNA. The genomic targeting RNA is referred to herein as a "guide RNA" or "gRNA. The guide RNA can include at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest and a CRISPR repeat. In type II systems, the gRNA also includes a second RNA called a tracrRNA sequence. In type II guide rnas (grnas), CRISPR repeats and tracrRNA sequences hybridize to each other to form duplexes. In the V-type guide rna (grna), crRNA forms a duplex. In both systems, duplexes may bind the site-directed polypeptide such that the guide RNA and the site-directed polypeptide form a complex. The genomic targeting nucleic acid can provide target specificity for the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid can thus direct the activity of the site-directed polypeptide.
Exemplary guide RNAs comprise a spacer sequence of 15-200 bases, wherein the genomic position is assembled based on the GRCh38 human genome. The ANGPTL3 gene may be located on chromosome 1:62,597,486-62,606,304 (Genome Reference consensus) -GRCh 38).
An exemplary guide RNA comprises a spacer sequence based on the RNA version of the DNA sequence presented in SEQ ID NO 5,305-17, 018. As understood by one of ordinary skill in the art, each guide RNA can be designed to contain a spacer sequence that is complementary to its genomic target sequence. For example, each of the spacer sequences, such as the RNA version of the DNA sequence presented in SEQ ID NO:5,305-17,018, can be placed into a single RNA chimera or crRNA (along with the corresponding tracrRNA). See, Jinek et al, science 337,816, 821(2012) and Deltcheva et al, Nature 471,602, 607 (2011).
The genomic targeting nucleic acid can be a bimolecular guide RNA. The genomic targeting nucleic acid may be a single molecule guide RNA.
The bimolecular guide RNA may include two RNA strands. The first strand comprises in the 5 'to 3' direction an optional spacer extension, a spacer sequence and a minimal CRISPR repeat. The second strand may comprise a minimal tracrRNA sequence (complementary to the minimal CRISPR repeat), a 3' tracrRNA sequence, and optionally a tracrRNA extension sequence.
The single guide rna (sgrna) in a type II system may comprise in the 5' to 3' direction an optional spacer extension, a spacer sequence, a minimum CRISPR repeat, a single guide linker, a minimum tracrRNA sequence, a 3' tracrRNA sequence, and an optional tracrRNA extension. The optional tracrRNA extension may include elements that aid in additional functions (e.g., stability) of the guide RNA. A single-molecule guide linker can link the smallest CRISPR repeat and the smallest tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension may comprise one or more hairpins.
The sgRNA can include a 20 nucleotide spacer sequence 5' to the sgRNA sequence. The sgRNA can include a spacer sequence of less than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA can include a spacer sequence of more than 20 nucleotides at the 5' end of the sgRNA sequence. The sgRNA can include a variable length spacer sequence of 17-30 nucleotides at the 5' end of the sgRNA sequence (see table 1).
The sgRNA may not include uracil at the 3' end of the sgRNA sequence, as in the sgRNA sequence in SEQ ID NO:17,051 of table 1. The sgRNA can include one or more uracils at the 3' end of the sgRNA sequence, such as the sgRNA sequence in SEQ ID NO:17,052 in table 1. For example, the sgRNA can include 1 uracil (U) at the 3' end of the sgRNA sequence. The sgRNA can include 2 uracils (UUs) at the 3' end of the sgRNA sequence. The sgRNA can include 3 uracils (UUUs) at the 3' end of the sgRNA sequence. The sgRNA can include 4 uracils (uuuuuu) at the 3' end of the sgRNA sequence. The sgRNA can include 5 uracils (UUUUU) at the 3' end of the sgRNA sequence. The sgRNA can include 6 uracils (UUUUUU) at the 3' end of the sgRNA sequence. The sgRNA can include 7 uracils (UUUUUUU) at the 3' end of the sgRNA sequence. The sgRNA can include 8 uracils (UUUUUUUU) at the 3' end of the sgRNA sequence.
The sgrnas can be unmodified or modified. For example, a modified sgRNA can include one or more 2 '-O-methyl and/or 2' -O-methyl phosphorothioate nucleotides.
TABLE 1 unmodified sgRNA
The single molecule guide rna (sgrna) in a type V system can include a minimal CRISPR repeat and a spacer in the 5 'to 3' direction.
By way of illustration, guide RNAs or other smaller RNAs used in CRISPR/Cas9 or CRISPR/Cpf1 systems can be readily synthesized by chemical means, as illustrated below and described in the art. Although chemical synthesis procedures are expanding, purification of such RNA by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly over around a hundred nucleotides. One way to generate RNA of greater length is to produce two or more molecules linked together. Much longer RNAs such as the RNA encoding Cas9 or Cpf1 endonuclease are more easily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic production of RNA, such as modifications that enhance stability, reduce the likelihood or extent of an innate immune response, and/or enhance other attributes, as described in the art.
Space-spreading sequence
In some examples of genome-targeted nucleic acids, the spacer extension sequence may modify activity, provide stability, and/or provide a location for genome-targeted nucleic acid modification. The spacer extension sequence may modify on-target or off-target activity or specificity. In some instances, a gap spreading sequence may be provided. The length of the spacer extension sequence may be greater than 1,5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides or more. The length of the spacer spreading sequence may be less than 1,5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides in length. The spacer extension sequence may be less than 10 nucleotides in length. The spacer extension sequence may be between 10-30 nucleotides in length. The spacer extension sequence may be between 30-70 nucleotides in length.
The spacer extension sequence may include another portion (e.g., a stability control sequence, an endoribonuclease binding sequence, a ribozyme). The moiety may reduce or increase the stability of the nucleic acid targeting nucleic acid. The portion may be a transcription terminator segment (i.e., a transcription termination sequence). The moiety may function in a eukaryotic cell. The moiety may function in prokaryotic cells. The moiety may function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., 7-methylguanylate cap (m7G)), a riboswitch sequence (e.g., to allow for regulation of stability and/or regulation of accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplast, etc.), a modification or sequence that provides tracking (e.g., to direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescence detection, a sequence that allows for fluorescence detection, etc.), and/or a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.).
Spacer sequence
The spacer sequence hybridizes to a sequence in a target nucleic acid of interest. The spacer of the genome-targeted nucleic acid can interact with the target nucleic acid via hybridization (i.e., base pairing) in a sequence-specific manner. The nucleotide sequence of the spacer may vary depending on the sequence of the target nucleic acid of interest.
In the CRISPR/Cas system herein, the spacer sequence can be designed to hybridize to the target nucleic acid located 5' to the PAM of the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have a mismatch. Each Cas9 enzyme has its specific PAM sequence identified in the target DNA. For example, streptococcus pyogenes identifies a PAM in a target nucleic acid that includes the sequence 5' -NRG-3', where R includes a or G, where N is any nucleotide, and N is immediately 3' to the target nucleic acid sequence targeted by the spacer sequence.
The target nucleic acid sequence may comprise 20 nucleotides. The target nucleic acid can include less than 20 nucleotides. The target nucleic acid can include more than 20 nucleotides. The target nucleic acid can include at least 5,10, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 30, or more nucleotides. The target nucleic acid can include up to 5,10, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 30, or more nucleotides. The target nucleic acid sequence may comprise 20 bases immediately 5' of the first nucleotide of the PAM. For example, in the sequence comprising 5'-NNNNNNNNNNNNNNNNNNNNNRG-3' (SEQ ID NO:17049), the target nucleic acid can comprise a sequence corresponding to N, where N is any nucleotide and the underlined NRG sequence is Streptococcus pyogenes PAM. This target nucleic acid sequence is often referred to as a PAM strand, and the complementary nucleic acid sequence is often referred to as a non-PAM strand. One skilled in the art will recognize that the spacer sequence hybridizes to a non-PAM strand of the target nucleic acid (fig. 1A and 1B).
The spacer sequence that hybridizes to the target nucleic acid can be at least 6 nucleotides (nt) in length. The spacer sequence may be at least about 6nt, at least about 10nt, at least about 15nt, at least about 18nt, at least about 19nt, at least about 20nt, at least about 25nt, at least about 30nt, at least about 35nt, or at least about 40nt, about 6nt to about 80nt, about 6nt to about 50nt, about 6nt to about 45nt, about 6nt to about 40nt, about 6nt to about 35nt, about 6nt to about 30nt, about 6nt to about 25nt, about 6nt to about 20nt, about 6nt to about 19nt, about 10nt to about 50nt, about 10nt to about 45nt, about 10nt to about 40nt, about 10nt to about 35nt, about 10nt to about 30nt, about 10nt to about 25nt, about 10nt to about 20nt, about 10nt to about 19nt, about 19nt to about 25nt, about 19nt to about 30nt, about 19nt to about 35nt, about 19nt to about 40nt, about 19nt to about 45nt, about 50nt to about 50nt, about 10nt to about 30nt, about 35nt, about 30nt, about 19 to about 30nt, about 19 to about 30nt, About 20nt to about 25nt, about 20nt to about 30nt, about 20nt to about 35nt, about 20nt to about 40nt, about 20nt to about 45nt, about 20nt to about 50nt, or about 20nt to about 60 nt. In some examples, the spacer sequence may include 20 nucleotides. In some examples, the spacer sequence may include 19 nucleotides. In some examples, the spacer may include 18 nucleotides. In some examples, the spacer may include 22 nucleotides.
In some examples, the percent complementarity between the spacer sequence and the non-PAM strand of the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some examples, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. The percent complementarity between the spacer sequence and the target nucleic acid can be at least 60% over about 20 consecutive nucleotides. The spacer sequence and the target nucleic acid can differ in length by 1 to 6 nucleotides, which can be considered as one or more bulges.
The spacer sequence may be designed or selected using a computer program. The computer program may use variables such as: predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic background, chromatin accessibility, GC%, genomic frequency of occurrence (e.g., genomic frequency of occurrence of sequences that are identical or similar but differ at one or more spots due to mismatches, insertions, or deletions), methylation status, presence of SNPs, and the like.
Minimal CRISPR repeat
In some aspects, the minimal CRISPR repeat is a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference CRISPR repeat (e.g., a crRNA from streptococcus pyogenes).
In some aspects, the minimal CRISPR repeat comprises a nucleotide that can hybridize to a minimal tracrRNA sequence in a cell. The minimum CRISPR repeat and the minimum tracrRNA sequence may form a duplex, i.e. a base-pairing double-stranded structure. The minimum CRISPR repeat and the minimum tracrRNA sequence may together be bound to a site-directed polypeptide. At least a portion of the minimal CRISPR repeat can hybridize to the minimal tracrRNA sequence. In some aspects, at least a portion of the smallest CRISPR repeat comprises at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the smallest tracrRNA sequence. At least a portion of the minimum CRISPR repeat can comprise at most about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum tracrRNA sequence.
The length of the minimum CRISPR repeat can be from about 7 nucleotides to about 100 nucleotides. For example, the length of the minimum CRISPR repeat is about 7 nucleotides (nt) to about 50nt, about 7nt to about 40nt, about 7nt to about 30nt, about 7nt to about 25nt, about 7nt to about 20nt, about 7nt to about 15nt, about 8nt to about 40nt, about 8nt to about 30nt, about 8nt to about 25nt, about 8nt to about 20nt, about 8nt to about 15nt, about 15nt to about 100nt, about 15nt to about 80nt, about 15nt to about 50nt, about 15nt to about 40nt, about 15nt to about 30nt, or about 15nt to about 25 nt. In some aspects, the length of the minimum CRISPR repeat is about 9 nucleotides. In some aspects, the length of the minimum CRISPR repeat is about 12 nucleotides.
The minimum CRISPR repeat can be at least about 60% identical to a reference minimum CRISPR repeat (e.g., a wild-type crRNA from streptococcus pyogenes) over a stretch of at least 6,7, or 8 contiguous nucleotides. For example, the minimum CRISPR repeat can be at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to a reference minimum CRISPR repeat over a stretch of at least 6,7, or 8 contiguous nucleotides.
Minimum tracrRNA sequence
The minimum tracrRNA repeat may be a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a wild-type tracrRNA from streptococcus pyogenes).
The minimal tracrRNA sequence may comprise nucleotides that hybridize to the minimal CRISPR repeat in the cell. The minimal tracrRNA sequence and the minimal CRISPR repeat form a duplex, i.e. a base-pairing double-stranded structure. The smallest tracrRNA sequence and the smallest CRISPR repeat can be bound together to a site-directed polypeptide. At least a portion of the smallest tracrRNA sequence can hybridize to the smallest CRISPR repeat. The minimum tracrRNA sequence may be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum CRISPR repeat.
The minimum tracrRNA sequence may be from about 7 nucleotides to about 100 nucleotides in length. For example, the length of the minimum tracrRNA sequence may be about 7 nucleotides (nt) to about 50nt, about 7nt to about 40nt, about 7nt to about 30nt, about 7nt to about 25nt, about 7nt to about 20nt, about 7nt to about 15nt, about 8nt to about 40nt, about 8nt to about 30nt, about 8nt to about 25nt, about 8nt to about 20nt, about 8nt to about 15nt, about 15nt to about 100nt, about 15nt to about 80nt, about 15nt to about 50nt, about 15nt to about 40nt, about 15nt to about 30nt, or about 15nt to about 25 nt. The minimum tracrRNA sequence may be about 9 nucleotides in length. The minimum tracrRNA sequence may be about 12 nucleotides in length. The minimum tracrRNA may consist of tracrRNA as described by Jinek et al, supra, with nt ranging from 23 to 48.
The minimum tracrRNA sequence may be at least about 60% identical to a reference minimum tracrRNA (e.g., a wild-type tracrRNA from streptococcus pyogenes) sequence over a stretch of at least 6,7, or 8 contiguous nucleotides. For example, the smallest tracrRNA sequence may be at least about 65% identical, at least about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical to the reference smallest tracrRNA sequence over a stretch of at least 6,7, or 8 consecutive nucleotides.
The duplex between min CRISPR RNA and min tracrRNA may comprise a double helix. The duplex between the smallest CRISPR RNA and the smallest tracrRNA can include at least about 1,2, 3,4, 5,6, 7,8, 9, or 10 or more nucleotides. The duplex between the smallest CRISPR RNA and the smallest tracrRNA can include up to about 1,2, 3,4, 5,6, 7,8, 9, or 10 or more nucleotides.
The duplex may include mismatches (i.e., the two strands of the duplex are not 100% complementary). The duplex may comprise at least about 1,2, 3,4 or 5 or mismatches. The duplex may comprise up to about 1,2, 3,4 or 5 or mismatches. The duplex may include no more than 2 mismatches.
Projection
In some cases, there may be a "bump" in the duplex between the smallest CRISPR RNA and the smallest tracrRNA. A bulge is an unpaired region of nucleotides within a duplex. The projections can assist in binding the duplexes to the site-directed polypeptide. The bulge may comprise an unpaired 5'-rrrn-3' (SEQ ID NO:17,053) on one side of the duplex and an unpaired nucleotide region on the other side of the duplex, where r is any purine and n comprises nucleotides that may form wobble pairs with nucleotides on the opposite strand. The number of unpaired nucleotides on both sides of the duplex may be different.
In one example, a bulge can include an unpaired purine (e.g., adenine) on the minimum CRISPR repeat strand of the bulge. In some examples, the bulge can comprise an unpaired 5'-AAGn-3' (SEQ ID NO:17,067) of the smallest tracrRNA sequence strand of the bulge, wherein n comprises a nucleotide that can form a wobble pair with a nucleotide on the smallest CRISPR repeat strand.
The bulge on the smallest CRISPR repeat side of the duplex can comprise at least 1,2, 3,4, or 5 or more unpaired nucleotides. The bulge on the smallest CRISPR repeat side of the duplex can comprise at most 1,2, 3,4, or 5 or more unpaired nucleotides. The bulge on the smallest CRISPR repeat side of the duplex can comprise 1 unpaired nucleotide.
The bulge on the smallest tracrRNA sequence side of the duplex may comprise at least 1,2, 3,4, 5,6, 7,8, 9, or 10 or more unpaired nucleotides. The bulge on the smallest tracrRNA sequence side of the duplex may comprise at most 1,2, 3,4, 5,6, 7,8, 9 or 10 or more unpaired nucleotides. The bulge on the second side of the duplex (e.g., the smallest tracrRNA sequence side of the duplex) may comprise 4 unpaired nucleotides.
The protrusion may comprise at least one wobble pair. In some examples, the protrusion may include at most one wobble pair. The projection can include at least one purine nucleotide. The projections may include at least 3 purine nucleotides. The bulge sequence may comprise at least 5 purine nucleotides. The raised sequence may include at least one guanine nucleotide. In some examples, the bulge sequence can include at least one adenine nucleotide.
Hair clip
In various examples, one or more hairpins can be located 3 'to the smallest tracrRNA in the 3' tracrRNA sequence.
The hairpin may start at about 1,2, 3,4, 5,6, 7,8, 9,10, 15, or 20 or more nucleotides from 3' of the last pairing nucleotide in the minimum CRISPR repeat and the minimum tracrRNA sequence duplex. The hairpin may start at most about 1,2, 3,4, 5,6, 7,8, 9, or 10 or more nucleotides from 3' of the last pairing nucleotide in the smallest CRISPR repeat and the smallest tracrRNA sequence duplex.
Hairpins can include at least about 1,2, 3,4, 5,6, 7,8, 9,10, 15, or 20 or more contiguous nucleotides. Hairpins can include up to about 1,2, 3,4, 5,6, 7,8, 9,10, 15, or more contiguous nucleotides.
A hairpin may include CC dinucleotides (i.e., two consecutive cytosine nucleotides).
A hairpin may include duplex nucleotides (e.g., nucleotides in the hairpin that hybridize together). For example, the hairpin may include a CC dinucleotide that hybridizes to a GG dinucleotide in a hairpin duplex of a 3' tracrRNA sequence.
One or more of the hairpins can interact with the guide RNA interaction region of the site-directed polypeptide.
In some examples, there are two or more hairpins, and in other examples, there are three or more hairpins.
3' tracrRNA sequence
The 3' tracrRNA sequence may comprise a sequence having at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a wild-type tracrRNA from streptococcus pyogenes).
The 3' tracrRNA sequence may be from about 6 nucleotides to about 100 nucleotides in length. For example, the 3' tracrRNA sequence may be about 6 nucleotides (nt) to about 50nt, about 6nt to about 40nt, about 6nt to about 30nt, about 6nt to about 25nt, about 6nt to about 20nt, about 6nt to about 15nt, about 8nt to about 40nt, about 8nt to about 30nt, about 8nt to about 25nt, about 8nt to about 20nt, about 8nt to about 15nt, about 15nt to about 100nt, about 15nt to about 80nt, about 15nt to about 50nt, about 15nt to about 40nt, about 15nt to about 30nt, or about 15nt to about 25nt in length. The 3' tracrRNA sequence may be about 14 nucleotides in length.
The 3' tracrRNA sequence may be at least about 60% identical to a reference 3' tracrRNA sequence (e.g., a wild-type 3' tracrRNA sequence from streptococcus pyogenes) over a stretch of at least 6,7, or 8 contiguous nucleotides. For example, the 3' tracrRNA sequence may be at least about 60% identical, about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical to a reference 3' tracrRNA sequence (e.g., a wild-type 3' tracrRNA sequence from streptococcus pyogenes) over a stretch of at least 6,7, or 8 contiguous nucleotides.
The 3' tracrRNA sequence may comprise more than one duplex region (e.g., hairpin, hybridization region). The 3' tracrRNA sequence may comprise two duplex regions.
The 3' tracrRNA sequence may include a stem-loop structure. The stem-loop structure in the 3' tracrRNA may comprise at least 1,2, 3,4, 5,6, 7,8, 9,10, 15 or 20 or more nucleotides. The stem-loop structure in the 3' tracrRNA may comprise up to 1,2, 3,4, 5,6, 7,8, 9 or 10 or more nucleotides. The stem-loop structure may comprise a functional portion. For example, the stem-loop structure can include an aptamer, ribozyme, protein-interacting hairpin, CRISPR array, intron, or exon. The stem-loop structure may comprise at least about 1,2, 3,4 or 5 or more functional moieties. The stem-loop structure may comprise up to about 1,2, 3,4 or 5 or more functional moieties.
The hairpin in the 3' tracrRNA sequence may include a P domain. In some examples, the P domain may comprise a double-stranded region in a hairpin.
tracrRNA extension sequences
The tracrRNA extension sequence may be provided whether in the context of a single molecule guide or a double molecule guide. the tracrRNA extension sequence may be from about 1 nucleotide to about 400 nucleotides in length. the length of the tracrRNA extension sequence may be greater than 1,5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or 400 nucleotides. the tracrRNA extension sequence may be about 20 to about 5000 or more nucleotides in length. the tracrRNA extension sequence may be greater than 1000 nucleotides in length. the length of the tracrRNA extension sequence may be less than 1,5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or 400 nucleotides. the length of the tracrRNA extension sequence may be less than 1000 nucleotides. the tracrRNA extension sequence may be less than 10 nucleotides in length. the tracrRNA extension sequence may be 10-30 nucleotides in length. the tracrRNA extension sequence may be 30-70 nucleotides in length.
the tracrRNA extension sequence may include functional portions (e.g., stability control sequences, ribozymes, endoribonuclease binding sequences). The functional portion may include a transcription terminator segment (i.e., a transcription termination sequence). The functional moiety may have a total length of about 10 nucleotides (nt) to about 100 nucleotides, about 10nt to about 20nt, about 20nt to about 30nt, about 30nt to about 40nt, about 40nt to about 50nt, about 50nt to about 60nt, about 60nt to about 70nt, about 70nt to about 80nt, about 80nt to about 90nt, or about 90nt to about 100nt, about 15nt to about 80nt, about 15nt to about 50nt, about 15nt to about 40nt, about 15nt to about 30nt, or about 15nt to about 25 nt. The functional moiety may function in a eukaryotic cell. Functional moieties may function in prokaryotic cells. Functional moieties may function in both eukaryotic and prokaryotic cells.
Non-limiting examples of suitable tracrRNA expansion functional moieties include: a 3' polyadenylation tail, a riboswitch sequence (e.g., to allow for regulation of stability and/or regulation of accessibility by proteins and protein aggregates), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplast, etc.), a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.). the tracrRNA extension sequence may include a primer binding site or a molecular indicator (e.g., a barcode sequence). the tracrRNA extension sequence may comprise one or more affinity tags.
Single molecule guide joint sequence
The linker sequence of the single molecule guide nucleic acid may be from about 3 nucleotides to about 100 nucleotides in length. For example, in Jinek et al, science 337(6096):816-821(2012) supra, a simple 4-nucleotide "tetracycle" (-GAAA-) is used. Illustrative linkers are about 3 nucleotides (nt) to about 90nt, about 3nt to about 80nt, about 3nt to about 70nt, about 3nt to about 60nt, about 3nt to about 50nt, about 3nt to about 40nt, about 3nt to about 30nt, about 3nt to about 20nt, about 3nt to about 10nt in length. For example, the length of the linker may be about 3nt to about 5nt, about 5nt to about 10nt, about 10nt to about 15nt, about 15nt to about 20nt, about 20nt to about 25nt, about 25nt to about 30nt, about 30nt to about 35nt, about 35nt to about 40nt, about 40nt to about 50nt, about 50nt to about 60nt, about 60nt to about 70nt, about 70nt to about 80nt, about 80nt to about 90nt, or about 90nt to about 100 nt. The linker for the single molecule guide nucleic acid may be between 4 nucleotides and 40 nucleotides. The linker can be at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. The linker may be up to about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.
The linker may comprise any of a variety of sequences, but in some instances the linker will not comprise a sequence of a large number of regions with homology to other portions of the guide RNA, which may cause intramolecular binding that may interfere with other functional regions of the guide. In Jinek et al, science 337(6096):816-821(2012) supra, the simple 4 nucleotide sequence-GAAA-is used, but many other sequences including longer sequences can be used as well.
The linker sequence may comprise a functional moiety. For example, the linker sequence may include one or more features comprising an aptamer, a ribozyme, a protein-interacting hairpin, a protein binding site, a CRISPR array, an intron, or an exon. The linker sequence may comprise at least about 1,2, 3,4 or 5 or more functional moieties. In some examples, a linker sequence may include up to about 1,2, 3,4, or 5 or more functional moieties.
Nucleic acid modification (chemical and structural modification)
In some aspects, the polynucleotide introduced into the cell may include one or more modifications that may be used, alone or in combination, to, for example, increase activity, stability or specificity, alter delivery, reduce an innate immune response in a host cell, or for other enhancements, as further described herein and known in the art.
In certain examples, modified polynucleotides may be used in CRISPR/Cas9 or CRISPR/Cpf1 systems, in which case the guide RNA (single or double molecule guide) and/or the DNA or RNA encoding the Cas9 or Cpf1 endonuclease introduced into the cell may be modified, as described and illustrated below. Such modified polynucleotides may be used in CRISPR/Cas9 or CRISPR/Cpf1 systems to edit any one or more genomic loci.
Using the CRISPR/Cas9 or CRISPR/Cpf1 system for the purpose of non-limiting illustration of such use, modifications to the guide RNA, which may be a single molecule guide or a bilayer, can be used to enhance the formation and stability of the CRISPR/Cas9 or CRISPR/Cpf1 genome editing complex comprising the guide RNA and the Cas9 or Cpf1 endonuclease. Modifications to the guide RNA can also or alternatively be used to enhance initiation, stability, or kinetics of an interaction between the genome editing complex and a target sequence in the genome, which can be used, for example, to increase on-target activity. Modifications to the guide RNA can also or alternatively be used to enhance specificity, e.g., the relative rate of genome editing at the mid-target site compared to the effects at other (off-target) sites.
The modification may also or alternatively be used to increase the stability of the guide RNA, for example by increasing the resistance of the guide RNA to degradation by ribonucleases (rnases) present in the cell, thereby increasing the half-life of the guide RNA in the cell. Modifications that enhance the half-life of the guide RNA can be particularly useful in introducing Cas9 or Cpf1 endonuclease into a cell to be edited via RNA that requires translation to generate the endonuclease, since increasing the half-life of the guide RNA introduced while the RNA encodes the endonuclease can be used to increase the time for which the guide RNA and the encoded Cas9 or Cpf1 endonuclease co-exist in the cell.
Modifications may also or alternatively be used to reduce the likelihood or extent that RNA introduced into a cell elicits an innate immune response. Such responses, which have been well characterized in the context of RNA interference (RNAi) including small interfering RNA (sirna), as described below and in the art, are often associated with a reduction in the half-life of the RNA and/or with the elicitation of cytokines or other factors associated with the immune response.
One or more types of modifications may also be made to RNA introduced into the cell that encodes the endonuclease, including, but not limited to, modifications that enhance the stability of the RNA (such as degradation thereof by increasing the presence of RNases in the cell), modifications that enhance translation of the resulting product (i.e., the endonuclease), and/or modifications that reduce the likelihood or extent to which the RNA introduced into the cell elicits an innate immune response.
Combinations of modifications such as the foregoing and other modifications may also be used. For example, in the case of CRISPR/Cas9 or CRISPR/Cpf1, one or more types of modifications may be made to the guide RNA (including the modifications exemplified above) and/or one or more types of modifications may be made to the RNA encoding the Cas endonuclease (including the modifications exemplified above).
By way of illustration, guide RNAs or other smaller RNAs used in CRISPR/Cas9 or CRISPR/Cpf1 systems can be readily synthesized by chemical means, enabling many modifications to be readily incorporated, as illustrated below and described in the art. Although chemical synthesis procedures are expanding, purification of such RNA by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly over around a hundred nucleotides. One way in which chemically modified RNA of greater length can be generated is to produce two or more molecules linked together. Much longer RNAs, such as the RNA encoding Cas9 endonuclease, are more easily generated enzymatically. While fewer types of modifications may be useful in enzymatically produced RNA, there are still modifications that may be useful, for example, to enhance stability, reduce the likelihood or extent of an innate immune response, and/or enhance other attributes, as described further below and in the art; and new types of modifications are being developed periodically.
By way of illustration of various types of modifications, particularly those frequently used with smaller chemically synthesized RNAs, the modifications may include one or more nucleotides modified at the 2 'position of the sugar, which in some aspects are 2' -O-alkyl, 2 '-O-alkyl, or 2' -fluoro modified nucleotides. In some examples, the RNA modification comprises a2 '-fluoro, 2' -amino, or 2 '-O-methyl modification on a pyrimidine, ribose without a base residue, or an inverted base at the 3' end of the RNA. Such modifications are often incorporated into oligonucleotides, and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) for a given target than 2' -deoxyoligonucleotides.
Many nucleotide and nucleoside modifications have been shown to make the oligonucleotides into which they are incorporated more resistant to nuclease digestion than the natural oligonucleotides; these modified oligonucleotides remain intact for a longer period of time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising a modified backbone, for example, phosphorothioate, phosphotriester, methylphosphonate, short chain alkyl or cycloalkyl intersugar linkages, or short chain heteroatom or heterocyclic intersugar linkages. Some oligonucleotides are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, in particular CH2-NH-O-CH2、CH、～N(CH3)、～N(CH3)～O～CH2(referred to as methylene (methylimino) or MMI backbone), CH2-O-N(CH3)-CH2、CH2-N(CH3)-N(CH3)-CH2And O-N (CH)3)-CH2-CH2A backbone, wherein the natural phosphodiester backbone is represented by O-P-O-CH; backbone of amino compound [ see De Mesmaeker et al, evaluation of chemical research (ace. chem. Res.) 28:366-374(1995)](ii) a Morpholino backbone structures (see Summerton and Weller, U.S. patent No. 5,034,506); peptide Nucleic Acid (PNA) backbones (where the phosphodiester backbone of an oligonucleotide is replaced with a polyamide backbone and the nucleotide is bound directly or indirectly to the aza nitrogen atom of the polyamide backbone, see Nielsen et al, science 1991,254,1497). Phosphorus-containing bonds include, but are not limited to: thiophosphates, chiral thiophosphates, dithiophosphates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates (including 3 'alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (including 3' -phosphoramidate and aminoalkyl phosphoramidates), thiocarbonylphosphonamide esters, thiocarbonylphosphonamidesAlkylphosphonates, thiocarbonylalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these esters, and those esters having reversed polarity wherein adjacent pairs of nucleoside units are linked in 3'-5' to 5'-3' or 2'-5' to 5 '-2'; see U.S. Pat. nos. 3,687,808, 4,469,863, 4,476,301, 5,023,243, 5,177,196, 5,188,897, 5,264,423, 5,276,019, 5,278,302, 5,286,717, 5,321,131, 5,399,676, 5,405,939, 5,453,496, 5,455,233, 5,466,677, 5,476,925, 5,519,126, 5,536,821, 5,541,306, 5,550,111, 5,563,253, 5,571,799, 5,587,361 and 5,625,050.
Morpholino-based oligomeric compounds are described in the following: braasch and David Corey, Biochemistry (Biochemistry) 41(14) 4503-4510 (2002); genetics (genetics) at Vol.30, No. 3 (2001); heasman, developmental biology (Dev. biol.) 243:209-214 (2002); nasevicius et al, Nature genetics (nat. Genet.) 26:216-220 (2000); lacerra et al, Proc. Natl. Acad. Sci., 97:9591-9596 (2000); and U.S. patent No. 5,034,506 issued on 23/7 in 1991.
Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al, J.Am.chem.Soc.) (122: 8595-8602 (2000).
Wherein the modified oligonucleotide backbone that does not contain a phosphorus atom has a backbone formed from: short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom internucleoside linkages or heterocyclic internucleoside linkages. These backbones include: those backbones having morpholino linkages (formed in part from the sugar portion of the nucleoside); a siloxane backbone; sulfide, sulfoxide and sulfone backbones; a methylacetyl (formacetyl) and thiomethylacetyl (thioacetacyl) backbone; methylene and thio-methyl acetyl backbones; an olefin-containing backbone; a sulfamate backbone; methylene imino and methylene hydrazino backbones; sulfonic acid ester and sulfonamide mainA chain; an amide backbone; and N, O, S and CH are mixed2Those of the component parts; see U.S. patent nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,264,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, 5,470,967, 5,489,677, 5,541,307, 5,561,225, 5,596,086, 5,602,240, 5,610,289, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437 and 5,677,439.
May also comprise one or more substituted sugar moieties, e.g. one of the following at the 2' position: OH, SH, SCH3、F、OCN、OCH3、OCH3O(CH2)n CH3、O(CH2)n NH2Or O (CH)2)n CH3Wherein n is 1 to about 10; c1 to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; cl; br; CN; CF (compact flash)3；OCF3(ii) a O-, S-or N-alkyl; o-, S-or N-alkenyl; SOCH3；SO2CH3；ONO2；NO2；N3；NH2(ii) a A heterocycloalkyl group; a heterocycloalkylaryl group; an aminoalkylamino group; a polyalkylamino group; a substituted silyl group; an RNA cleavage group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or groups for improving the pharmacodynamic properties of the oligonucleotide, and other substituents with similar properties. In some aspects, the modification comprises 2 '-methoxyethoxy (2' -O-CH)2CH2OCH3Also known as 2' -O- (2-methoxyethyl)) (Martin et al, reported in Heiv chemistry 1995 (Heiv. Chim. acta), 78, 486). Other modifications include 2 '-methoxy (2' -OCH)3)2 '-propoxy (2' -OCH)2CH2CH3) And 2 '-fluoro (2' -F). Similar modifications may also be made at other positions on the oligonucleotide, particularly at the 3 'position of the sugar on the 3' terminal nucleotide and at the 5 'position of the 5' terminal nucleotide. The oligonucleotide may also have a sugar mimetic, such as cyclobutyl in place of pentofuranosyl.
In some examples, the sugar and internucleoside linkages, i.e., the backbone, of the nucleotide unit may be replaced by novel groups. The base unit can be maintained hybridized to an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is known as Peptide Nucleic Acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide may be replaced with an amide-containing backbone, such as an aminoethylglycine backbone. The nucleobases may be retained and bound directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Pat. nos. 5,539,082, 5,714,331 and 5,719,262. Additional teachings of PNA compounds can be found in Nielsen et al, science 254:1497-1500 (1991).
Additionally or alternatively, guide RNAs may also comprise nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, an "unmodified" or "native" nucleobase comprises adenine (a), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases that are only rarely or transiently found in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines (particularly 5-methylcytosine (also known as 5-methyl-2' deoxycytidine and often referred to in the art as 5-Me-C)), 5-Hydroxymethylcytosine (HMC), glycosyl HMC and gentiobiosyl HMC, and synthetic nucleobases such as 2-aminoadenine, 2- (methylamino) adenine, 2- (indazolylmethyl) adenine, 2- (aminomethyl amino) adenine or other heterosubstituted methyladenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyl uracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine and 2, 6-diaminopurine. Kornberg, a., "DNA Replication" (DNA Replication), frieman, w.h. freeman & Co., san francisco, pages 75 to 77 (1980); gebeyehu et al, nucleic acids research (Nucl. acids Res.) 15:4513 (1997). "universal" bases known in the art, e.g., inosine, may also be included. It has been shown that 5-Me-C substitutions increase nucleic acid duplex stability by 0.6-1.2 deg.C (Sanghvi, Y.S., crook, S.T. and Lebleu, eds. B., "Antisense Research and Applications (Antisense Research and Applications), CRC Press, Pokaraton, 1993, pages 276 to 278), and are in the area of base substitutions.
Modified nucleobases can include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil; 2-thiothymine and 2-thiocytosine; 5-halouracils and cytosines; 5-propynyl uracils and cytosines; 6-azouracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy and other 8-substituted adenines and guanines; 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3-deazaguanine and 3-deazaadenine.
Further, nucleobases may include those disclosed in: U.S. Pat. nos. 3,687,808; brief Encyclopedia of Polymer Science And Engineering (The Concise Encyclopedia of Polymer Science And Engineering), pp 858 to 859, Kroschwitz, J.I. eds, John Wiley's father-son (John Wiley & Sons), 1990; (ii) a Englisch et al, International edition of applied chemistry (Angewandle Chemie), 1991,30, page 613; and Sanghvi, y.s., chapter 15, antisense research and applications, pages 289 to 302, crook, s.t. and Lebleu, eds, b, CRC press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present disclosure. These nucleobases include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. It has been shown that 5-methylcytosine substitutions increase nucleic acid duplex stability by 0.6-1.2 ℃ (Sanghvi, Y.S., crook, S.T. and Lebleu, eds. B., "antisense research and applications", CRC Press, Pokaraton, 1993, pages 276 to 278) and are in the area of base substitutions, even more particularly in combination with 2' -O-methoxyethyl sugar modifications. Modified nucleobases are described in the following: U.S. Pat. nos. 3,687,808 and 4,845,205, 5,130,302, 5,134,066, 5,175,273, 5,367,066, 5,432,272, 5,457,187, 5,459,255, 5,484,908, 5,502,177, 5,525,711, 5,552,540, 5,587,469, 5,596,091, 5,614,617, 5,681,941, 5,750,692, 5,763,588, 5,830,653, 6,005,096, and U.S. patent application publication 2003/0158403.
Thus, the term "modified" refers to an unnatural sugar, phosphate, or base that is incorporated into a guide RNA, an endonuclease, or both a guide RNA and an endonuclease. It is not necessary to modify all positions in a given oligonucleotide uniformly, and in fact, more than one of the above-described modifications may be incorporated into a single oligonucleotide or even a single nucleoside within an oligonucleotide.
The guide RNA and/or mRNA (or DNA) encoding the endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Some parts include, but are not limited to: lipid fractions, such as the cholesterol fraction [ Letsinger et al, Proc. Natl. Acad. Sci. USA 86:6553-6556(1989) ]; cholic acid [ Manoharan et al, Rapid report of Bio-organic chemistry and medicinal chemistry (bioorg.Med.chem.Let.) ] 4:1053-1060(1994) ]; thioethers, such as hexyl-S-trityl mercaptan [ Manohara et al, Ann.N.Y.Acad.Sci.) ] 660:306-309(1992) and Manohara et al, J.Bioorgano chemistry and medicinal chemistry letters 3:2765-2770(1993) ]; mercaptocholesterol [ Oberhauser et al, nucleic acids Res. 20: 533-; fatty chains, such as dodecyl glycol or undecyl residues [ Kabanov et al, "FEBS letters 259:327 (1990) and Svinarchuk et al, biochemistry (Biochimie) 75:49-54(1993) ]; phospholipids such as dicetyl-rac-glycerol or triethylammonium 1, 2-di-O-hexadecyl-rac-propanetriyl-3-H-phosphate [ Manohara et al, Tetrahedron letters 36:3651-3654(1995) and Shea et al, nucleic acids Res 18:3777-3783(1990) ]; polyamine or polyethylene glycol chains [ Mancharan et al, Nucleosides and Nucleotides (Nucleotides) 14:969-973(1995) ]; adamantane acetic acid [ Manoharan et al, tetrahedron letters 36:3651-3654(1995) ]; palm-based moieties [ Mishra et al, biochem. Biophys. acta 1264:229-237(1995) ]; or a stearylamine or hexylamine-carbonyl-t-hydroxycholesterol moiety [ crook et al, journal of pharmacology and Experimental therapeutics (J.Pharmacol. Exp. Ther.) 277: 923-. See also U.S. Pat. nos. 4,828,979, 4,948,882, 5,218,105, 4,948,882, 5,138,045, 4,948,882, 365,082,830, 4,948,882, 3675,3672, 4,948,882, 3675, 4,948,882, 3675, 4,948,882, 3675,3672, 367,3672, 4,948,882, 3675, 4,948,882, 3675, 367,3672, 4,948,882, 3675, 36.
Sugars or other moieties can be used to target proteins and complexes including nucleotides, such as cationic polysomes and liposomes, to specific sites. For example, hepatocyte directed transfer may be mediated via asialoglycoprotein receptor (ASGPR); see, e.g., Hu et al, Protein peptide letters 21(10) 1025-30 (2014). Other systems known in the art and regularly developed can be used to target the biomolecules and/or complexes thereof used in this case to a particular target cell of interest.
These targeting molecules or conjugates can comprise a conjugate group covalently bound to a functional group, such as a primary or secondary hydroxyl group. The conjugate bases of the present disclosure comprise an intercalator, a reporter, a polyamine, a polyamide, a polyethylene glycol, a polyether, a group that enhances the pharmacodynamic properties of an oligomer, and a group that enhances the pharmacokinetic properties of an oligomer. Typical conjugate groups include cholesterol, lipids, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes. In the context of the present disclosure, groups that enhance pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or enhance sequence-specific hybridization to a target nucleic acid. In the context of the present disclosure, a group that enhances a pharmacokinetic property comprises a group that improves uptake, distribution, metabolism, or excretion of a compound of the present disclosure. Representative conjugate groups are disclosed in International patent application No. PCT/US92/09196 (published as WO1993/007883) and U.S. Pat. No. 6,287,860, filed on 23/10 of 1992. Conjugate moieties include, but are not limited to, lipid moieties such as cholesterol moieties, cholic acids, thioethers (e.g., hexyl-5-tritylthiol), mercaptocholesterol, fatty chains (e.g., dodecyl glycol or undecyl residues), phospholipids (e.g., di-hexadecyl-rac-glycerol or triethylammonium 1, 2-di-O-hexadecyl-rac-tripropyl-3-H-phosphonate), polyamine or polyethylene glycol chains, or adamantane acetic acid, palmityl moieties, or octadecylamine or hexylamino-carbonyl-hydroxycholesterol moieties. See, for example, U.S. Pat. nos. 4,828,979, 4,948,882, 5,218,105, 4,948,882, 5,138,045, 4,948,882, 371, 4,948,882, 365,082,830, 4,948,882, 365,3672, 4,948,882, 365,3672, 4,948,882, 3675, 4,948,882, 367,3672, 4,948,882, 367,3672, 4,948,882, 367,367,3672, 4,948,882, 367,3672, 4,948,882, 367,3675.
Longer polynucleotides, which are less amenable to chemical synthesis and are typically produced by enzymatic synthesis, can also be modified by various means. Such modifications may include, for example, the introduction of certain nucleotide analogs, the incorporation of specific sequences or other moieties at the 5 'end or 3' end of the molecule, and other modifications. By way of illustration, mRNA encoding Cas9 is about 4kb in length and can be synthesized by in vitro transcription. Modifications to mRNA can be applied, for example, to increase its translation or stability (e.g., by increasing its resistance to degradation by the cell) or to reduce the tendency of the RNA to elicit the innate immune response typically observed in cells following introduction of exogenous RNA, particularly longer RNAs such as the RNA encoding Cas 9.
Many such modifications have been described in the art, such as a poly-a tail, a 5' cap analogue (e.g., an anti-inversion cap analogue (ARCA) or m7G (5') ppp (5') g (mcap)), a modified 5' or 3' untranslated region (UTR), the use of modified bases (such as pseudo-UTP, 2-thio-UTP, 5-methylcytidine-5 ' -triphosphate (5-methyl-CTP) or N6-methyl-ATP), or treatment with phosphatases to remove the 5' terminal phosphate. These and other modifications are known in the art and new modifications to RNA are being developed on a regular basis.
Modified RNA has many commercial suppliers, including, for example, TriLink Biotech, AxoLabs, Bio-Synthesis Inc., Dharmacon, etc. For example, 5-methyl-CTP can be used to confer desirable properties such as increased nuclease stability, increased translation, or reduced interaction of innate immune receptors with RNA transcribed in vitro, as described by TriLink. It has been shown that 5-methylcytidine-5' -triphosphate (5-methyl-CTP), N6-methyl-ATP, and also pseudo-UTP and 2-thio-UTP, also reduce innate immune stimulation in culture and in vivo, while enhancing translation, as described in the Kormann et al and Warren et al publications referenced below.
It has been shown that improved therapeutic effects can be achieved using chemically modified mrnas delivered in vivo; see, e.g., Kormann et al, Nature Biotechnology 29,154-157 (2011). Such modifications may, for example, be used to increase the stability and/or reduce the immunogenicity of the RNA molecule. By using chemical modifications such as pseudo U, N6-methyl-a, 2-thio-U and 5-methyl-C, it was found that the substitution of only one-fourth of the uridine and cytidine residues with 2-thio-U and 5-methyl-C, respectively, resulted in a significant reduction in toll-like receptor (TLR) -mediated recognition of mRNA in mice. These modifications can be used to effectively increase the in vivo stability and longevity of mRNA by reducing activation of the innate immune system; see, e.g., Kormann et al, supra.
It has also been shown that repeated administration of synthetic messenger RNAs incorporating modifications designed to bypass the innate anti-viral response can reprogram differentiated human cells to be pluripotent. See, e.g., Warren et al, Cell Stem Cell (7), (5), 618-30 (2010). This modified mRNA, which acts as a primary reprogramming protein, would be an efficient means to reprogram a variety of human cell types. Such cells are called induced pluripotent stem cells (ipscs) and it has been found that RNA can be synthesized using enzymes incorporating 5-methyl-CTP, pseudo-UTP and an anti-inversion cap analogue (ARCA) to effectively circumvent the antiviral response of the cells; see, e.g., Warren et al, supra.
Other polynucleotide modifications described in the art include, for example, the use of poly-a tails, the addition of 5 'end cap analogs (such as m7G (5') ppp (5') g (mcap)), the modification of the 5' or 3 'untranslated region (UTR), or treatment with phosphatases to remove the 5' terminal phosphate-and new methods are being developed on a regular basis.
Many compositions and techniques suitable for generating modified RNA for use herein have been developed in conjunction with modifications to RNA interference (RNAi), including small interfering RNA (sirna). siRNA presents particular challenges in vivo, as the effect of siRNA on gene silencing via mRNA interference is often transient, which may require repeated administrations. In addition, siRNA is double stranded rna (dsRNA), and mammalian cells have an immune response that has evolved to detect and neutralize dsRNA, which is often a byproduct of viral infection. Thus, there are mammalian enzymes such as PKR (dsRNA-responsive kinase) and possibly retinoic acid inducible gene I (RIG-I) that can mediate cellular responses to dsRNA, as well as Toll-like receptors (such as TLR3, TLR7, and TLR8) that can trigger induction of cytokines in response to such molecules; see, e.g., Angart et al, Pharmaceuticals 6 (Basel) 440-468 (2013); kanasty et al, molecular therapy 20(3), 513-524 (2012); burnett et al, journal of Biotech (Biotechnol J.) 6(9), 1130-46 (2011); judge and MacLachlan, human Gene therapy (Hum Gene Ther) 19(2), 111-24 (2008); and references cited therein.
Numerous modifications have been developed and applied to enhance RNA stability, reduce innate immune responses, and/or to combine other benefits that would be useful to introduce polynucleotides into human cells, as described herein; see, e.g., Whitehead KA et al, Annual Review of Chemical and biomolecular Engineering, 2:77-96 (2011); gaglione and Messere, short medical chemistry (MiniRev Med Chem) 10(7) 578-95 (2010); chernolovskaya et al, molecular therapy introduction (Curr Opinmol. Ther.) 12(2) 158-67 (2010); deleavey et al, handbook of nucleic Acid chemistry experiments (Curr ProtocNucl Acid Chem), Chapter 16: Unit 16.3 (2009); behlke, Oligonucleotides (Oligonucleotides) 18(4) (305-19) (2008); fucini et al, Nucleic acid therapy (Nucleic acid thers) 22(3) 205-210 (2012); bremsen et al, leading edges of genetics (Front Genet) 3:154 (2012).
As noted above, there are many commercial suppliers of modified RNA, many of which specialize in modifications designed to improve the effectiveness of siRNA. Various approaches have been provided based on various findings reported in the literature. For example, Dharmacon states that the replacement of non-bridging oxygens with sulfur (phosphorothioate, PS) has been widely used to improve nuclease resistance of siRNA as reported by Kole, Nature Reviews Drug Discovery 11: 125-. It has been reported that modification of the 2' position of ribose improves nuclease resistance of the internucleotide phosphate linkage, while increasing duplex stability (Tm), which has also been shown to provide protection against immune activation. The combination of moderate PS backbone modifications and well tolerated small 2 '-substitutions (2' -O-methyl, 2 '-fluoro, 2' -hydrogen) is associated with highly stable siRNAs for in vivo applications, as reported by Sotschek et al, Nature 432:173-178 (2004); and it was reported that 2' -O-methyl modification effectively improved stability as reported by Volkov, oligonucleotide 19:191-202 (2009). With respect to reducing induction of innate immune response, it was reported that modification of specific sequences with 2' -O-methyl, 2' -fluoro, 2' -hydrogen reduced TLR7/TLR8 interactions while preserving silencing activity overall; see, e.g., Judge et al, molecular therapy (mol. ther.) 13: 494-; and Cekai ite et al, J.Mol.biol. (J.mol.) 365:90-108 (2007). Additional modifications such as 2-thiouracil, pseudouracil, 5-methylcytosine, 5-methyluracil, and N6-methyladenosine have also been shown to minimize immune effects mediated through TLR3, TLR7, and TLR 8; see, e.g., Kariko, K. et al, immunization (Immunity) 23:165-175 (2005).
As is also known in the art and commercially available, many conjugates can be applied to polynucleotides for use herein, including, for example, cholesterol, tocopherols, and folic acid, lipids, peptides, polymers, linkers, and aptamers, such as RNA, that can enhance their delivery and/or uptake by cells; see, e.g., Winkler's review, "therapy delivery" (the. deliv.) 4: 791-.
Codon optimization
Polynucleotides encoding the site-directed polypeptides can be codon optimized according to standard methods known in the art for expression in cells containing the target DNA of interest. For example, if the target nucleic acid is expected to be in a human cell, a human codon-optimized polynucleotide encoding Cas9 is contemplated for use in generating Cas9 polypeptides.
Complex of genome-targeted nucleic acid and site-directed polypeptide
The genome-targeted nucleic acid interacts with a site-directed polypeptide (e.g., a nucleic acid-guided nuclease such as Cas9), thereby forming a complex. The genomic targeting nucleic acid directs the site-directed polypeptide to the target nucleic acid.
Ribonucleoprotein complex (RNP)
The site-directed polypeptide and the genomic targeting nucleic acid can each be administered separately to a cell or a patient. Alternatively, the site-directed polypeptide may be pre-complexed with one or more guide RNAs or one or more crrnas along with a tracrRNA. The pre-compounded material may then be administered to a cell or patient. This pre-compounded material is called ribonucleoprotein particles (RNPs). The site-directed polypeptide in RNP can be, for example, a Cas9 endonuclease or a Cpf1 endonuclease. The site-directed polypeptide may be flanked at the N-terminus, the C-terminus, or both the N-terminus and the C-terminus by one or more Nuclear Localization Signals (NLS). For example, the Cas9 endonuclease may be flanked by two NLSs, one at the N-terminus and a second at the C-terminus. The NLS can be any NLS known in the art, such as SV40 NLS. The weight ratio of the genome-targeting nucleic acid to the site-directed polypeptide in the RNP can be 1: 1. For example, the weight ratio of sgRNA to Cas9 endonuclease in RNP can be 1: 1.
Nucleic acid coding system components
The present disclosure provides nucleic acids comprising nucleotide sequences encoding the genome-targeting nucleic acids of the present disclosure, the site-directed polypeptides of the present disclosure, and/or any nucleic acid or protein molecule required to perform aspects of the methods of the present disclosure.
The nucleic acids encoding the genome-targeting nucleic acids of the present disclosure, the site-directed polypeptides of the present disclosure, and/or any nucleic acids or protein molecules required to perform aspects of the methods of the present disclosure may include vectors (e.g., recombinant expression vectors).
The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector, wherein additional nucleic acid segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
In some examples, a vector may be capable of directing the expression of a nucleic acid to which it is operatively linked. Such vectors are referred to herein as "recombinant expression vectors" or more simply "expression vectors", the recombinant expression vectors and expression vectors providing equivalent functions.
The term "operably linked" means that the nucleotide sequence of interest is linked to one or more regulatory sequences in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in the following: goeddel; gene expression technique: methods in enzymology (Gene Expression Technology: Methods in enzymology) 185, Academic Press, san Diego, Calif. (1990). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). One skilled in the art will appreciate that the design of the expression vector may depend on factors such as the choice of target cell, the desired level of expression, and the like.
Contemplated expression vectors include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviruses (e.g., murine leukemia virus, splenic necrosis virus, and vectors derived from retroviruses such as rous sarcoma virus, hawegian sarcoma virus, avian leukemia virus, lentiviruses, human immunodeficiency virus, myelo-and ecto-myeloproliferative sarcoma virus, and mammary tumor virus), as well as other recombinant vectors. Other vectors contemplated for use in eukaryotic target cells include, but are not limited to, the vectors pXT1, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Other vectors may be used so long as they are compatible with the host cell.
In some examples, the vector may include one or more transcriptional and/or translational control elements. Any of a number of suitable transcriptional and translational control elements may be used in the expression vector, including constitutive and inducible promoters, transcriptional enhancer elements, transcriptional terminators and the like, depending on the host/vector system utilized. The vector may be a self-inactivating vector which inactivates viral sequences or components of the CRISPR machinery or other elements.
Non-limiting examples of suitable eukaryotic promoters (i.e., promoters that function in eukaryotic cells) include those from: cytomegalovirus (CMV) immediate early, Herpes Simplex Virus (HSV) thymidine kinase, early and late SV40, Long Terminal Repeats (LTR) from retrovirus, human elongation factor-1 promoter (EF1), mixed constructs including Cytomegalovirus (CMV) enhancer fused to chicken β -actin promoter (CAG), murine stem cell virus promoter (MSCV), phosphoglycerate kinase-1 locus Promoter (PGK), and mouse metallothionein-I.
For expression of small RNAs (including guide RNAs used in conjunction with Cas endonucleases), various promoters such as RNA polymerase III promoter (including, for example, U6 and H1) may be advantageous. The description of such promoters and parameters for enhancing the use of such promoters are known in the art, and additional information and methods are being described periodically; see, e.g., Ma, H, et al, "Molecular Therapy-Nucleic Acids (Molecular Therapy-Nucleic Acids)," 3, e161 (2014) doi: 10.1038/mtna.2014.12.
The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression. The expression vector may also comprise a nucleotide sequence encoding a non-native tag (e.g., a histidine tag, a hemagglutinin tag, a green fluorescent protein, etc.) fused to the site-directed polypeptide, thereby producing a fusion protein.
The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline regulated promoter, a steroid regulated promoter, a metal regulated promoter, an estrogen receptor regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., CMV promoter, UBC promoter). In some cases, the promoter can be a spatially and/or temporally limited promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.).
Nucleic acids encoding the genome-targeting nucleic acids and/or site-directed polypeptides of the present disclosure can be packaged into or onto the surface of a delivery vehicle for delivery to a cell. Contemplated delivery vehicles include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, various targeting moieties can be used to enhance the preferential interaction of such agents with a desired cell type or location.
Introduction of the complexes, polynucleotides, and nucleic acids of the present disclosure into a cell may occur by: viral or phage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nuclear transfection, calcium phosphate precipitation, Polyethyleneimine (PEI) mediated transfection, DEAE dextran mediated transfection, liposome mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle mediated nucleic acid delivery, and the like.
Method of treatment
Provided herein are methods for treating a patient having dyslipidemia. One aspect of this method is ex vivo cell-based therapy. For example, a biopsy is performed on the patient's liver. Then, liver-specific progenitor cells or primary hepatocytes are isolated from the biopsy material. Next, the chromosomal DNA of these progenitor cells or primary hepatocytes is corrected using the materials and methods described herein. Finally, the progenitor cells or primary hepatocytes are implanted into the patient. Any source or type of cell may be used as a progenitor cell.
Another aspect of this method is ex vivo cell-based therapy. For example, patient-specific induced pluripotent stem cells (ipscs) can be generated. The chromosomal DNA of these iPS cells can then be edited using the materials and methods described herein. Next, the genome-edited ipscs can be differentiated into other cells. Finally, the differentiated cells are implanted into the patient.
Yet another aspect of this method is ex vivo cell-based therapy. For example, mesenchymal stem cells may be isolated from a patient, which may be isolated from bone marrow or peripheral blood of the patient. Next, chromosomal DNA of these mesenchymal stem cells may be edited using the materials and methods described herein. Next, the genome-edited mesenchymal stem cells may be differentiated into any type of cells, such as hepatocytes. Finally, the differentiated cells, such as hepatocytes, are implanted into the patient.
One advantage of ex vivo cell therapy is the ability to comprehensively analyze the therapy prior to administration. Nuclease-based therapeutics can have some level of off-target effect. Performing gene editing ex vivo allows one to characterize the edited cell population prior to implantation. The present disclosure encompasses sequencing the entire genome of the edited cell to ensure that off-target effects, if any, can be at genomic locations associated with minimal risk to the patient. In addition, specific cell populations, including clonal populations, can be isolated prior to implantation.
Another advantage of ex vivo cell therapy relates to the genetic modification of ipscs compared to other primary cell sources. ipscs are prolific, thereby facilitating the availability of the large number of cells required for cell-based therapy. Furthermore, ipscs are an ideal cell type for performing clonal isolation. This allows screening for the correct genome modification without the risk of reducing viability. In contrast, other primary cells, such as hepatocytes, survive only a few passages and are difficult to expand clonally. Thus, manipulating ipscs to treat dyslipidemia is much easier and reduces the amount of time required to perform the desired genetic modification.
The methods may also comprise in vivo-based therapies. The materials and methods described herein are used to edit chromosomal DNA of a patient's cells.
While certain cells present attractive targets for ex vivo therapy and therapies, increased delivery efficacy may allow for direct in vivo delivery to such cells. Ideally, targeting and editing will be directed to the relevant cells. By using promoters which are active only in certain cells and/or developmental stages, cleavage in other cells can also be prevented. The additional promoter is inducible and can therefore be temporally controlled when the nuclease is delivered as a plasmid. The amount of time that the delivery RNA and protein remain resident in the cell can also be adjusted by adding therapeutics or domains to alter the half-life. In vivo treatment would eliminate many of the treatment steps, but a lower delivery rate would require a higher editing rate. In vivo treatment can eliminate problems and losses from ex vivo treatment and transplantation.
An advantage of in vivo gene therapy may be ease of therapeutic agent production and administration. The same treatment methods and therapies will likely be used to treat more than one patient, e.g., multiple patients sharing the same or similar genotypes or alleles. In contrast, ex vivo cell therapy typically requires the use of the patient's own cells that are isolated, manipulated, and returned to the same patient.
Also provided herein are cellular methods for editing the ANGPTL3 gene in a cell by genome editing. For example, cells can be isolated from a patient or animal. The chromosomal DNA of the cell can then be edited using the materials and methods described herein.
The methods provided herein, whether cellular, ex vivo, or in vivo, may involve reducing (knocking down) or eliminating (knocking out) expression of the ANGPTL3 gene by introducing one or more insertions, deletions, or mutations within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene.
For example, knock-down or knock-out strategies may involve disrupting the reading frame in the ANGPTL3 gene by introducing random insertions or deletions (indels) due to imprecise NHEJ repair pathways. This can be achieved by: one single-or double-strand break in a gene of interest is induced with one or more CRISPR endonucleases and a gRNA (e.g., crRNA + tracrRNA or sgRNA), or two or more single-or double-strand breaks in a gene of interest are induced with two or more CRISPR endonucleases and two or more sgrnas. This approach would require the development and optimization of sgrnas for the ANGPTL3 gene.
Alternatively, the knock-down or knock-out strategy may also involve deletion of one or more segments within or near the ANGPTL3 gene or other DNA sequences encoding regulatory elements of the ANGPTL3 gene. This deletion strategy requires at least one pair of grnas (e.g., crRNA + tracrRNA or sgRNA) that are capable of binding to two different sites within or near the ANGPTL3 gene and one or more CRISPR endonucleases. A CRISPR endonuclease configured with two grnas induces two double-strand breaks at the desired positions. After cleavage, the two ends, whether blunt or overhanging, can be joined by NHEJ, resulting in deletion of the intervening segment. The NHEJ repair pathway may produce insertions, deletions or mutations at the junctions.
In addition to the genome editing strategies described above, another strategy involves modulating the expression, function, or activity of ANGPTL3 by editing in the regulatory sequence.
In addition to the editing options listed above, sea can use Cas9 or similar proteins to target effector domains to additional target sites that can be identified for editing or within the scope of the effector domains. A series of chromatin modifying, methylating or demethylating enzymes may be used to alter the expression of the target gene. One possibility is to reduce the expression of ANGPTL3 protein when the mutation results in an undesired activity. These types of epigenetic regulation have some advantages, particularly when they are limited in possible off-target effects.
In addition to coding and splicing sequences, there are many types of genomic target sites.
Regulation of transcription and translation involves a number of different classes of sites that interact with cellular proteins or nucleotides. The DNA binding site of a transcription factor or other protein can often be targeted for mutations or deletions to investigate the role of the site, but can also be targeted to alter gene expression. Sites can be added by non-homologous end joining NHEJ or by direct genome editing of Homology Directed Repair (HDR). The increased use of genome sequencing, RNA expression and whole genome studies for transcription factor binding has increased our ability to identify how sites lead to developmental or temporal gene regulation. These control systems may be direct or may involve extensive coordinated regulation that may require integration of activity from multiple enhancers. Transcription factors generally bind to degenerate DNA sequences of 6-12bp in length. The low level of specificity provided by individual sites indicates that complex interactions and rules are involved in the binding and functional outcome. Binding sites with less degeneracy may provide a simpler means of regulation. The artificial transcription factor can be designed to specify longer sequences with fewer similar sequences in the genome and with lower likelihood of off-target cleavage. Any of these types of binding sites can be mutated, deleted or even created to achieve gene regulation or alteration of expression (cancer, m.c. et al, nature (2015)).
Another class of gene regulatory regions with these characteristics are microrna (mirna) binding sites. mirnas are non-coding RNAs that play a key role in post-transcriptional gene regulation. mirnas can regulate the expression of 30% of all mammalian protein-encoding genes. Specific and potent gene silencing by double-stranded RNA (rnai) was found, as well as additional small non-coding RNAs (cancer, m.c. et al, nature (2015)). The largest class of non-coding RNAs of importance for gene silencing is miRNA. In mammals, mirnas are first transcribed into long RNA transcripts, which may be individual transcription units, portions of protein introns, or other transcripts. Long transcripts are referred to as primary mirnas (pri-mirnas) that contain imperfect base-pairing hairpin structures. These pri-mirnas can be cleaved by a protein complex in the nucleus (Drosha-related) Microprocessor (Microprocessor) into one or more shorter precursor mirnas (pre-mirnas).
pre-mirnas are short stem loops of about 70 nucleotides in length with a 2-nucleotide 3' overhang that are derived as mature 19-25 nucleotide mirnas miRNA-x duplexes. miRNA strands with lower base-pairing stability (guide strands) can be loaded onto RNA-induced silencing complex (RISC). The satellite chains (labeled x) may be functional, but are often degraded. Mature mirnas tether RISC to partially complementary sequence motifs in target mrnas found primarily in the 3' untranslated region (UTR) and induce post-transcriptional gene silencing (Bartel, d.p., "Cell 136, 215-.
mirnas can be important in development, differentiation, cell cycle and growth control, and in almost all biological pathways of mammals and other multicellular organisms. mirnas may also be involved in cell cycle control, apoptosis and stem cell differentiation, hematopoiesis, hypoxia, muscle development, neurogenesis, insulin secretion, cholesterol metabolism, aging, viral replication, and immune responses.
A single miRNA can target hundreds of different mRNA transcripts, while an individual transcript can be targeted by many different mrnas. More than 28645 microRNAs have been annotated in the latest version of miRBase (v.21). Some mirnas may be encoded by multiple loci, some of which may be expressed from tandem co-transcriptional clusters. The features allow complex regulatory networks with multiple approaches and feedback control. mirnas may be part of these feedback and regulatory circuits and may help regulate gene expression by keeping protein production within certain limits (Herranz, h. and Cohen, s.m., (Genes Dev.) 24, 1339-.
mirnas may also be important in a number of human diseases associated with aberrant miRNA expression. This correlation underscores the importance of miRNA regulatory pathways. Recent studies of miRNA deletion have linked miRNA to modulation of immune responses (Stern-Ginossar, n. et al, science 317,376-381 (2007)).
mirnas are also strongly linked to cancer and may play a role in different types of cancer. Mirnas have been found to be down-regulated in many tumors. mirnas would be important in the regulation of key cancer-related pathways such as cell cycle control and DNA damage response and therefore can be used for diagnosis and clinically targeted. micro-RNAs can subtly regulate the balance of angiogenesis, such that experiments that deplete all micro-RNAs inhibit tumor angiogenesis (Chen, S. et al, Genes and development (Genes Dev) 28,1054-1067 (2014)).
As already shown for protein-encoding genes, miRNA genes can also be subject to epigenetic changes that occur with cancer. Many miRNA loci can be associated with CpG islands, increasing the chance of modulation by DNA methylation (Weber, b., streesemann, c., Brueckner, b., and Lyko, f., (Cell Cycle) 6,1001-1005 (2007)). Most studies have used treatment with chromatin remodeling drugs to reveal epigenetically silenced mirnas.
In addition to its role in RNA silencing, mirnas can also activate translation (Posadas, d.m. and carthw, r.w., "genetics and development theory" 27,1-6 (2014)). Knock-out miRNA sites may lead to reduced expression of the targeted gene, while introduction of these sites may increase expression.
Individual mirnas can be knocked out most efficiently by mutating the seed sequence (bases 2-8 of the microrna), which can be important for binding specificity. Cleavage at this region followed by NHEJ for error repair can effectively abrogate miRNA function by blocking binding to the target site. Mirnas can also be inhibited by specifically targeting specific loop regions near palindromic sequences. Catalytically inactive Cas9 can also be used to inhibit shRNA expression (Zhao, y et al, scientific report (Sci Rep) 4,3943 (2014)). In addition to targeting mirnas, the binding site can also be targeted and mutated to prevent silencing by mirnas.
According to the present disclosure, any microrna (mirna) or binding site thereof can be incorporated into the compositions of the present disclosure.
The composition may have regions such as, but not limited to, regions comprising the sequence of any of the microRNAs listed in SEQ ID NO:632-4,715, the reverse complement of the microRNA listed in SEQ ID NO:632-4,715, or the microRNA anti-seed region of any of the microRNAs listed in SEQ ID NO:632-4,715.
The compositions of the present disclosure may include one or more microrna target sequences, microrna sequences, or microrna seeds. Such sequences may correspond to any known microRNA, such as those taught in U.S. publication US2005/0261218 and U.S. publication US 2005/0059005. As a non-limiting example, known microRNAs, their sequences and their binding site sequences in the human genome are set forth below in SEQ ID NO 632-4,715.
Microrna sequences include "seed" sequences, i.e., sequences in the region of positions 2-8 of the mature microrna that have perfect Watson-Crick complementarity to the miRNA target sequence. The microRNA seed can include positions 2-8 or positions 2-7 of the mature microRNA. In some aspects, a microrna seed can comprise 7 nucleotides (e.g., nucleotides 2-8 of a mature microrna), with the seed complementary site in the corresponding miRNA target flanked by adenine (a) opposite position 1 of the microrna. In some aspects, a microrna seed can comprise 6 nucleotides (e.g., nucleotides 2-7 of a mature microrna), with the seed complementary site in the corresponding miRNA target flanked by adenine (a) opposite position 1 of the microrna. See, e.g., Grimson A, Farh KK, Johnston WK, Garrett-Engel P, Lim LP, Bartel DP; molecular cells (mol. cell.) in 2007, month 7 and 6; 27(1):91-105. The bases of the microRNA seeds are fully complementary to the target sequence.
Identification of microRNAs, microRNA target regions, and their expression patterns and roles in biology has been reported (Bonauer et al, Current Drug Targets 201011: 943 949; Anand and Cheresh, Haemology's monograph (Curr Optin Hematol) 201118: 171-.
For example, if a composition is not intended to be delivered to the liver but ends there, miR-122 can inhibit expression of the delivered sequence when one or more target sites of microrna miR-122, which is abundant in the liver, is engineered into the polynucleotide encoding the target sequence. The introduction of one or more binding sites for different micrornas can be engineered to further reduce longevity, stability, and protein translation, thereby providing an additional defensible layer.
As used herein, the term "microrna site" refers to a microrna target site or microrna recognition site or any nucleotide sequence to which a microrna binds or associates. It is understood that "binding" may follow traditional Watson-Crick hybridization rules or may reflect any stable association of microRNAs with target sequences at or near the microRNA site.
In contrast, for the purposes of the compositions of the present disclosure, microrna binding sites may be engineered out of (i.e., removed from) their naturally occurring sequences in order to increase protein expression in specific tissues. For example, the miR-122 binding site can be removed to improve protein expression in the liver.
Specifically, micrornas are known to be differentially expressed in immune cells (also referred to as hematopoietic cells), such as Antigen Presenting Cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, and the like. Immune cell specific micrornas are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and unwanted immune responses following gene therapy and tissue/organ transplantation. Immune cell-specific micrornas also regulate many aspects of the development, proliferation, differentiation and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are expressed only in immune cells, particularly enriched in bone marrow dendritic cells. Introduction of a miR-142 binding site into the 3' -UTR of a polypeptide of the present disclosure can selectively inhibit gene expression in antigen presenting cells through miR-142 mediated mRNA degradation, thereby limiting antigen presentation in professional APCs (e.g., dendritic cells), and thereby preventing antigen-mediated immune responses following gene delivery (see Annoni a et al, blood (blood) 2009,114, 5152-.
In one example, microrna binding sites known to be expressed in immune cells, particularly antigen presenting cells, can be engineered into polynucleotides to inhibit expression of the polynucleotides in APCs through microrna-mediated RNA degradation, thereby inhibiting antigen-mediated immune responses, while maintaining expression of the polynucleotides in non-immune cells that are not expressed by immune cell-specific micrornas.
Many microrna expression studies have been conducted and described in the art to describe differential expression of micrornas in various cancer cells/tissues and other diseases. Some micrornas are abnormally overexpressed in some cancer cells, while others are underexpressed. For example, micrornas are differentially expressed in: cancer cells (WO2008/154098, US2013/0059015, US2013/0042333, WO 2011/157294); cancer stem cells (US 2012/0053224); pancreatic cancer and diseases (US2009/0131348, US2011/0171646, US2010/0286232, US 8389210); asthma and inflammation (US 8415096); prostate cancer (US 2013/0053264); hepatocellular carcinoma (WO2012/151212, US2012/0329672, WO2008/054828, US 8252538); lung cancer cells (WO2011/076143, WO2013/033640, WO2009/070653, US 2010/0323357); cutaneous T cell lymphoma (WO 2013/011378); colorectal cancer cells (WO2011/0281756, WO 2011/076142); cancerous positive lymph nodes (WO2009/100430, US 2009/0263803); nasopharyngeal carcinoma (EP 2112235); chronic obstructive pulmonary disease (US2012/0264626, US 2013/0053263); thyroid cancer (WO 2013/066678); ovarian cancer cells (US2012/0309645, WO 2011/095623); breast cancer cells (WO2008/154098, WO2007/081740, US2012/0214699), leukemias and lymphomas (WO2008/073915, US2009/0092974, US2012/0316081, US2012/0283310, WO 2010/018563).
Non-limiting examples of microRNA sequences and tissue and/or cell targeting are described in SEQ ID NO 632-4,715.
Genome engineering strategy
In some aspects, the methods of the present disclosure may involve editing one or both of the alleles. Gene editing for modification of one or more alleles has the advantage of permanently altering the target gene or gene product.
Steps of the ex vivo methods of the present disclosure may include editing hepatocytes isolated from a patient using genome engineering. Alternatively, the steps of the ex vivo methods of the present disclosure may include editing patient-specific ipscs or mesenchymal stem cells. Likewise, the steps of the in vivo methods of the present disclosure involve the use of genome engineering to edit cells of dyslipidemia patients. Similarly, steps in the cellular methods of the present disclosure may include editing the ANGPTL3 gene in a human cell by genome engineering.
Dyslipidemia patients may show different mutations in the ANGPTL3 gene. Any CRISPR endonuclease, each having its own associated PAM, which may or may not be disease specific, may be used in the methods of the present disclosure.
For example, expression of the ANGPTL3 gene can be disrupted or eliminated by introducing random insertions or deletions (indels) due to imprecise NHEJ repair pathways. The target region may be the coding sequence (i.e., exon) of the ANGPTL3 gene. Insertion or deletion of nucleotides into the coding sequence of a gene may result in "frame shifts" in which the normal 3-letter codon pattern is disrupted. In this way, gene expression and thus protein production may be reduced or eliminated. This method can also be used to target any intron, intron-exon junction or regulatory DNA element of the ANGPTL3 gene where sequence changes may interfere with expression of the ANGPTL3 gene.
As another example, NHEJ can also be used to delete fragments within or near a gene by altering the splice donor or acceptor site, either directly or by cleavage of one or several grnas targeted to several positions. This may be useful when small random indels are not sufficient to knock down the target gene. Pairs of guide chains have been used for this type of deletion.
In the absence of a donor, several non-homologous repair pathways in which DNA ends are joined with little or no base pairing at the junction may be used to join ends from DNA breaks or ends from different breaks. In addition to the classical NHEJ, similar repair mechanisms exist, such as the alternative NHEJ. If there are two breaks, the insert can be deleted or inverted. The NHEJ repair pathway may produce insertions, deletions or mutations at the junctions.
NHEJ may also lead to homology-dependent target integration. For example, inclusion of nuclease target sites on the donor plasmid may promote integration of the transgene into the chromosome double strand break after in vivo nuclease cleavage of both the donor and chromosome (Cristea, "Biotechnol Bioeng") 2013, months; 110(3): 871-80). After nuclease cleavage, the 15-kb inducible gene expression cassette is inserted into a defined locus in a human cell line using NHEJ. (see, e.g., Maresca, M., Lin, V.G., Guo, N., and Yang, Y., "Genome research (Genome Res.) 23,539-546 (2013); Cristea et al, Biotechnology and Bioengineering 2013,871-80, 10.1002/bit.24733). The integrated sequence may disrupt the reading frame of the ANGPTL3 gene or alter the structure of the gene.
As another alternative, Homology Directed Repair (HDR) may also be used to knock out a gene or alter gene function. HDR is basically an error-free mechanism that uses supplied homologous DNA sequences as templates during DSB repair. The rate of HDR is a function of the distance between the mutation and the cleavage site, so it is important to select overlapping or closest target sites. The template may comprise additional sequences flanking the homologous region or may contain sequences different from the genomic sequence, thereby allowing sequence editing.
For example, an HDR knockout strategy can involve disrupting the structure or function of an ANGPTL3 gene by inserting a non-functional or unrelated sequence into the gene or replacing a portion of the gene with a non-functional or unrelated sequence. This can be achieved by: inducing one single-stranded break or double-stranded break in a gene of interest with one or more CRISPR endonucleases and a gRNA (e.g., crRNA + tracrRNA or sgRNA), or inducing two or more single-stranded breaks or double-stranded breaks in a gene of interest with one or more CRISPR endonucleases and two or more grnas, in the presence of a donor DNA template (which can be a short single-stranded oligonucleotide, a short double-stranded oligonucleotide, a long single-stranded or double-stranded DNA molecule) exogenously introduced to direct a cellular DSB response to HDR. This approach would require the development and optimization of gRNA and donor DNA molecules for the ANGPTL3 gene.
Homology directed repair is a cellular mechanism for repairing DSBs. The most common form is homologous recombination. There are additional HDR pathways, including single strand annealing and alternative HDR. Genome engineering tools allow researchers to manipulate cellular homologous recombination pathways to site-specifically modify genomes. It has been found that cells can repair double strand breaks using synthetic donor molecules provided in trans. Thus, targeted changes in the genome can be made by introducing a double-strand break in the vicinity of a specific mutation and providing a suitable donor. Compared with 1:106The rate of individual cells receiving the cognate donor alone, specific cleavage increased the rate of HDR by more than 1,000-fold. The rate of Homology Directed Repair (HDR) at a particular nucleotide is a function of the distance to the cleavage site, so it is important to select an overlapping or nearest target site. Gene editing has an advantage over gene addition in that in situ editing leaves the undisturbed remainder of the genome.
The donor supplied for editing by HDR varies significantly but may contain the expected sequence with small or large flanking homology arms for allowing annealing of genomic DNA. The homologous regions flanking the introduced gene change may be 30bp or less, or as large as a multi-kilobase cassette that may contain promoters, cdnas, and the like. Both single-stranded and double-stranded oligonucleotide donors have been used. These oligonucleotides range in size from less than 100nt to over many kb, but longer ssDNA can also be generated and used. Double stranded donors, including PCR amplicons, plasmids and mini-loops, may be used. Overall, it has been found that AAV vectors can be a very efficient means of donor template delivery, but packaging of individual donors is limited to <5 kb. Active transcription of the donor tripled HDR, indicating that inclusion of a promoter can increase conversion. In contrast, CpG methylation of the donor reduced gene expression and HDR.
In addition to wild-type endonucleases such as Cas9, there are nickase variants that inactivate one or the other nuclease domain resulting in cleavage of only one DNA strand. HDR can be directed from Cas nickase alone or using paired nickases flanking the target region. The donor may be single stranded, nicked or dsDNA.
Donor DNA can be supplied with or independently from nucleases by a variety of different methods, such as by transfection, nanoparticles, microinjection, or viral transduction. A range of tethering options have been proposed to increase the availability of donors for HDR. Examples include attaching the donor to a nuclease, to a DNA binding protein that binds nearby, or to a protein involved in DNA end binding or repair.
Repair pathway selection can be guided by a variety of culture conditions, such as those that affect cell circulation, or by targeting DNA repair and related proteins. For example, to increase HDR, key NHEJ molecules, such as KU70, KU80, or DNA ligase IV, may be inhibited.
In addition to genome editing by NHEJ or HDR, site-specific gene insertion using both the NHEJ pathway and HDR has been performed. In certain circumstances, combinatorial approaches may be applicable, possibly involving intron/exon boundaries. NHEJ may prove to be efficient for concatenation in introns, whereas in coded regions, error-free HDR may be more appropriate.
The ANGPTL3 gene contains many exons, as shown in table 3. Any one or more of these exons or nearby introns may be targeted to produce one or more insertions or deletions that disrupt the reading frame and ultimately eliminate the activity of the ANGPTL3 protein.
In some embodiments, the methods can provide for a deleted gRNA pair to be achieved by cleaving the gene twice at positions flanking the undesired sequence. This sequence may comprise one or more exons, introns, intronic exon junctions, other DNA sequences encoding regulatory elements of the ANGPTL3 gene, or combinations thereof. Cleavage can be accomplished by a pair of DNA endonucleases each performing a DSB in the genome or by multiple nickases that perform DSBs together in the genome.
Alternatively, the method can provide a gRNA to perform a double-stranded cleavage within an encoding or splicing sequence. Double-stranded cleavage can be performed by a single DNA endonuclease or multiple nickases that perform DSBs together in the genome.
The splice donor and acceptor are typically within 100 base pairs of adjacent introns. In some examples, the method can provide for cleavage of a gRNA of approximately +/-100- & gt 3100bp relative to each exon/intron junction of interest.
For any of the genome editing strategies, gene editing can be confirmed by sequencing or PCR analysis.
Target sequence selection
The shifting of the 5 'boundary and/or the 3' boundary relative to a particular reference locus can be used to facilitate or enhance a particular application of gene editing, depending in part on the endonuclease system selected for editing, as further described and illustrated herein.
In a first non-limiting example of such target sequence selection, many endonuclease systems have the requirement that rules or criteria can direct the initial selection of potential target sites for cleavage, such as a PAM sequence motif in a specific position adjacent to the DNA cleavage site in the case of a CRISPR type II or type V endonuclease.
In another non-limiting example of target sequence selection or optimization, the frequency of off-target activity (i.e., the frequency at which DSBs occur at sites other than the selected target sequence) for a particular combination of target sequence and gene editing endonuclease can be assessed relative to the frequency of on-target activity. In some cases, cells that have been correctly edited at a desired locus may have a selective advantage over other cells. Illustrative, but non-limiting, examples of selectivity advantages include obtaining attributes such as: enhanced replication rate, persistence, resistance to certain conditions, enhanced success of transplantation rate or persistence in vivo after introduction into a patient, and other attributes associated with maintaining such cells or increasing the number or viability of such cells. In other cases, cells that have been correctly edited at a desired locus may be positively selected by one or more screening methods for identifying, classifying, or otherwise selecting cells that have been correctly edited. Both selective advantage and targeted selection methods can exploit phenotypes associated with alterations. In some cases, the cell may be edited two or more times to generate a second modification that results in a new phenotype for selection or purification of a desired population of cells. This second modification can be produced by adding a second gRNA for a selectable or screenable marker. In some cases, the cells can be correctly edited at the desired locus using DNA fragments containing cDNA and also selectable markers.
Whether any selectivity advantage applies or any directional selection is to be applied in a particular situation, target sequence selection may also be guided by taking into account off-target frequency in order to enhance the efficiency of application and/or reduce the likelihood of undesirable changes occurring at sites other than the desired target. As further described and illustrated herein and in the art, the occurrence of off-target activity can be influenced by a number of factors, including similarities and differences between target sites and various off-target sites, as well as the particular endonuclease used. Bioinformatic tools are available that aid in predicting off-target activity, and such tools can also be frequently used to identify the most likely off-target active sites, which can then be evaluated in an experimental setting to assess the frequency of off-target activity relative to on-target activity, thereby allowing sequences with higher relative on-target activity to be selected. Illustrative examples of such techniques are provided herein, and other techniques are known in the art.
Another aspect of target sequence selection involves homologous recombination events. Sequences sharing regions of homology may serve as the focus of homologous recombination events leading to deletion of the inserted sequence. Such recombination events occur during the normal replication process of chromosomes and other DNA sequences, and also at other times of synthesis of DNA sequences, as in the case of Double Strand Break (DSB) repair, which occurs regularly during the normal cell replication cycle, but can also be enhanced by the occurrence of various events such as UV light and other inducers of DNA breaks or the presence of certain agents such as various chemical inducers. Many of these inducers cause DSBs to occur randomly in the genome, and DSBs can be regularly induced and repaired in normal cells. During repair, the original sequence can be reconstructed with full fidelity, however, in some cases, small insertions or deletions (referred to as "indels") are introduced at the DSB sites.
DSBs can also be specifically induced at specific locations, as in the case of the endonuclease systems described herein, can be used to cause targeted or preferential genetic modification events at selected chromosomal locations. The tendency of homologous sequences to undergo recombination in the context of DNA repair (and replication) can be exploited in a variety of situations and is the basis for one application of gene editing systems such as CRISPR, where homology-directed repair is used to insert a sequence of interest provided by the use of a "donor" polynucleotide into a desired chromosomal location.
The desired deletion can also be created using a region between specific sequences, which can be a small "micro-homology" region that can include as few as ten base pairs or less. For example, a single DSB may be introduced at a site exhibiting little homology to nearby sequences. During the normal process of repairing such DSBs, a high frequency of occurrence results in deletion of the inserted sequence due to recombination promoted by the DSB and accompanying cellular repair processes.
However, in some cases, selection of target sequences within the region of homology may also result in much larger deletions, including gene fusions (when the deletion is in the coding region), which may or may not be desirable given the particular circumstances.
The examples provided herein further demonstrate the selection of various target regions for the production of DSBs designed to induce insertions, deletions or mutations that result in a reduction or elimination of ANGPTL3 protein activity, and the selection of specific target sequences within such regions designed to minimize off-target versus on-target events.
Human cells
To alleviate dyslipidemia or any disorder associated with ANGPTL3, the primary target of gene editing is human cells as described and shown herein. For example, in an ex vivo method, the human cell may be a somatic cell that, after modification using techniques as described, may give rise to a differentiated cell, such as a hepatocyte or progenitor cell. For example, in an in vivo method, the human cells may be liver cells, kidney cells, or cells from other affected organs.
By performing gene editing in autologous cells that are derived from, and thus have been perfectly matched to, a patient in need thereof, it is possible to generate cell populations that can be safely reintroduced into the patient and effectively produce cells that will effectively alleviate one or more clinical conditions associated with the patient's disease.
Stem cells are capable of both proliferating and producing more progenitor cells, which in turn have the capacity to produce large numbers of blasts, which in turn can produce differentiated or differentiable daughter cells. The daughter cells can be induced to proliferate themselves and produce progeny that subsequently differentiate into one or more mature cell types while still retaining one or more cells with the developmental potential of the parent. The term "stem cell" refers to a cell that is capable or potential to differentiate into a more specialized or differentiated phenotype under a particular circumstance and in some circumstances retains the ability to proliferate without substantial differentiation. In one aspect, the term progenitor or stem cell refers to a broad range of progenitor cells, the progeny (progeny) of which are often specialized in different directions by differentiation, for example, by acquiring completely independent characteristic properties, as occurs in the progressive diversification of embryonic cells and tissues. Cell differentiation is a complex process that typically occurs through many cell divisions. The differentiated cells may be derived from pluripotent cells that are themselves derived from pluripotent cells, or the like. Although each of these pluripotent cells may be considered a stem cell, the range of cell types that each pluripotent cell can produce may vary widely. Some differentiated cells also have the ability to produce cells with greater developmental potential. This ability may be natural or may be artificially induced upon treatment with various factors. In many biological cases, a stem cell may also be "pluripotent" in that it may produce progeny of more than one different cell type, but this is not necessary for "stem-ness".
Self-renewal can be another important aspect of stem cells. In theory, self-renewal can occur by either of two major mechanisms. Stem cells can divide asymmetrically, with one daughter cell retaining the stem cell state and the other expressing some other different specific function and phenotype. Alternatively, some of the stem cells in the population may divide symmetrically into two stem cells, thereby leaving some stem cells in the population intact while other cells in the population produce only differentiated progeny. "progenitor cells" typically have a more primitive cellular phenotype (i.e., are at an earlier step along a developmental pathway or progression than fully differentiated cells). Progenitor cells also often have significant or very high proliferative potential. Progenitor cells can give rise to multiple different differentiated cell types or a single differentiated cell type, depending on the developmental pathway and on the environment in which the cells develop and differentiate.
In the context of the occurrence of an individual cell, the adjectives "differentiated" or "differentiation" are relative terms. A "differentiated cell" is a cell that has progressed further down a developmental pathway than the cell it compares to. Thus, stem cells can differentiate into lineage restricted precursor cells (e.g., myocyte progenitor cells), which in turn can further differentiate down the way into other types of precursor cells (e.g., myocyte precursors) and then into terminally differentiated cells such as myocytes, which play a characteristic role in certain tissue types and may or may not retain the ability to further proliferate.
Induced pluripotent stem cells
The genetically engineered human cells described herein can be induced pluripotent stem cells (ipscs). The advantage of using ipscs is that cells can be obtained from the same subject to which the progenitor cells are to be administered. That is, somatic cells can be obtained from a subject, reprogrammed into induced pluripotent stem cells, and then re-differentiated into progenitor cells (e.g., autologous cells) to be administered to the subject. Because the progenitor cells are substantially derived from an autologous source, the risk of transplant rejection or allergic reactions can be reduced compared to using cells from another subject or group of subjects. In addition, the use of ipscs eliminates the need for cells obtained from embryonic sources. Thus, in one aspect, the stem cells used in the methods of the present disclosure are not embryonic stem cells.
Although differentiation is generally irreversible in a physiological context, several methods have recently been developed for reprogramming somatic cells to ipscs. Exemplary methods are known to those skilled in the art and are briefly described below.
The term "reprogramming" refers to a process of altering or reversing the differentiation state of a differentiated cell (e.g., a somatic cell). In other words, reprogramming refers to the process of driving differentiation of cells back to a more undifferentiated or more primitive type of cell. It should be noted that culturing many primary cells may result in some loss of fully differentiated characteristics. Thus, simply culturing such cells, as embodied in the term differentiated cells, does not render the cells non-differentiated (e.g., undifferentiated) or pluripotent. In addition to stimuli that result in a partial loss of differentiation properties in culture, the transition of differentiated cells to pluripotency requires reprogramming of the stimuli. Reprogrammed cells also have the property of being able to undergo extensive passaging without loss of growth potential, relative to primary cell parents, which typically have the ability to divide only a limited number in culture.
Prior to reprogramming, the cells to be reprogrammed may be partially differentiated or terminally differentiated. Reprogramming may encompass the complete reversal of the differentiation state of a differentiated cell (e.g., a somatic cell) to a pluripotent or multipotent state. Reprogramming may encompass the complete or partial reversal of the differentiated state of a differentiated cell (e.g., a somatic cell) to an undifferentiated cell (e.g., an embryoid cell). Reprogramming may result in the expression of a particular gene by the cell, the expression of which further facilitates reprogramming. In certain examples described herein, reprogramming a differentiated cell (e.g., a somatic cell) can cause the differentiated cell to assume an undifferentiated state (e.g., to be an undifferentiated cell). The resulting cells are referred to as "reprogrammed cells" or "induced pluripotent stem cells (ipscs or iPS cells)".
Reprogramming may involve altering, for example reversing, at least some of the following that occur during cell differentiation: heritable patterns of nucleic acid modifications (e.g., methylation), chromatin condensation, epigenetic changes, genomic imprinting, and the like. Reprogramming is different from simply maintaining an existing undifferentiated state of an already pluripotent cell or maintaining an existing less than fully differentiated state of a cell that is already a pluripotent cell (e.g., myogenic stem cell). In some examples, the compositions and methods described herein can also be used for such purposes, although reprogramming is also different from promoting self-renewal or proliferation of already pluripotent or multipotent cells.
Many methods are known in the art that can be used to generate pluripotent stem cells from somatic cells. Any such method of reprogramming somatic cells to a pluripotent phenotype would be suitable for use in the methods described herein.
Reprogramming methods for generating pluripotent cells using defined combinations of transcription factors have been described. Mouse somatic cells can be transformed into ES cell-like cells with expanded developmental potential by direct transduction of Oct4, Sox2, Klf4, and c-Myc; see, e.g., Takahashi and Yamanaka, cells 126(4) 663-76 (2006). ipscs resemble ES cells in that they restore pluripotency-related transcriptional circuitry and many epigenetic landscapes. In addition, the mouse iPSC meets all standard assays for pluripotency: specifically, differentiation into cell types of the three germ layers in vitro, teratoma formation, contribution to chimeras, germ line transmission [ see, e.g., Maherali and Hochedlinger, cell stem cells [ 3(6):595-605(2008) ], and tetraploid complementation.
Human ipscs can be obtained using similar transduction methods, and the triple transcription factors OCT4, SOX2 and NANOG have been established as a core set of transcription factors that manage pluripotency; see, e.g., Budniatzky and Gepstein, Stem cell transformation medicine (Stem Cells Transl Med.) 3(4):448-57 (2014); barrett et al, Stem cell transformation medicine 3:1-6sctm.2014-0121 (2014); focosi et al, journal of hematological cancer (Blood cancer journal) 4: e211 (2014); and references cited therein. The generation of ipscs can be achieved by historically introducing nucleic acid sequences encoding stem cell-associated genes into adult somatic cells using viral vectors.
ipscs can be generated or derived from terminally differentiated somatic cells as well as adult somatic cells or somatic stem cells. That is, non-pluripotent progenitor cells can be made pluripotent or multipotent by reprogramming. In this case, it may not be necessary to include as many reprogramming factors as are needed to program the terminally differentiated cells. Further, reprogramming can be induced by non-viral introduction of a reprogramming factor, e.g., by introduction of the protein itself or by introduction of a nucleic acid encoding a reprogramming factor or by introduction of messenger RNA that produces a reprogramming factor upon translation (see, e.g., Warren et al, cell stem cell 7(5):618-30 (2010)) One or more of a member of the Sox family, a member of the Klf family, and a member of the Myc family is introduced into the somatic cell. The methods and compositions described herein may further include introducing one or more of each of Oct-4, Sox2, Nanog, c-MYC, and Klf4 for reprogramming. As noted above, the exact method used for reprogramming is not necessarily critical to the methods and compositions described herein. However, when cells differentiated from reprogrammed cells are to be used in, for example, human therapy, reprogramming is not achieved by methods that alter the genome, on the one hand. Thus, in such an instance, reprogramming can be accomplished without the use of, for example, viral vectors or plasmid vectors.
Reprogramming efficiency (i.e., the number of cells that have been reprogrammed) from a population of starting cells can be enhanced by the addition of various agents, such as small molecules, as shown below: shi et al, cell Stem cell 2:525-528 (2008); huanggfu et al, Nature Biotechnology 26(7):795-797 (2008); and Marson et al, cell Stem cell 3:132-135 (2008). Thus, an agent or combination of agents that enhances the efficiency or rate of induced pluripotent stem cell production may be used to produce patient-specific or disease-specific ipscs. Some non-limiting examples of agents that enhance reprogramming efficiency include soluble Wnt, Wnt conditioned media, BIX-01294(G9a histone methyltransferase), PD0325901(MEK inhibitor), DNA methyltransferase inhibitor, Histone Deacetylase (HDAC) inhibitor, valproic acid, 5' -azacytidine, dexamethasone (dexamethasone), suberoylanilide hydroxamic acid (SAHA), vitamin C, and Trichostatin (TSA), among others.
Other non-limiting examples of reprogramming enhancers include: suberoylanilide hydroxamic acid (SAHA (e.g., MK0683, vorinostat) and other hydroxamic acids), BML-210, Depudecin (e.g., (-) -Depudecin), HC toxin, Nullscript (4- (l, 3-dioxo-lH, 3H-benzo [ de ] isoquinolin-2-yl) -N-hydroxybutanamide), phenylbutyric acid (e.g., Sodium phenylbutyrate) and valproic acid ((VP A) and other short chain fatty acids), Scriptaid, Suramin Sodium (Suramin Sodium), Tributin A (TSA), APHA compound 8, Apicidin, Sodium butyrate, pivaloyloxymethylbutyrate (Pivanex, AN-9), triptoxin B (Trapoxin B), Chlamydocin, depsipeptide (also known as FR 1228 or 90228), benzamide (e.g., FK-4-acetyl-N-acetyl-adenine (e.g., FKCI-275), N-acetyl-27-acetyl-adenine (27-27), and other hydroxamine), MGCD0103, NVP-LAQ-824, CBHA (m-carboxycinnamic acid bis-hydroxamic acid), JNJ16241199, Tubacin, A-161906, progxamide, oxamflatin, 3-Cl-UCHA (e.g., 6- (3-chlorophenylureido) hexohydroxamic acid), AOE (2-amino-8-oxo-9, 10-epoxydecanoic acid), CHAP31, and CHAP 50. Other reprogramming enhancers include, for example, HDACs (e.g., catalytically inactive forms), siRNA inhibitors of HDACs, and dominant negative forms of antibodies that specifically bind to HDACs. Such inhibitors are available from, for example, BIOMOL International (BIOMOL International), deep gloss (Fukasawa), Merck Biosciences (Merck Biosciences), Novartis (Novartis), Gloulter Pharmaceuticals (Gloucesser Pharmaceuticals), Titan Pharmaceuticals (Titanpharmaceuticals), MethylGene, and Sigma Aldrich.
To confirm that pluripotent stem cells used with the methods described herein were induced, isolated clones can be tested for expression of stem cell markers. Such expression in somatic cell-derived cells identifies the cells as induced pluripotent stem cells. The stem cell marker may be selected from the non-limiting group comprising: SSEA3, SSEA4, CD9, Nanog, Fbxl5, Ecatl, Esgl, Eras, Gdf3, Fgf4, Cripto, Daxl, Zpf296, Slc2a3, Rexl, Utfl, and Natl. In one instance, for example, cells expressing Oct4 or Nanog were identified as pluripotent. Methods for detecting the expression of such markers may include, for example, RT-PCR and immunological methods for detecting the presence of the encoded polypeptide, such as Western blot or flow cytometry analysis. The detection may involve not only RT-PCR but also the detection of protein markers. Intracellular markers can be optimally identified via RT-PCR or protein detection methods such as immunocytochemistry, whereas cell surface markers are easily identified, e.g. by immunocytochemistry.
The pluripotent stem cell characteristics of the isolated cells can be confirmed by tests that assess the ability of ipscs to differentiate into cells of each of the three germ layers. As an example, teratoma formation in nude mice can be used to assess the pluripotent properties of isolated clones. Cells may be introduced into nude mice, and histology and/or immunohistochemistry may be performed on tumors produced by the cells. Growth of tumors involving cells from all three germ layers, for example, further indicates that the cells are pluripotent stem cells.
Liver cell
In some aspects, the genetically engineered human cell described herein is a hepatocyte. Hepatocytes are cells of the main parenchymal tissue of the liver. The liver cells account for 70-85% of the liver mass. These cells are involved: protein synthesis; protein storage; the conversion of carbohydrates; synthesis of cholesterol, bile salts and phospholipids; detoxification, modification and excretion of exogenous and endogenous substances; and initiation of bile formation and secretion.
Generation of patient-specific ipscs
One step of the ex vivo methods of the present disclosure may involve generating a patient-specific iPS cell, a plurality of patient-specific iPS cells, or a patient-specific iPS cell line. There are many established methods in the art for generating patient-specific iPS cells, as described below: takahashi and Yamanaka, 2006; takahashi, Tanabe et al, 2007. For example, the generating step may include: a) isolating somatic cells, such as skin cells or fibroblasts, from a patient; and b) introducing a set of pluripotency-associated genes into the somatic cell so as to induce the cell to become a pluripotent stem cell. The set of pluripotency-associated genes may be one or more genes selected from the group consisting of OCT4, SOX1, SOX2, SOX3, SOX15, SOX18, NANOG, KLF1, KLF2, KLF4, KLF5, c-MYC, n-MYC, REM2, TERT, and LIN 28.
Performing biopsy or aspiration of a patient's liver or bone marrow
A biopsy or aspiration is a tissue or fluid sample taken from the body. There are many different kinds of biopsies or aspirations. Almost all biopsies or aspirations involve the use of sharp instruments to remove small amounts of tissue. If the biopsy is to be performed on the skin or other sensitive area, the paralytic drug may be applied first. The biopsy or aspiration may be performed according to any of the methods known in the art. For example, in biopsy, a needle is injected through the abdominal skin into the liver, thereby capturing liver tissue. For example, during bone marrow aspiration, a large needle is used to enter the pelvis to collect bone marrow.
Isolation of liver-specific progenitor cells or Primary hepatocytes
The liver-specific progenitor cells and primary hepatocytes may be isolated according to any method known in the art. For example, human hepatocytes are isolated from fresh surgical specimens. Healthy liver tissue is used to isolate hepatocytes by collagenase digestion. The cell suspension obtained was filtered through a 100-mm nylon mesh and precipitated by centrifugation at 50g for 5 minutes, resuspended and washed twice to three times in cold wash medium. Human hepatic stem cells are obtained by culturing under stringent conditions the hepatocytes obtained from the fresh liver preparation. Hepatocytes plated on collagen-coated plates were cultured for 2 weeks. After 2 weeks, the surviving cells were removed and characterized for expression of stem cell markers (Herrera et al, Stem cells (STEM CELLS) 2006; 24: 2840-2850).
Isolation of mesenchymal Stem cells
Mesenchymal stem cells may be isolated according to any method known in the art, such as from bone marrow or peripheral blood of a patient. For example, bone marrow aspirate may be collected into a syringe with heparin. Cells can be washed on Percoll and centrifuged. The cells can be cultured in Duber's Modified Eagle's Medium (DMEM) (reduced carbohydrate) containing 10% Fetal Bovine Serum (FBS) (Pitttinger MF, Mackay AM, Beck SC et al, science 1999; 284: 143-.
Genetically modified cells
The term "genetically modified cell" refers to a cell that includes at least one genetic modification introduced by genome editing (e.g., using CRISPR/Cas9 or CRISPR/Cpf1 systems). In some ex vivo examples herein, the genetically modified cell may be a genetically modified progenitor cell. In some in vivo examples herein, the genetically modified cell may be a genetically modified hepatocyte. Genetically modified cells comprising exogenous genome-targeting nucleic acids and/or exogenous nucleic acids encoding genome-targeting nucleic acids are contemplated herein.
The term "control treatment population" describes a population of cells that have been treated with the same media, viral induction, nucleic acid sequence, temperature, confluence, flask size, pH, etc., except for the addition of genome editing components. Any method known in the art may be used to measure transcription or protein expression or activity of the ANGPTL3 gene, for example, western blot analysis of ANGPTL3 protein or quantitation of ANGPTL3 mRNA.
The term "isolated cell" refers to a cell that has been removed from the organism in which it was originally found or the progeny of such a cell. Optionally, the cells may be cultured in vitro, for example, under defined conditions or in the presence of other cells. Optionally, the cell is later introduced into a second organism or reintroduced into an organism from which it (or cells that genetically inherit the cell) was isolated.
With respect to an isolated population of cells, the term "isolated population" refers to a population of cells that has been removed and isolated from a mixed or heterogeneous population of cells. In some cases, an isolated population can be a substantially pure population of cells as compared to a heterogeneous population from which the cells are isolated or enriched. In some cases, the isolated population can be an isolated population of human progenitor cells, e.g., a substantially pure population of human progenitor cells, as compared to a heterogeneous population of cells comprising human progenitor cells and cells from which the human progenitor cells are derived.
With respect to a particular cell population, the term "substantially enhanced" refers to a cell population that: the presence of a particular type of cell is increased at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 400-fold, at least 1000-fold, at least 5000-fold, at least 20000-fold, at least 100000-fold, or more, relative to a pre-existing or reference level, e.g., depending on the desired level of such cell for use in the reduction of dyslipidemia.
With respect to a particular cell population, the term "substantially enriched" refers to a cell population that is at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, or more, relative to the cells that make up the total cell population.
With respect to a particular cell population, the term "substantially enriched" or "substantially pure" refers to a cell population that is at least about 75%, at least about 85%, at least about 90%, or at least about 95% pure relative to the cells comprising the total cell population. That is, with respect to a population of progenitor cells, the term "substantially pure" or "substantially purified" refers to a population of cells that contains less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, or less than 1% of cells that are not progenitor cells, as that term is defined herein.
Differentiation of genome-edited ipscs into other cell types
Another step of the ex vivo methods of the present disclosure may comprise differentiating the genome-edited ipscs into hepatocytes. The differentiation step may be performed according to any method known in the art. For example, hipscs were differentiated into definitive endoderm using various treatments including activin and B27 supplement (Life technologies). Further differentiating definitive endoderm into hepatocytes, the treatment comprising: FGF4, HGF, BMP2, BMP4, oncostatin M, dexamethasone, and the like. (Duan et al, Stem cells 2010; 28: 674-.
Differentiating the genome-edited mesenchymal stem cells into hepatocytes
Another step of the ex vivo method of the present disclosure may include differentiating the genome-edited mesenchymal stem cells into hepatocytes. The differentiation step may be performed according to any method known in the art. For example, hMSCs are treated with various factors and hormones, including insulin, transferrin, FGF4, HGF, bile acids (Sawitza I et al, science report (SciRep.) 2015; 5: 13320).
Implanting cells into a patient
Another step of the ex vivo method of the present disclosure may include implanting the hepatocytes into the patient. This implantation step may be accomplished using any implantation method known in the art. For example, the genetically modified cells can be injected directly into the blood of a patient or otherwise administered to a patient.
Another step of the ex vivo methods of the present disclosure involves implanting progenitor cells or primary hepatocytes into a patient. This implantation step may be accomplished using any implantation method known in the art. For example, the genetically modified cells can be injected directly into the liver of a patient or otherwise administered to a patient.
Formulation and delivery
Pharmaceutically acceptable carrier
The ex vivo methods of administering progenitor cells to a subject contemplated herein involve the use of therapeutic compositions comprising progenitor cells.
The therapeutic compositions can contain a physiologically tolerable carrier along with the cellular composition and optionally at least one additional bioactive agent dissolved or dispersed therein as an active ingredient as described herein. In some cases, a therapeutic composition is substantially non-immunogenic when administered to a mammalian or human patient for therapeutic purposes, unless so desired.
The progenitor cells described herein can generally be administered as a suspension with a pharmaceutically acceptable carrier. One skilled in the art will recognize that the pharmaceutically acceptable carrier to be used in the cell composition will not comprise buffers, compounds, cryopreservatives, or other agents in amounts that substantially interfere with the viability of the cells to be delivered to the subject. The formulation comprising the cells may comprise, for example, a permeation buffer that allows for maintenance of cell membrane integrity and optionally nutrients for maintaining cell viability or enhancing transplantation upon administration. Such formulations and suspensions are known to those skilled in the art and/or may be suitable for use with progenitor cells using routine experimentation as described herein.
The cell composition may also be emulsified or presented as a liposome composition, provided that the emulsification procedure does not adversely affect cell viability. The cells and any other active ingredients may be mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredients and in amounts suitable for use in the methods of treatment described herein.
The additional agent comprised in the cellular composition may comprise a pharmaceutically acceptable salt of a component thereof. Pharmaceutically acceptable salts include the acid addition salts (formed from the free amino groups of the polypeptide) formed from inorganic acids such as, for example, hydrochloric or phosphoric acids, or organic acids such as acetic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine (procaine), and the like.
Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions containing no material other than the active ingredient and water or containing a buffer such as sodium phosphate at physiological pH, physiological saline, or both, such as phosphate buffered saline. Still further, the aqueous carrier may contain more than one buffer salt as well as salts, such as sodium and potassium chloride, dextrose, polyethylene glycol, and other solutes. The liquid composition may also contain a liquid phase in addition to and excluding water. Examples of such additional liquid phases are glycerol, vegetable oils such as cotton seed oil and water-oil emulsions. The amount of active compound used in the cellular composition that is effective in the treatment of a particular disorder or condition may depend on the nature of the disorder or condition and may be determined by standard clinical techniques.
Guide RNA formulations
The guide RNAs of the present disclosure may be formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, and the like, depending on the particular mode of administration and dosage form. The guide RNA composition may be formulated to achieve a physiologically compatible pH and range from about
Suitable excipients include, for example, carrier molecules comprising large, slowly metabolised macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactivated virus particles. Other exemplary excipients may include antioxidants (such as, but not limited to, ascorbic acid), chelating agents (such as, but not limited to, EDTA), carbohydrates (such as, but not limited to, dextrins, hydroxyalkyl celluloses, and hydroxyalkyl methylcelluloses), stearic acid, liquids (such as, but not limited to, oils, water, saline, glycerol, and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.
Delivery of
The guide RNA polynucleotide (RNA or DNA) and/or one or more endonuclease polynucleotides (RNA or DNA) may be delivered by viral delivery vehicles or non-viral delivery vehicles known in the art. Alternatively, one or more endonuclease polypeptides may be delivered by viral delivery vehicles such as electroporation or lipid nanoparticles or non-viral delivery vehicles known in the art. In a further alternative aspect, the DNA endonuclease may be delivered as one or more polypeptides alone or in a pre-complexed with one or more guide RNAs or one or more crrnas along with a tracrRNA.
Polynucleotides can be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA conjugates, aptamer-RNA chimeras, and RNA fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer and Lieberman, Gene therapy (Gene therapy) 18:1127-1133(2011) which focuses on non-viral delivery vehicles for siRNA that are useful for the delivery of other polynucleotides.
For the polynucleotides of the present disclosure, the formulation may be selected from any of those taught, for example, in international application PCT/US 2012/069610.
Polynucleotides encoding endonucleases such as guide RNAs, sgrnas, and mrnas can be delivered to cells or patients by Lipid Nanoparticles (LNPs).
LNP refers to any particle with a diameter of less than 1000nm, 500nm, 250nm, 200nm, 150nm, 100nm, 75nm, 50nm or 25 nm. Alternatively, the nanoparticles may range in size from 1-1000nm, 1-500nm, 1-250nm, 25-200nm, 25-100nm, 35-75nm, or 25-60 nm.
LNPs can be made from cationic, anionic or neutral lipids. Neutral lipids such as the fusogenic phospholipid DOPE or the membrane component cholesterol may be included in LNPs as "helper lipids" to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy due to poor stability and rapid clearance and the generation of inflammatory or anti-inflammatory responses.
LNPs can also be composed of hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.
LNPs can be produced using any lipid or combination of lipids known in the art. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC-cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE and GL 67A-DOPE-DMPE-polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1 and 7C 1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG-CerC14 and PEG-
The lipids can be combined in any number of molar ratios to produce LNP. In addition, one or more polynucleotides can be combined with one or more lipids in a wide range of molar ratios to produce LNPs.
As described above, the site-directed polypeptide and the genomic targeting nucleic acid can each be administered separately to a cell or patient. Alternatively, the site-directed polypeptide may be pre-complexed with one or more guide RNAs or one or more crrnas along with a tracrRNA. The pre-compounded material may then be administered to a cell or patient. This pre-compounded material is called ribonucleoprotein particles (RNPs).
RNA is capable of forming specific interactions with RNA or DNA. Although this property is exploited in many biological processes, it is also accompanied by the risk of promiscuous interactions in the nucleic acid-enriched cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs) in which RNA is pre-complexed with endonuclease. Another benefit of RNPs is the protection of RNA from degradation.
The endonuclease in the RNP may be modified or unmodified. Likewise, the gRNA, crRNA, tracrRNA, or sgRNA may be modified or unmodified. Many modifications are known in the art and may be used.
Generally, the endonuclease can be combined with the sgRNA at a molar ratio of 1: 1. Alternatively, the endonuclease, crRNA and tracrRNA may be combined, typically in a molar ratio of 1:1: 1. However, a wide range of molar ratios can be used to generate RNPs.
AAV (adeno-associated virus)
Recombinant adeno-associated virus (AAV) vectors can be used for delivery. Techniques for producing rAAV particles in which the AAV genome to be packaged, rep and cap genes, and helper virus functions comprising the polynucleotide to be delivered, are provided to a cell are standard in the art. Production of rAAV typically requires the presence of the following components within a single cell (denoted herein as a packaging cell): rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be from any AAV serotype from which a recombinant virus may be derived and may be from an AAV serotype different from the rAAV genomic ITRs, including, but not limited to, the AAV serotypes described herein. Production of pseudotyped rAAV is disclosed, for example, in international patent application publication No. WO 01/83692.
AAV serotypes
AAV particles that package polynucleotides encoding compositions of the disclosure (e.g., an endonuclease, donor sequence, or RNA guide molecule of the disclosure) can include or be derived from any natural or recombinant AAV serotype. According to the present disclosure, the AAV particle may utilize or be based on a serotype selected from any one of the following serotypes and variants thereof, including but not limited to AAV1, AAV10, AAV106.1/hu.37, AAV11, AAV114.3/hu.40, AAV12, AAV127.2/hu.41, AAV127.5/hu.42, AAV128.1/hu.43, AAV128.3/hu.44, AAV130.4/hu.48, AAV145.1/hu.53, AAV145.5/hu.54, AAV145.6/hu.55, AAV16.12/hu.11, AAV16.3, AAV16.8/hu.10, AAV161.10/hu.60, 161.6/hu.61, AAV1-7/rh.48, AAV1-8/rh.49, AAV2, AAV AAV2.5T, AAV 161.10/hu.15, AAV 1.223-hu.5/hu.223, AAV 1/hu.50, AAV 635/hu.5/hu.1, AAV 1/hu.223, AAV 1/hu.5, AAV 1/hu.50, AAV 2/hu.223, AAV 1/hu.5, AAV 1/hu.6, AAV 1/hu.5, AAV 1/hu.5, AAV1, AAV 1.6, AAV 1/hu.5/hu.55, AAV 1/hu.6, AAV 1.1.1, AAV 1/hu.6, AAV 1.6, AAV3.1/hu.9, AAV3-11/rh.53, AAV3-3, AAV33.12/hu.17, AAV33.4/hu.15, AAV33.8/hu.16, AAV3-9/rh.52, AAV33, AAV 3-19/rh.55, AAV42.12, AAV 3-10, AAV3-11, AAV 3-12, AAV 3-13, AAV 3-15, AAV3-1 b, AAV 3-2, AAV3-3 a, AAV3-3 b, AAV 3-4, AAV 3-5 a, AAV 3-5 b, AAV 3-6 b, AAV 72-8, AAV 72-aa, AAV 72-1, AAV 3-12, AAV 72-20, AAV 3-21, AAV 72-23, AAV 72-5 b, AAV 3-6 b, AAV 3-8, AAV 3-54, AAV 72/75, AAV 33/rh.46, AAV 33/rh.4, AAV4, AAV3, AAV 72-4, AAV 72-3, AAV 72, AAV4, AAV8, AAV3, AAV 72-3, AAV6, AAV3-3, AAV4, AAV6, AAV 72-, AAV5, AAV52.1/hu.20, AAV52/hu.19, AAV5-22/rh.58, AAV5-3/rh.57, AAV54.1/hu.21, AAV54.2/hu.22, AAV54.4R/hu.27, AAV54.5/hu.23, AAV54.7/hu.24, AAV58.2/hu.25, AAV6, AAV6.1, AAV6.1.2, AAV6.2, AAV7, AAV7.2, AAV7.3/hu.7, AAV8, AAV-8b, AAV-8h, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, DJ 9.9.9, AAV 3.3.13, AAV 3.3.16, AAV9.24, AAV 9.15, AAV2 VVA 3.15, AAV2, hAAVvAAVv5.7, hAAVvAAVvAAVv5.7, hAAVvAAVvAAVvAAVv7.7, hAAVvAAVvAAVvAAVv7.7.7, AAV2, hAAVvAAVvAAVvAAVvAAVvAAVv5.7.7, AAV 2-hEvAAVvAAVv7.7.7, AAV2, AAV 8b, AAV2, AAV 8b, AAV8, AAV-8, AAV 8h, AAV-8, AAV-8, AAV 8h, AAV8, AAV 8h, AAV8, AAV, AAVhu.13, AAVhu.14/9, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.19, AAVhu.2, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.3, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.4, AAVhu.40, Vhu.41, Vhu.42, Vhu.43, AAVhu.41, AAVhu.42, Vhu.43, AAVhu.7, AAVhu-4858, AAVhu-58, AAVhu-8, AAVhu-53, AAVhu-AAVhu.7, AAVhu-8, AAVhu-27, AAVhu.7, AAVhu-AAVhu.7, AAVhu-8, AAVhu-2, AAVhu-3, AAVhu-8, AAVhu-8, AAVhu-3, AAVhu-8, AAVhu-8, AAVhu-8, AAVhu-3, AAVhu-8, AAVhu-3, AAVhu-8, AAVhu-8, AAVhu-3, AAVhu-AAVhu, AAV-LK17, AAV-LK18, AAV-LK19, AAVN721-8/rh.43, AAV-PAEC11, AAV-PAEC12, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAVpi.1, AAVpi.2, AAVpi.3, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.1R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, Vrh.2, AAVrh.20, AAVrh.21, AAVrh.22, AAh.23, AAh.24, AAh.25, AAh.2R, AAh.31, AAVrh.32, AAVrh 33, Vrh.52, AAVrh 48, AAVrh 52, AAVrh 52, AAVrh 2 Vrh 2, AAVrh 52, AAVrh 2, AAVrh 52, AAVrh 2, AAVrh 52, AAVrh 2, AAVrh 52, AAVrh 2 Vrh 2, AAVrh 2 Vrh 2V, UPENN AAV10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAVSM 10-2, and/or AAV SM 10-8.
In some aspects, the AAV serotype may be or have a mutation in an AAV9 sequence, such as but not limited to AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, as described by N pulcherla et al (molecular therapy 19(6):1070 (2011)).
In some aspects, the AAV serotype may be or have a sequence as described in U.S. patent No. US 6156303, such as but not limited to AAV3B (SEQ ID NOs: 1 and 10 of US 6156303), AAV6 (SEQ ID NOs: 2,7 and 11 of US 6156303), AAV2 (SEQ ID NOs: 3 and 8 of US 6156303), AAV3A (SEQ ID NOs: 4 and 9 of US 6156303), or derivatives thereof.
In some aspects, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al (Journal of Virology 82(12): 5887-. The amino acid sequence of AAVDJ8 may include two or more mutations to remove the heparin-binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described as SEQ ID NO. 1 in U.S. Pat. No. 7,588,772 may include two mutations: (1) R587Q, wherein arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln); and (2) R590T, wherein arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr). As non-limiting examples three mutations may be included: (1) K406R, wherein the lysine at amino acid 406 (K; Lys) is changed to arginine (R; Arg); (2) R587Q, wherein arginine (R; Arg) at amino acid 587 is changed to glutamine (Q; Gln); and (3) R590T, wherein arginine (R; Arg) at amino acid 590 is changed to threonine (T; Thr).
In some embodiments, the AAV serotype may be or have a sequence as described in international publication No. WO2015121501 or a variant thereof, such as, but not limited to, an ideal AAV (ttava) (SEQ ID NO:2 of WO 2015121501), "
In accordance with the present disclosure, the selection or use of AAV capsid serotypes may be from multiple species. In one example, the AAV may be an avian AAV (aaav). The AAAV serotype may be or have a sequence as described in U.S. Pat. No. US 9238800, such as, but not limited to, AAAV (SEQ ID NOs: 1,2, 4,6, 8,10, 12, and 14 in US9,238,800), or a variant thereof.
In one example, the AAV may be bovine AAV (baav). The BAAV serotype may be or have a sequence as described in US patent No. US9,193,769, such as but not limited to BAAV (SEQ id nos: 1 and 6 of US 9193769), or a variant thereof. The BAAV serotype may be or have a sequence as described in US patent No. US7427396, such as but not limited to BAAV (SEQ ID NOs: 5 and 6 of US 7427396), or a variant thereof.
In one example, the AAV may be a goat AAV. The goat AAV serotype can be or have a sequence as described in U.S. Pat. No. US7427396, such as, but not limited to, goat AAV (SEQ ID NO:3 of US 7427396), or a variant thereof.
In other examples, the AAV may be engineered as a hybrid AAV from two or more parental serotypes. In one example, the AAV may be AAV2G9, and AAV2G9 includes sequences from AAV2 and AAV9. The AAV2G9AAV serotype may be or have a sequence as described in U.S. patent publication No. US 2016/0017005.
In one example, the AAV can be a serotype generated from an AAV9 capsid library having mutations in amino acids 390-627(VP1 numbering) as described by Pulichella et al (molecular therapy 19(6):1070-1078 (2011)). The serotypes and corresponding nucleotide and amino acid substitutions may be, but are not limited to, AAV9.1 (G1594C; D532H), AAV6.2(T1418A and T1436X; V473D and I47 479K), AAV9.3 (T1238A; F413Y), AAV9.4(T1250C and A1617T; F417S), AAV9.5(A1235G, A1314T, A1642G, C1760T; Q412R, T548R, A587R), AAV 1239.6 (T1233672; F411R), AAV9.9 (G1203R, G1785R; W595R), AAV9.10 (A1500R, T366R; M559.11 (A1425R, A1702, A9, A R; W3672; W3680, W3672; W36595R, R; W3645, 3645, R; 3636363645, 3645, R; 3663, R, 3668, R, 3645, 3655, 3645, 3655, 3645, 3680, R, 3680, R, 3655, R, 369, 3680, 369, 3668, R, 3655, 369, R, 369, 3668, 369, R, 3668, R, 369, R, 3668, R, 369, 3668, R, 369, R, 369, 3668, 369, R, 369, R, 369, 3668, 369, R, 369, R, 369, R, 369, 9.47(G1241A, G1358A, A1669G, C1745T, S414N, G453D, K557E, T582I), AAV9.48(C1445T, A1736T; P482L, Q579L), AAV9.50(A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301H, A1405H, C1664H; G1811H; R134H, S469H, A555H, G604H), AAV9.54 (C1531H, T1609H; L511H, L537H), AAV9.55 (T365; F36535), AAV9.58(C1475, C13572, T H, AAV 3668, T14672, T H, AAV 3668, H, AAV H, AAV 3668, H, 3668, H, 3668, H, 3668, H, 3668, H, 3668, H, 3668, H, 3668, H, 3668, H, 36.
In one example, the AAV may be a serotype comprising at least one AAV capsid CD8+ T cell epitope. As non-limiting examples, the serotype may be AAV1, AAV2, or AAV 8.
In one example, the AAV may be a variant, such as PHP.A or PHP.B as described in Deverman.2016. Nature Biotechnology 34(2) 204-209.
In one example, the AAV can be a serotype selected from any of those serotypes found in SEQ ID NO 4,734-5,302 and Table 2.
In one example, the AAV can be encoded by a sequence, fragment or variant as described in SEQ ID NO 4,734-5,302.
The general principles of rAAV production are reviewed, for example, in: carter,1992, Biotechnology, 1533-539; and Muzyczka,1992, [ current topic of microbiology and immunology (curr. topics in microbiological. and Immunol.) ] 158: 97-129. Various methods are described in the following: ratschin et al, molecular cell biology (mol. cell. biol.) 4:2072 (1984); hermonat et al, Proc. Natl. Acad. Sci. USA 81:6466 (1984); tratschin et al, molecular cell biology 5:3251 (1985); McLaughlin et al, J.Virol., 62:1963 (1988); and Lebkowski et al, 1988, molecular cell biology 7:349 (1988). Samulski et al, (1989, J. Virol. 63: 3822-3828); U.S. Pat. nos. 5,173,414; WO 95/13365 and corresponding U.S. patent No. 5,658,776; WO 95/13392; WO 96/17947; PCT/US 98/18600; WO 97/09441(PCT/US 96/14423); WO 97/08298(PCT/US 96/13872); WO 97/21825(PCT/US 96/20777); WO 97/06243(PCT/FR 96/01064); WO 99/11764; perrin et al (1995) Vaccine (Vaccine) 13: 1244-1250; paul et al (1993) Human Gene Therapy (Human Gene Therapy) 4: 609-615; clark et al (1996) Gene Therapy (Gene Therapy) 3: 1124-; U.S. patent No. 5,786,211; U.S. patent No. 5,871,982; and U.S. Pat. No. 6,258,595.
AAV vector phenotypes can be matched to target cell types. For example, the following exemplary cell types can be transduced by the indicated AAV phenotype, and the like.
TABLE 2 tissue/cell types and serotypes
Tissue/cell type
Serotype
Liver disease
AAV3、AAV5、AAV8、AAV9
Skeletal muscle
AAV1、AAV7、AAV6、AAV8、AAV9
Central nervous system
AAV5、AAV1、AAV4、AAV9
RPE
AAV5、AAV4
Photoreceptor cell
AAV5
Lung (lung)
AAV9
Heart and heart
AAV8
Pancreas gland
AAV8
Kidney (Kidney)
AAV2、AAV8
Hematopoietic stem cells
AAV6
In addition to adeno-associated viral vectors, other viral vectors can be used. Such viral vectors include, but are not limited to, lentiviruses, alphaviruses, enteroviruses, pestiviruses, baculoviruses, herpes viruses, epstein-barr viruses (epstein barr viruses), papova viruses, pox viruses, vaccinia viruses, and herpes simplex viruses.
In some aspects, Cas9 mRNA, sgRNA targeting one or two loci in the ANGPTL3 gene, and donor DNA can each be formulated individually into lipid nanoparticles or all together into one lipid nanoparticle.
In some aspects, Cas9 mRNA can be formulated as a lipid nanoparticle, while sgrnas and donor DNA can be delivered in an AAV vector.
Options are available for delivery of Cas9 nuclease as a DNA plasmid, as mRNA, or as a protein. The guide RNA may be expressed from the same DNA or may also be delivered as RNA. The RNA may be chemically modified to alter or improve its half-life or to reduce the likelihood or extent of an immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow for efficient delivery; split versions of Cas9 and smaller orthologs of Cas9 can be packaged in AAV as donors can for HDR. There are also a range of non-viral delivery methods that can deliver each of these components, or both non-viral and viral methods can be employed. For example, nanoparticles can be used to deliver proteins and guide RNAs, while AAV can be used to deliver donor DNA.
Administration and administration
The terms "administering," "introducing," and "implanting" may be used interchangeably in the following contexts: cells, e.g., progenitor cells, are placed in a subject by a method or pathway that results in the introduced cells being at least partially localized at a desired site, e.g., a site of injury or repair, such that one or more desired effects are produced. Cells, e.g., progenitor cells, or differentiated progeny thereof, can be administered by any suitable route that results in delivery to the desired location in the subject where at least a portion of the implanted cells or cell components remain viable. The viability cycle of the cells after administration to a subject can be as short as a few hours (e.g., twenty-four hours) to a few days, as long as several years, or even the life cycle of the patient, i.e., long-term transplantation. For example, in some aspects described herein, an effective amount of liver progenitor cells is administered via a systemic route of administration, such as an intraperitoneal route or an intravenous route.
The terms "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any subject for whom diagnosis, treatment (treatment), or therapy (therapy) is desired. In some aspects, the subject is a mammal. In some aspects, the subject is a human.
When provided prophylactically, the progenitor cells described herein can be administered to a subject prior to any symptoms of dyslipidemia. Thus, prior administration of the progenitor cell population is useful for preventing dyslipidemia.
The progenitor cell population administered according to the methods described herein can include allogeneic progenitor cells obtained from one or more donors. Such progenitor cells may be of any cell or tissue origin, e.g., liver, muscle, heart, etc. "allogeneic" refers to progenitor cells or biological samples comprising progenitor cells obtained from one or more different donors of the same species, wherein the genes at one or more loci are not identical. For example, the population of liver progenitor cells administered to a subject may be derived from one or more unrelated donor subjects or from one or more non-identical siblings. In some cases, a population of isogenic progenitor cells can be used, such as those obtained from genetically identical animals or from syngeneic twins. The progenitor cells can be autologous cells; that is, the progenitor cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same.
The term "effective amount" refers to the amount of the progenitor cell population or progeny thereof required to prevent or reduce at least one or more signs or symptoms of dyslipidemia, and refers to a sufficient amount of the composition to provide the desired effect, e.g., to treat a subject with dyslipidemia. Thus, the term "therapeutically effective amount" refers to an amount of progenitor cells or a composition comprising progenitor cells that is sufficient to promote a particular effect when administered to a typical subject such as a human having or at risk of dyslipidemia. An effective amount will also comprise an amount sufficient to prevent or delay the development of disease symptoms, alter the course of disease symptoms (e.g., without limitation, slow the progression of disease symptoms), or reverse disease symptoms. It will be understood that the appropriate "effective amount" for any given situation may be determined by one of ordinary skill in the art using routine experimentation.
For use in the aspects described herein, an effective amount of progenitor cells includes at least 102At
Moderate and incremental reductions in the level of ANGPTL3 expressed in cells of patients with ANGPTL 3-related disorders may be beneficial to alleviate one or more symptoms of the disease, increase long-term survival, and/or reduce side effects associated with other treatments. The presence of progenitor cells that produce reduced levels of ANGPTL3 is beneficial after administration of such cells to a human patient. In some cases, effective treatment of the subject results in a reduction in ANGPTL3 levels by at least about 3%, 5%, or 7% relative to total ANGPTL3 in the treated subject. In some examples, the reduction in ANGPTL3 will be at least about 10% of
By "administering" is meant delivering the cell composition to the subject by a method or route that results in at least partial localization of the progenitor cell composition at the desired site. The cellular composition may be administered by any suitable route that results in effective treatment of the subject, i.e., administration that results in delivery to the desired location of the subject where at least a portion of the delivered composition, i.e., at least 1 x 104The individual cells are delivered to the desired site for a period of time.
In one aspect of the method, the pharmaceutical composition may be administered via a route such as, but not limited to: enteral (into the intestine), gastrointestinal tract, epidural (into the dura), oral (through the mouth), transdermal, epidural, intracerebral (into the brain), intracerebroventricular (into the ventricle), epidermal (onto the skin), intradermal (into the skin itself), subcutaneous (under the skin), nasal (through the nose), intravenous (into the veins), intravenous bolus injection, intravenous drip, intraarterial (into the artery), intramuscular (into the muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal (infusion or injection into the peritoneum), intravesical infusion, intravitreal (through the eye), intracavernosal injection (into the pathological cavity), intracavitary (into the base of the penis), intravaginal, intrauterine, extraamniotic, transdermal (diffusion through intact skin for distribution), systemic, or intravenous infusion, Transmucosal (diffusion through the mucosa), transvaginal, insufflation (snuffing), sublingual, sublabial, enema, eye drop (onto the conjunctiva), ear drop, ear (in or through the ear), cheek (pointing to the cheek), conjunctiva, skin, tooth (to one or more teeth), electroosmosis, endocervix, paranasal sinus (endosusial), endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intraabdominal, ovine, intraarticular, intralipid, intrabronchial, intracapsular, intracartilaginous (in the cartilage), caudate (in the cauda equina), intracisternal (in the cisterna cerebelloloris), intracorneal (in the cornea), intraoral (in the tooth), intracoronary (in the coronary), intracavernosal (in the inflatable space of the corpus cavernosum), intradiscal (in the glandular), intraduodennal (in the duodenum), and intraduodenal (in the duodenum), Within the dura mater (within or below the dura mater), within the epidermis (to the epidermis), within the esophagus (to the esophagus), within the stomach (within the stomach), within the gingiva (within the gingiva), within the ileum (within the distal portion of the small intestine), intralesional (within the local lesion or introduced directly into the local lesion), intraluminal (within the lumen), intralymphatic (within the lymph), intramedullary (within the medulla cavity), within the meninges (within the meninges), intramyocardial (within the myocardium), intraocular (within the eye), ovarian (within the ovary), pericardium (within the pericardium), pleural (within the pleura), prostatic (within the prostate), intrapulmonary (within the lung or its bronchi), intrasinus (within the nasal or periorbital sinus), spinal (within the spine), intrasynovial (within the synovial cavity of the joint), tendon (within the tendon), testicular (within the testis), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal shaft), Intrathoracic (intrathoracic), intratubular (intraorgan tubular), intratumoral (intratumoral), intratympanic (intraaurus media), intravascular (within one or more vessels), intraventricular (within the ventricle), iontophoresis (by means of an electric current, in which ions of soluble salts migrate into body tissues), lavage (for bathing or irrigating an open wound or body cavity), laryngeal (directly on the larynx), nasogastric (through the nose into the stomach), occlusive dressing techniques (topical route of administration, then covered with a dressing that occludes the area), ocular (to the outer eye), oropharyngeal (directly to the mouth and pharynx), parenteral, transdermal, periarticular, peridural, perineural, periodontal, rectal, respiratory (in the respiratory tract, by oral or nasal inhalation for local or systemic effect), retrobulbar (behind the pons or behind the eyeballs), Intramyocardial (into the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (across or across the placenta), transtracheal (across the wall of the trachea), transtympanous (across or across the tympanous), ureter (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, neural block, biliary tract perfusion, cardiac perfusion, photopheresis, and spinal column.
Modes of administration include injection, infusion, instillation, and/or ingestion. "injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subintimal, subarachnoid, intraspinal, intracerobrospinal and intrasternal injection and infusion. In some examples, the route is intravenous. For delivery of cells, administration may be by injection or infusion.
The cells may be administered systemically. The phrases "systemic administration," "administered systemically," "peripheral administration," and "administered peripherally" refer to the administration of a population of progenitor cells not directly into a target site, tissue, or organ, such that the population of progenitor cells instead enters the subject's circulatory system and is thus subject to metabolism and other similar processes.
The efficacy of a treatment comprising a composition for the treatment of dyslipidemia can be determined by an experienced clinician. However, for example, treatment is considered "effective treatment" if any or all of the signs or symptoms of ANGPTL3 levels are altered in a beneficial manner (e.g., reduced by at least 10%) or other clinically acceptable symptoms or disease markers are improved or alleviated. Efficacy may also be measured by an individual not deteriorating or requiring medical intervention (e.g., progression of the disease stopping or at least slowing) as assessed by hospitalization. Methods of measuring these indices are known to those skilled in the art and/or described herein. Treatment includes any treatment of a disease in a subject or animal (some non-limiting examples include humans or mammals) and includes: (1) inhibiting the disease, e.g., arresting or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of development of symptoms.
Treatment according to the present disclosure may alleviate one or more symptoms associated with dyslipidemia by reducing or altering the amount of ANGPTL3 in an individual.
Characterization and characterization of the angiopoietin-like 3(ANGPTL3) Gene
ANGPTL3 is associated with diseases and disorders such as, but not limited to, arteriosclerosis, atherosclerosis, cardiovascular disease, coronary heart disease, Diabetes (diabets), Diabetes (diabets mellitis), non-insulin dependent Diabetes Mellitus, fatty liver, hyperinsulinemia, hyperlipidemia, hypertriglyceridemia, hypo-beta-lipoproteinemia, inflammation, insulin resistance, metabolic disease, obesity, oral malignancies, disorders of lipid metabolism, lip and oral cancer, dyslipidemia, metabolic syndrome X, hypertriglyceridemia, obenz trigonocephaly syndrome (Opitz trigenoceraly syndrome), ischemic stroke, hypertriglyceridemia results, familial hypo-beta-lipoproteinemia 2, familial hypo-lipoproteinemia, and ischemic cerebrovascular accidents. Editing the ANGPTL3 gene using any of the methods described herein can be used to treat, prevent, and/or alleviate the symptoms of the diseases and disorders described herein.
The ANGPTL3 gene encodes angiopoietin-
ANGPTL3 is also known to cause hypobetalipoproteinemia. Hypobetalipoproteinemia is an inherited disorder (autosomal recessive) affecting humans 1/1000 and 1/3000 worldwide. Common symptoms of hypobetalipoproteinemia include plasma levels of LDL cholesterol or apolipoprotein B below the 5 th percentile, which impair the body's ability to absorb and transport fat and may lead to retinal degeneration, neuropathy, coagulopathy or abnormal accumulation of fat in the liver (known as hepatic steatosis). In severely affected patients, hepatic steatosis may progress to chronic liver disease (cirrhosis). Current treatment for low beta lipoproteinemia involves a strict limitation of long chain fatty acids to 15 grams per day to improve fat absorption. Transient supplementation of medium chain triglycerides may be effective in infants with hypobetalipoproteinemia, but the amount must be closely monitored to avoid hepatotoxicity. Another option for treating hypobetalipoproteinemia is the administration of high doses of vitamin E to prevent neurological complications. Alternatively, if elevated prothrombin time indicates vitamin K depletion, vitamin A supplementation (10,000-25,000IU/d) may be effective.
In one example, the target tissue for the compositions and methods described herein is liver tissue.
In one example, the gene is angiopoietin-like 3(ANGPTL3), which ANGPTL3 can also be referred to as
TABLE 3 Intron and exons of ANGPTL3
Table 4 provides information on all transcripts of the ANGPTL3 gene based on the Ensembl database. The transcript ID from Ensembl and the corresponding NCBI RefSeq ID of the transcript, the translation ID from Ensembl and the corresponding NCBI RefSeq ID of the protein, the biotype of the transcript sequence as classified by Ensembl and the exons and introns in the transcript based on the information in table 3 are provided in table 4.
TABLE 4 transcript information of ANGPTL3
ANGPTL3 has 2 SNPs, and the UniProt VAR numbers of this ANGPTL3 gene are VAR _049071 and VAR _ 067283.
In one example, a guide RNA used in the present disclosure may include at least one 20 nucleotide (nt) target nucleic acid sequence listed in table 5. The gene symbols and sequence identifiers (gene SEQ ID NO) of the genes are provided in table 5, the gene sequences comprising 1-5 kilobase pairs upstream and/or downstream of the target gene (extender gene SEQ ID NO) and a 20nt target nucleic acid sequence (20nt target sequence SEQ ID NO). In the sequences listing the corresponding target genes, the strand for the targeted gene (annotated with either (+) strand or (-) strand in the sequence listing), the associated PAM type, and the PAM sequence were described for each of the 20nt target nucleic acid sequences (SEQ ID NO: 5305-17018). It is understood in the art that where "T" is "U", the spacer sequence may be an RNA sequence corresponding to the 20nt sequence listed in table 5.
TABLE 5 nucleic acid sequences
In one example, a guide RNA used in the present disclosure may include at least one spacer sequence that, where "T" is "U", may be an RNA sequence corresponding to a 20 nucleotide (nt) target sequence, such as, but not limited to, any of SEQ ID NO: 5305-17018.
In one example, a guide RNA used in the present disclosure may include at least one spacer sequence that, if "T" is "U", is an RNA sequence corresponding to a 20nt sequence, such as, but not limited to, any of SEQ ID NO 5305-17018.
In one example, the guide RNA may include a 20 nucleotide (nt) target nucleic acid sequence associated with a PAM type, such as, but not limited to, NAAAAC, NNAGAAW, NNGRRT, nnnnnnght tt, NRG, or YTN. As a non-limiting example, a 20nt target nucleic acid sequence for a particular target gene and a particular PAM type can be an RNA sequence corresponding to any one of the 20nt nucleic acid sequences in table 6 if "T" is "U".
TABLE 6 nucleic acid sequences according to PAM type
In one example, the guide RNA may include a 22 nucleotide (nt) target nucleic acid sequence associated with a YTN PAM type. As a non-limiting example, a 22nt target nucleic acid sequence for a particular target gene may include a 20nt core sequence, wherein the 20nt core sequence may be the RNA sequence corresponding to SEQ ID NO 10172-17018 where "T" is "U". As another non-limiting example, a 22nt target nucleic acid sequence for a particular target gene may include a core sequence, wherein the core sequence may be a fragment, segment or region of the RNA sequence corresponding to any of SEQ ID NO 10172-17018 where "T" is "U".
Other methods of treatment
Gene editing can be performed using nucleases engineered into target-specific sequences. To date, there are four main types of nucleases: meganucleases and derivatives thereof, Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas9 nuclease systems. Nuclease platforms differ in design difficulty, targeting density, and mode of action, particularly when the specificity of ZFNs and TALENs is across the entire protein-DNA interaction, while RNA-DNA interaction primarily directs Cas 9.
CRISPR endonucleases such as Cas9 can be used in the methods of the present disclosure. However, the teachings described herein as treating the target site can be applied to other forms of endonucleases, such as ZFNs, TALENs, HE or MegaTAL, or using a combination of nucleases. However, in order to apply the teachings of the present disclosure to such endonucleases, one needs to engineer proteins directed to specific target sites, among other things.
Additional binding domains may be fused to the Cas9 protein to increase specificity. The target site of these constructs will map to the identified gRNA designated site, but will require additional binding motifs such as for the zinc finger domain. In the case of Mega-TAL, meganucleases can be fused to the TALE DNA-binding domain. Meganuclease domains can increase specificity and provide cleavage. Similarly, an inactivated or killed Cas9(dCas9) can be fused to the cleavage domain and requires the sgRNA/Cas9 target site and a DNA-binding domain adjacent to the binding site for fusion. In addition to catalytic inactivation, this would likely require engineering some proteins of dCas9 to reduce binding without additional binding sites.
Zinc finger nucleases
Zinc Finger Nucleases (ZFNs) are modular proteins comprising an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease fokl. Because FokI functions only as a dimer, a pair of ZFNs must be engineered to bind to homologous target "half-site" sequences on opposite DNA strands with precise spacing between them to enable the formation of catalytically active FokI dimers. Upon dimerization of fokl domains that are not sequence specific by themselves, DNA double strand breaks are created between ZFN half-sites as an initial step in genome editing.
The DNA-binding domain of each ZFN typically comprises 3-6 zinc fingers with an abundant Cys2-His2 architecture, each zinc finger recognizing primarily a nucleotide triplet on one strand of the target DNA sequence, but a strand-spanning interaction with the fourth nucleotide may also be important. Changes in amino acid positions of the zinc fingers at positions that make critical contact with DNA result in changes in the sequence specificity of a given zinc finger. Thus, a four-finger zinc finger protein will selectively recognize a 12bp target sequence, where the target sequence is a triplet-preferred complex contributed by each zinc finger, but triplet preference may be affected to varying degrees by neighboring zinc fingers. An important aspect of ZFNs is that they can be easily retargeted to almost any genomic address simply by modifying individual zinc fingers, but considerable expertise is required to do so. In most applications of ZFNs, proteins with 4-6 zinc fingers are used, recognizing 12-18bp, respectively. Thus, a pair of ZFNs will typically recognize a 24-36bp combined target sequence, not containing the typical 5-7bp spacing between half-sites. The binding sites may be further separated by larger intervals, comprising 15-17 bp. Target sequences of this length may be unique in the human genome, provided that no repeats or gene homologs are included during the design process. However, ZFN protein-DNA interactions are not absolute in their specificity, so off-target binding and cleavage events occur as heterodimers between the two ZFNs or as homodimers of one or the other of the ZFNs. The latter possibility has been effectively eliminated by engineering the dimerization interface of FokI domains to create "add" and "subtract" variants (also referred to as obligate heterodimer variants) that can only dimerize with each other, but not with themselves. The imposition of obligate heterodimers prevents the formation of homodimers. This greatly enhances the specificity of ZFNs, as well as any other nucleases that employ these FokI variants.
Various ZFN-based systems have been described in the art, modifications of which are reported periodically, and many references describe rules and parameters for guiding ZFN design. See, e.g., Segal et al, Proc. Natl. Acad. Sci. USA 96(6) 2758-63 (1999); dreier B et al, journal of molecular biology 303(4):489-502 (2000); liu Q et al, J Biol Chem., 277(6), 3850-6 (2002); dreier et al, journal of Biochemistry 280(42), 35588-97 (2005); and Dreier et al, J. biol. chem. 276(31) 29466-78 (2001).
Transcription activator-like effector nucleases (TALEN)
TALENs represent another format of modular nucleases, whereby an engineered DNA binding domain is linked to a FokI nuclease domain as with ZFNs, and a pair of TALENs operate back and forth to achieve targeted DNA cleavage. The main difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition performance. The TALEN DNA binding domain is derived from a TALE protein originally described in the plant bacterial pathogen Xanthomonas sp. TALEs comprise a tandem array of 33-35 amino acid repeats, each repeat recognizing a single base pair in the target DNA sequence, typically up to 20bp in length, giving a total target sequence length of up to 40 bp. The nucleotide specificity of each repeat is determined by the Repeat Variable Diresidue (RVD), which comprises only two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are mainly recognized by four RVDs respectively: Asn-Asn, Asn-Ile, His-Asp and Asn-Gly. This constitutes a simpler recognition code than for zinc fingers and thus represents an advantage for nuclease design over the latter. However, like ZFNs, the protein-DNA interaction of TALENs is not absolute in its specificity, and TALENs also benefit from using obligate heterodimer variants of the FokI domain to reduce off-target activity.
Additional variants of FokI domains have been generated that are inactivated in catalytic function. If half of the TALEN or ZFN pair contains an inactive FokI domain, only single-stranded DNA cleavage (nick) but not DSB will occur at the target site. The results are comparable to using CRISPR/Cas9 or CRISPR/Cpf1 "nickase" mutants in which one of the Cas9 cleavage domains has been inactivated. DNA nicking can be used to drive genome editing by HDR, but is less efficient than using DSBs. The main benefit is that off-target incisions are repaired quickly and accurately, unlike DSBs, which are susceptible to NHEJ-mediated error repair.
Various TALEN-based systems have been described in the art and modifications thereof are reported periodically; see, e.g., Boch, science 326(5959):1509-12 (2009); mak et al, science 335(6069), 716-9 (2012); and Moscou et al, science 326(5959) 1501 (2009). The use of TALENs based on the "Golden Gate" platform or cloning scheme has been described by a number of groups; see, e.g., Cermak et al, nucleic acids research 39(12) e82 (2011); li et al, nucleic acids research 39(14), 6315-25 (2011); weber et al, "public science library on" (PLoS One.), (6), (2) e16765 (2011); wang et al, J Genet Genomics 41(6):339-47,
Homing endonucleases
Homing Endonucleases (HEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and often cleave DNA with high specificity at unique sites in the genome. There are at least six known HE families as classified by their structure, including GIY-YIG, His-Cis cassette, H-N-H, PD- (D/E) xK, and the Vsr class, which is derived from a wide range of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria, and phages. As with ZFNs and TALENs, HE can be used to generate DSBs at the target locus as an initial step in genome editing. In addition, some natural and engineered HEs cleave only a single strand of DNA, thereby acting as site-specific nicking enzymes. The large target sequence of HE and the specificity it provides make it an attractive candidate for generating site-specific DSBs.
Various HE-based systems have been described in the art and modifications thereof are reported periodically; see, e.g., Steentoft et al, Glycobiology (Glycobiology) 24(8), 663-80 (2014); belfort and Bonocora, methods of molecular biology 1123:1-26 (2014); hafez and Hausner, Genome 55 (Genome) (8):553-69 (2012); and references cited therein.
MegaTAL/Tev-mTALEN/MegaTev
As further examples of hybrid nucleases, the MegaTAL and Tev-mTALEN platforms use fusions of TALE DNA binding domains with catalytically active HE, thereby exploiting both the tunable DNA binding and specificity of TALEs, along with the cleavage sequence specificity of HE; see, e.g., Boissel et al, NAR 42: 2591-; kleinstimer et al, G3, 4:1155-65 (2014); and Boissel and Scharenberg, methods of molecular biology 1239:171-96 (2015).
In a further variant, the MegaTev architecture is a fusion of meganuclease (Mega) with a nuclease domain derived from GIY-YIG homing endonuclease, I-tevi (tev). These two active sites are located-30 bp apart on the DNA matrix and produce two DSBs with incompatible binding ends; see, e.g., Wolfs et al, NAR 42,8816-29 (2014). It is expected that other combinations of existing nuclease-based methods will evolve and be useful in achieving the targeted genomic modifications described herein.
dCas9-FokI or dCpf1-Fok1 and other nucleases
Combining the structural and functional properties of the nuclease platforms described above provides an additional method for genome editing that can potentially overcome some of the inherent deficiencies. As an example, CRISPR genome editing systems typically use a single Cas9 endonuclease to generate DSBs. The specificity of targeting is driven by the 20 or 24 nucleotide sequence in the guide RNA that undergoes Watson-Crick base pairing with the target DNA (plus the additional 2 bases in the adjacent NAG or NGG PAM sequence in the case of Cas9 from streptococcus pyogenes). This sequence is long enough to be unique in the human genome, however, the specificity of the RNA/DNA interaction is not absolute, and a very large mix is sometimes tolerable, particularly in the 5' end at half the target sequence, effectively reducing the number of bases driving specificity. One solution to this is to inactivate Cas9 or Cpf1 catalytic functions completely-retaining only RNA-guided DNA binding functions-and instead fuse the fokl domain to the inactivated Cas 9; see, e.g., Tsai et al, Nature Biotechnology 32:569-76 (2014); and Guilinger et al, Nature Biotechnology 32:577-82 (2014). Because fokl must dimerize to become catalytically active, two guide RNAs are required to tether the two fokl fusions in close proximity to form a dimer and cleave the DNA. This essentially doubles the number of bases in the combined target site, thereby increasing the stringency of targeting by CRISPR-based systems.
As a further example, fusions of TALE DNA binding domains with catalytically active HE, such as I-TevI, take advantage of both the tunable DNA binding and specificity of TALE and the cleavage sequence specificity of I-TevI, and are expected to further reduce off-target cleavage.
VII. kit
The present disclosure provides kits for carrying out the methods described herein. The kit may comprise one or more of the following: a genome-targeted nucleic acid, a polynucleotide encoding a genome-targeted nucleic acid, a site-directed polypeptide, a polynucleotide encoding a site-directed polypeptide, and/or any nucleic acid or protein molecule necessary to carry out aspects of the methods described herein, or a combination thereof.
The kit may comprise: (1) a vector comprising a nucleotide sequence encoding a genome-targeted nucleic acid; (2) a site-directed polypeptide or a vector comprising a nucleotide sequence encoding a site-directed polypeptide; and (3) reagents for reconstituting and/or diluting one or more vectors and/or polypeptides.
The kit may comprise: (1) a vector comprising (i) a nucleotide sequence encoding a genomic targeting nucleic acid and (ii) a nucleotide sequence encoding a site-directed polypeptide; and (2) reagents for reconstituting and/or diluting the carrier.
In any of the above kits, the kit can include a single molecule guide genome targeting nucleic acid. In any of the above kits, the kit can include a bimolecular genome-targeting nucleic acid. In any of the above kits, the kit may comprise two or more bi-molecular guides or single-molecular guides. The kit may include a vector encoding the nucleic acid targeting nucleic acid.
In any of the above kits, the kit can further comprise a polynucleotide to be inserted to achieve the desired genetic modification.
The components of the kit may be in separate containers or combined into a single container.
Any of the kits described above may further comprise one or more additional reagents, wherein such additional reagents are selected from buffers, buffers for introducing the polypeptide or polynucleotide into a cell, wash buffers, control reagents, control vectors, control RNA polynucleotides, reagents for producing the polypeptide from DNA in vitro, adapters for sequencing, and the like. The buffer may be a stabilization buffer, a reconstitution buffer, a dilution buffer, or the like. The kit may also include one or more components that can be used to promote or enhance target binding or cleavage of DNA by endonucleases or to improve target specificity.
In addition to the components mentioned above, the kit may further comprise instructions for practicing the method using the components of the kit. Instructions for practicing the methods may be recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be present in the kit as a package insert, a label for a container of the kit or a component thereof (i.e., associated with a package or sub-package), and the like. The instructions may exist as electronically stored data files on a suitable computer readable storage medium such as a CD-ROM, diskette, flash drive, etc. In some cases, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g., via the internet) may be provided. An example of this is a kit comprising a web site where the instructions can be viewed and/or from which the instructions can be downloaded. As with the description, this means for obtaining the description may be recorded on a suitable substrate.
Specific methods and compositions
Thus, the present disclosure specifically relates to the following non-limiting methods according to the present disclosure: in a first method, method 1, the present disclosure provides a method for editing an angiopoietin-like 3(ANGPTL3) gene in a cell by genome editing, the method comprising the step of introducing one or more deoxyribonucleic acid (DNA) endonucleases into the cell to effect one or more Single Strand Breaks (SSBs) or Double Strand Breaks (DSBs) within or near an ANGPTL3 gene or ANGPTL3 regulatory element, which results in one or more permanent insertions, deletions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.
In another method, method 2, the present disclosure provides an ex vivo method for treating a patient having an ANGPTL 3-related condition or disorder, the method comprising the steps of: isolating hepatocytes from a patient; editing within or near the ANGPTL3 gene of hepatocytes or other DNA sequences encoding regulatory elements of the ANGPTL3 gene; and implanting the genome-edited hepatocytes into the patient.
In another method,
In another method,
In another method,
In another method, method 6, the present disclosure provides an ex vivo method for treating a patient having an ANGPTL 3-related condition or disorder, the method comprising the steps of: isolating mesenchymal stem cells from a patient; editing within or near the ANGPTL3 gene of mesenchymal stem cells or other DNA sequences encoding regulatory elements of the ANGPTL3 gene; differentiating the mesenchymal stem cells subjected to genome editing into liver cells; and implanting the hepatocytes into the patient.
In another method, method 7, the present disclosure provides the method of method 6, wherein the editing step comprises introducing one or more deoxyribonucleic acid (DNA) endonucleases into the mesenchymal stem cells to achieve one or more Single Strand Breaks (SSBs) or Double Strand Breaks (DSBs) within or near the ANGPTL3 gene or ANGPTL3 regulatory elements, the introduction resulting in one or more permanent insertions, deletions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.
In another method, method 8, the present disclosure provides an in vivo method for treating a patient having an ANGPTL 3-related disorder, the method comprising the step of editing an ANGPTL3 gene in a cell of the patient.
In another method, method 9, the present disclosure provides the method of method 8, wherein the editing step comprises introducing one or more deoxyribonucleic acid (DNA) endonucleases into the cell to effect one or more Single Strand Breaks (SSBs) or Double Strand Breaks (DSBs) within or near the ANGPTL3 gene or ANGPTL3 regulatory element, the introduction resulting in one or more permanent insertions, deletions, or mutations of at least one nucleotide within or near the ANGPTL3 gene, thereby reducing or eliminating expression or function of the ANGPTL3 gene product.
In another method,
In another method, method 11, the present disclosure provides the method of
In another method, method 12, the present disclosure provides a method of altering the contiguous genomic sequence of an ANGPTL3 gene in a cell, the method comprising contacting the cell with one or more deoxyribonucleic acid (DNA) endonucleases to achieve one or more Single Strand Breaks (SSBs) or Double Strand Breaks (DSBs).
In another approach, method 13, the present disclosure provides the method of method 12, wherein the alteration of the contiguous genomic sequence occurs in one or more exons of the ANGPTL3 gene.
In another approach, method 14, the present disclosure provides a method according to any one of methods 1 to 13, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are selected from any one of those sequences set forth in SEQ ID NOs 1-620 and variants having at least 70% homology to any one of those sequences set forth in SEQ ID NOs 1-620.
In another method, method 15, the present disclosure provides the method of method 14, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are one or more proteins or polypeptides.
In another method, method 16, the present disclosure provides the method of method 14, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are one or more polynucleotides encoding the one or more DNA endonucleases.
In another method, method 17, the present disclosure provides the method of method 16, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are one or more ribonucleic acids (RNAs) encoding the one or more DNA endonucleases.
In another method, method 18, the present disclosure provides the method of method 17, wherein the one or more ribonucleic acids (RNAs) are one or more chemically modified RNAs.
In another method, method 19, the present disclosure provides the method of method 18, wherein the one or more ribonucleic acids (RNAs) are chemically modified in the coding region.
In another method,
In another method, method 21, the present disclosure provides a method according to any one of methods 1 to 20, wherein the method further comprises introducing one or more grnas or one or more sgrnas into the cell.
In another approach, method 22, the present disclosure provides a method according to method 21, wherein the one or more grnas or the one or more sgrnas include a spacer sequence that is complementary to a segment of the coding sequence of the ANGPTL3 gene.
In another approach, method 23, the present disclosure provides a method according to method 21, wherein the one or more grnas or the one or more sgrnas include a spacer sequence that is complementary to a sequence flanking the ANGPTL3 gene or other sequence encoding a regulatory element of the ANGPTL3 gene.
In another approach, method 24, the present disclosure provides a method according to any one of methods 21 to 23, wherein the one or more grnas or the one or more sgrnas are chemically modified.
In another approach,
In another approach, method 26, the present disclosure provides a method according to
In another method, method 27, the present disclosure provides the method of any one of methods 14 to 26, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are formulated as liposomes or lipid nanoparticles.
In another method, method 28, the present disclosure provides the method of any one of methods 21-27, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are formulated into liposomes or lipid nanoparticles that further include the one or more grnas or the one or more sgrnas.
In another method, method 29, the present disclosure provides the method according to any one of methods 12 or 21 to 23, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are encoded in an AAV vector particle, wherein the AAV vector serotype is selected from the group consisting of SEQ ID NOs 4,734-5,302 and those listed in Table 2.
In another approach,
In another method, method 31, the present disclosure provides the method according to any one of methods 21-23, wherein the one or more deoxyribonucleic acid (DNA) endonucleases are encoded in an AAV vector particle that also encodes the one or more grnas or the one or more sgrnas, wherein the AAV vector serotype is selected from the group consisting of SEQ ID NOs 4,734-5,302 and those listed in table 2.
The present disclosure also provides a composition, composition 1 comprising a single guide RNA comprising at least a spacer sequence, which is an RNA sequence corresponding to any one of SEQ ID NO 5305-17018.
In another composition, composition 2, the present disclosure provides the single-molecule guide RNA according to composition 1, wherein the single-molecule guide RNA further comprises a spacer extension region.
In another composition,
In another composition,
In another composition,
In another composition, composition 6, the present disclosure provides the single molecule guide RNA of
In another composition, composition 7, the present disclosure provides the single molecule guide RNA according to composition 6, wherein the Cas9 or Cpf1 endonuclease is selected from streptococcus pyogenes Cas9, staphylococcus aureus Cas9, neisseria meningitidis Cas9, streptococcus thermophilus CRISPR1Cas9, streptococcus thermophilus CRISPR3Cas9, treponema denticola Cas9, lachnospira ND2006Cpf1, and aminoacococcus (Acidaminococcus sp.) BV3L6Cpf1, and variants having at least 70% homology to these enzymes.
In another composition, composition 8, the present disclosure provides the single molecule guide RNA of composition 7, wherein the Cas9 or Cpf1 enzyme comprises one or more Nuclear Localization Signals (NLS).
In another composition, composition 9, the present disclosure provides the single molecule guide RNA according to composition 8, wherein at least one NLS is located at or within 50 amino acids of the amino terminus of the Cas9 or Cpf1 endonuclease and/or at least one NLS is located at or within 50 amino acids of the carboxy terminus of the Cas9 or Cpf1 endonuclease.
In another composition,
In another composition, composition 11, the present disclosure provides DNA encoding a single molecule guide RNA according to compositions 1 to 3.
In another composition, composition 12, the present disclosure provides DNA encoding the CRISPR/Cas system according to compositions 8 to 10.
In another composition, composition 13, the present disclosure provides a vector comprising the DNA according to composition 11 or 12.
In another composition, composition 14, the present disclosure provides the vector of composition 13, wherein the vector is a plasmid.
In another composition, composition 15, the present disclosure provides the vector of composition 13, wherein the vector is an AAV vector particle, and the AAV vector serotype is selected from the group consisting of SEQ ID NO 4,734 and 5,302, and those listed in Table 2.
IX. definition
The term "comprising" is used with reference to compositions, methods, and one or more corresponding components thereof that are critical to the invention, but that may include unspecified elements, whether critical or not.
The term "consisting essentially of …" refers to those elements required for a given aspect. The terms allow for the presence of additional elements that do not materially affect one or more of the basic and novel or functional characteristics of the aspects of the invention.
The term "consisting of …" refers to compositions, methods, and their corresponding components as described herein, which do not include any elements not recited in the description of the aspect.
The singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.
Certain numerical values presented herein are preceded by the term "about". The term "about" means a number within ± 10% of the recited number.
When numerical ranges are presented herein, it is contemplated that each intervening value, between the lower and upper limit of that range, the value being the upper and lower limit of that range, and all stated values within that range, are encompassed within the disclosure. The present disclosure also contemplates all possible subranges within the lower and upper limits of the stated range.
The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred materials and methods are now described. Other features, objects, and advantages of the invention will be apparent from the description. In the description, the singular forms also include the plural forms unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification will control.
Any numerical range recited in this specification describes all sub-ranges subsumed within that range with the same numerical precision (i.e., having the same number of assigned numbers). For example, a recited range of "1.0 to 10.0" describes all subranges between (and including 1.0 and 10.0) the recited minimum value of 1.0 and the recited maximum value of 10.0, such as, for example, "2.4 to 7.6," even though the range of "2.4 to 7.6" is not explicitly recited in the context of this specification. Accordingly, applicants reserve the right to modify the specification (including the claims) to specifically recite any sub-ranges of equal numerical precision that are included within the ranges explicitly recited in the specification. All such ranges are inherently described in this specification such that revisions used to explicitly recite any such subranges will comply with the written description, sufficiency of description, and contingent requirements, including the requirements set forth in 35u.s.c. § 112(a) and 123(2) EPC clauses. Moreover, unless the context clearly dictates otherwise, all numerical parameters described in this specification (such as those expressing values, ranges, amounts, percentages, etc.) may be read as if prefaced by the word "about", even if the word "about" does not expressly appear before the number. In addition, numerical parameters set forth in this specification should be construed in light of the number of reported significant digits, the accuracy of the numerical value, and by applying ordinary rounding techniques. It will also be appreciated that the numerical parameters described in this specification necessarily have inherent variability characteristics of the underlying measurement techniques used to determine the value of the parameter.
The details of one or more aspects of the disclosure are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred materials and methods are now described. Other features, objects, and advantages of the disclosure will be apparent from the description. In the description, the singular forms also include the plural forms unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification will control.
The invention is further illustrated by the following non-limiting examples.
Examples of X
The invention will be more fully understood by reference to the following examples, which provide illustrative, non-limiting aspects of the disclosure.
The examples describe the use of the CRISPR system as an illustrative genome editing technique to produce a defined therapeutic genomic deletion, insertion, or substitution in an angptl3 gene that results in a permanent deletion or mutation in the angptl3 gene, referred to herein as a "genomic modification" that reduces or eliminates angptl3 protein activity. The introduction of defined therapeutic modifications represents a novel therapeutic strategy for potentially alleviating dyslipidemia, as described and illustrated herein.
Example 1 CRISPR/SpCas9 target site of ANGPTL3 Gene
Target site scanning was performed on a region of the ANGPTL3 gene. Each region was scanned for a prototype spacer adjacent motif (PAM) with sequence NRG. Then, a gRNA 20bp spacer sequence corresponding to PAM was identified as shown in SEQ ID NO 6,634-10,171 of the sequence Listing.
Example 2-CRISPR/SaCas 9 target site of ANGPTL3 Gene
Target site scanning was performed on a region of the ANGPTL3 gene. Each region was scanned for a prototype spacer adjacent motif (PAM) with the sequence NNGRRT. Then, a gRNA 20bp spacer sequence corresponding to PAM is identified, as shown in SEQ ID NO:5,596-6,079-10,171 of the sequence table.
Example 3 CRISPR/StCas9 target site of ANGPTL3 Gene
Target site scanning was performed on a region of the ANGPTL3 gene. Each region was scanned for a prototype spacer adjacent motif (PAM) with the sequence NNAGAAW. Then, 20bp spacer sequence of gRNA corresponding to PAM was identified as shown in SEQ ID NO:5,399-5,595 of the sequence Listing.
Example 4 CRISPR/TdCas9 target site of ANGPTL3 Gene
Target site scanning was performed on a region of the ANGPTL3 gene. Each region was scanned for a prototype spacer adjacent motif (PAM) with the sequence NAAAAC. Then, a 20bp spacer sequence of gRNA corresponding to PAM was identified as shown in SEQ ID NO 5,305-5,398 of the sequence Listing.
Example 5 CRISPR/NmCas9 target site of ANGPTL3 Gene
Target site scanning was performed on a region of the ANGPTL3 gene. Each region was scanned for a prototype spacer adjacent motif (PAM) with the sequence NNNNGATT. Then, a gRNA 20bp spacer sequence corresponding to PAM is identified, as shown in SEQ ID NO:6,080-6,633 in the sequence table.
Example 6 CRISPR/Cpf1 target site of ANGPTL3 Gene
Target site scanning was performed on a region of the ANGPTL3 gene. Each region was scanned for a prototype spacer adjacent motif (PAM) with the sequence TTN or YTN. Then, a gRNA 22bp spacer sequence corresponding to PAM is identified, as shown in SEQ ID NO:10,172-17,018 in the sequence table.
Example 7 bioinformatics analysis of subtended guide Strand
Candidate guides are then screened and selected in a single process or a multi-step process involving both theoretical binding and experimentally assessed on-target and off-target site activity. By way of illustration, candidate guides having sequences that match a particular on-target site, such as a site within the ANGPTL3 gene, to an adjacent PAM are assessed for the likelihood of cleavage at off-target sites having similar sequences, using one or more of a variety of bioinformatic tools for assessing off-target binding, as described and shown in more detail below, in order to assess the likelihood of effect at chromosomal locations other than the expected chromosomal location.
Candidates predicted to have a relatively low likelihood of off-target activity are then experimentally evaluated to measure target activity therein and then off-target activity at each site. Preferred guides have sufficiently high on-target activity to achieve a desired level of gene editing at a selected locus and relatively low off-target activity to reduce the likelihood of alterations at other chromosomal loci. The ratio of on-target activity to off-target activity is often referred to as "specificity" of the guide.
For initial screening of predicted off-target activity, there are many known and publicly available bioinformatic tools that can be used to predict the most likely off-target sites; and since binding to a target site in the CRISPR/Cas9 or CRISPR/Cpf1 nuclease system is driven by Watson-Crick base pairing between complementary sequences, the degree of dissimilarity (and hence reduced off-target binding potential) is essentially related to the major sequence differences: mismatches and bulges are i.e. bases that change to non-complementary bases, as well as insertions or deletions of bases in a potential off-target site relative to the target site. An exemplary bioinformatics tool called COSMID (CRISPR off-target site with mismatches, insertions and deletions) (available on the web through criprpr. Other bioinformatics tools include, but are not limited to, autocosmids and ccops.
Bioinformatics is used to minimize off-target cleavage in order to reduce the deleterious effects of mutations and chromosomal rearrangements. Studies of the CRISPR/Cas9 system indicate the possibility of high off-target activity due to non-specific hybridization of the guide strand to DNA sequences with base pair mismatches and/or bulges, particularly at positions distant from the PAM region. Therefore, it is important to have a bioinformatic tool that can identify potential off-target sites with insertions and/or deletions between the RNA guide strand and genomic sequences in addition to base pair mismatches. Bioinformatics tool CCTop based off-target prediction algorithm was used to search the genome for potential CRISPR off-target sites (CCTop is available on the web through CRISPR. Codid outputs a ranked list of potential off-target sites based on the number and location of mismatches, allowing for a more informed selection of target sites and avoiding the use of sites with a higher likelihood of off-target cleavage.
Additional bioinformatics pipelines that take into account the estimated in-target and/or off-target activity of gRNA targeting sites in the region are employed. Other characteristics that may be used to predict activity include information about the cell type in question, DNA accessibility, chromatin state, transcription factor binding sites, transcription factor binding data, and other CHIP-seq data. Additional factors that predict editing efficiency are considered, such as the relative positions and orientations of gRNA pairs, local sequence features, and micro-homology.
Initial evaluation and screening of CRISPR/Cas9 target sites focused on the ANGPTL 3-200 bp 5' upstream sequence, exons 1-6 (out of 7 exons), and intron 1-6 regions. Either the full intron sequence was evaluated, or the large intron of the-100-and 300-bp sequence proximal to the exon-intron junction was evaluated. Grnas within exon sequences can be used to generate indels that result in loss of protein function by altering protein sequences and/or truncating proteins. Grnas in the 5' UTR sequence can be used alone or in combination with grnas within exons to remove translation initiation sites and prevent protein synthesis. The grnas in introns can be used alone or in combination with grnas within exons to remove splice donor and acceptor sites that result in the production of truncated proteins and subsequent loss of function.
Initial bioinformatic analysis identified approximately 203 guides targeting the ANGPTL3 gene. This wizard subset was further analyzed. The guide to have predicted off-target sites (1 or 2 mismatches) was eliminated, and also the guide to overlap with SNPs with minor allele frequencies >0.0002 was eliminated. We also prioritized grnas for screening based on their position in the Angptl3 sequence; grnas targeting the 5' exon are preferred. This analysis led a pool of 192 guides to prioritize the guides for in vitro transcription based guide screening protocols (table 7).
EXAMPLE 8 testing of preferred guided on-target Activity in cells
In order to identify a wide range of grnas capable of editing the homologous DNA target region, In Vitro Transcription (IVT) gRNA screens were performed. The relevant genomic sequences were submitted for analysis using gRNA design software. The resulting list of grnas was reduced to a list with about 200 grnas based on sequence uniqueness (only grnas that did not have the best match elsewhere in the genome were screened) and minimal predicted off-target. This set of grnas was transcribed in vitro and transfected with Lipofectamine MessengerMAX into HEK293T cells that constitutively express Cas 9. Cells were harvested 48 hours after transfection, genomic DNA was isolated, and cleavage efficiency was assessed using the TIDE assay (fig. 2-4).
From the 192 wizards screened in HEK cells, we identified a wizard with high editing efficiency and low CCTop off-target score (table 7 and fig. 2-4).
Grnas with significant activity in cultured cells were then followed to measure changes in the ANGPTL3 gene (examples 11-13). Specifically, two guides that specifically target the human ANGPTL3 sequence and two grnas that target human and monkey (cross-reactive) ANGPTL3 (100% match available cynomolgus and rhesus ANGPTL3 sequences) were selected for in vitro editing experiments described below (see, e.g., table 8). Off-target events can be tracked again. A variety of cells can be transfected and the level of gene editing and possible off-target events measured. These experiments allow for optimization of nuclease and donor design and delivery.
Table 7 gRNA sequences and cleavage efficiency in HEK293T cells (thymine can be replaced with uracil in any of these sequences to generate the corresponding guide RNA sequence).
Example 10-cross-reactivity of grnas targeting ANGPTL3 in primary hepatocytes
This example demonstrates the high efficiency cross-reactive activity of ANGPTL3 grnas in primary hepatocytes isolated from cynomolgus monkeys and human donors following knockdown by lipofectamine (lipofectamine) transfection complexes including Cas9 mRNA and grnas.
Primary hepatocytes isolated from human and cynomolgus monkeys (In Vitro ADMET Laboratories, Maryland) were plated In confluent monolayers and transfected with Cas9 mRNA and
Capital letters: an unmodified nucleotide; lower case letters: nucleotides with 2' -O-methyl modifications; n or N: any nucleotide; *: phosphorothioate linkage (SEQ ID NO:17,058). Modified grnas are shown in table 8.
Briefly, cells were plated at 0.35 × 106 cells/well into confluent monolayers in 24-well collagen I coated plates (Corning Biocoat collagen I multiwell plate, catalog No. 356408) and at 37℃ at 5% CO2Middle and middle InVitroGRO flat plateThe culture was carried out in a medium (BioReclamatoniIVT, Z990003). Monolayers of hepatocytes were transfected 3-5 hours after plating with grnas complexed with Cas9 mRNA. Human hepatocytes were transfected with human-specific or species-cross-reactive grnas, and monkey hepatocytes were transfected with species-cross-reactive grnas. Lipofectamine was used according to the manufacturer's protocol at a final gRNA amount of 200ngTM MessengerMaxTMTransfection reagent (semer feishel corporation (ThermoFisher), catalog No. LMRNA003) performs transfection of grnas.
Hepatocytes were also transfected with Lipofectamine MessengerMax without Cas9 and grnas to generate "MOCK" samples. In addition, hepatocytes were transfected with Cas9 mRNA and gRNA controls for each hepatocyte known to be continuously active with a known range of editing efficiency per hepatocyte species (e.g.,: C3gRNA in human hepatocytes or PCSK9 gRNA in monkey hepatocytes). Cells were medium-changed 16 hours after transfection with fresh InVitroGRO medium and incubated with gRNA-lipofectamine complexes for 48 hours, at which time the cells were lysed in preprEM (ZyGem) according to the manufacturer's protocol.
Hepatocytes transfected with Cas9 and ANGPTL3gRNA were analyzed by the chase transfectant (control) (Brinkman EK, Chen T, Amendola M, van Steense B) by the chase deletion method (easy quantitative assessment of genome editing by sequence-Tracking digestion) (nucleic acid research 2014 12/16/2014; 42(22): e168.doi:10.1093/nar/gku936) using the KAPA HiFi PCR kit for short, using genomic DNA as a template for PCR.
The PCR amplicons were purified using AxyPrep Mag PCR clean kit (Axygen). The amplicons were sequenced and analyzed using a decomposition algorithm. gRNA activity was measured as the ratio of alleles with various indels (1 to 50nt insertion or 1 to 50nt deletion) adjacent to the predicted cleavage site of streptococcus pyogenes Cas9 (i.e., between nucleotides-4 and-3 upstream of PAM (ngg) on the non-target strand and between 3 and 4 nucleotides downstream of the PAM complement (CCN) on the target strand).
The TIDE analysis showed that ANGPTL3 grnas EX2, T6 and T9 induced-50% -60% indels in human hepatocytes, while EX1 grnas induced an average efficiency of < 20% (see fig. 5A). The cross-reactive wizards T6 and T9 were active and induced gene editing in monkey hepatocytes. gRNA T6 had the highest editing efficiency with > 60% insertion deletions in monkey hepatocytes (see fig. 5B).
TABLE 8-ANGPTL 3gRNA sequences
Example 11-secretion of ANGPTL3 protein in Gene-edited Primary human hepatocytes
This example demonstrates a correlation between efficient gene editing of T6gRNA and a reduction in ANGPTL3 protein secreted in primary human hepatocytes.
Primary human hepatocytes (in vitro ADMET laboratory) at 0.35X 106Individual cells/well were plated into confluent monolayers in 24-well collagen I coated plates (corning Biocoat collagen I multiwell plate, cat # 356408) and at 37 ℃ in 5% CO2In (c), the culture was carried out in InVitroGRO plate medium (BioReclamatoIVT, Z990003). Hepatocyte monolayers were transfected 3-5 hours after plating with ANGPTL 3T 6gRNA or C3gRNA (non-related gRNA that efficiently knocks out human C3 but does not edit ANGPTL3 gene) in complex with Cas 9-mRNA. Transfection of grnas was performed using Lipofectamine MessengerMax according to the manufacturer's protocol with a final amount of gRNA of 200 ng. Hepatocytes were also transfected with lipofectamine messenger max without Cas9 mRNA and gRNA to generate "MOCK" samples. Cells received media changes of fresh InVitroGRO media 16 hours after transfection. The samples were incubated with gRNA-lipofectin complexes for 48 hours, at which time the supernatants were collected for human ANGPTL3 protein analysis and cells were lysed in preprgel em (ZyGem) according to the manufacturer's protocol.
Hepatocytes transfected with Cas9 and T6gRNA or Cas9 and C3gRNA were analyzed by TIDE with "MOCK" transfectants (control group). The TIDE analysis showed that ANGPTL3 was edited by T6gRNA (-60% indel) (FIG. 6A). Similarly, the human C3 gene was efficiently edited by C3gRNA with an insertion deletion frequency of-55% in the same human donor (fig. 6A).
The concentration of ANGPTL3 protein in the supernatant collected from the gene-edited sample was measured using Sandwich enzyme-linked immunosorbent assay (ELISA) against human ANGPTL3 protein (human ANGPTL3ELISA kit, R & D Systems, catalog No. DY 3829). The results show that supernatants from primary hepatocytes with an efficiency of-60% when editing the ANGPTL3 gene by T6gRNA contained less than 1ng/mL of ANGPTL3 protein, with a significant decrease in ANGPTL3 protein levels relative to the control (fig. 6B). Control groups "MOCK" and C3 showed similar levels of ANGPTL3 protein at-2.8 ng/mL (FIG. 6B) and-2.6 ng/mL (FIG. 6B), respectively. This study showed that efficient editing of the ANGPTL3 gene resulted in a functional reduction of the ANGPTL3 protein secreted in primary hepatocytes.
To increase the detection window for ANGPTL3 protein knock-down, co-cultured primary human hepatocytes were cultured and transfected with grnas and Cas 9.
Primary human hepatocytes (ADMET laboratory in vitro) were cultured in a co-culture format in the presence of isolated murine 3T3fibroblasts (SN Bhatia, UJ Balis, ML Yarmush, M toner. "effect of cell-cell interactions on preservation of cell phenotype: coculture of hepatocytes and nonparenchymal cells (Effect of cell-cell interaction of cellular phenotype: cocultivation of cells and nonparenochlorical cells), "The Association of American society for laboratory and biology (The FASEB Journal 13(14),1883-1900, SN Bhatia, ML Yarmush, M Toner. Hepatocytes and 3T3fibroblasts (control cell interactions of micropattering in co-cultures: hepatocytes and 3T3 fibrates) ", journal of biomedical Materials Research (J.biomedical Materials Research) 34(2), 189-.I perforated plate, cat # 356408) and at 37 ° -c, 5% CO2In (c), the culture was carried out in InVitroGRO plate medium (BioReclamatoIVT, Z990003). Hepatocyte cocultures were transfected 24 hours after starting culture with grnas (table 8) and Cas9 mRNA. Transfection of grnas was performed using Lipofectamine MessengerMax according to the manufacturer's protocol with a final amount of gRNA of 200 ng. Hepatocytes were also transfected with Lipofectamine MessengerMax. Cells received media changes of fresh invitrogero media 6 hours after transfection with gRNA-lipofectin complexes, and were changed every 24 hours for 10 days.
Co-cultured primary hepatocytes transfected with Cas9 and T6gRNA or Cas9 and C3gRNA were co-cultured with "MOCK" transfectants (control group) by TIDE analysis. The TIDE analysis showed that ANGPTL3 was edited by T6gRNA (-60% indel) (FIG. 7A). Similarly, the human C3 gene was efficiently edited by C3gRNA with an indel frequency of-52% in the same human donor (fig. 7A). These data demonstrate a consistent editing profile of primary human hepatocytes in both single culture and co-culture formats.
The concentration of ANGPTL3 protein in the supernatant collected from the gene-edited sample was measured using Sandwich enzyme-linked immunosorbent assay (ELISA) against human ANGPTL3 protein (human ANGPTL3ELISA kit, R & D Systems, catalog No. DY 3829). The results showed that supernatants from primary hepatocytes with an efficiency of-60% when editing the ANGPTL3 gene by T6gRNA contained-1 ng/mL of ANGPTL3 protein, with a significant decrease in ANGPTL3 protein levels relative to the control (fig. 7B). Control groups "MOCK" and C3 showed similar levels of ANGPTL3 protein at-29 ng/mL and-31 ng/mL, respectively. Co-cultured primary hepatocytes secreted 5-fold higher levels of ANGPTL3 protein compared to single-cultured hepatocytes and demonstrated that disruption of the ANGPTL3 gene resulted in a strong reduction in secreted ANGPTL3 protein.
Example 12-secretion of ANGPTL3 protein in gene-edited primary monkey hepatocytes
This example demonstrates a correlation between efficient gene editing of T6gRNA and a reduction in ANGPTL3 protein secreted in primary monkey hepatocytes.
Liver of primary monkeyCell (in vitro ADMET laboratory) at 0.35X 106Individual cells/well were plated into confluent monolayers in 24-well collagen I coated plates (corning Biocoat collagen I multiwell plate, cat # 356408) and at 37 ℃ in 5% CO2In (c), the culture was carried out in InVitroGRO plate medium (BioReclamatoIVT, Z990003). Hepatocyte monolayers were transfected 3-5 hours after plating with ANGPTL 3T 6gRNA or PCSK9 gRNA (non-related gRNA that efficiently knocks out the PCSK9 gene in the monkey genome but does not edit the ANGPTL3 gene) in complex with Cas9 mRNA. Transfection of grnas was performed using Lipofectamine MessengerMax according to the manufacturer's protocol with a final amount of gRNA of 200 ng. Hepatocytes were also transfected with Lipofectamine messenger max without Cas9 mRNA and gRNA to generate "MOCK" samples. Cells received media changes of fresh InVitroGRO media 16 hours after transfection. The samples were incubated with gRNA-lipofectin complexes for 48 hours, at which time the supernatants were collected for human ANGPTL3 protein analysis and cells were lysed in preprgel em (ZyGem) according to the manufacturer's protocol.
Monkey hepatocytes transfected with Cas9 and T6gRNA, T9 gRNA or PCSK9 gRNA were compared to "MOCK" transfectants (control group) by TIDE analysis. The TIDE analysis showed that ANGPTL3 was edited by T6gRNA (-67%) and T9 gRNA (-29%) in FIGS. 5B. Similarly, PCSK9 gRNA efficiently edited the monkey PCSK9 gene with insertion deletion frequency of-41% in the same monkey donor (fig. 5B).
The concentration of ANGPTL3 protein in supernatants collected from gene-edited samples was determined using the Sandwich enzyme-linked immunosorbent assay (ELISA) against monkey ANGPTL3 protein (monkey ANGPTL3ELISA kit, life cycle Bio (LifeSpan Bio), cat # LS _ F38518). The results showed that supernatants from primary hepatocytes with an efficiency of 67% when editing the ANGPTL3 gene by T6gRNA contained less than 1ng/mL of ANGPTL3 protein, with a significant decrease in ANGPTL3 protein levels relative to the control (fig. 8). Control groups "MOCK" and C3 showed similar levels of ANGPTL3 protein at-3 ng/mL and-2.5 ng/mL, respectively. This study showed that efficient editing of the ANGPTL3 gene by cross-reactive gRNA T6 resulted in a functional reduction of ANGPTL3 protein secreted in primary monkey hepatocytes.
Example 13 in vivo testing in related animal models
After evaluation of the CRISPR-Cas 9/guide combination, the main formulation will be tested in vivo in animal models.
Cross species ANGPTL3gRNA combinations, i.e., complexes of Cas9 mRNA and grnas, that produce high efficiency deletions in the ANGPTL3 gene in primary human hepatocytes were formulated into lipid nanoparticles for delivery.
When preclinical data were acquired using monoclonal antibodies and antisense oligonucleotide therapy for ANGPTL3 inhibition, cynomolgus monkeys were used as the large animal model. These therapies are currently completing phase I/II clinical trials to evaluate the correlation between ANGPTL3 inhibition and lowering of triglycerides, LDL-cholesterol and HDL-cholesterol in patients with familial hypercholesterolemia.
Lipid nanoparticles complexed with Cas9 mRNA and T6gRNA were infused into monkeys and whole blood samples were collected hourly during the first day post-dosing and once every three days over a period of 14 days. Prior to dosing, a baseline whole blood collection will also be performed. The control group will contain animals infused with saline.
Body weight will be monitored throughout the study, and plasma and serum samples will be monitored for cytokines as well as complement activation (inflammatory response) and clinical lipidome (total cholesterol, HDL, LDL-C and triglycerides). At the end of 14 days, liver tissue will be collected and evaluated for gene editing of the ANGPTL3 gene.
Liver tissue was homogenized from control and dosed animals and analyzed for evidence of effective ANGPTL3 gene editing by TIDE analysis.
Results of the TIDE analysis and lipid chemistry during the study will yield a correlation between indel frequency and modification of cholesterol levels, with an emphasis on the reduction of the major biological marker LDL-C.
As described above, culturing in human cells also allows direct testing of human targets and background human genomes.
In addition, preclinical efficacy and safety assessments can be observed by transplanting modified mouse or human hepatocytes into a mouse model. The modified cells can be observed in several months after transplantation.
EXAMPLE 14 testing of preferred guided off-target Activity in cells
The grnas from IVT screens in the above examples with the best on-target activity were tested for off-target activity using, among other methods, a hybrid capture assay, GUIDE sequencing (GUIDE Seq), and whole genome sequencing.
XI equivalents and ranges
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited by the above description but rather is as set forth in the appended claims.
A claim or description containing one or more members of a group "or" between "one or more members of the group is deemed to be satisfied if one, more than one, or all of the members of the group are present in, used in, or otherwise associated with a given product or process, unless indicated to the contrary or otherwise evident from the context. The present disclosure encompasses embodiments in which exactly one member of the group is present in, used in, or otherwise associated with a given product or process. The present disclosure includes embodiments in which more than one or all of the members of the group are present in, used in, or otherwise associated with a given product or process.
In addition, it should be understood that any particular embodiment of the present disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. Since such embodiments are considered to be known to those of ordinary skill in the art, they may be excluded even if exclusion is not explicitly set forth herein. Any particular embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic or active ingredient; any method of manufacture; any method of use, etc.) may be excluded from any one or more claims for any reason, whether or not related to the presence of prior art.
It is to be understood that the words which have been used are words of description rather than limitation, and that changes may be made within the scope of the appended claims without departing from the true scope and spirit of the disclosure in its broader aspects.
Although the present disclosure has been described with a certain length and a certain specificity with respect to several described embodiments, it is not intended that the present disclosure should be limited to any such details or embodiments or any particular embodiments, but rather should be construed with reference to the appended claims so as to provide as broad an interpretation of such claims as is practicable in view of the prior art and, therefore, to effectively encompass the intended scope of the disclosure.
Comments on the illustrative examples
While the present disclosure provides a description of various specific aspects for the purpose of illustrating various aspects of the disclosure and/or potential applications of the disclosure, it is to be understood that variations and modifications will occur to those skilled in the art. Accordingly, the invention(s) described herein should be construed as being at least as broad as required to be protected and not as narrow as defined by the particular illustrative aspects provided herein.
Unless otherwise indicated, any patent, publication, or other disclosure material, in its entirety, is herein incorporated by reference into the specification, to the extent that the incorporated material does not conflict with existing descriptions, definitions, statements, or other disclosure material set forth explicitly in this specification. As such, and to the extent necessary, the explicit disclosure as set forth in this specification supersedes any conflicting material incorporated by reference. Any material, or portion thereof, that is said to be incorporated by reference into this specification, but which conflicts with existing definitions, statements, or other disclosure material set forth herein is only incorporated to the extent that: no conflict arises between the incorporated material and the prior disclosed material. Applicants reserve the right to modify the specification to explicitly recite any subject matter, or portion thereof, incorporated by reference herein.