Tumor infiltrating lymphocyte and treatment method

文档序号：1760004 发布日期：2019-11-29 浏览：31次中文

阅读说明：本技术 肿瘤浸润性淋巴细胞和治疗方法 (Tumor infiltrating lymphocyte and treatment method ) 是由布兰登·莫里亚提博·韦伯莫达希尔·乔杜里史蒂文·A·罗森堡道格拉斯·C·帕尔默尼于 2017-10-18 设计创作，主要内容包括：公开了用于治疗胃肠癌的遗传修饰组合物,例如非病毒载体和肿瘤浸润性淋巴细胞。公开了利用CRISPR系统产生遗传修饰组合物的方法。还公开了制备和使用用于治疗胃肠癌的遗传修饰组合物的方法。(Disclose the genetic modification composition for treating human primary gastrointestinal cancers, such as non-virus carrier and tumor infiltrating lymphocyte.Disclose the method for generating genetic modification composition using CRISPR system.Also disclose the method for making and using the genetic modification composition for treating human primary gastrointestinal cancers.)

1. a kind for the treatment of method comprising:

It is applied to subject in need:

A) counterplan, the counterplan include amount to be enough to reduce the immune response of the subject to the subject Apply at least one immunosuppressor；

It b) include the pharmaceutical composition for being enough to inhibit the antifungal agent of the amount of fungal infection of the subject；And

C) comprising the pharmaceutical composition of kinds of tumors infiltrating lymphocytes (TIL), the tumor infiltrating lymphocyte (TIL) At least part of destruction comprising cytokine induction SH2-containing protein (CISH) gene.

2. the method as described in claim 1 further comprises administration of antibiotics.

3. a kind for the treatment of method comprising:

It is applied to subject in need:

A) counterplan, the counterplan include amount to be enough to inhibit the immune response of the subject to the subject Apply at least one immunosuppressor；

It b) include the pharmaceutical composition for being enough to inhibit the antibiotic of the amount of bacterium infection of the subject；And

4. method as claimed in claim 3 further comprises application antifungal agent.

5. a kind for the treatment of method comprising:

It is applied to subject in need:

A) comprising being enough to reduce the cyclophosphamide of the amount of the immune response of the subject and the pharmaceutical composition of fludarabine；

It b) include the pharmaceutical composition for being enough to inhibit the Fluconazole of the amount of fungal infection of the subject；And

6. it includes to be enough to inhibit the bacterium infection of the subject that method as claimed in claim 5, which further comprises application, Amount trimethoprim and sulfamethoxazole pharmaceutical composition.

7. a kind for the treatment of method comprising:

It is applied to subject in need:

A) comprising being enough to reduce the cyclophosphamide of the amount of the immune response of the subject and the pharmaceutical composition of fludarabine；

B) comprising being enough to inhibit the trimethoprim of the amount of the bacterium infection of the subject and the medicine of sulfamethoxazole Compositions；And

8. the method for claim 7, further comprising applying comprising being enough to inhibit the fungal infection of the subject Amount Fluconazole pharmaceutical composition.

9. a kind of method for treating cancer comprising: the in vitro engineering of therapeutically effective amount is applied to subject in need Change tumor infiltrating lymphocyte (TIL), wherein the in vitro engineering TIL includes: cytokine induction SH2-containing protein (CISH) destruction in gene, the destruction lead to the inhibition of CISH protein function in the engineered in vitro TIL, wherein institute State the sequence for instructing polynucleotide to be combined destroyed and be located at by SEQ ID NO:68.

10. method according to any one of claims 1 to 4, wherein the counterplan is included in front of the application TIL About 14 days to about 24 hours application immunosuppressor.

11. method according to any one of claims 1 to 4, wherein the counterplan is included in front of the application TIL About 10 days to about 24 hours application immunosuppressor.

12. method according to any one of claims 1 to 4, wherein the counterplan is included in front of the application TIL About 7 days to about 24 hours application immunosuppressor.

13. the method as described in any one of Claims 1-4 and 10 to 12, wherein the immunosuppressor includes that radiation is controlled Treat agent, biological agent or chemical agent.

14. method as claimed in claim 13, wherein the immunosuppressor includes the chemical agent.

15. method as claimed in claim 14, wherein the chemical agent includes at least one below: cyclophosphamide, mustargen, Chlorambucil, melphalan, ifosfamide, thio-tepa, hexamethylmelamine, busulfan, fludarabine, nitroso ureas, platinum, Methotrexate (MTX), imuran, purinethol, procarbazine, Dacarbazine, Temozolomide, Carmustine, lomustine, chain urea Rhzomorph, fluorouracil, dactinomycin D, anthracycline, mitomycin C, bleomycin and mithramycin.

16. method as claimed in claim 15, wherein the chemical agent includes the cyclophosphamide.

17. method as claimed in claim 15, wherein the chemical agent is fludarabine.

18. the method as described in any one of claim 15 to 17, wherein applying subject described in about 40mg/kg to about The cyclophosphamide of subject described in 50mg/kg.

19. method as claimed in claim 18, wherein the cyclophosphamide be applied at least about 2 days to about 5 days it is described by Examination person.

20. the method as described in any one of claim 15 to 17, wherein applying subject described in about 10mg/kg to about The cyclophosphamide of subject described in 15mg/kg.

21. method as claimed in claim 20, wherein the cyclophosphamide be applied at least about 7 days to about 10 days it is described by Examination person.

22. the method as described in any one of claim 15 to 17, wherein applying subject described in about 3mg/kg to about 5mg/ The cyclophosphamide of subject described in kg.

23. the method as described in any one of claim 15 to 17, wherein applying subject described in about 50mg/kg to about The cyclophosphamide of subject described in 80mg/kg.

24. the method as described in any one of claim 15 to 17, wherein application is more than the cyclophosphamide of 50mg/kg.

25. method as claimed in claim 24, wherein applying the cyclophosphamide of about 60mg/kg.

26. the method as described in any one of claim 15 to 25, wherein applying about 20mg/m²The body surface face of the subject It accumulates to about 30mg/m²The fludarabine of the body surface area of the subject.

27. method as claimed in claim 26, wherein applying about 25mg/m²The fluorine of the body surface area of the subject reaches Draw shore.

28. the method as described in any one of Claims 1-4 and 10 to 27, wherein the counterplan includes partly or completely Full immunosupress.

29. the method as described in any one of claim 1,2,4 and 10 to 28, wherein the antifungal agent is selected from: polyenoid, Azoles, allyl amine and echinocandin.

30. method as claimed in claim 29, wherein the antifungal agent is the azoles.

31. method as claimed in claim 30, wherein the azoles is selected from: bifonazole, butoconazole, clotrimazole, econazole, sweet smell Ticonazole, Isoconazole, ketoconazole, luliconazole, Miconazole, Omoconazole, Oxiconazole, Sertaconazole, sulconazole, thiophene health Azoles, albaconazole, Chinese mugwort Fluconazole, epoxiconazole, Fluconazole, Chinese mugwort Saperconazole, Itraconazole, posaconazole, propiconazole, Lei Fukang Azoles, terconazole and voriconazole.

32. method as claimed in claim 31, wherein the azoles is Fluconazole.

33. method as claimed in claim 32, wherein applying the Fluconazole of about 100mg to about 800mg.

34. method as claimed in claim 33, wherein the Fluconazole of application 400mg.

35. the method as described in any one of claim 1,2,4 and 10 to 34, wherein the antifungal agent and the TIL are same When or sequence apply.

36. method as claimed in claim 35, wherein application in the about the 0th day to the about the 4th day is described antimycotic after the TIL Agent.

37. the method as described in any one of claim 2-4 and 10 to 36, wherein the antibiotic includes below at least one Kind: bacteria wall targeting agent, cell membrane targeting agent, bacterial enzyme agent interfering, fungicide, protein synthesis inhibitor or bacteriostatic agent.

38. method as claimed in claim 37, wherein the antibiotic includes fungicide.

39. method as claimed in claim 38, wherein the fungicide is cephalosporin or quinolone.

40. method as claimed in claim 37, wherein the antibiotic includes bacteriostatic agent.

41. method as claimed in claim 40, wherein the preventative application of the bacteriostatic agent.

42. the method as described in any one of claim 37 to 41, wherein the bacteriostatic agent is trimethoprim, sulphur Amine first oxazole or pentamidinum.

43. method as claimed in claim 42, wherein the trimethoamine for applying about 100mg to about 1000mg is phonetic Pyridine, sulfamethoxazole or pentamidinum.

44. method as claimed in claim 43, wherein the trimethoprim of application 160mg.

45. method as claimed in claim 43, wherein the sulfamethoxazole of application 800mg.

46. method as claimed in claim 43, wherein the pentamidinum of application 300mg.

47. the method as described in any one of claim 37 to 46, wherein the bacteriostatic agent before the TIL, with it is described TIL simultaneously or applied after the TIL.

48. method as claimed in claim 47, wherein the bacteriostatic agent before the application of the TIL about 14 days to institute It applies the application about 6 months later for stating TIL.

49. the method as described in any one of claim 37 to 48, wherein about 8 days extremely before the TIL for the bacteriostatic agent It applies at least 4 days after the TIL.

50. the method as described in any one of Claims 1-4 9, wherein the application includes intravenous, oral, intramuscular, abdomen It is applied in film or in pleura.

51. the method as described in any one of claim 1 to 50, wherein the immunosuppressor passes through infusion application.

52. the method as described in any one of claim 15 to 51, wherein the cyclophosphamide is the dosage of about 60mg/kg, And it is diluted in 5% glucose solution of 250ml and was transfused through 1 hour.

53. the method as described in any one of claim 15 to 52, wherein the fludarabine is in 0.9% chlorination of 100ml 25mg/m in sodium (USP)²Dosage, and through about 15 to about 30 minutes be transfused.

54. the method as described in any one of claim 1 to 53 further comprises that application is described tested comprising being enough to activate The pharmaceutical composition of the immunostimulant of the amount of the TIL in person.

55. method as claimed in claim 54, wherein the immunostimulant includes at least one below: vaccine, colony Stimulant, interferon, interleukin, virus, antigen, costimulation agent, immunogenic agents, immunomodulator or immunotherapeutic agent.

56. method as claimed in claim 55, wherein the immunostimulant includes the interleukin.

57. method as claimed in claim 56, wherein the interleukin is Aldesleukin, and with about 550,000 to about The dosage of 800,000IU/kg is applied.

58. method as claimed in claim 57, wherein the Aldesleukin is applied with the dosage of about 720,000IU/kg.

59. the method as described in any one of claim 1 to 58 further comprises that application is described tested comprising being enough to prevent The pharmaceutical composition of the infection mitigation agent of the amount of the infection of person.

60. method as claimed in claim 59, wherein the infection mitigation agent is herpesviral prophylactic.

61. method as claimed in claim 60, wherein the subject is HSV positive.

62. the method as described in any one of claim 60 to 61, wherein the herpesviral prophylactic be Valaciclovir or Acyclovir.

63. the method as described in any one of claim 1 to 62, wherein by being selected from CRISPR, zinc finger, TALEN and its appointing The system of what combination induces the destruction.

64. the method as described in claim 63, wherein the system is CRISPR system.

65. the method as described in any one of claim 63 to 64, wherein the CRISPR system include selected from Cas1, Cas1B、Cas2、Cas3、Cas4、Cas5、Cas6、Cas7、Cas8、Cas9、Cas10、Csy1、Csy2、Csy3、Cse1、Cse2、 Csc1、Csc2、Csa5、Csn2、Csm2、Csm3、Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、Csb1、 Csb2、Csb3、Csx17、Csx14、Csx10、Csx16、CsaX、Csx3、Csx1、Csx1S、Csf1、Csf2、CsO、Csf4、 The endonuclease of Cpf1, c2c1, c2c3 and Cas9HiFi.

66. the method as described in claim 65, wherein the endonuclease is Cas9.

67. the method as described in any one of claim 65 to 66, wherein the endonuclease executes the destruction.

68. the method as described in any one of claim 1 to 67, wherein the destruction includes the exon of gene or includes Son.

69. method as recited in claim 68, wherein the destruction is in the exon of gene.

70. the method as described in any one of claim 1 to 69, wherein the destruction is in preceding region sequence adjacent to motif (PAM) in about 20 base-pairs.

71. the method as described in any one of claim 1 to 70, wherein the destruction is in preceding region sequence adjacent to motif (PAM) in about 10 base-pairs.

72. the method as described in any one of claim 1 to 71, wherein the destruction is in preceding region sequence adjacent to motif (PAM) in about 5 base-pairs.

73. the method as described in any one of claim 1 to 72, wherein region sequence is adjacent to motif between before the destruction range (PAM) 3 base-pairs.

74. the method as described in any one of claim 1 to 73, wherein it is described destroy SEQ ID NO:13 exon or In introne.

75. the method as described in claim 74, wherein the destruction is in the exon of SEQ ID NO:13.

76. the method as described in any one of claim 63 to 75, wherein the CRISPR system includes instructing polynucleotide.

77. the method as described in claim 76, wherein described instruct polynucleotide and SEQ ID NO:68 to have at least about 60% Homology.

78. the method as described in any one of claim 1 to 77, wherein described destroy includes double-strand break.

79. the method as described in claim 78, wherein the double-strand break occurs in SEQ ID NO:71 or SEQ ID NO: At 77.

80. the method as described in any one of claim 1 to 79, wherein the TIL is with about 1 x 10⁹A cell, 3 x 10⁹ A cell, 1 x 10¹⁰A cell, 3 x 10¹⁰A cell is to about 1 x 10¹¹The dosage of a cell is applied.

81. the method as described in any one of claim 1 to 80, wherein the TIL was applied through about 30 minutes.

82. the method as described in any one of claim 1 to 81, wherein the TIL is intravenously applied.

83. the method as described in claim 82, wherein described intravenous including infusion.

84. the method as described in any one of claim 1 to 83 further comprises carrying out being transfused preceding test to the TIL.

85. the method as described in claim 84, wherein test includes at least one below before the infusion: phenotype test, Effect test, microbiological assay, endotoxin test, vigor test and tumour cell test.

86. the method as described in claim 85, wherein phenotype test includes detecting the presence of the CD3 on the TIL.

87. the method as described in any one of claim 85 to 86 carries out the TIL wherein effect test is included in Detection IFN γ is horizontal after AntiCD3 McAb stimulation.

88. the method as described in any one of claim 85 to 87, wherein the microbiological assay includes detecting aerobic training Support object, the growth of anaerobic cultures, leather flange-like state, fungi state or mycoplasma state.

89. the method as described in any one of claim 85 to 88, wherein endotoxin test includes carrying out horseshoe crab measurement.

90. the method as described in any one of claim 85 to 89, wherein vigor test includes carrying out trypan blue exclusion Measurement.

91. the method as described in any one of claim 85 to 90, wherein tumour cell test includes cell pathology Measurement.

92. the method as described in any one of claim 84 to 91, wherein the microorganism before the infusion in test When test is negative, the TIL is applied.

93. the method as described in any one of claim 84 to 92, wherein the vigor before the infusion in test is surveyed When examination is in the presence of being more than at least about 70% living cells, the TIL is applied.

94. the method as described in any one of claim 84 to 93, wherein the phenotype before the infusion in test is surveyed When examination has at least about 80% CD3 positive, the TIL is applied.

95. the method as described in any one of claim 84 to 94, wherein test is tested in the effect before the infusion In to the TIL carry out the post-stimulatory IFN γ of AntiCD3 McAb be at least about 200pg/mL/10⁵When a cell, the TIL is applied.

96. the method as described in any one of claim 84 to 95, wherein test is in the cell pathology before the infusion When the tumour cell in every at least about 200 TIL checked in test is negative, the TIL is applied.

97. a kind for the treatment of product, described tumor-infiltrated it includes the dosage form with kinds of tumors infiltrating lymphocytes (TIL) Property lymphocyte (TIL) include cytokine induction SH2-containing protein (CISH) gene at least part of destruction；And it is anti-true The dosage form of microbial inoculum.

98. a kind for the treatment of product, it includes the folate synthesis inhibitor of the amount for the fungal infection for being enough to inhibit the subject or The dosage form of nucleic acid crosslinking agent；And the dosage form with kinds of tumors infiltrating lymphocytes (TIL), the tumor infiltrating lymph Cell (TIL) includes at least part of destruction of cytokine induction SH2-containing protein (CISH) gene.

99. a kind for the treatment of product, it includes the dosage forms of the antifungal agent selected from polyenoid, azoles, allyl amine or echinocandin；And Dosage form with kinds of tumors infiltrating lymphocytes (TIL), the tumor infiltrating lymphocyte (TIL) include cell factor Induce at least part of destruction of SH2-containing protein (CISH) gene.

100. a kind for the treatment of product, described tumor-infiltrated it includes the dosage form with kinds of tumors infiltrating lymphocytes (TIL) Property lymphocyte (TIL) include cytokine induction SH2-containing protein (CISH) gene at least part of destruction, wherein described TIL is with about 7.0 x 10⁷A cell/mL to about 2.0 x 10⁸The freezing density freezen protective of a cell/mL.

101. a kind for the treatment of product, it includes:

A) dosage form of antifungal agent；

B) dosage form of immunosuppressor；

C) dosage form of antibiotic；And

E) with the dosage form of kinds of tumors infiltrating lymphocytes (TIL), the tumor infiltrating lymphocyte (TIL) includes thin At least part of destruction of intracellular cytokine induction SH2-containing protein (CISH) gene.

102. the treatment product as described in any one of claim 97 to 100, wherein the treatment product further includes and exempts from The dosage form of epidemic disease inhibitor.

103. the treatment product as described in claim 102, wherein the immunosuppressor is prepared for applying in the TIL It was applied with about 14 days before to about 24 hours to subject.

104. the treatment product as described in any one of claim 102 to 103, wherein the immunosuppressor is prepared for It is applied to subject within about 10 days to about 24 hours before the application of the TIL.

105. the treatment product as described in any one of claim 102 to 104, wherein the immunosuppressor is prepared for It is applied to subject within about 7 days to about 24 hours before the application of the TIL.

106. the treatment product as described in any one of claim 102 to 105, wherein the immunosuppressor includes that radiation is controlled Treat agent, biological agent or chemical agent.

107. the treatment product as described in claim 106, wherein the immunosuppressor includes the chemical agent.

108. the treatment product as described in claim 107, wherein the chemical agent includes at least one below: ring phosphinylidyne Amine, mustargen, Chlorambucil, melphalan, ifosfamide, thio-tepa, hexamethylmelamine, busulfan, fludarabine, nitrous Base urea, platinum, methotrexate (MTX), imuran, purinethol, procarbazine, Dacarbazine, Temozolomide, Carmustine, Luo Mosi Spit of fland, streptozotocin, fluorouracil, dactinomycin D, anthracycline, mitomycin C, bleomycin and mithramycin.

109. the treatment product as described in claim 108, wherein the chemical agent includes cyclophosphamide.

110. the treatment product as described in claim 108, wherein the chemical agent includes fludarabine.

111. the treatment product as described in any one of claim 108 to 110, wherein applying subject described in about 40mg/kg To the cyclophosphamide of subject described in about 50mg/kg.

112. the treatment product as described in claim 111, wherein the cyclophosphamide was applied to through at least about 2 days to about 5 days The subject.

113. the treatment product as described in any one of claim 108 to 110, wherein applying subject described in about 10mg/kg To the cyclophosphamide of subject described in about 15mg/kg.

114. the treatment product as described in claim 113, wherein the cyclophosphamide was applied to through at least about 7 days to about 10 days The subject.

115. the treatment product as described in any one of claim 108 to 110, wherein applying subject described in about 3mg/kg extremely The cyclophosphamide of subject described in about 5mg/kg.

116. the treatment product as described in any one of claim 108 to 110, wherein applying subject described in about 50mg/kg To the cyclophosphamide of subject described in about 80mg/kg.

117. the treatment product as described in any one of claim 108 to 110, wherein application is more than the ring of 50mg/kg Phosphamide.

118. the treatment product as described in claim 117, wherein applying the cyclophosphamide of about 60mg/kg.

119. the treatment product as described in any one of claim 108 to 118, wherein applying about 20mg/m²The subject's Body surface area is to about 30mg/m²The fludarabine of the body surface area of the subject.

120. the treatment product as described in claim 119, wherein applying about 25mg/m²The institute of the body surface area of the subject State fludarabine.

121. the treatment product as described in any one of claim 102 to 120, wherein the immunosuppressor generate part or Complete immunosupress.

122. the treatment product as described in any one of claim 97 to 121, wherein the dosage form of the antifungal agent is selected from: more Alkene, azoles, allyl amine and echinocandin.

123. the treatment product as described in claim 122, wherein the antifungal agent is azoles.

124. the treatment product as described in claim 123, wherein the azoles is selected from: bifonazole, butoconazole, clotrimazole, benefit Health azoles, Fenticonazole, Isoconazole, ketoconazole, luliconazole, Miconazole, Omoconazole, Oxiconazole, Sertaconazole, sulphur health Azoles, tioconazole, albaconazole, Chinese mugwort Fluconazole, epoxiconazole, Fluconazole, Chinese mugwort Saperconazole, Itraconazole, posaconazole, propiconazole, Ravuconazole, terconazole and voriconazole.

125. the treatment product as described in claim 124, wherein the azoles is Fluconazole.

126. the treatment product as described in any one of claim 124 to 125, wherein the Fluconazole is with about 100mg to about The amount of 800mg exists.

127. the treatment product as described in claim 126, wherein the Fluconazole exists with the amount of 400mg.

128. the treatment product as described in any one of claim 97 to 127, wherein the dosage form of the antifungal agent with it is described TIL is administered simultaneously or sequentially.

129. the treatment product as described in claim 128, wherein described in being applied for the about the 0th day to the about the 4th day after the TIL The dosage form of antifungal agent.

130. the treatment product as described in any one of claim 97 to 129 further includes the dosage form of antibiotic.

131. the treatment product as described in claim 130, wherein the antibiotic includes at least one below: bacteria wall target To agent, cell membrane targeting agent, bacterial enzyme agent interfering, fungicide, protein synthesis inhibitor and bacteriostatic agent.

132. the treatment product as described in claim 131, wherein the antibiotic includes fungicide.

133. the treatment product as described in claim 132, wherein the fungicide is cephalosporin or quinolone.

134. the treatment product as described in any one of claim 130 to 133, wherein the dosage form of the antibiotic is antibacterial Agent.

135. the treatment product as described in claim 134, wherein the bacteriostatic agent is prepared for preventative application.

136. the treatment product as described in any one of claim 134 to 135, wherein the bacteriostatic agent is trimethoamine Pyrimidine, sulfamethoxazole or pentamidinum.

137. the treatment product as described in claim 136, wherein the trimethoprim, sulfamethoxazole or pentane Amidine exists with the amount of about 100mg to about 1000mg.

138. the treatment product as described in claim 137, wherein the trimethoprim exists with the amount of 160mg.

139. the treatment product as described in claim 137, wherein the sulfamethoxazole exists with the amount of 800mg.

140. the treatment product as described in claim 137, wherein the pentamidinum exists with the amount of 300mg.

141. treatment product as described in any one of claim 131 to 140, wherein the bacteriostatic agent before the TIL, It is applied simultaneously or after the TIL with the TIL.

142. treatment product as described in claim 141, wherein the bacteriostatic agent is about 14 before the application of the TIL It was applied to about 6 months after the application of the TIL.

143. treatment product as described in any one of claim 131 to 142, wherein the bacteriostatic agent is before the TIL It applies within about 8 days at least 4 days after the TIL.

144. treatment product as described in any one of Claims 1-4 9 further comprises applying the dosage form.

145. treatment product as described in claim 144, wherein the treatment product is prepared for intravenous, oral, flesh It is applied in interior, peritonaeum or in pleura.

146. treatment product as described in any one of claim 102 to 145, wherein the dosage form of the immunosuppressor is matched It is made and is applied by infusion.

147. treatment product as described in any one of claim 108 to 146, wherein the cyclophosphamide is with about 60mg/kg Dosage application, and be diluted in 5% glucose solution of 250ml and through 1 hour be transfused.

148. treatment product as described in any one of claim 108 to 147, wherein the fludarabine is in 100ml 25mg/m in 0.9% sodium chloride (USP)²Dosage application, and through about 15 to about 30 minutes be transfused.

149. treatment product as described in any one of claim 97 to 148, wherein the immunostimulant is to be enough to activate The amount of the TIL in the subject exists.

150. treatment product as described in claim 149, wherein the immunostimulant includes at least one below: epidemic disease It seedling, colony-stimulating agent, interferon, interleukin, virus, antigen, costimulation agent, immunogenic agents, immunomodulator and immune controls Treat agent.

151. treatment product as described in claim 150, wherein the dosage form of the immunostimulant includes interleukin.

152. treatment product as described in claim 151, wherein the interleukin is Aldesleukin, and with about 550, 000 to about 800,000IU/kg dosage application.

153. treatment product as described in claim 152, wherein the Aldesleukin is with the dosage of about 720,000IU/kg Application.

154. treatment product as described in any one of claim 97 to 153, wherein the treatment product further includes foot To prevent the dosage form of the infection mitigation agent of the amount of the infection of the subject.

155. treatment product as described in claim 154, wherein the infection mitigation agent is herpesviral prophylactic.

156. treatment product as described in claim 155, wherein the herpesviral prophylactic is with tested to the treatment HSV positive Person effectively measures presence.

157. treatment product as described in any one of claim 155 to 156, wherein the herpesviral prophylactic is to cut down former times Lip river Wei or acyclovir.

158. treatment product as described in any one of claim 97 to 157, wherein by being selected from CRISPR, zinc finger, TALEN And its any combination of system induces the destruction.

159. treatment product as described in claim 158, wherein the system is CRISPR system.

160. treatment product as described in any one of claim 158 to 159, wherein the CRISPR system includes being selected from Cas1、Cas1B、Cas2、Cas3、Cas4、Cas5、Cas6、Cas7、Cas8、Cas9、Cas10、Csy1、Csy2、Csy3、Cse1、 Cse2、Csc1、Csc2、Csa5、Csn2、Csm2、Csm3、Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、 Csb1、Csb2、Csb3、Csx17、Csx14、Csx10、Csx16、CsaX、Csx3、Csx1、Csx1S、Csf1、Csf2、CsO、 The endonuclease of Csf4, Cpf1, c2c1, c2c3 and Cas9HiFi.

161. treatment product as described in claim 160, wherein the endonuclease is Cas9.

162. treatment product as described in any one of claim 160 to 161, wherein the endonuclease executes described break It is bad.

163. treatment product as described in any one of claim 97 to 162, wherein described destroy the exon including gene Or introne.

164. treatment product as described in claim 163, wherein the destruction is in the exon of gene.

165. treatment product as described in any one of claim 97 to 164, wherein the destruction is neighbouring in preceding region sequence In about 20 base-pairs of motif (PAM).

166. treatment product as described in any one of claim 97 to 164, wherein the destruction is neighbouring in preceding region sequence In about 10 base-pairs of motif (PAM).

167. treatment product as described in any one of claim 97 to 164, wherein the destruction is neighbouring in preceding region sequence In about 5 base-pairs of motif (PAM).

168. treatment product as described in any one of claim 97 to 167, wherein region sequence is adjacent between before the destruction range About 3 base-pairs of nearly motif (PAM).

169. treatment product as described in any one of claim 97 to 168, wherein the destruction is SEQ ID NO:13's In exon or introne.

170. treatment product as described in claim 169, wherein the destruction is in the exon of SEQ ID NO:13.

171. treatment product as described in any one of claim 158 to 170, wherein the CRISPR system includes that guidance is more Nucleic acid.

172. treatment product as described in claim 171, wherein described instruct polynucleotide and SEQ ID NO:68 to have at least About 60% homology.

173. treatment product as described in any one of claim 97 to 172, wherein described destroy includes double-strand break.

174. treatment product as described in claim 173, wherein the double-strand break occurs in SEQ ID NO:71 or SEQ At ID NO:77.

175. treatment product as described in any one of claim 97 to 174, wherein the TIL is with about 1 x 10⁹A cell, 3 x 10⁹A cell, 1 x 10¹⁰A cell, 3 x 10¹⁰A cell is to about 1 x 10¹¹The amount of a cell exists.

176. treatment product as described in any one of claim 97 to 175, wherein the TIL was applied through about 30 minutes.

177. treatment product as described in any one of claim 97 to 176, wherein the TIL is intravenously applied.

178. treatment product as described in claim 177, wherein described intravenous including infusion.

179. treatment product as described in any one of claim 97 to 178 further comprises being transfused to the TIL Preceding test.

180. treatment product as described in claim 179, wherein test includes at least one below: phenotype before the infusion Test, effect test, microbiological assay, endotoxin test, vigor test and tumour cell test.

181. treatment product as described in claim 180, wherein phenotype test includes the CD3 detected on the TIL In the presence of.

182. treatment product as described in any one of claim 180 to 181, wherein effect test is included in described Detection IFN γ is horizontal after TIL carries out AntiCD3 McAb stimulation.

183. treatment product as described in any one of claim 180 to 182, wherein the microbiological assay includes detection Aerobic culture, the growth of anaerobic cultures, leather flange-like state, fungi state or mycoplasma state.

184. treatment product as described in any one of claim 180 to 183, wherein endotoxin test includes carrying out horseshoe crab Measurement.

185. treatment product as described in any one of claim 180 to 184, wherein vigor test includes carrying out platform to expect Indigo plant excludes measurement.

186. treatment product as described in any one of claim 180 to 185, wherein tumour cell test includes cell Pathology measurement.

187. treatment product as described in any one of claim 97 to 186, wherein described in being tested before the infusion When microbiological assay is negative, the TIL is applied.

188. treatment product as described in any one of claim 97 to 187, wherein described in being tested before the infusion When vigor test is in the presence of being more than at least about 70% living cells, the TIL is applied.

189. treatment product as described in any one of claim 97 to 188, wherein described in being tested before the infusion When phenotype test has at least about 80% CD3 positive, the TIL is applied.

190. treatment product as described in any one of claim 97 to 189, wherein test is in the effect before the infusion Carrying out the post-stimulatory IFN γ of AntiCD3 McAb to the TIL in power test is at least about 200pg/mL/10⁵When a cell, described in application TIL。

191. treatment product as described in any one of claim 97 to 190, wherein test is described thin before the infusion When the tumour cell in every at least about 200 TIL checked in the test of born of the same parents' pathology is negative, the TIL is applied.

192. a kind of nucleic acid compositions, with any of SEQ ID NO:64 to SEQ ID NO:69 at least 60% Sequence homology.

193. nucleic acid compositions as described in claim 192, wherein the sequence homology be at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or up to about 100%.

Background technique

The adoptive transfer of tumor infiltrating lymphocyte (TIL) obtains in terms of the permanent regression for mediating metastatic melanoma Considerable success.Although achieving these successes, application of the TIL therapy in other entity tumor environment, which still has, is chosen War property.This may be the inhibiting effect played by tumor microenvironment and in receptor signal conduction and effector function acquisition side It is being damaged in the T cell in face.Target apoptosis albumen 1 (PD-1) and cytotoxic T lymphocyte GAP-associated protein GAP (CTLA-4) the external inhibition that the immunologic test point inhibitor based on monoclonal antibody of function can mitigate T cell sometimes is made With, but have and autoimmunity pair that may be fatal caused by the systemic activities of non-tumor-reactive T cells is made due to them Use risk.Recently, achieved in terms of the lymphocyte genetic engineering for identifying the molecular target in tumour in vivo significantly into Step, the significant case alleviated so as to cause target tumor.However, these successes are largely confined to neoplastic hematologic disorder, And it is limited to lack identifying molecule and lack by the cell expression in specific tumors for the broader applications of solid tumor The weary molecule that can be used for specifically binding tumor targets and destroyed so as to mediate tumor.Some Latest Development concerns are in some cases The identification of the tumour-specific mutation of the lower antitumor t cell response of triggering.For example, full sequencing of extron group method can be used to reflect These other endogenous mutants.Tran E et al., " Cancer immunotherapy based on mutation-specific CD4+T cells in a patient with epithelial cancer,”Science 344:641-644(2014)。

Summary of the invention

Disclosed herein is a kind for the treatment of methods comprising: counterplan, the preparation side are applied to subject in need Case includes that the amount to be enough to reduce the immune response of the subject applies at least one immunosuppressor to the subject；Packet The pharmaceutical composition of the antifungal agent of amount containing the fungal infection for being enough to inhibit the subject；And it is infiltrated comprising kinds of tumors Property lymphocyte (TIL) pharmaceutical composition, the tumor infiltrating lymphocyte (TIL) include cytokine induction contain SH2 At least part of destruction of albumen (CISH) gene.In some cases, method may further include administration of antibiotics.

Disclosed herein is a kind for the treatment of methods comprising: counterplan, the preparation side are applied to subject in need Case includes that the amount to be enough to inhibit the immune response of the subject applies at least one immunosuppressor to the subject；Packet The pharmaceutical composition of the antibiotic of amount containing the bacterium infection for being enough to inhibit the subject；And include kinds of tumors wellability The pharmaceutical composition of lymphocyte (TIL), the tumor infiltrating lymphocyte (TIL) include cytokine induction egg containing SH2 At least part of destruction of white (CISH) gene.In some cases, method may further include application antifungal agent.

Disclosed herein is a kind for the treatment of methods comprising: applied to subject in need: comprising be enough to reduce it is described by The cyclophosphamide of the amount of the immune response of examination person and the pharmaceutical composition of fludarabine；Comprising being enough to inhibit, the subject's is true The pharmaceutical composition of the Fluconazole of the amount of bacterium infection；And the pharmaceutical composition comprising kinds of tumors infiltrating lymphocytes (TIL) Object, the tumor infiltrating lymphocyte (TIL) include at least part of cytokine induction SH2-containing protein (CISH) gene Destruction.In some cases, method may further include the amount of bacterium infection of the application comprising being enough to inhibit subject The pharmaceutical composition of trimethoprim and sulfamethoxazole.

Disclosed herein is a kind for the treatment of methods comprising: to subject in need application comprising be enough to reduce it is described by The cyclophosphamide of the amount of the immune response of examination person and the pharmaceutical composition of fludarabine；Comprising being enough to inhibit, the subject's is thin The trimethoprim of the amount of bacterium infection and the pharmaceutical composition of sulfamethoxazole；And it is drenched comprising kinds of tumors wellability The pharmaceutical composition of bar cell (TIL), the tumor infiltrating lymphocyte (TIL) include cytokine induction SH2-containing protein (CISH) at least part of destruction of gene.In some cases, method may further include application comprising being enough to inhibit The pharmaceutical composition of the Fluconazole of the amount of the fungal infection of subject.

Disclosed herein is a kind of methods for treating cancer comprising: it is effective that treatment is applied to subject in need The in vitro engineer tumor infiltrating lymphocytes (TIL) of amount, wherein the in vitro engineering TIL includes: cytokine induction Destruction in SH2-containing protein (CISH) gene, it is described to destroy the suppression for leading to CISH protein function in the engineered in vitro TIL System, wherein described destroy the sequence for instructing polynucleotide to be combined being located at by SEQ ID NO:68.In some cases, preparation Scheme is included in about 14 days to about 24 hours application immunosuppressor before application TIL.In some cases, counterplan includes About 10 days to the about 24 hours application immunosuppressor before applying TIL.Counterplan may include about 7 before applying TIL It was to about 24 hours application immunosuppressor.In some cases, immunosuppressor includes radiotherapy dose, biological agent or chemistry Agent.Immunosuppressor may include chemical agent.Chemical agent may include at least one below: cyclophosphamide, mustargen, benzenebutanoic acid Mustargen, melphalan, ifosfamide, thio-tepa, hexamethylmelamine, busulfan, fludarabine, nitroso ureas, platinum, first ammonia butterfly Purine, imuran, purinethol, procarbazine, Dacarbazine, Temozolomide, Carmustine, lomustine, streptozotocin, fluorine Uracil, dactinomycin D, anthracycline, mitomycin C, bleomycin and mithramycin.Chemical agent may include cyclophosphamide.Chemistry Agent can be fludarabine.About 40mg/kg subject can be applied to the cyclophosphamide of about 50mg/kg subject.Cyclophosphamide can To be applied to subject through at least about 2 days to about 5 days.In some cases, about 10mg/kg subject can be applied to about The cyclophosphamide of 15mg/kg subject.In some cases, cyclophosphamide can be applied at least about 7 days to about 10 days by Examination person.In some cases, about 3mg/kg subject can be applied to the cyclophosphamide of about 5mg/kg subject.In some cases Under, about 50mg/kg subject can be applied to the cyclophosphamide of about 80mg/kg subject.In some cases, it can apply super Cross the cyclophosphamide of 50mg/kg.In some cases, the cyclophosphamide of about 60mg/kg can be applied.In some cases, may be used To apply about 20mg/m²Subject's body surface area is to about 30mg/m²The fludarabine of subject's body surface area.In some cases, About 25mg/m can be applied²The fludarabine of subject's body surface area.In some cases, counterplan includes partially or completely Immunosupress.Antifungal agent can be selected from: polyenoid, azoles, allyl amine and echinocandin.Antifungal agent can be azoles.Azoles can be selected from: Bifonazole, butoconazole, clotrimazole, econazole, Fenticonazole, Isoconazole, ketoconazole, luliconazole, Miconazole, Ao Mokang Azoles, Oxiconazole, Sertaconazole, sulconazole, tioconazole, albaconazole, Chinese mugwort Fluconazole (efinaconazole), epoxiconazole, fluorine Health azoles, Chinese mugwort Saperconazole, Itraconazole, posaconazole, propiconazole, ravuconazole, terconazole and voriconazole.As the anti-true of azoles Microbial inoculum can be Fluconazole.In some cases, the Fluconazole of about 100mg to about 800mg can be applied.It can apply 400mg's Fluconazole.Antifungal agent can be administered simultaneously or sequentially with TIL.Application in the about the 0th day to the about the 4th day it can resist very after TIL Microbial inoculum.In some cases, antibiotic includes at least one below: bacteria wall targeting agent, cell membrane targeting agent, bacterial enzyme are dry Disturb agent, fungicide, protein synthesis inhibitor or bacteriostatic agent.In some cases, antibiotic includes fungicide.Fungicide can be Cephalosporin or quinolone.In some cases, antibiotic includes bacteriostatic agent.Bacteriostatic agent preventative can be applied.In some feelings Under condition, bacteriostatic agent can be trimethoprim, sulfamethoxazole or pentamidinum.About 100mg can be applied to about 1000mg Trimethoprim, sulfamethoxazole or pentamidinum.In some cases, the trimethoxy benzyl two of 160mg can be applied Aminometradine.In some cases, the sulfamethoxazole of 800mg can be applied.In some cases, the penta of 300mg can be applied Alkane amidine.Bacteriostatic agent can be applied simultaneously or after TIL before TIL, with TIL.Bacteriostatic agent can be about 14 before applying TIL It was applied to application TIL about 6 months later.In some cases, bacteriostatic agent can before the TIL about 8 days to after TIL It applies at least 4 days.

In some cases, application in intravenous, oral, intramuscular, peritonaeum or in pleura including applying.In some cases Under, immunosuppressor can be applied by infusion.In some cases, cyclophosphamide can be about the dosage of 60mg/kg, and dilute It is transfused in 5% glucose solution of 250ml and through 1 hour.In some cases, fludarabine can be in 100ml 25mg/m in 0.9% sodium chloride (USP)²Dosage, and through about 15 to about 30 minutes be transfused.Method may further include application Pharmaceutical composition, described pharmaceutical composition include to be enough to activate the immunostimulant of the amount of the TIL in subject.Immunostimulant It may include at least one below: vaccine, colony-stimulating agent, interferon, interleukin, virus, antigen, costimulation agent, immunogene Property agent, immunomodulator or immunotherapeutic agent.Immunostimulant may include interleukin.Interleukin can be Aldesleukin, and It can be applied with about 550,000 to about 800,000IU/kg dosage.In some cases, Aldesleukin can with about 720, The dosage of 000IU/kg is applied.In some cases, method may further include application pharmaceutical composition, the pharmaceutical composition Object includes the infection mitigation agent for being enough to prevent the amount of subject's infection.In some cases, infection mitigation agent can be herpesviral Prophylactic.In some cases, subject can be positive for HSV.In some cases, herpesviral prophylactic can be Valaciclovir Or acyclovir.It in some cases, can be by being induced selected from CRISPR, zinc finger, TALEN and its any combination of system It destroys.System can be CRISPR system.CRISPR system may include selected from Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6、Cas7、Cas8、Cas9、Cas10、Csy1、Csy2、Csy3、Cse1、Cse2、Csc1、Csc2、Csa5、Csn2、Csm2、 Csm3、Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、Csb1、Csb2、Csb3、Csx17、Csx14、 Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Cpf1, c2c1, c2c3 and Cas9HiFi Endonuclease.Endonuclease can be Cas9.In some cases, endonuclease executes destruction.Destruction may include base The exon or introne of cause.Destruction can be in the exon of gene.Destruction can be in preceding region sequence adjacent to the pact of motif (PAM) In 20 base-pairs.Destruction can be in about 10 base-pairs of the preceding region sequence adjacent to motif (PAM).Destruction can be in the area Qian Jian sequence In about 5 base-pairs for arranging neighbouring motif (PAM).Destroy can before between region sequence adjacent to 3 base-pairs of motif (PAM).In Under some cases, destroy in the exon or introne of SEQ ID NO:13.Destruction can be in the exon of SEQ ID NO:13 In.In some cases, CRISPR system includes instructing polynucleotide.Instruct polynucleotide that can have at least about with SEQ ID NO:68 60% homology.In some cases, destroy includes double-strand break.Double-strand break can occur in SEQ ID NO:71 or SEQ At ID NO:77.In some cases, TIL can be with about 1x 10⁹A cell, 3x 10⁹A cell, 1x 10¹⁰A cell, 3x 10¹⁰A cell is to about 1x 10¹¹The dosage of a cell is applied.In some cases, TIL can be applied through about 30 minutes.Some In the case of, TIL can be applied intravenously.Intravenous application may include infusion.

In some cases, method, which may further include, carries out TIL to be transfused preceding test.It is tested before infusion and may include At least one below: phenotype test, effect test, microbiological assay, endotoxin test, vigor test and tumour cell are surveyed Examination.In some cases, phenotype test includes the presence of the CD3 on detection TIL.In some cases, effect test is included in Detection IFN γ is horizontal after carrying out AntiCD3 McAb stimulation to TIL.In some cases, microbiological assay includes detecting aerobic culture Object, the growth of anaerobic cultures, leather flange-like state, fungi state or mycoplasma state.Endotoxin test may include carrying out horseshoe crab survey It is fixed.In some cases, vigor test includes carrying out trypan blue to exclude measurement.In some cases, tumour cell, which is tested, includes Cell pathology measurement.In some cases, it when the microbiological assay in the preceding test of infusion can be negative, can apply TIL.It in some cases, can when the vigor test in the preceding test of infusion, which exists, is more than at least about 70% living cells To apply TIL.It in some cases, can be with when the phenotype test before the infusion in test has at least about 80% CD3 positive Apply TIL.In some cases, it is extremely that test, which carries out the post-stimulatory IFN γ of AntiCD3 McAb to TIL in effect test, before infusion Few about 200pg/mL/10⁵When a cell, TIL can be applied.In some cases, test is surveyed in cell pathology before infusion When the tumour cell in every at least about 200 TIL checked in examination is negative, TIL can be applied.

Disclosed herein is a kind for the treatment of products, and it includes the dosage form with kinds of tumors infiltrating lymphocytes (TIL), institutes Stating tumor infiltrating lymphocyte (TIL) includes at least part of broken of cytokine induction SH2-containing protein (CISH) gene It is bad；And the dosage form of antifungal agent.

Disclosed herein is a kind for the treatment of products, and it includes the synthesis of the folic acid for the amount for being enough to inhibit the fungal infection of subject to press down The dosage form of preparation or nucleic acid crosslinking agent；And the dosage form with kinds of tumors infiltrating lymphocytes (TIL), it is described tumor-infiltrated Property lymphocyte (TIL) include cytokine induction SH2-containing protein (CISH) gene at least part of destruction.

Disclosed herein is a kind for the treatment of products, and it includes the antifungal agents selected from polyenoid, azoles, allyl amine or echinocandin Dosage form；And the dosage form with kinds of tumors infiltrating lymphocytes (TIL), the tumor infiltrating lymphocyte (TIL) At least part of destruction comprising cytokine induction SH2-containing protein (CISH) gene.

Disclosed herein is a kind for the treatment of product, it includes: the dosage form of antifungal agent；The dosage form of immunosuppressor；Antibiotic Dosage form；And the dosage form with kinds of tumors infiltrating lymphocytes (TIL), the tumor infiltrating lymphocyte (TIL) At least part of destruction comprising cytokine induction SH2-containing protein (CISH) gene.In some cases, treatment product can To further include the dosage form of immunosuppressor.Immunosuppressor can be prepared for before applying TIL about 14 days to about It is applied to subject within 24 hours.In some cases, immunosuppressor can be prepared for before applying TIL about 10 days extremely It is applied to subject within about 24 hours.In some cases, immunosuppressor can be prepared for before applying TIL about 7 days It is applied to about 24 hours to subject.In some cases, immunosuppressor includes radiotherapy dose, biological agent or chemical agent. In some cases, immunosuppressor includes chemical agent.In some cases, chemical agent includes at least one below: ring phosphorus Amide, mustargen, Chlorambucil, melphalan, ifosfamide, thio-tepa, hexamethylmelamine, busulfan, fludarabine, Asia Nitrourea, platinum, methotrexate (MTX), imuran, purinethol, procarbazine, Dacarbazine, Temozolomide, Carmustine, Lip river are not Take charge of spit of fland, streptozotocin, fluorouracil, dactinomycin D, anthracycline, mitomycin C, bleomycin and mithramycin.In some feelings Under condition, chemical agent includes cyclophosphamide.In some cases, chemical agent includes fludarabine.In some cases, it can apply About 40mg/kg subject to about 50mg/kg subject cyclophosphamide.In some cases, cyclophosphamide can be through at least about 2 It was applied to subject to about 5 days.In some cases, about 10mg/kg subject can be applied to about 15mg/kg subject's Cyclophosphamide.In some cases, cyclophosphamide can be applied to subject through at least about 7 days to about 10 days.In some cases Under, about 3mg/kg subject can be applied to the cyclophosphamide of about 5mg/kg subject.In some cases, it can apply about 50mg/kg subject to about 80mg/kg subject cyclophosphamide.In some cases, the ring more than 50mg/kg can be applied Phosphamide.In some cases, the cyclophosphamide of about 60mg/kg can be applied.In some cases, about 20mg/ can be applied m²Subject's body surface area is to about 30mg/m²The fludarabine of subject's body surface area.In some cases, it can apply about 25mg/m²The fludarabine of subject's body surface area.In some cases, immunosuppressor generates part or complete immune suppression System.In some cases, the dosage form of antifungal agent can be selected from: polyenoid, azoles, allyl amine and echinocandin.In some cases, Antifungal agent can be azoles.Azoles can be selected from: bifonazole, butoconazole, clotrimazole, econazole, Fenticonazole, Isoconazole, ketoconazole, Luliconazole, Miconazole, Omoconazole, Oxiconazole, Sertaconazole, sulconazole, tioconazole, albaconazole, Chinese mugwort Fluconazole, fluorine Ring azoles, Fluconazole, Chinese mugwort Saperconazole, Itraconazole, posaconazole, propiconazole, ravuconazole, terconazole and voriconazole.One In a little situations, azoles can be Fluconazole.In some cases, Fluconazole can exist with the amount of about 100mg to about 800mg.One In a little situations, Fluconazole can exist with the amount of 400mg.In some cases, the dosage form of antifungal agent can with TIL simultaneously or Sequence is applied.The dosage form of antifungal agent can be applied within the about the 0th day to the about the 4th day after TIL.In some cases, treatment produces Product can further include the dosage form of antibiotic.Antibiotic may include at least one below: bacteria wall targeting agent, cell membrane Targeting agent, bacterial enzyme agent interfering, fungicide, protein synthesis inhibitor and bacteriostatic agent.In some cases, antibiotic includes killing Microbial inoculum.Fungicide can be cephalosporin or quinolone.In some cases, the dosage form of antibiotic can be bacteriostatic agent.Bacteriostatic agent can To be prepared for preventative application.In some cases, bacteriostatic agent can be trimethoprim, sulfamethoxazole or penta Alkane amidine.In some cases, trimethoprim, sulfamethoxazole or pentamidinum can be with about 100mg to about 1000mg Amount exist.In some cases, trimethoprim can exist with the amount of 160mg.In some cases, sulfalene Oxazole can exist with the amount of 800mg.In some cases, pentamidinum can exist with the amount of 300mg.In some cases, Bacteriostatic agent can be applied simultaneously or after TIL before TIL, with TIL.In some cases, bacteriostatic agent can be in the TIL The application before apply within about 6 months after the application to the TIL in about 14 days.In some cases, bacteriostatic agent can It was applied with about 8 days at least 4 days after the TIL before the TIL.Treatment product may further include form of administration.

Treatment product can be formulated by applying in intravenous, oral, intramuscular, peritonaeum or in pleura and apply.In Under some cases, the dosage form of immunosuppressor can be formulated into be applied by infusion.In some cases, cyclophosphamide can be with The dosage of about 60mg/kg is applied, and is diluted in 5% glucose solution of 250ml and was transfused through 1 hour.In some cases Under, fludarabine can be with the 25mg/m in 0.9% sodium chloride of 100ml (USP)²Dosage application, and through about 15 to about 30 points Clock infusion.In some cases, immunostimulant can be to be enough to activate the amount of the TIL in subject to exist.Immunostimulant Including at least one below: vaccine, colony-stimulating agent, interferon, interleukin, virus, antigen, costimulation agent, immunogenicity Agent, immunomodulator and immunotherapeutic agent.In some cases, the dosage form of immunostimulant includes interleukin.Interleukin can be Aldesleukin, and can be applied with about 550,000 to about 800,000IU/kg dosage.In some cases, A Dibai Interleukin can be applied with the dosage of about 720,000IU/kg.In some cases, treatment product may further include be enough it is pre- The dosage form of the infection mitigation agent of the amount of anti-subject's infection.Infection mitigation agent can be herpesviral prophylactic.Herpesviral prevention Agent can be effectively to measure presence to treatment HSV positive subjects.In some cases, herpesviral prophylactic can be to cut down former times Lip river Wei or acyclovir.It in some cases, can be by being lured selected from CRISPR, zinc finger, TALEN and its any combination of system Lead destruction.System can be CRISPR system.CRISPR system may include selected from Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6、Cas7、Cas8、Cas9、Cas10、Csy1、Csy2、Csy3、Cse1、Cse2、Csc1、Csc2、Csa5、Csn2、Csm2、 Csm3、Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、Csb1、Csb2、Csb3、Csx17、Csx14、 Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Cpf1, c2c1, c2c3 and Cas9HiFi Endonuclease.In some cases, endonuclease can be Cas9.Endonuclease can execute destruction.Destruction can wrap Include the exon or introne of gene.In some cases, destroying can be in the exon of gene.In some cases, it destroys It can be in about 20 base-pairs of the preceding region sequence adjacent to motif (PAM).In some cases, destruction can be in preceding region sequence neighbour In about 10 base-pairs of nearly motif (PAM).In some cases, destruction can be in preceding region sequence adjacent to about the 5 of motif (PAM) In a base-pair.In some cases, destruction can before between region sequence adjacent to 3 base-pairs of motif (PAM).In some cases Under, destruction can be in the exon or introne of SEQ ID NO:13.In some cases, destroying can be SEQ ID NO:13's In exon.In some cases, CRISPR system includes instructing polynucleotide.Instruct polynucleotide that can have with SEQ ID NO:68 At least about 60% homology.Destruction may include double-strand break.In some cases, double-strand break occurs in SEQ ID NO:71 Or at SEQ ID NO:77.In some cases, TIL can be with about 1x 10⁹A cell, 3x 10⁹A cell, 1x 10¹⁰It is a thin Born of the same parents, 3x 10¹⁰A cell is to about 1x 10¹¹The amount of a cell exists.In some cases, TIL can be applied through about 30 minutes.In Under some cases, TIL can be applied intravenously.Intravenous application may include infusion.In some cases, treatment product can be into one Step includes carrying out being transfused preceding test to TIL.In some cases, test includes at least one below before infusion: phenotype test, Effect test, microbiological assay, endotoxin test, vigor test and tumour cell test.In some cases, phenotype is tested Presence including detecting the CD3 on the TIL.In some cases, effect test is included in after TIL progress AntiCD3 McAb stimulation It is horizontal to detect IFN γ.In some cases, microbiological assay includes detecting aerobic culture, the growth of anaerobic cultures, leather Flange-like state, fungi state or mycoplasma state.In some cases, endotoxin test includes carrying out horseshoe crab measurement.In some cases Under, vigor test includes carrying out trypan blue to exclude measurement.In some cases, tumour cell test includes that cell pathology is surveyed It is fixed.In some cases, when the microbiological assay in the preceding test of infusion is negative, TIL can be applied.In some feelings Under condition, when the vigor test in the preceding test of infusion, which has, is more than at least about 70% living cells, TIL can be applied.Some In the case of, when the phenotype test in the preceding test of infusion has at least about 80% CD3 positive, TIL can be applied.Before infusion It is at least about 200pg/mL/10 that test, which carries out the post-stimulatory IFN γ of AntiCD3 McAb to TIL in effect test,⁵It, can be with when a cell Apply TIL.In some cases, in every at least about 200 TIL that test checks in cell pathology test before infusion When tumour cell is negative, TIL can be applied.

Disclosed herein is nucleic acid compositions, appointing in the nucleic acid compositions and SEQ ID NO:64 to SEQ ID NO:69 One at least 60% sequence homology.In some cases, sequence homology can at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or up to about 100%.

Disclosed herein is the methods of the patient's condition such as treatment cancer comprising obtains tumor infiltrating lymph from tumor sample Cell (TIL) identifies jump reaction TIL, and with CRISPR nucleases endogenous gene or part thereof.In some cases Under, tumor sample can carry out sequencing analysis.In some cases, sequencing analysis identifies the mutation in tumor sample without identifying Mutation in non-tumor sample.In some cases, sequencing analysis may include full sequencing of extron group, transcript profile is sequenced or it Combination.Sequencing analysis can be full sequencing of extron group.

In some cases, identification may include the antigen presenting cell that TIL is introduced to peptide of the expression comprising mutation (APC).In some cases, identify the TIL that may further include APC of the detection by being introduced in peptide of the expression comprising mutation The presence of secreted interferon gamma (IFN γ).Peptide can have the length of about 15 aggressiveness to about 30 aggressiveness.Peptide can have 25 The length of aggressiveness.In some cases, identification may include introducing TIL to carry out electroporation using the polynucleotide comprising mutation Antigen presenting cell (APC).

In some cases, identify and may further include detection interferon gamma as secreted by the TIL for being introduced in APC The presence of (IFN γ).Destruction may include the double-strand break in the genome of TIL.Double-strand break can pass through CRISPR nucleic acid Enzyme carries out.In some cases, CRISPR nuclease can be selected from Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7、Cas8、Cas9、Cas10、Csy1、Csy2、Csy3、Cse1、Cse2、Csc1、Csc2、Csa5、Csn2、Csm2、Csm3、 Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、Csb1、Csb2、Csb3、Csx17、Csx14、Csx10、 Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Cpf1, c2c1, c2c3 and Cas9HiFi.CRISPR Nuclease can be Cas9.

In some cases, method may further include amplification TIL.TIL can be people TIL.Method can be wrapped further It includes to subject and applies antifungal agent.Method may further include to subject's administration of antibiotics.

Disclosed herein is the methods for the human primary gastrointestinal cancers for treating subject in need comprising from the stomach of subject in need Intestinal tumor sample obtains tumor infiltrating lymphocyte (TIL), identifies jump reaction TIL, with CRISPR nucleases institute The CISH gene in jump reaction TIL is stated, and the TIL is expanded to 1x10⁹To about 2x 10¹¹Dosage；Wherein to institute Stating stomach and intestine tumor sample progress sequencing of extron group may be not present with identifying to be present in the tumor sample in health tissues sample Mutation in product, and wherein the identification include antigen presenting cell (APC) surface on present the mutation and by institute APC is stated to be cultivated together with the TIL to detect the level of IFN-γ.In some cases, presentation may include will using comprising The antigen presenting cell (APC) that the polynucleotide of mutation carries out electroporation is cultivated together with TIL.In some cases, presentation can be with Including will be cultivated together with TIL with the antigen presenting cell (APC) of the peptide pulse comprising mutation.Cell factor can be anti-in mutation It detects in answering property TIL, and can't detect in not mutated reactivity TIL.Compared in not mutated reactivity TIL, dashing forward Becoming in reactivity TIL can detecte higher levels of cell factor.CRISPR nuclease can be Cas9.TIL can be T cell.

Detailed description of the invention

Novel feature of the invention is specifically described in appended claims.By reference to below to utilization original of the invention The detailed description and attached drawing that the illustrative embodiment of reason is illustrated will be obtained to the more preferable of the features and advantages of the present invention Understand, in the drawings:

Fig. 1 shows the structure of four kinds of plasmids, including Cas9 nuclease plasmid, HPRT gRNA plasmid, Amaxa EGFPmax plasmid and HPRT targeting vector.

Fig. 2 shows the gene modification percentages occurred by CRISPR gRNA in potential target site.

Fig. 3 shows the DSB of the induction of the CRISPR in the T cell through stimulating.

Fig. 4 A and Fig. 4 B show the 6th day PD-1, CTLA-4, PD-1 and CTLA-2 after being transfected with guide RNA, or The expression of CCR5, PD-1 and CTLA-4.Representativeness instructs object: PD-1 (P2, P6, P2/6), CTLA-4 (C2, C3, C2/3) or CCR5(CC2).A. Inhibitory receptor expression percentage is shown.B. it shows and inhibits relative to the normalization of control guide RNA Property expression of receptor.

Fig. 5 A show be unstained and without instruct object compare compared with, using CRISPR and CTLA-4 specificity guide RNA CTLA-4 expression after (instruct object #2 and instruct object #3) progress electroporation in primary human T-Cells.Fig. 5 B shows and is unstained With without instructing object control to compare, electricity is carried out using CRISPR and PD-1 specificity guide RNA (instruct object #2 and instruct object #6) and is worn PD-1 expression behind hole in primary human T-Cells.

Fig. 6 shows the primary human T-Cells after carrying out electroporation using CRISPR and multiple CTLA-4 and PD-1 guide RNA The FACS result of middle CTLA-4 and PD-1 expression.

Fig. 7 A and Fig. 7 B are shown handled with CRISPR after double knockout percentages in primary human T-Cells.Fig. 7 A is shown Compared with only Zap, only Cas9 and all guide RNAs compare, object #2, CTLA-4 is instructed to instruct object #3, CTLA-4 with CTLA-4 The T for instructing object #2 and #3, PD-1 to instruct object #2 and CTLA-4 that object #2, PD-1 is instructed to instruct object #6 and CTLA-4 that object #3 is instructed to handle CTLA-4 in cell knocks out percentage.Fig. 7 B is shown compared with only Zap, only Cas9 and all guide RNAs compare, and is used PD-1 instructs object #2, PD-1 that object #6, PD-1 is instructed to instruct object #2 and #6, PD-1 that object #2 and CTLA-4 is instructed to instruct object #2, PD-1 The PD-1 in T cell for instructing object #6 and CTLA-4 that object #3 is instructed to handle knocks out percentage.

Fig. 8 shows using CRISPR and there is guide RNA of specificity or combinations thereof progress electricity to wear CTLA-4, PD-1 T cell vigor behind hole.

Fig. 9 is CEL-I measurement as a result, showing in only introducing PD-1 guide RNA, introducing PD-1 and CTLA-4 guidance RNA, or introduce CCR5, PD-1 and CLTA-4 guide RNA, only Zap or only gRNA as control under conditions of, instructed by PD-1 The cutting that RNA#2, #6, #2 and #6 are carried out.

Figure 10 is CEL-I measurement as a result, showing in only introducing CTLA-4 guide RNA, introducing PD-1 and CTLA-4 refers to It leads RNA, or introduces CCR5, PD-1 and CLTA-4 guide RNA, and under conditions of using only Zap or only gRNA is as compareing, by The cutting that CTLA-4 guide RNA #2, #3, #2 and #3 are carried out.

Figure 11 be CEL-I measurement as a result, show with only Zap, only Cas 9 or only guide RNA control compared with, introducing Under conditions of CCR5 guide RNA and CCR5 guide RNA, PD-1 guide RNA or CTLA-4 guide RNA, by CCR5 guide RNA #2 The cutting of progress.

Figure 12 is shown as measured, having 2 ' O- methyl RNAs using 5 micrograms and 10 micrograms by CD3FACS expression TCR α of the optimization CRISPR guide RNA of modification in primary human T-Cells is knocked out.

Figure 13 depicts the method that T cell vigor and phenotype are measured after being handled with CRISPR and CTLA-4 guide RNA.It is logical Cross frequency (frequency normalization relative to the control of independent electroporation) progress through handling cell to normal FSC/SSC spectrum is shown It is quantitative to measure phenotype.Intragroup cell is also gated by FSC/SSC, vigor is measured to the dye of refusing of viability dye.Pass through CD3 and CD62L measures T cell phenotype.

It is thin that Figure 14 shows the measurement T after with CRISPR and PD-1 guide RNA and the processing of PD-1 and CTLA-4 guide RNA The method of born of the same parents' vigor and phenotype.By the frequency through handling cell to display normal FSC/SSC spectrum (relative to independent electroporation The frequency normalization of control) quantitatively measure phenotype.Intragroup cell is also gated to viability dye by FSC/SSC Dye is refused to measure vigor.T cell phenotype is measured by CD3 and CD62L.

Figure 15 is shown after PD-1 the or CTLA-4 guide RNA transfection with primary human T-Cells and Jurkat control the 4th day Detect the result of the T7E1 measurement of CRISPR gene editing.NN compares for no T7E1 nuclease.

Figure 16 shows the result by decomposing tracking insertion and deletion (TIDE) analysis.Show PD-1 and CTLA-4 guidance The gene editing Percent efficiency of RNA.

Figure 17 shows the results by decomposing tracking insertion and deletion (TIDE) analysis for single guidance transfection.For with The primary human T-Cells of PD-1 or CTLA-1 guide RNA and CRISPR transfection show the percentage of the sequence with missing or insertion Than.

Figure 18 shows the PD-1 sequence deletion with double targetings.

Figure 19 shows the sequencing result of the PCR product of the PD-1 sequence deletion with double targetings.Show that sample 6 and 14 has There are two the fusions of gRNA sequence, and 135bp therebetween is removed.

Figure 20 shows double targeting sequence deletions of CTLA-4.Missing between two guide RNA sequences exists in double In the sequencing of guidance targeting CTLA-4 (sample 9 and 14).T7E1 measurement confirms missing by PCR.

Figure 21 A and Figure 21 B are shown with CTLA-4 positive human T-cell after anti-CTLA-4 guide RNA and CRISPR transfection CTLA-4FACS analysis.B. it shows and is shone in human T-cell relative to pulse pair after being transfected with anti-CTLA-4 guide RNA and CRISPR CTLA-4 knock out efficiency.

Figure 22 depicts the sgRNA of the modification for CISH, PD-1, CTLA4 and AAVS1.

Figure 23 A, which is shown, expresses percentage with the PD-1 after anti-PD-1CRISPR system transfections.Figure 23 B show with only The PD-1 that Cas9 control is compared knocks out Percent efficiency.

Figure 24 depicts the FACS of the CTLA-4 dyeing human T-cell of use by oneself CRISPR and the transfection of anti-CTLA-4 guide RNA The quantitative data of analysis.The 6th day CTLA-4 expresses percentage and knocks out the data of percentage after showing transfection.

Figure 25 shows the facs analysis of the PD-1 dyeing human T-cell with CRISPR and the transfection of anti-PD-1 guide RNA.It shows After transfection the 14th day PD-1 expression (anti-human CD279PerCP-Cy5.5) data.

Figure 26 is shown compared with only Cas9 control, with the PD-1 for the human T-cell that CRISPR and anti-PD-1 guide RNA transfect It expresses percentage and PD-1 knocks out percentage.

Figure 27 shows the 14th day cytometer of the human T-cell with CRISPR, anti-CTLA-4 and the transfection of anti-PD-1 guide RNA Several and vigor.

Figure 28 is shown with CRISPR, and only anti-PD-1 instructs object #2, anti-PD-1 to instruct object #2 and #6, or only resists CTLA-4 instructs the FACS data of the 14th day human T-cell after object #3 electroporation.Will engineering T cell stimulate again 48 hours to comment Estimate the expression of CTLA-4 and PD-1, and is compared with the control cell of unused guide RNA electroporation.

Figure 29, which is shown, instructs object #2 and #3 with CRISPR and anti-CTLA-4, and anti-PD-1 instructs object #2 and anti-CTLA-4 14th day human T-cell after instructing object #3 or anti-PD-1 that object #2 and #6, anti-CTLA-4 is instructed to instruct object #3 and #2 electroporation FACS data.Engineering T cell is stimulated into the expression to assess CTLA-4 and PD-1 in 48 hours again, and electric with unused guide RNA The control cell of perforation is compared.

Figure 30 depicts the gene modification of the CRISPR mediation for the CISH locus in primary human T-Cells Surveyor measurement result.

Figure 31 shows somatic mutation load to be changed between each tumor type.Tumour-specific neoantigen generates and is in It is now theoretically directly proportional to mutational load.

Figure 32, which is shown, to modify pseudouridine-the 5 '-triphosphoric acid and 5- methylcytidine -5- triphosphoric acid that nucleic acid carries out.

Figure 33 depicts the analysis of density measurement with the 293T cell transfected of CRISPR and CISH gRNA 1,3,4,5 or 6 Repetition experiment.

Figure 34 A and Figure 34 B show the repetition TIDE analysis of CISH gRNA 1.

Figure 35 A and Figure 35 B show the repetition TIDE analysis of CISH gRNA 3.

Figure 36 A and Figure 36 B show the repetition TIDE analysis of CISH gRNA 4.

Figure 37 A and Figure 37 B show the repetition TIDE analysis of CISH gRNA 5.

Figure 38 A and Figure 38 B show the repetition TIDE analysis of CISH gRNA 6.

Figure 39 shows the Western blotting for being shown in CISH loss of proteins after CRISPR knockout in primary T cells.

Figure 40 A and Figure 40 B show the absolute cell count of people TIL stimulation front and back.Figure 40 A is shown in RPMI culture medium Or the first donorcells before and after the stimulation cultivated in vitro culture base count.Figure 40 B is shown to be cultivated in RPMI culture medium Stimulation before and after the second donorcells count.

Figure 41 A and Figure 41 B show the human tumour infiltration that electroporation is carried out with the CRISPR system of targeting PD-1 locus Property lymphocyte (TIL) or control cell cell amplification.Figure 41 A shows amplification when adding self feeder cells, or Figure 41 B shows amplification when being not added with self feeder cells.

Figure 42 depicts the generation of the TIL of CISH KO TIL proleulzin amplification, by AntiCD3 McAb with immobilization and Soluble anti-CD28 is incubated stimulate over 4 days together.At the 0th day, collects TIL and deliver targeting CISH's by electroporation CRISPR/Cas9 reagent.It, will be through repairing in the presence of the peripheral blood mononuclear cells feeder cells and IL-2 through irradiating after electroporation The TIL of decorations is transferred to G-Rex flask, for subsequent rapid amplifying.During first time cell count and (+) 7 days after When being commissioned to train feeding, the relatively small aliquot of cell is collected to determine insertion/deletion (insertion and deletion) frequency by being sequenced.Then (+) 14 days harvest TIL obtain sample at this time and carry out quality control evaluation, and then prepare bag (infusion-ready in infusion Bag freezen protective in).

Figure 43 A, Figure 43 B and Figure 43 C depict the TiDE analysis of the edited CISH locus of CRISPR/Cas9.Rapid amplifying After 14 days, separates and carry out PCR on genomic DNA and CRISPR target region in PDCD1 and CISH.It is subjected to PCR amplification TiDE analysis.The sum frequency of insertion and deletion, and the distribution of insertion and missing are illustrated, which is based on subject PV1, PV2 With lost in PV3 or obtain insertion and missing size (in terms of base-pair).

Figure 44 is depicted after the CRISPR/Cas9 for subject PV1, PV2 and PV3 is edited, CISH locus The summary of TiDE analysis.

Figure 45 A and Figure 45 B show the loss of CISH protein expression after CRISPR/Cas9 is edited.14 days after electroporation, then It stimulates PB T cell and TIL 48 hours to induce CISH to express, or it is not stimulated again.Control indicates that cell does not receive CRISPR/Cas9 component.Cas9+gRNA indicates to receive Cas9mRNA and the exon 3 designed for targeting CISH locus The cell of gRNA.

Figure 46 A, Figure 46 B and Figure 46 C show the growth of T cell and vigor after CRISPR is edited.Figure 46 A shows electricity and wears 6 days vigor of Kong Hou.Figure 46 B shows the 12nd day after electroporation total cell number, is initiated with 3x10⁶A cell.Cell= Without operation；ZAP=only electroporation.Figure 46 C shows the total cell number in normal structure culture bottle through 11 days TIL, and every kind Condition is initiated with 3x10⁶A cell.

Figure 47 A and Figure 47 B show the SPICE figure that cell factor generates in the T cell and TIL that CRISPR/Cas9 is edited. 14 days after electroporation, the AntiCD3 McAb and soluble anti-CD28 antibody combined using plate stimulates T cell and TIL again, and passes through cell Interior dyeing measures cytokine production with flow cytometry.

Figure 48 A depicts the loss of PD-1 protein expression after CRISPR/Cas9 is edited.14 days after electroporation, then stimulate outer All blood T cells or TIL 72 hours induce PD-1 to express.PD-1 is expressed in the T cell stimulated again.Figure 48 B is shown to be pierced again PD-1 expression in sharp TIL.Percent loss is indicated with red.

Figure 49 shows the absolute cell numbers of control and the tumor infiltrating lymphocyte through CISH modification.

Figure 50 A shows the control cultivated there are IL-2 at the 7th day and CISH knocks out TIL.Figure 50 B is shown The control cultivated at the 7th day in the case where IL-2 is not present and CISH knock out TIL.

Figure 51 A shows the site of missing the target of PDCD1.Figure 51 B shows the CISH gRNA identified by GUIDE-Seq.

Figure 52 shows the frequency of the targeting insertion and deletion at the CISH locus through GUIDE-Seq and GMP PQ manufacture operation Rate (ns, P=0.93).

Specific embodiment

It is described below and embodiment of the present invention is set forth in detail with embodiment.It should be appreciated that the present invention is not limited to herein The specific embodiment, and therefore can change.It would be recognized by those skilled in the art that there are many variations by the present invention And modification, it includes within the scope of the invention.

Definition

It is related to the term " about " of referential data and its grammer equivalent item as used herein and its grammer equivalent item may include From the value plus or minus 10% numberical range.For example, the amount of " about 10 " includes 9 to 11 amount.It is related to the art of referential data Language " about " may also include the numerical value from the value plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% Range.

Term " activation (activation) " as used herein and its grammer equivalent item can instigate cell to be transformed into from dormant state The process of active state.The process may include that response to antigen, the phenotype of migration and/or function activation state or heredity change Become.For example, term " activation (activation) " can refer to the step-by-step procedure of t cell activation.For example, T cell may need at least two letters Number, to become to activate completely.First signal can occur after TCR is combined by antigen -- MHC complex, and second signal can lead to Cross costimulatory molecules in conjunction with and occur.In vitro, the first signal of AntiCD3 McAb analog, and anti-CD28 analog second signal.

Term " neighbouring (adjacent) " as used herein and its grammer equivalent item can refer to just beside references object.Example Such as, term neighbouring (adjacent) can refer to therebetween without any nucleotide under the context of nucleotide sequence.For example, polynucleotides A It is adjacent with polynucleotides B (neighbouring) to can refer between A and B without the AB of any nucleotide.

Term " antigen " as used herein and its grammer equivalent item can refer to containing can be combined by one or more receptors One or more epitopes molecule.For example, antigen the immune system of stimulation of host can generate cellular antigens spy when being rendered Specific immunological response, or can produce humoral antibody response.Antigen can also have through itself or exist in conjunction with another molecule The ability of Shi Yinfa cell and/or humoral response.For example, tumor-cell antigen can be identified by TCR.Antigen such as neoantigen may be with The tumour of high mutational load is related, Figure 31.

Term " epitope " as used herein and its grammer equivalent item can refer to can be by antibody, B cell, T cell or engineering Change a part of the antigen of cell recognition.For example, epitope can be the cancer epitope identified by TCR.Multiple epitopes in antigen It can also be identified.Epitope can also be mutation.

Term " self " as used herein and its grammer equivalent item can refer to from identical organism.For example, can incite somebody to action Sample (for example, cell) removal, processing, and identical subject (for example, patient) is returned in the subsequent time.Autologous procedure Different from allogeneic process, during allogeneic, donor and recipient are different subject.

Term " cancer " as used herein and its grammer equivalent item, which can refer to its unique property (losing normal control), to be caused The growth not adjusted, the cell hyperproliferation for lacking differentiation, local organization invasion and shifting.For method of the invention, cancer Disease can be any cancer, including below any: acute lymphoblastic cancer, acute myeloid leukaemia, acinus shape striated muscle Sarcoma, bladder cancer, osteocarcinoma, the cancer of the brain, breast cancer, cancer of anus, carcinoma of anal canal, the carcinoma of the rectum, cancer eye, intrahepatic cholangiocarcinoma, arthrocarcinoma, neck Cancer, gallbladder cancer or pleura and cancer, rhinocarcinoma, CARCINOMA OF THE NASAL CAVITY or cancer of middle ear, carcinoma of mouth, carcinoma of vulva, chronic lymphocytic leukemia, chronic bone Marrow cancer, colon cancer, the cancer of the esophagus, cervical carcinoma, fibrosarcoma, human primary gastrointestinal cancers, Hodgkin lymphoma, hypopharyngeal cancer, kidney, laryngocarcinoma, white blood Disease, liquid tumors, liver cancer, lung cancer, lymthoma, malignant mesothelioma, mastocytoma, melanoma, Huppert's disease, nasopharynx Cancer, non-Hodgkin lymphoma, oophoroma, cancer of pancreas, peritoneal cancer, nethike embrane cancer and mesenterium cancer, pharynx cancer, prostate cancer, the carcinoma of the rectum, Kidney, cutaneum carcinoma, carcinoma of small intestine, soft tissue cancer, solid tumor, gastric cancer, carcinoma of testis, thyroid cancer, carcinoma of ureter and/or urine bladder Cancer.As used herein, term " tumour " refers to, for example, the misgrowth of the cell or tissue of malignant class or benign classes.

Term " cancer neoantigen " or " neoantigen " or " new epitope " as used herein and its grammer equivalent item can refer to not The antigen encoded in normal unmutated host genome.In some cases, " neoantigen " can be represented since body cell is prominent The oncogenic virus albumen or paraprotein for becoming and generating.For example, neoantigen can pass through the cell mechanism via virus protein activities It destroys and generates.Another example can be the exposure of carcinogenic compound, and it is thin which can lead to body in some cases Cytoplasmic process becomes.This somatic mutation finally can lead to the formation of lesion/cancer disease.

Term " cytotoxicity " as used in this specification refers to unexpected or undesirable under the normal condition of cell Change.The normal condition of cell can refer to present or exist before cell is exposed to cytotoxic composition, medicament and/or condition State.In general, the cell in normal condition is the cell in stable state.Cell normal condition it is unexpected or undesirable Changing can be complete with such as cell death (for example, apoptosis), the reduction for replicating potential, cell integrity such as film The reduction of property, the reduction of metabolic activity, the reduction of developmental potency or any cytotoxic effect disclosed herein form It presents.

Phrase " reducing cytotoxicity " or " reducing cytotoxicity " refer to that cell is exposed to cytotoxic composition, medicament And/or after condition, the reduction of the degree or frequency of the unexpected or undesirable change of cell normal condition.The phrase can refer to reduce The cytotoxicity degree being exposed in the individual cells of cytotoxic composition, medicament and/or condition, or refer to that cell is worked as in reduction The cell number of cytotoxicity is presented when group is exposed to cytotoxic composition, medicament and/or condition in group.

Term " engineering " as used herein and its grammer equivalent item can refer to nucleic acid, for example, in organism genome The one or more of nucleic acid change.Term " engineering " can refer to the change, addition and/or missing of gene.Being engineered cell can also Refer to the cell with addition, missing and/or the gene changed.

Term " cell " as used herein or " being engineered cell " and its grammer equivalent item can refer to people or non-human animal comes The cell in source.

Term " checking point gene " as used herein and its grammer equivalent item can refer to participate in process of inhibition (for example, feedback Ring) any gene, which, which plays, adjusts immune response (for example, reducing the immunosupress of the uncontrolled propagation of harmful response Property feedback loop) amplitude effect.These responses may include facilitating molecular barriers, which prevents may be for infection Immune response and/or maintain periphery self tolerance during occur collateral tissue damage.Check the non-limiting of point gene Example may include the CD28 receptor family member extended and its ligand and participate in the gene of co-suppression approach (for example, CTLA-4 And PD-1).Term " checking point gene " also can refer to immunologic test point gene.

" CRISPR ", " CRISPR system " or " CRISPR nucleic acid enzyme system " and its grammer equivalent item may include and DNA with And has the function of the non-coding RNA point that the Cas albumen (for example, Cas9) of nuclease (for example, two nuclease domains) combines Sub (for example, guide RNA).See, for example, Sander, J.D. et al., " CRISPR-Cas systems for editing, regulating and targeting genomes,"Nature Biotechnology,32:347–355(2014)；Also join See for example, Hsu, P.D. et al., " Development and applications of CRISPR-Cas9for genome engineering,”Cell 157(6):1262-1278(2014)。

Term " destruction " as used herein and its grammer equivalent item can refer to for example by cutting, deletion, insertion, mutation, It resets or any combination thereof and changes the process of gene.It destroys the knockout that can lead to protein expression or strikes low.Knockout can be It knocks out completely or partially.For example, gene can be destroyed and knocking out or striking low.Destroying gene partially can reduce or completely inhibit By the expression of the protein of the coded by said gene.Different genes can also be caused by destroying gene, for example, the activation of downstream gene.In Under some cases, term " destruction " can be used interchangeably with terms such as inhibition, interruption or engineering.

Term " function " as used herein and its grammer equivalent item can refer to execute, have or serve the energy of expected purpose Power.Function may include any percentage of 100% from baseline to normal function.For example, function may include or including about normal Function 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% and/or 100%.In some cases, term function can refer to be more than or more than about just The 100% of Chang Gongneng, for example, the 125% of normal function, 150%, 175%, 200%, 250%, 300% and/or more than.

Term " gene editing " as used herein and its grammer equivalent item can refer to insertion, replace or remove one from genome The genetic engineering of a or multiple nucleotide.It can be used nuclease (for example, naturally occurring nuclease or artificial reconstructed nucleic acid Enzyme) carry out gene editing.

Term " mutation " as used herein and its grammer equivalent item may include one or more nucleotide in polynucleotides Displacement, missing and insertion.For example, in polynucleotides (cDNA, gene) or polypeptide sequence at most 1,2,3,4,5,6,7,8, 9,10,11,12,13,14,15,20,25,30,40,50 or more nucleotide/amino acid can be replaced, delete and/or insert Enter.Mutation can influence gene or the coded sequence of its regulating and controlling sequence.Mutation can also influence the structure or coded of genome sequence MRNA structure/stability.

Term " non-human animal " as used herein and its grammer equivalent item may include all animal species in addition to a person, Including non-human mammal, natural animal or genetic modification non-human animal can be.Term " nucleic acid ", " polynucleotides ", " more Nucleic acid " and " oligonucleotides " and its grammer equivalent item are used interchangeably, and can refer to linear or cyclic conformation and to be single-stranded or The deoxyribonucleotide or ribonucleotide polymer of double-stranded form.For the purpose of present disclosure, these terms are not answered It is interpreted the limitation about length.These terms can also cover the analog of natural nucleotide and in base, sugar and/or phosphorus The nucleotide modified in acid moieties (for example, phosphorothioate backbone).The modification of these terms can also cover demethylation, The addition of the addition of CpG methylation, the removal of bacterium methylation and/or mammal methylation.In general, the class of specific nucleotide It can base pairing having the same specificity like object, that is, the analog of A can carry out base pairing with T.

Term " peripheral blood lymphocytes " (PBL) as used herein and its grammer equivalent item can refer in blood (for example, outer All blood) in recycle lymphocyte.Peripheral blood lymphocytes can refer to the indefinite lymphocyte positioned at organ.Peripheral blood lymphocytes It may include T cell, NK cell, B cell or any combination thereof.

Term " phenotype " as used herein and its grammer equivalent item can refer to the observable characteristic or characteristic of organism, such as it Form, development, biochemistry or physiological property, phenology, behavior and behavior product combination.According to context, term " phenotype " sometimes may be used Refer to the combination of the observable characteristic or characteristic of group.

Term " preceding region sequence " as used herein and its grammer equivalent item can refer to a part of guide RNA such as The intervening sequence of guide RNA or the PAM of engineering targeting moiety hybridization are adjacent to nucleic acid sequence.Region sequence can be and be instructed between preceding RNA target to gene, genome or intrachromosomal nucleotide sequence.Under native state, preceding region sequence and PAM are (between preceding Region sequence is adjacent to motif) it is adjacent.The site cut by the nuclease of RNA guidance is in preceding region sequence.For example, working as guide RNA Between before targeting is specific when region sequence, Cas albumen will generate double-strand break in preceding region sequence, to cut the area Qian Jian sequence Column.After dicing, the destruction of preceding region sequence can lead to the reparation of non-homologous end joining (NHEJ) or homology guidance (HDR).Between preceding the destruction of region sequence can lead to it is preceding between region sequence missing.Additionally or in the alternative, the destruction of preceding region sequence can Between before causing exogenous nucleic acid sequences to be inserted into region sequence or replace before between region sequence.

Term " recipient " as used herein and its grammer equivalent item can refer to people or non-human animal.Recipient is also possible to Recipient in need.

Term " recombination " as used herein and its grammer equivalent item can refer to what hereditary information between two polynucleotides exchanged Process.For the purpose of present disclosure, " homologous recombination " or " HR " can refer to for example occur during double-strand break reparation It is such heredity exchange particular form.The process may need nucleotide sequence homology, for example, being carried out using donor molecule The template reparation of target molecule (for example, molecule of experience double-strand break), and sometimes referred to as non-crossing transcription frequency or short distance (short tract) transcription frequency.Such transfer may also refer to the heteroduplex formed between the target and donor of destruction The mispairing of DNA corrects, and/or (wherein donor can be used for recombining a part that can become target for the chain annealing of dependence synthesis Hereditary information) and/or correlated process.Such specific HR usually can lead to the change of target molecule sequence, so that donor is more Some or all of nucleotide sequence can be integrated into target polynucleotide.In some cases, term " recombination arm " and " homologous Arm " is used interchangeably.

Term " targeting vector " and " targeting vector " are used interchangeably herein.

Term " T cell " as used herein and its grammer equivalent item can refer to the T cell from any source.For example, T is thin Born of the same parents can be primary T cells, for example, Autologous T cells, cell line etc..T cell is also possible to the mankind or non-human T cell.

Term " TIL " or tumor infiltrating lymphocyte as used herein and its grammer equivalent item can refer to separate from tumour Cell.For example, TIL can be the cell for moving to tumour.TIL is also possible to infiltrate the cell of tumour.TIL can be Any cell found in tumour.For example, TIL can be T cell, B cell, monocyte, natural kill (NK) cell or its Any combination.TIL can be the cell colony of mixing.TIL group may include not isophenic cell, different differentiation degree it is thin Born of the same parents, the cell of different pedigrees or any combination thereof.

If the patient's condition treated changes, it is likely to occur " therapeutic effect ".The variation can be positive or disappear Pole.For example, " good effect " can correspond to the increase of the T cell number activated in subject.In another example, " disappear Pole effect " can correspond to the reduction of the amount or size of tumour in subject.If improving at least 10%, preferably at least 25%, more Preferably at least 50%, even more desirably at least 75%, and most preferably 100%, then there is " variation " of the treated patient's condition.It should Variation can be based on the improvement of the severity of the treated patient's condition of individual, or being based on (should with and without therapeutic composition Therapeutic composition and composition of the invention are administered in combination) difference on the frequency of the patient's condition that improves in the population of individuals treated It is different.Similarly, the method for present disclosure may include the cell to the amount of subject's application " treatment is effective "." treatment has term Effect " it should be understood to the definition corresponded to " with therapeutic effect ".

Term " safe port (safe harbor) " as used herein and " immune safe port (immune safe Harbor) " and its grammer equivalent item can refer to can be used for integrating the position in the genome of exogenous nucleic acid, and wherein the integration will not lead to It crosses individually addition nucleic acid and any significant impact is caused to the growth of host cell.The non-limiting example of safe port may include HPRT, AAVS SITE (for example, AAVS1, AAVS2 etc.), CCR5 or Rosa26.

Term " sequence " as used herein and its grammer equivalent item can refer to nucleotide sequence, which can be DNA or RNA；It can be linear, cricoid or branch；And it can be single-stranded or double-strand.Sequence can be mutated.Sequence Column can be any length, for example, 2 to 1, the length of 000,000 or more nucleotide (or in-between or more than it Any integer value), for example, about 100 to about 10,000 nucleotide, or about 200 to about 500 nucleotide.

It summarizes

Disclosed herein is the compositions and method for treating disease or the patient's condition such as cancer.There is disclosed herein for treating The therapeutic scheme of various diseases or the patient's condition such as cancer.Therapeutic scheme may include the cell for applying genetic modification, such as tumor-infiltrated Property lymphocyte, be used for treatment use.Immunotherapy (ACT) effectively based on adoptive cellular transfer can be used for treating cancer (for example, metastatic cancer) patient.For example, tumor infiltrating lymphocyte can be modified to destroy immunologic test point gene.

Cell

Compositions disclosed herein can use cell.Cell can be primary cell.Cell can be recombinant cell.It can be from perhaps Mostly non-limiting source obtains cell, which includes peripheral blood mononuclear cells, marrow, lymph node tissue, umbilical cord Blood, thymic tissue, the tissue from infection site, ascites, pleural effusion, spleen tissue and tumour.For example, any T can be used Cell line.Alternatively, cell can derive from healthy donors, be diagnosed with the patient of cancer or be diagnosed with the patient of infection. In another embodiment, cell can be a part that the mixed cell population of different phenotypic characteristics is presented.It can also be from thin Born of the same parents treat library (bank) and obtain cell.The cell of the destruction resistant to immunosuppressive therapy can be obtained.It can also repair Desired cell colony is selected before decorations.Selection may include at least one of the following: Magneto separate, resists flow cytometry selection Raw element selection.The one or more cell can be any haemocyte, such as peripheral blood mononuclear cells (PBMC), lymphocyte, list Nucleus or macrophage.The one or more cell can be any immunocyte, such as lymphocyte, B cell or T cell. Cell can also be obtained from the tumor sample of wholefood, single blood sampling ingredient art or subject.Cell can be tumor-infiltrated Property lymphocyte (TIL).In some cases, single blood sampling ingredient art can be Leukapheresis.Leukapheresis can be with It is the process of the washed corpuscles from blood.During Leukapheresis, it can be pipetted from the syringe needle in the arm of subject Blood is recycled by the machine that whole blood is divided into red blood cell, blood plasma and lymphocyte, then by another arm Syringe needle makes blood plasma and red blood cell return to subject.In some cases, cell is separated after application therapeutic scheme and cell therapy. For example, single blood sampling ingredient art can be carried out with cell order of administration or simultaneously.In some cases, dosed cells product it The single blood sampling ingredient art of preceding and progress in about 6 weeks later.In some cases, -3 weeks, -2 weeks, -1 after dosed cells product Week, 0 week, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years or the single blood sampling ingredient of progress in up to 10 years Art.In some cases, it can carry out releasing about Specific lytic, cell factor by the cell that single blood sampling ingredient art obtains Put, metabolism group research, bioenergetics research, cell factor generate intracellular FAC, ELISA spot measurement and lymphocyte The test of subgroup analysis.In some cases, it can be used with the sample of Cell Cryopreservation product or single blood sampling ingredient art product In the retrospective analysis of infused cells phenotype and function.

TIL can be separated from suffering from cancered organ.It can be separated from the organ with cancer one or more thin Born of the same parents, the organ can for brain, heart, lung, eye, stomach, pancreas, kidney, liver, intestines, uterus, bladder, skin, hair, nail, ear, body of gland, Nose, mouth, lip, spleen, gum, tooth, tongue, salivary gland, tonsillotome, pharynx, oesophagus, large intestine, small intestine, rectum, anus, first shape Gland, thymus gland, bone, cartilage, tendon, ligament, adrenal capsule, skeletal muscle, smooth muscle, blood vessel, blood, spinal cord, tracheae, urine output Pipe, urethra, hypothalamus, hypophysis, pylorus, adrenal gland, ovary, fallopian tubal, uterus, vagina, mammary gland, testis, seminal vesicle, penis, leaching Bar, lymph node or lymphatic vessel.One or more TIL may be from brain, heart, liver, skin, intestines, lung, kidney, eye, small intestine or pancreas. TIL may be from pancreas, kidney, eye, liver, small intestine, lung or heart.TIL may be from pancreas.One or more cells can be thin for pancreas islet Born of the same parents, for example, pancreatic beta cell.In some cases, TIL may be from human primary gastrointestinal cancers.TIL culture can be prepared in several ways.Example Such as, tumour and non-cancer tissue or necrotic zone trimming can be opened.It then can be about 2-3mm at length by lesion segmentation.Some In the case of, it can be 0.5mm to about 5mm, about 1mm to about 2mm, about 2mm to about 3mm, about 3mm to about at size by lesion segmentation 4mm or about 4mm are to about 5mm.Then culture medium and cell stimulatory agents such as cell factor be can use and cultivate tumor fragment in vitro. In some cases, IL-2 can be used for expanding the TIL from tumor fragment.The concentration of IL-2 can be about 6000IU/mL.IL-2's Concentration also can be about 2000IU/mL, 3000IU/mL, 4000IU/mL, 5000IU/mL, 6000IU/mL, 7000IU/mL, 8000IU/mL, 9000IU/mL or up to about 10000IU/mL.Once TIL is amplified, then it can be carried out external test with Determine tumor response.For example, CD3, CD4, CD8 and CD58 expression of TIL can be assessed by FACS.It can also make TIL It is subjected to co-cultivation, cytotoxicity assay, ELISA measurement or ELISPOT measurement.In some cases, TIL culture can freeze Save or undergo rapid amplifying.Can include but is not limited to from the donor separation cell such as TIL in certain stage of development, the stage Embryo, newborn, youth and adult phase.TIL can be separated from adult.It can be with the age of its point of cellifugal people 10,9,8,7,6,5,4,3,2 or 1 years old or less.For example, can at 6 years old, people below separates cell from the age.It can also be from the age People's separation cell such as TIL below at 3 years old.In some cases, non-human donor can be the age as at least about 18 years old adult People.It in some cases, can be with storing blood product.Bag is frozen it is, for example, possible to use cryostore to store and frozen blood Product.

In some cases, the cell that can be used for the cell of cell therapy or can be destroyed by genome can for the given factor It is positive or negative.In some embodiments, it is thin to can be CD3+ cell, CD3- cell, CD5+ cell, CD5- for cell Born of the same parents, CD7+ cell, CD7- cell, CD14+ cell, CD14- cell, CD8+ cell, CD8- cell, CD103+ cell, CD103- Cell, CD11b+ cell, CD11b- cell, BDCA1+ cell, BDCA1- cell, L- selection albumen+cell, L- select albumen- Cell, CD25+, CD25- cell, CD27+, CD27- cell, CD28+ cell, CD28- cell, CD44+ cell, CD44- cell, CD56+ cell, CD56- cell, CD57+ cell, CD57- cell, CD62L+ cell, CD62L- cell, CD69+ cell, CD69- Cell, CD45RO+ cell, CD45RO- cell, CD127+ cell, CD127- cell, CD132+ cell, CD132- cell, IL-7 + cell, IL-7- cell, IL-15+ cell, IL-15- cell, agglutinin receptor G1 positive cell, agglutinin receptor G1 yin Property cell or its differentiation or dedifferente cell.It is not intended to limit by the example of the factor of cell expression, and art technology Personnel will be understood that cell can be any factor known in the art positive or negative.In some embodiments, Cell can be the positive for two or more factors.For example, cell can be CD4+ and CD8+.In some embodiments In, cell can be feminine gender for two or more factors.For example, cell can be CD25-, CD44- and CD69-.In In some embodiments, cell one or more factors can be it is positive, and can be with for one or more factors It is negative.For example, cell can be CD4+ and CD8-.It then can be by selected cell infusion into subject.Some In embodiment, the cell with or without one or more given factors can be selected (for example, can based on a kind of or The existence or non-existence of a variety of factors separates cell).In some embodiments, selected cell can also expand in vitro Increase.Selected cell can carry out amplification in vitro before infusion.It should be appreciated that thin used in any method disclosed herein Born of the same parents can be the mixture (for example, two or more different cells) of any cell disclosed herein.For example, in the disclosure The method of appearance may include cell, and the cell is the mixture of CD4+ cell and CD8+ cell.In another example, this public affairs The method for opening content may include cell, and the cell is the mixture of CD4+ cell and juvenile cell.In some cases, carefully Born of the same parents can be by CD45RO (-), CCR7 (+), CD45RA (+), CD62L+ (L- select albumen), CD27+, CD28+ and IL-7R α+ The stem-like cell memory T of composition_SCMCell, stem-like cell memory cell can also express CD95, IL-2R β, CXCR3 and LFA-1, and Show many functional attributes different from stem-like cell memory cell.Engineering cell can also be comprising L- selection albumen and The central memory T of CCR7_CMCell, wherein the center memory cell can secrete such as IL-2 but not secrete IFN γ or IL-4.Engineering Changing cell can also be the effect memory T comprising L- selection albumen or CCR7_EMCell, and generation such as effector cell's factor is such as IFN γ and IL-4.In some cases, cell colony can be introduced into subject.For example, cell colony can be T cell and NK The combination of cell.In other cases, group can be juvenile cell and the combination of effector cell.Cell colony can be TIL.

Particularly, the anti-CD2 antibody with anti-cd 3 antibodies or its antigen-binding fragment or fixation on the surface can such as be passed through Contact, or it is thin to T by being contacted with protein kinase C activators (for example, bryostatin) (sometimes in conjunction with Calcium ionophore) Born of the same parents group carries out stimulated in vitro.For the accessory molecule on costimulation T cell surface, matching in conjunction with the accessory molecule can be used Body.For example, T cell group can contact under conditions of T cell can be stimulated to be proliferated with anti-cd 3 antibodies and anti-CD28 antibody.One In a little situations, 4-1BB can be used for stimulating cell.For example, cell can be stimulated with 4-1BB and IL-21 or another cell factor.For Anti-cd 3 antibodies and anti-CD28 antibody can be used in the proliferation of stimulation cd4 t cell or cd8 t cell.For example, providing the medicine of signal Agent can be coupled in the solution or with surface.The ratio of particle and cell may depend on the granular size relative to target cell.In In further embodiment, cell such as T cell can be combined with the coated pearl of medicament, and wherein the pearl and cell then can be into Row separation, and optionally cultivated.Each pearl can be coated with anti-cd 3 antibodies or anti-CD28 antibody, or some In the case of, it can be coated with the combination of the two.In alternate embodiment, before culture, the coated pearl of medicament and Cell does not separate, but cultivates together.It can be contacted by making to attach to the paramagnetic beads (3x28 pearl) of AntiCD3 McAb and anti-CD28 T cell connects cell surface protein.In some cases, in buffer, for example, phosphate buffered saline (PBS) (PBS) (example Such as, bivalent cation such as calcium and magnesium are free of) in combination cell and pearl (for example, ratio is 1:1 M-450CD3/CD28T paramagnetic beads).Any cell concentration can be used.The mixture can cultivate or cultivate about several hours (for example, About 3 hours) extremely or to about 14 days, or any hour integer value therebetween.In another embodiment, which can cultivate Or culture about 21 days or at most 21 days or at most about 21 days.Condition suitable for T cell culture may include can be containing proliferation Appropriate culture medium with the factor necessary to vigor is (for example, minimum essential medium or RPMI culture medium 1640 or X-vivo 5 (Lonza)), the factor include serum (for example, tire ox or human serum), proleulzin (IL-2), insulin, IFN-g, IL-4, IL-7, GM-CSF, IL-10, IL-21, IL-15, TGF β and TNF α or any other additive grown for cell.For thin Other additives of intracellular growth include but is not limited to surfactant, plasmanate and reducing agent such as N- mucolyticum Acid and 2 mercapto ethanol.Culture medium may include RPMI 1640, A1M-V, DMEM, MEM, α-MEM, F-12, X-Vivo1 and X- Vivo 20, Optimizer have amino acid, Sodium Pyruvate and the vitamin of addition, serum-free or are supplemented with suitable blood (or blood plasma) or the one group of hormone limited clearly, and/or it is sufficiently used for the cell factor of the amount of T cell growth and amplification.Some In the case of, the RPMI of the bottle of 865mL can have 100mL human serum, 25mL Hepes 1M, 10mL10,000U/mL and 10,000 μ The penicillin/streptomycin of g/mL and the gentamicin of 0.2mL 50mg/mL.After adding additive, 0.2 μ can be used M x1L filter filtering RPMI culture medium simultaneously stores at 4 DEG C.In some embodiments, antibiotic (for example, penicillin and Streptomysin) it is only contained in experimental cultures, it is not included in the intracorporal cell culture of subject to be infused into.In some feelings Under condition, human serum can be thawed in 37 DEG C of water-baths, then heat inactivation (for example, for the bottle of 100mL, continues at 56 DEG C 30 minutes).Before adding culture medium, 0.8 μm and 0.45 μm of filter filtering serum can be passed through.

Under the conditions of target cell can maintain necessary to support growth；For example, temperature (for example, 37 DEG C) appropriate and atmosphere (for example, air adds 5%CO₂).In some cases, the T cell for being exposed to the different stimulated time can express different spies Sign.In some cases, the solvable monospecific tetrameric antibody for people CD3, CD28, CD2 or any combination thereof can be used.

In some cases, undergoing the cell of destruction can be activated or expand and co-culturing with tissue or cell.Carefully Born of the same parents can be antigen presenting cell.Artificial antigen can express the ligand and costimulatory molecules of T cell receptor in delivery cell (aAPC), And it can activate and expand T cell to be used to shift, while improve its effect and function in some cases.AAPC can be by engineering Turn to any gene that expression is used for t cell activation.AAPC can be engineered to any gene of the expression for T cell amplification. AAPC can be pearl, cell, protein, antibody, cell factor or any combination.Signal can be delivered to by aAPC can undergo base Because of a group cell colony for transplanting.For example, aAPC can deliver signal 1, signal 2, signal 3 or any combination.Signal 1 can be antigen Identification signal.For example, signal 1, which can be TCR, connects or can lead to the activation of CD3 signal transduction complex by peptide-MHC complex The agonistic antibody for CD3 combination.Signal 2 can be costimulatory signal.For example, costimulatory signal can be respectively with Anti- CD28, induction type costimulation object (ICOS), CD27 and the 4-1BB (CD137) that ICOS-L, CD70 and 4-1BBL are combined.Signal 3 It can be cytokine signaling.Cell factor can be any cell factor.Cell factor can be IL-2, IL-7, IL-12, IL-15, IL-21 or any combination thereof.

In some cases, artificial antigen in delivery cell (artificial antigen presenting cell, AAPC it) can be used for activation and/or amplifying cells group.In some cases, artificial antigen can not induce of the same race in delivery cell Special-shaped specificity (allospecificity).In some cases, aAPC can not express HLA.Heredity can be carried out to aAPC to repair It is decorated with and stablizes the gene that expression can be used for activating and/or stimulating.In some cases, K562 cell can be used for activating.K562 is thin Born of the same parents can also be used to expand.K562 cell can be human erythroleukemia cell line.K562 cell can be engineered interested to express Gene.K562 cell can not endogenous expression HLA I class, II class or CD1d molecule, but can express ICAM-1 (CD54) and LFA-3(CD58).K562 can be engineered to transmit signal 1 to T cell.For example, K562 cell can be engineered to express HLA I class.In some cases, K562 cell can be engineered to express other molecule, as B7, CD80, CD83, CD86, CD32, CD64,4-1BBL, AntiCD3 McAb, AntiCD3 McAb mAb, anti-CD28, anti-CD28mAb, CD1d, anti-CD2, the IL-15 of film combination, film combine IL-2, truncated CD19 or any combination of IL-21, film combination that IL-17, film combine.In some cases, except CD80 and Except CD83, engineering K562 cell can also express the AntiCD3 McAb mAb of form membrane, clone OKT3.In some cases, CD80 is removed Except CD83, engineering K562 cell can also express the anti-CD28mAb of the AntiCD3 McAb mAb of form membrane, clone OKT3, form membrane.

In some cases, can with antigen and the histocompatibility antigen through irradiating in delivery cell (APC), (such as raising is thin Born of the same parents PBMC) carry out stimulating again for cell.In some cases, non-specific mitogen such as PHA and of the same race can be used Allosome feeder cells next life long cell.Feeder cells PBMC can be irradiated with 40Gy.Feeder cells PBMC can be with about 10Gy extremely About 15Gy, about 15Gy are to about 20Gy, about 20Gy to about 25Gy, about 25Gy to about 30Gy, about 30Gy to about 35Gy, about 35Gy to about 40Gy, about 40Gy to about 45Gy, about 45Gy to about 50Gy irradiate.In some cases, it can be stimulated only with AntiCD3 McAb and IL-2 Control flask containing the feeder cells through irradiating.

AAPC can be pearl.The available antibody for CD3 and CD28 of spherical polystyrene pearl be coated with and for T Cell-stimulating.Pearl can be any size.In some cases, pearl can be or can be about 3 microns and 6 microns.Pearl Son can be or can be about 4.5 microns of size.Pearl can be used with the ratio of any cell and pearl.For example, can make With the pearl of every milliliter of 1,000,000 cell 3:1 and the ratio of cell.AAPC can also be rigid spheric granules, polystyrene cream Glue microballon, magnetic Nano or micron particles, nanoscale quantum dot, 4, it is (lactic acid-ethanol) copolymer (PLGA) microballoon, aspherical Particle, 5, carbon nano-tube bundle, 6, ellipsoid PLGA particle, 7, nanometer worm (nanoworm), the system of the lipid bilayer containing fluid, 8, The lipid bilayer (2D-SLB) of 2D- support, 9, liposome, 10, the micro- domain liposome of RAFTsome/, SLB particle (11) or its any group It closes.

In some cases, the amplifiable cd4 t cell of aAPC.For example, aAPC can be engineered to simulate the limitation of HLA II class Property cd4 t cell antigen processing and present approach.K562 can be engineered with express HLA-D, DP α chain, DP β chain, Ii, DM α, DM β, CD80, CD83 or any combination thereof.For example, pulse can be carried out to engineering K562 cell with HLA restricted peptides, to expand Increase the restricted antigentic specificity cd4 t cell of HLA.

In some cases, can by the use of aAPC and the combination of cytokines being exogenously introduced, with for t cell activation, Amplification or any combination.Can also amplifying cells in vivo, such as after genome transplantation cell is applied to subject, by Amplifying cells in the blood of examination person.

In some cases, cell can be scaled up to the production realized by standard rapid amplifying scheme (REP) Amount.The average fold amplification of the TIL of genetic modification can be 1071 times.In some cases, average fold amplification can be 500 To 2000 times.The TIL of genetic modification average fold amplification can be 500 to 600,600 to 700,700 to 800,800 to 900,900 to 1000,1000 up to 2000 times.In some cases, the engineering cell dosage for patient's infusion can be with It is about 1x10¹⁰The TIL of a knockout.

Before application, later and/or the cell of period (for example, engineering cell or engineering primary T cells or TIL) can To be functional.For example, cell can after application at least or at least about 1,2,3,4,5,6,7,8,9,10,11,12,13, 14, it is within 15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,40,50,60,70,80,90 or 100 days It is functional.The cell of adoptive transfer can after application at least or at least about 1,2,3,4,5,6,7,8,9,10,11 or 12 The moon is functional.The cell of application can be after infusion at least or at least about 1,2,3,4,5,6,7,8,9,10,15,20,25 Or 30 years are functional.In some cases, the cell of application can be functional throughout one's life in recipient.

Further, the cell of adoptive transfer can play 100% function of its normal, expected operation.Cell can also play Its normal, expected operation 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% function.

In long-term cultivation, the cell that genome destroys can not show not depending on the characteristic of the growth or conversion of stimulation. For example, in some cases, when cultivating in the case where no cell factor such as IL-2, the cell that genome destroys can not expand Increase.In some cases, genome destroy cell about 1 after the exposing cell factor such as IL-2,2,3,4,5,6,7,8,9,10, 11、12、13、14、15、16、17、18、19、20、21、22、23、24、25、26、27、28、29、30、31、32、33、34、35、 36、37、38、39、40、41、42、43、44、45、46、47、48、49、50、51、52、53、54、55、56、57、58、59、60、 61、62、63、64、65、66、67、68、69、70、71、72、73、74、75、76、77、78、79、80、81、82、83、84、85、 86, it possibly can not survive after 87,88,89,90,91,92,93,94,95,96,97,98 or 99 days.

Cell composition as described herein can be with freezen protective.Freezen protective can be in such as 5%DMSO ultimate density It is carried out in Cryostor CS10.Freezen protective can be with about 7.5x 10⁷A cell/mL to about 1.5x 10⁸A cell/mL's is cold Freeze density to carry out.Freezing density can be about 1x10⁷A cell/mL, 1.5x10⁷A cell/mL, 2x10⁷A cell/mL, 2.5x10⁷A cell/mL, 3x10⁷A cell/mL, 3.5x10⁷A cell/mL, 4x10⁷A cell/mL, 4.5x10⁷A cell/ mL、5x10⁷A cell/mL, 5.5x10⁷A cell/mL, 6x10⁷A cell/mL, 6.5x10⁷A cell/mL, 7x10⁷A cell/ mL、7.5x10⁷A cell/mL, 8x10⁷A cell/mL, 8.5x10⁷A cell/mL, 9x10⁷A cell/mL, 9.5x10⁷It is a thin Born of the same parents/mL, 1x10⁸A cell/mL, 1.5x10⁸A cell/mL, 2x10⁸A cell/mL, 2.5x10⁸A cell/mL, 3x10⁸It is a thin Born of the same parents/mL, 3.5x10⁸A cell/mL, 4x10⁸A cell/mL, 4.5x10⁸A cell/mL, 5x10⁸A cell/mL, 5.5x10⁸It is a Cell/mL, 6x10⁸A cell/mL, 6.5x10⁸A cell/mL, 7x10⁸A cell/mL, 7.5x10⁸A cell/mL or up to About 8x10⁸A cell/mL.

Such as, in some cases it may it harvests, wash TIL and be resuspended in buffer such as Cryostor buffer In.The prepared product can be mixed with isometric Cryostore CS10.In some cases, have by cell composition introducing The subject needed is thawed before.

Cell viability can be determined by flow cytometry and trypanblue exclusion method.In some cases, on flow cytometer Forward scattering and lateral scattering can determine percent living cells.In other cases, cell can be dyed with annexin V To determine dead cell/living cells percentage.Trypanblue exclusion method can also be used for determining that cell is living by hemacytometer Power.In some cases, it can be at least about 50% cell of application great-hearted.In other cases, about 50%, 60%, 70%, 80%, 90%, 95% or up to 100% cell can be great-hearted.

Cell target

Cell such as TIL can be with targeting antigen.Cell can also target epitope.Antigen can be tumor-cell antigen.Epitope It can be tumour cell epitope.Tumor infiltrating lymphocyte (TIL) be can choose as clone and/or widow and clone subgroup, With the specific reaction for being directed to subject's Specific cancer neoantigen.At least one of following methods can be used to come really Determine specific reaction: the full sequencing of extron group of tumour and the series connection long peptide screening method of mini gene/synthesis, E.Tran et al., Cancer immunotherapy based on mutation-specific CD4+T cells in a patient with epithelial cancer.Science 344,641-645(2014).Tumour cell epitope can be anti-derived from kinds of tumors Original, such as resist to be freely mutated the antigen (neoantigen or new epitope) of caused tumour, shared tumour specific antigen, break up Antigen that is former and being overexpressed in tumour.In some cases, neoantigen or new table can be identified by 5 ' RACE and TCR-PCR Position.Some examples are only enumerated, these antigens for example can derived from alpha-actinine -4, ARTC1, BCR-ABL fusion protein (b3a2), B-RAF, CASP-5, CASP-8, beta-catenin, Cdc27, CDK4, CDKN2A, COA-1, dek-can merge egg White, EFTUD2, elongation factor 2, ETV6-AML1 fusion protein, FLT3-ITD, FN1, GPNMB, LDLR- fucosyltransferase Fusion protein, HLA-A2d, HLA-Al ld, hsp70-2, KIAAO205, MART2, ME1, MUM-1f, MUM-2, MUM-3, neo- PAP, myoglobulin I class, NFYC, OGT, OS-9, p53, pml-RAR alpha fusion protein, PRDX5, PTPRK, K-ras, N-ras, RBAF600, SIRT2, SNRPD1, SYT-SSX1 fusion protein or SYT-SSX2 fusion protein, TGF-β RII, triose-phosphate isomerase Enzyme, BAGE-1, GAGE-1,2,8, Gage 3,4,5,6,7, GnTVf, HERV-K-MEL, KK-LC-1, KM-HN-1, LAGE-1, MAGE-A1、MAGE-A2、MAGE-A3、MAGE-A4、MAGE-A6、MAGE-A9、MAGE-A10、MAGE-Al2、MAGE-C2、 mucink、NA-88、NY-ESO-1/LAGE-2、SAGE、Sp17、SSX-2、SSX-4、TAG-1、TAG-2、TRAG-3、TRP2- INT2g, XAGE-1b, CEA, gp100/Pmel17, kallikrein 4, mammaglobin-A, Melan-A/MART-1, NY-BR- 1, OA1, PSA, RAB38/NY-MEL-1, TRP-1/gp75, TRP-2, tyrosinase, fat differentiation related protein (adipophilin), AIM-2, ALDH1A1, BCLX (L), BCMA, BING-4, CPSF, cyclin D1, DKK1, ENAH (hMena), EP-CAM, EphA3, EZH2, FGF5, G250/MN/CAIX, HER-2/neu, IL13R α 2, intestines Carboxylesterase, α tire Albumen, M-CSFT, MCSP, mdm-2, MMP-2, MUC1, p53, PBF, PRAME, PSMA, RAGE-1, RGS5, RNF43, RU2AS, Protein isolate 1, SOX10, STEAP1, survivin, Telomerase, VEGF and/or WT1.Tumor associated antigen can be by host The antigen of improper expression；Tumor associated antigen can be the mutation of the molecule by host's normal expression, truncation, false folding or The abnormal show of other modes；Tumor associated antigen can be with normal expression but identical with the molecule of unusual high levels expression；Or Tumor associated antigen can express in abnormal situation or environment.Tumor associated antigen can be, for example, protein or protein Segment, complex carbohydrate, gangliosides, haptens, nucleic acid, other biological molecule or any combination thereof.In some feelings Under condition, target is neoantigen or new epitope.For example, neoantigen can be the mutation of the E805G in ERBB2IP.In some cases, Neoantigen and new epitope can be identified by full sequencing of extron group.In some cases, neoantigen and new epitope target can It is expressed by stomach and intestine cancer cell.Neoantigen and new epitope can be expressed in epithelioma.

Epitope can be matrix epitope.Epitope can be in the matrix of tumor microenvironment.Antigen can be matrix antigen.It is anti- Original can be in the matrix of tumor microenvironment.Some examples are only enumerated, these antigens and these epitopes for example may be present in tumour On endothelial cell, tumor vasculature, tumour fibroblast, tumour pericyte, tumor stroma and/or mesenchyma stroma of tumors cell. These antigens for example may include CD34, MCSP, FAP, CD31, PCNA, CD117, CD40, MMP4 and/or tenascin.

Genome destroys

Genome destruction may include exon and introne.In some cases, genome destruction can be gene order Destruction.The destruction of gene can be the destruction of any specific gene.Consider the genetic homology object for covering the gene in the application (for example, any Mammalian versions of gene).Some genetic homology objects are known in the art, but in some cases, together Source object is unknown.However, it is possible to by using the database such as NCBI BLAST obtained can be disclosed to nucleic acid (DNA or RNA) Sequence or protein sequence are compared to find the homologous gene between mammal.

Genome destroys the function that can improve cell.For example, genome destroys the cytotoxicity that target can be enhanced.Base Because group destruction can also enhance the proliferation or persistence of cell.For example, cancer immunity treatment can be improved in the gene that can be destroyed The treatment potentiality of method.Cell can be engineered to knock out one or more endogenous genes.The endogenous gene that can be knocked may include Immunologic test point gene.Immunologic test point gene can be irritation and check that point gene or inhibition check point gene.It can make It is provided with the 38th edition the 2nd added edition (GRCh38.p2) procedure set of genome canonical sequence alliance human genomic sequence immune Checkpoint gene location.Database can be used and select the gene that will be knocked out.In some cases, certain endogenous genes are to base Because being more revisable for group engineering.Database may include the target site permitted in epigenetics.In some cases, number According to library can be ENCODE (encyclopedia (encyclopedia of DNA Elements) of DNA element) (http: // www.genome.gov/10005107).Database can identify with the opening chromatin that can more allow progress genome project Region.The gene that can be destroyed, which may participate in, weakens TCR signal transduction, functional affinity or the immunity to cancer.One In a little situations, when stimulating TCR, gene upregulation to be destroyed.Gene, which may participate in, inhibits cell amplification, functional affinity or thin Intracellular cytokine is multi-functional.Gene may participate in the generation of negative regulation cell factor.For example, gene may participate in depression effect cell factor, For example, the generation of IFN-γ and/or TNF.Gene may also participate in the table for inhibiting the post-stimulatory supportive cell factor such as IL-2 of TCR It reaches.

Cell can have the gene of one or more destructions.For example, one or more genes that its expression is destroyed can To be to check point gene, such as PD-1 or CISH.In some cases, one or more genes that expression can be destroyed exist It is shown in table 1.For example, the gene that can be destroyed can be shown centainly with gene disclosed herein (such as gene in table 1) Identity and/or homology.Accordingly, it is considered to can destroy show or about show 50% with the gene of table 1,55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology (in nucleic acid or protein level) Gene.Also consider can destroy show or about show about 50% with the gene of table 1,55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, the gene of 95%, 96%, 97%, 98%, 99% or 100% identity (in nucleic acid or protein level).

Table 1: check that point gene is summarized

Cell can have one or more repressed genes.For example, it expresses repressed one or more genes It may include any one of table 1 gene and its homologous or modification variant.Gene inhibition can be also carried out in several ways.Example It such as, can be by knocking out, changing the promoter of gene and/or by application RNA interfering come inhibition of gene expression.This can be in organism Level is carried out in tissue, organ and/or cellular level.If striking low one or more bases in cell, tissue and/or organ Cause then can interfere reagent by administering RNA, for example, siRNA, shRNA or Microrna inhibit the one or more gene.Example Such as, the nucleic acid stability that can express shRNA can be transfected into cell to strike low expression.In addition, the nucleic acid of shRNA can will can be expressed It is inserted into the genome of T cell, to strike the gene in low T cell.

In some cases, the gene that can be disrupted or inhibited can be CISH.CISH gene can be cell factor and lure STAT inhibiting factor (CIS) (the also referred to as STAT suppression of cytokine signaling conduction inhibiting factor (SOCS) or STAT induction led The factor (SSI) processed) protein family member, (see, for example, Palmer et al., Cish actively silences TCR signaling in CD8+T cells to maintain tumor tolerance,The Journal of Experimental Medicine 202(12),2095-2113(2015)).Gene can be one of SOCS protein family Point, SOCS protein family can form a part of the classical degeneration factor of adjustable cytokine signaling.CISH can join With by the cell factor such as hematopoietin, prolactin of JAK-STAT5 approach conducted signal or interleukin-13 (IL-3) by The negative regulation of body.Gene can inhibit STAT5 trans-activation by inhibiting the tyrosine phosphorylation of STAT5.Known CISH family Member is the cytokine signaling conduction negative regulator of cytokine induction.Gene expression can by hematopoietic cell IL2, IL3, GM-CSF or EPO induction.The gene protein degradation that proteasome mediates may participate in the inactivation of EPO Receipter. In some cases, gene to be targeted can express in tumor specific T cells.Gene to be targeted can the increasing when being destroyed Add infiltration of the engineering cell to antigen related neoplasms.

The functional affinity for improving effector T cell disappears for overcoming the inhibiting factor in tumor microenvironment and causing tumour It may be vital for moving back.In some cases, Cish (the SH2 albumen of cytokine induction)-cytokine signaling conducts The member-of inhibiting factor (SOCS) family can pass through CD8⁺T cell receptor (TCR) in T cell stimulates to induce, can be with It is resident in T cell and expresses in tumour, and their functional affinities to tumour can be inhibited.Tumour-specific CD8⁺T is thin Their amplification can be enhanced in the genetic defect of Cish in born of the same parents, and functional affinity and cell factor are multi-functional, causes built The significant and lasting recession of vertical tumour.Cish and key TCR signal transduction intermediate phospholipase C gamma1 (PLC- γ 1) object The interaction of reason ground makes intermediate targeting proteins enzyme body after TCR stimulation degrade.These discoveries establish it is a kind of new can target To interaction, tumour-specific CD8 is adjusted⁺The functional affinity of T cell, and can be operated to improve ACT Immunotherapy for cancer.In some cases, Cish knocks out or strikes the low cytokine levels that may cause and increases.It is corresponding with wild type The supernatant of cell is compared, and raised cytokine levels may include IFN-γ in supernatant, TNF-α, IL-2 or combinations thereof It increases.In other cases, knock out or strike the increase that low gene such as Cish may include antigen sensitive.In some cases, The increase of antigen sensitive can be measured by total cell factor expression level, the increase of antigen sensitive can be 40 to 100 times.Compared with the correspondence cell of control, the increase of antigen sensitive can be 40 to 50,50 to 60,60 to 70,70 to 80, 80 to 90,90 to 100 times.

In some cases, as by IFN-γ, TNF-α and/or IL-2 level measured by, Cish knock out or strike it is low can Lead to the maximum amount of increase of cytokine release.In some cases, ELISA can measure the total cell factor in supernatant Level, and can not directly measure the cytokine production on subgroup or cellular level.In order to assess different subgroup or a Whether body T cell may cause cytokine production increase, can be to CD8⁺T cell is selected, is stimulated, for intracellular IFN-γ, TNF-α and IL-2 carry out total dyeing and use hybridoma supematant assesse.In some cases, Cish can be with negative regulation Gross effect cell factor in tumor specific T cells generates and multi-functional the two.The hereditary total deletion of Cish can increase Powerful affinity and make CD8⁺T cell becomes lasting tumor-killing agent, this may answer the memory of recurrent tumor It answers and has an impact.

One or more genes in T cell can be knocked out or destroyed with any method.For example, knocking out one or more genes It may include that one or more genes are deleted from the genome of T cell.Knockout, which may also include from T cell, removes all or part of gene Sequence.It is further contemplated that knocking out may include all or part of gene replaced in T cell genome with one or more nucleotide.It strikes Except one or more genes may additionally include insetion sequence in one or more genes, to destroy the one or more gene Expression.For example, insetion sequence can generate terminator codon in the intermediate of one or more genes.Insetion sequence can also make one or The open reading frame of multiple genes is mobile.It is further contemplated that any combination for the technology that knocks out can be combined.For example, tissue is special The opposite sex knocks out or cell-specific knockout can be combined with induction type technology, to generate tissue specificity or cell-specific lures Conductivity type knocks out.In addition, other systems such as development-specific promoter can be with tissue-specific promoter and/or induction type knockout group It closes and uses.

Knockout technology may also include gene editing.It is, for example, possible to use nuclease (including CRISPR GAP-associated protein GAP (Cas eggs It is white, such as Cas9), Zinc finger nuclease (ZFN), activating transcription factor sample effector nuclease (TALEN) and meganuclease) Carry out gene editing.Nuclease can be naturally occurring nuclease, genetic modification and/or the nuclease of recombination.Also it can be used System (for example, PiggyBac, sleeping beauty (Sleeping beauty)) based on transposons carries out gene editing.For example, can be with Gene editing is carried out using transposase.

In some cases, the cell of the cell of engineering or gene containing destruction or part thereof is surveyed before can undergoing infusion Examination.Infusion before test may include to engineering cell culture carry out phenotype test, effect test, microbiological assay, At least one of endotoxin test, vigor test and tumour cell test.For some examples, phenotype test may include detection The presence of CD3, CD4, CD8, CD56, CD45RA, CD45RO, IL-7 receptor alpha, CD28.In some cases, it is engineered on cell The level of marker be more than at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or at most about 100%.When the phenotype test in the preceding test of infusion can be at least about 80%CD3 positive, TIL can be applied.

In some cases, the effect test of TIL may include detecting IFN γ after carrying out AntiCD3 McAb stimulation to TIL culture Level.In some cases, the level for carrying out the post-stimulatory IFN γ of AntiCD3 McAb to TIL culture is significantly higher than comparable control Cell colony.In some cases, test generates at least about after carrying out AntiCD3 McAb stimulation to TIL in effect test before infusion 200pg/mL/10⁵When the IFN γ of a cell, TIL can be applied.In some cases, it is tested before infusion in effect test At least about 50pg/mL/10 is generated after carrying out AntiCD3 McAb stimulation to TIL⁵A cell, 75pg/mL/10⁵A cell, 100pg/mL/10⁵ A cell, 150pg/mL/10⁵A cell, 200pg/mL/10⁵A cell, 250pg/mL/10⁵A cell, 300pg/mL/10⁵It is a When the IFN γ of cell, TIL can be applied.

In some cases, TIL group is tested for the presence of tumour cell in composition.For in cytopathy The tumour cell in every at least about 200 TIL checked in Neo-Confucianism test, the TIL that can be applied can be feminine gender.In other situations Under, checked in cell pathology test per the tumour cell existed at least about 200 TIL less than 1%.In other situations Under, checked in cell pathology test per the tumour cell existed at least about 200 TIL less than 2%.In other situations Under, checked in cell pathology test per the tumour cell existed at least about 200 TIL less than 3%.In other situations Under, checked in cell pathology test per the tumour cell existed at least about 200 TIL less than 4%.In other situations Under, checked in cell pathology test per the tumour cell existed at least about 200 TIL less than 5%.

CRISPR system

Method described herein can utilize CRISPR system.Merge RNA and Cas albumen in the presence of at least five seed types CRISPR system.I type, type III and the assembling of IV type can cut more Cas protein complexes of the nucleic acid complementary with crRNA.I type It is required to carry out pre-crRNA processing before processed crRNA is assembled into more Cas protein complexes with type III.II type It include the single Cas albumen compound at least one guide RNA with V-type CRISPR system.

General Mechanism and the latest developments of CRISPR system: Cong, L. et al. are discussed in the following documents, “Multiplex genome engineering using CRISPR systems,”Science,339(6121):819-823 (2013)；Fu, Y. et al., " High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells,"Nature Biotechnology,31,822–826(2013)；Chu, VT et al., “Increasing the efficiency of homology-directed repair for CRISPR-Cas9- induced precise gene editing in mammalian cells,”Nature Biotechnology 33,543– 548(2015)；Shmakov, S. et al., " Discovery and functional characterization of diverse Class 2CRISPR-Cas systems,"Molecular Cell,60,1-13(2015)；Makarova, KS etc. People, " An updated evolutionary classification of CRISPR-Cas systems ", Nature Reviews Microbiology,13,1-15(2015).The locus specificity cutting of target DNA occurs to determine by both following Position: 1) base pairing between guide RNA and target DNA (region sequence between before also referred to as) it is complementary and 2) it is short in target DNA Motif (region sequence is adjacent to motif between before referred to as) (PAM)).For example, CRISPR system can be used, for example, II type CRISPR system System generates engineering cell.Cas enzyme used in method disclosed herein can be the Cas9 of catalytic dna cutting.By spreading out The enzymatic that the closely related Cas9 of Cas9 or any of streptococcus pyogenes (Streptococcus pyogenes) is carried out is born to make With double-strand break, 20 nucleotide hybridizations of the target site sequence and guide sequence can be generated at target site sequence, and have Region sequence is adjacent to motif (PAM) between having preceding after 20 nucleotide positioned at the target sequence.

In some cases, CRISPR system can introduce mutation.Mutation can be insertion or missing.For example, CRISPR System can introduce the insertion of at least part of 1bp comprising CISH.It in some cases, can with CRISPR system manipulation TIL Can will not the TIL amplification after the electroporation to CRISPR system have a negative impact.In some cases, in order to determining in heredity Whether the knockout frequency observed in level is related to protein losses, it can be estimated that protein such as CISH egg after CRISPR is knocked out White expression.For example, the AntiCD3 McAb and soluble anti-CD28 antibody that can use within the 14th day after electroporation plate combination are to periphery Blood (PB) T cell and TIL are stimulated again, and can be to protein such as CISH by flow cytometry and Western blotting The loss of albumen is assessed.In some cases, the PB T cell of CRISPR modification and TIL can expand 14 days, then again Stimulation 48 hours.Since CISH is intracellular protein, cell can be collected and analyze extraction by Western blotting Object.It is consistent with the high knockout rate that the TiDE by genomic modification is analyzed, circulation T cell of the protein such as CISH in knockout Be substantially absent or reduce in TIL.

I.Cas albumen

Carrier can operationally connect with the enzyme coded sequence of coding CRISPR enzyme such as Cas albumen (CRISPR GAP-associated protein GAP) It connects.The non-limiting example of Cas albumen may include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also referred to as Csn1 or Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2、Csm3、Csm4、Csm5、Csm6、Cmr1、Cmr3、Cmr4、Cmr5、Cmr6、Csb1、Csb2、Csb3、Csx17、Csx14、 Csx10、Csx16、CsaX、Csx3、Csx1、Csx1S、Csf1、Csf2、CsO、Csf4、Cpf1、c2c1、c2c3、Cas9HiFi、 Its homologue or its modification type.In some cases, the dead Cas albumen of catalysis, such as dCas9 can be used.Unmodified CRISPR enzyme can have DNA cleavage activity, such as Cas9.At the bootable target sequence of CRISPR enzyme, as in target sequence and/or target sequence Complementary series in a chain or two chains cutting.For example, CRISPR enzyme may be guided apart from first of target sequence or most 1,2,3,4,5,6,7,8,9,10,15,20,25,50,100,200,500, the latter nucleotide or more base-pair or A chain or two in about 1,2,3,4,5,6,7,8,9,10,15,20,25,50,100,200,500 or more base-pair The cutting of chain.The carrier of coding CRISPR enzyme can be used, which mutates relative to corresponding wild-type enzyme, make One chain of target polynucleotide of the CRISPR azymia cutting containing target sequence that must be mutated or the ability of two chains.Cas albumen It can be high-fidelity Cas albumen, such as Cas9HiFi.In some cases, Cas albumen can be modified.For example, Cas can be N7- Methyl-Gppp (2 '-O- methyl-A).In some cases, Cas albumen such as Cas9 albumen can be surveyed before clinical use Sequence.For example, the in-vitro transcription product of purifying can be assessed, by polyacrylamide gel electrophoresis to verify in clinical prods not In the presence of other mRNA types in addition to Cas9.In addition, the purifying mRNA of coding Cas albumen such as Cas9 can undergo and pass through reverse The verifying of record and subsequent sequencing, to verify identity under nucleotide level.Cas sequence can contain nuclear localization sequence (NLS).Core Positioning sequence can come from SV40.NLS may be from least one below: SV40, nucleoplasmin, input albumen α, C-myc, EGL-13, TUS, BORG, hnRNPA1, Mata2 or PY-NLS.NLS can be on the C-terminal or N-terminal of Cas albumen.Some In the case of, Cas albumen can contain 1 to 5 NLS sequence.Cas albumen can contain 1,2,3,4,5,6,7,8,9 or at most 10 NLS Sequence.Cas albumen such as Cas9 can contain there are two NLS sequence.NLS sequence of the Cas albumen containing SV40 and nucleoplasmin.Cas Albumen can also contain at least one non-translational region.

2 streptococcus pyogenes Cas9 (SpCas9) of table

The streptococcus pyogenes Cas9mRNA that table 3 is modified

Cas9 can refer to wild-type example Cas9 polypeptide (for example, Cas9 from streptococcus pyogenes) at least or extremely Few about 50%, 60%, 70%, 80%, 90%, 100% sequence identity and/or the polypeptide of sequence similarity.Cas9 can refer to With wild-type example Cas9 polypeptide (for example, come from streptococcus pyogenes) have at most or at most about 50%, 60%, 70%, 80%, the polypeptide of 90%, 100% sequence identity and/or sequence similarity.Cas9 can refer to may include that amino acid change such as lacks The wild type of mistake, insertion, displacement, variant, mutation, fusion, chimeric or any combination thereof or the Cas9 albumen of modified forms.

Codon optimization can be carried out to be used for the polynucleotides for encoding endonuclease (for example, Cas albumen such as Cas9) Expression in specific cells such as eukaryocyte.Such optimization may need dashing forward for external source (for example, recombination) DNA Become, to simulate the codon preference of expected host organisms or cell while encoding same protein.

Can be used coding comprising one or more nuclear localization sequences (NLS) (be such as more than or more than about 1,2,3,4,5, 6,7,8,9,10 NLS) CRISPR enzyme carrier.For example, CRISPR enzyme may include being more than near amino terminal or its Or be more than about 1,2,3,4,5,6,7,8,9,10 NLS, being more than near carboxyl terminal or its or more than about 1,2,3,4,5, 6,7,8,9,10 NLS or these any combination are (for example, in one or more NLS of amino terminal and in carboxyl terminal One or more NLS).When there are more than one NLS, each can be selected so that single NLS independently of other NLS It may be present in more than one copy and/or combined with one or more other NLS and is present in one or more copies.

NLS can be single point or double points.In some cases, from singly divide NLS different, it is double to divide NLS that have intervening sequence. NLS may be from least one below: SV40, nucleoplasmin, input albumen α, C-myc, EGL-13, TUS, BORG, HnRNPA1, Mata2 or PY-NLS.NLS can be located at any position in polypeptide chain, for example, close to N-terminal or C-terminal.For example, NLS can be at 1,2,3,4,5,10,15,20,25,30,40,50 amino acid along polypeptide chain since N-terminal or C-terminal or In about 1,2,3,4,5,10,15,20,25,30,40,50 amino acid.Sometimes, NLS can be at since N-terminal or C-terminal 50 amino acid or more amino acid or about 50 amino acid or more amino acid, for example, 100,200,300,400, 500, in 600,700,800,900 or 1000 amino acid.

Endonuclease may include and the site-directed polypeptide of wild-type example (for example, Cas9 from streptococcus pyogenes) Nuclease domain have at least or at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or The amino acid sequence of 100% amino acid sequence identity.

Although streptococcus pyogenes Cas9 (SpCas9) (table 2) is typically used as CRISPR endonuclease for genome work Journey, but it may not be the best endonuclease in each target excision site.For example, the PAM sequence of SpCas9 (5 ' NGG 3 ') Largely exist in entire human genome, but NGG sequence possibly can not be properly positioned to target required gene for modifying.In Under some cases, different endonucleases can be used for targeting certain Genomic targets.In some cases, can be used has The SpCas9 derivative variant of the synthesis of non-NGG PAM sequence.In addition, it is lineal to have authenticated other Cas9 from various species Homologue, and these " non-SpCas9 " combination can also be used for a variety of PAM sequences of the invention.For example, relatively large sized SpCas9 (about 4kb coded sequence) mean carry SpCas9cDNA plasmid possibly can not in cell effective expression.Phase Instead, the coded sequence ratio SpCas9 of staphylococcus aureus (Staphylococcus aureus) Cas9 (SaCas9) is short by about 1 Kilobase, so as to allow its effective expression in cell.Similar with SpCas9, SaCas9 endonuclease can be in vitro It modifies the target gene in mammalian cell and modifies the target gene in mouse in vivo.

The substitute of streptococcus pyogenes Cas9 may include show in mammalian cells cleavage activity from Cpf1 The endonuclease of the RNA guidance of family.Different from Cas9 nuclease, the result for the DNA cutting that Cpf1 is mediated is with short 3 ' The double-strand break of jag.A possibility that staggeredly cut mode of Cpf1 can open directed gene transfer, similar to traditional limit Enzyme clone processed, the efficiency of gene editing can be improved in this.As above-mentioned Cas9 variant and ortholog thing, Cpf1 can also can be by The number of loci of CRISPR targeting extends to the region lacked by the SpCas9 site NGG PAM favor rich in AT or is rich in AT Genome.

The Cas albumen of any functional concentration can be introduced into cell.For example, the Cas mRNA of 15 micrograms can be introduced thin In born of the same parents.In other cases, the Cas mRNA of 0.5 microgram to 100 micrograms can be introduced.Can introduce 0.5,5,10,15,20, 25, the Cas mRNA of 30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100 micrograms.

In some cases, two incision enzyme method can be used for introducing double-strand break or genome fracture.Cas albumen can be in core At known amino acid in sour enzyme domains be mutated, thus delete a nuclease domain activity and generation can generate list The nickase Cas albumen of chain fracture.Nickase can be used in target site together with two different guide RNAs of targeting opposite strand It generates DSB (commonly referred to as " two incision " or " two incision enzyme " CRISPR system).This method can dramatically increase target specificity, Because being less likely to generate two notch that miss the target in close enough distance so as to cause DSB.

It can be in the identity and effect using preceding test nuclease such as Cas9.It is, for example, possible to use spectrophotometric analysis, RNA agarose gel analysis, LC-MS, at least one of endotoxin analysis and sterile test determine identity and effect.One In a little situations, identity test can determine clinic/therapeutical uses acceptable level.For example, acceptable spectrophotometric analysis As a result L/ bottles of 105 ± 10 μ, 1.0 ± 0.1mg/mL be can be.Acceptable spectrophotometric analysis result can also be about 90-120 ± 10 L/ bottles of μ, L/ bottles of ± 10 μ of 1.0 ± 0.1mg/mL or about 90-120, about 0.1 to 5.0 ± 0.1mg/mL.

In some cases, the UV260/280 ratio of nuclease such as Cas9 can be about 1.0 ± 0.1.UV260-280 ratio It can be about 1.0-5.0 ± 0.1.

In some cases, nuclease such as Cas9 can have the integrality that measures by RNA agarose gel analysis/big It is small.The size of Cas9 can be about 4500 bases.The size of Cas9 can be about 4000 to about 8000 bases.The size of Cas9 can It is about 4000 to about 5000 bases, about 5000 to about 6000 bases, about 6000 to about 7000 bases, about 7000 to about 8000 bases.In some cases, biological analyser can be used for measuring the size of nucleotide sequence such as Cas9.Biological analyser The size of Cas9 sequence can be measured, which can be about 4000 to about 5000 bases, about 5000 to about 6000 bases, about 6000 to about 7000 bases, about 7000 to about 8000 bases.

In some cases, the level of endotoxin of nuclease such as Cas9 can be measured.Endotoxin test can be horseshoe crab measurement. Endotoxic clinic/treatment acceptable level is smaller than 3EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 10EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 8EU/mL.Endotoxic clinic/treatment acceptable level can Less than 5EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 4EU/mL.Endotoxic clinic/treatment is subjected to water It is flat to be smaller than 3EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 2EU/mL.Endotoxic clinic/treatment can connect 1EU/mL is smaller than by level.Endotoxic clinic/treatment acceptable level is smaller than 0.5EU/mL.

In some cases, nuclease such as Cas9 can undergo sterile test.The clinic of sterile test/treatment acceptable level Can for 0 or by culture without growth indicate.The clinic of sterile test/treatment acceptable level may be less than 0.5% growth.Nothing Clinic/treatment acceptable level of bacterium test may be less than 1% growth.

In some cases, nucleotide sequence such as Cas9 sequence can be sequenced to confirm its identity.For example, can be Input Cas9mRNA transcription templates are sequenced with about 4 times of coverage before generating Cas9mRNA batch.It can be by poly- Acrylamide gel electrophoresis (PAGE) assesses the in-vitro transcription product of purifying, is size expected from Cas9 to verify mRNA, and And other mRNA types are not present in clinical or treatment product.In some cases, experience is passed through reverse transcription by the mRNA of purifying The verifying of reverse transcription and subsequent DNA sequencing that enzyme (RT) mediates, to verify identity under nucleotide level.

In some cases, the effect of nuclease function can be tested by trial operation.Exist for example, Cas9 can be tested Function effect in the primary human T-Cells of three independent donors.It can be tried in a manner of identical with Patient Sample A Agent delivering.Effect, and the insertion and deletion in each donor can be determined by the way that target gene group locus is sequenced Frequency can achieve or more than 50%.In some cases, effect can be determined by the way that target gene group locus is sequenced Power, and the insertion and deletion frequency in each donor can achieve or more than 60%.It in some cases, can be by target Genomic locus is sequenced to determine effect, and the insertion and deletion frequency in each donor can achieve or be more than 65%.In some cases, effect can be determined by the way that target gene group locus is sequenced, and in each donor Insertion and deletion frequency can achieve or more than 70%.It in some cases, can be by being surveyed to target gene group locus Sequence determines effect, and the insertion and deletion frequency in each donor can achieve or more than 75%.

II. polynucleotide is instructed

Polynucleotide is instructed to can be DNA or RNA.Polynucleotide is instructed to can be single-stranded or double-stranded.In some cases, refer to Lead region of the polynucleotide containing single stranded zone and double stranded region.Instruct polynucleotide that can also form secondary structure.As used herein Term " guide RNA (gRNA) " and its grammer equivalent item can refer to have target DNA specificity and can be formed with Cas albumen multiple Fit RNA.Guide RNA may include guide sequence or intervening sequence, which specifies target site and draw RNA/Cas complex Specified target DNA is directed to be cut.For example, CRISPR complex can be targeted different genes and carry out target by guide RNA To double-strand break.The locus specificity cutting of target DNA occurs by both following position determined: 1) guide RNA and target DNA Base pairing between (region sequence between before also referred to as) is complementary；And 2) in target DNA be referred to as before between region sequence adjacent to motif (PAM) short motif.In some cases, it can be used in the early stage exon that can be identified in common expression transcript The algorithm of gRNA design gRNA.Points-scoring system can be used to be ranked up candidate gRNA according to potentiality are missed the target, the scoring System can be considered: (a) the mispairing sum between gRNA sequence and the genome sequence of any tight fit；(b) relative to PAM The mismatch site in site, the mismatch site and the mispairing close to the site PAM are related to active negative effect；(c) between mispairing Distance, for illustrate adjacent mispairing for destruction instruct DNA interact cumulative effect；And any combination thereof.Some In the case of, the possibility for the cutting that more mispairing may make the CRISPR in the site mediate between gRNA and genome target site Property is lower.In some cases, mismatch site and the site PAM direct neighbor.In other cases, mismatch site can distance 1, the site PAM nucleotide is to 100 kilobase.In some cases, the candidate gRNA comprising mispairing may not be adjacent with PAM. In other cases, at least two candidate gRNA comprising mispairing can be with 1 nucleotide of mutual distance to 100 kilobase Mode combination genome.Mispairing can be the displacement of nucleotide.For example, in some cases, G will replace T.GRNA and genome Between mispairing the fidelity of CRISPR gene editing can be made to reduce.In some cases, just scoring gRNA can be about 110 Nucleotide, and can be without containing the mispairing with complementary genes group sequence.In other cases, just scoring gRNA can be about 110 nucleotide, and at most 3 mispairing with complementary genes group sequence can be contained.In other cases, just score gRNA 110 nucleotide can be about, and at most 20 mispairing with complementary genes group sequence can be contained.Instruct polynucleotide can be with Any sequence in table 4 have at least or at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or at most about 100% sequence identity and/or sequence similarity.In some cases, instruct polynucleotide that can contain core Connect key between thuja acid, which can be thiophosphate.Any number of thiophosphate may be present.For example, In It instructs that 1 to about 100 thiophosphate may be present in multicore acid sequence.In some cases, there are 1 to 10 thiophosphoric acids Ester.In some cases, in instructing multicore acid sequence there are 0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15, 16,17,18,19 or 20 thiophosphates.

Table 4. targets the sequence table of the gRNA of the modification of PD-1, CTLA-4, AAVS1 or CISH gene.

In some cases, the gRNA that can design and select highest to score, and patient can be originated from by experiment TIL and T cell from peripheral blood in assess the upper target editorial efficiency of every kind of gRNA.In some cases, pass through TiDE points The editorial efficiency of analysis measurement can be more than at least about 20%.In other cases, editorial efficiency can be about 20% to about 50%, about 50% to about 80%, about 80% to about 100%.In some cases, by the editorial efficiency of TiDE analysis measurement for PD-1 It can be 85%, can be 90% for CISH.In some cases, insertion and deletion percentage can be measured in GMP trial operation.Example Such as, it can be sequenced by Sanger and TIDE analysis is formed to analyze the upper target insertion and deletion of final cell product.It can be always From the about 1x10 of control and laboratory sample⁶Genomic DNA is extracted in a cell, and is subjected to using in disrupted gene The PCR that the primer of (such as CISH) flank carries out.TIDE software program analysis Sanger sequencing chromatogram can be used, which can To quantify the size distribution of insertion and deletion frequency and insertion and deletion by comparing compareing and knocking out sample.

Method disclosed herein, which may also include, introduces at least one guide RNA or nucleic acid into cell or embryo, for example, compiling The DNA of at least one guide RNA of code.The endonuclease enzyme interacting that guide RNA can be instructed with RNA is with by the endonuclease Guidance is to specific target site, at the site, before the specificity in 5 ' ends of guide RNA and chromosome sequence between region sequence into Row base pairing.

Guide RNA may include two kinds of RNA, for example, CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). Guide RNA may include the single guidance formed by a part (for example, funtion part) fusion of crRNA and tracrRNA sometimes RNA(sgRNA).Guide RNA can also be the dual RNA comprising crRNA and tracrRNA.Guide RNA may include crRNA and lack Weary tracrRNA.In addition, crRNA can hybridize with target DNA or preceding region sequence.

As discussed above, guide RNA can be expression product.For example, the DNA of coding guide RNA can be and include Encode the carrier of the sequence of guide RNA.It can be by the way that with isolated guide RNA or Plasmid DNA, (it includes the sequences of coding guide RNA Column and promoter) cell or organism are transfected, guide RNA is transferred in cell or organism.It can also otherwise, such as Guide RNA is transferred in cell or organism using virus-mediated gene delivery.

Guide RNA can be separated.For example, guide RNA can be transfected into cell or organism in the form of isolated RNA In.Guide RNA can be prepared by using the in-vitro transcription of any in-vitro transcription system.Can in the form of isolated RNA and It is not that guide RNA is transferred in cell with the plasmid form of the coded sequence comprising guide RNA.

Guide RNA may include DNA target to section and protein binding section.DNA target to section (DNA target to sequence or Every sequence) comprising can be complementary with particular sequence (for example, preceding region sequence) in target DNA nucleotide sequence.Protein binding area Section (or protein binding sequence) can be with site-directed modification polypeptide, for example, the endonuclease such as Cas albumen of RNA guidance is mutual Effect." section " means segment/portion/region of molecule, for example, the continuous nucleotide segment in RNA.Section however, may also mean that multiple Fit region/part, so that section may include the region of more than one molecule.For example, in some cases, targeting DNA's The protein binding section of RNA is a kind of RNA molecule, therefore the protein binding section includes the region of the RNA molecule.In other feelings Under condition, the protein binding section for targeting the RNA of DNA includes the two independent molecules hybridized along complementary region.

Guide RNA may include two independent RNA molecules or single rna molecule.Exemplary unimolecule guide RNA includes DNA target is to both section and protein binding section.

The RNA of two molecular dnas of illustrative targeting may include crRNA sample (" CRISPR RNA " or " targeting object-RNA " or " crRNA " or " crRNA repetitive sequence ") molecule and corresponding tracrRNA sample (" trans-acting CRISPR RNA " or " activation because Son-RNA " or " tracrRNA ") molecule.It may include DNA target to section (for example, spacer region) and one that first RNA molecule, which can be, The crRNA sample molecule (targeting object-RNA) of section nucleotide, this section of nucleotide can form the protein binding section comprising guide RNA The half of double-stranded RNA (dsRNA) duplex.Second RNA molecule can be may include one section of nucleotide corresponding tracrRNA Sample molecule (activity factor-RNA), this section of nucleotide can form the another of the dsRNA duplex of the protein binding section of guide RNA Half.In other words, one section of nucleotide of crRNA sample molecule can be complementary with one section of nucleotide of tracrRNA sample molecule and be hybridized, with Form the dsRNA duplex of the protein binding domain of guide RNA.So, it may be said that each crRNA sample molecule has accordingly TracrRNA sample molecule.CrRNA sample molecule can be additionally provided single stranded DNA targeting section or intervening sequence.Therefore, crRNA sample point Son and tracrRNA sample molecule (as corresponding pairing) can hybridize to form guide RNA.Two molecule guide RNA of theme may include appointing What corresponding crRNA and tracrRNA pairs.

The DNA target of guide RNA can be with the sequence at target site in chromosome sequence (for example, preceding to section or intervening sequence Between region sequence) it is complementary so that the DNA target of guide RNA can carry out base pairing with the target site or preceding region sequence to section.In Under some cases, the DNA target of guide RNA may include or comprising about 10 nucleotide extremely or to about 25 nucleotide or more to section Multiple nucleotide.For example, base-paired regions between target site in the first area and chromosome sequence of guide RNA can be with For or can be about 10,11,12,13,14,15,16,17,18,19,20,22,23,24,25 or more than 25 nucleotide Length.Sometimes, the first area of guide RNA can be or can be about the length of 19,20 or 21 nucleotide.

Guide RNA can target the nucleic acid sequence of 20 nucleotide or about 20 nucleotide.Target nucleic acid can be less than or less than about 20 nucleotide.Target nucleic acid can be at least or at least about 5,10,15,16,17,18,19,20,21,22,23,24,25,30 Or more nucleotide.Target nucleic acid can be at most or at most about 5,10,15,16,17,18,19,20,21,22,23,24,25, 30 or more nucleotide.Target nucleic acid sequence can be 5 ' 20 bases or about 20 close to first nucleotide of PAM A base.Guide RNA can target nucleic acid sequence.Instruct polynucleotide such as guide RNA can be bound to it is any in table 5 or table 6 Sequence has at least or at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or at most about The genome sequence of 100% sequence identity and/or sequence similarity.In some cases, instruct polynucleotide such as guide RNA can To combine about 1 base-pair of distance PAM to the genome area of about 20 base-pairs.Instruct object can in conjunction with distance PAM about 1, 2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 or at most about 20 base-pairs genome area.

CISH guide RNA (gRNA) target sequence that table 5 is engineered

SEQ ID	gRNA No.	Exon	Target 5 ' -3 '
				70	1	2	TTGCTGGCTGTGGAGCGGAC
71	2	2	GACTGGCTTGGGCAGTTCCA
				72	3	2	TGCTGGGGCCTTCCTCGAGG
73	4	2	CCGAAGGTAGGAGAAGGTCT
				74	5	2	ATGCACAGCAGATCCTCCTC
75	6	2	AGAGAGTGAGCCAAAGGTGC
				76	1	3	GGCATACTCAATGCGTACAT
77	2	3	GGGTTCCATTACGGCCAGCG
				78	3	3	AAGGCTGACCACATCCGGAA
79	4	3	TGCCGACTCCAGCTTCCGTC
				80	5	3	CTGTCAGTGAAAACCACTCG
81	6	3	CGTACTAAGAACGTGCCTTC

The genome sequence of engineering gRNA targeting, which is listed in table 5 and table 6, to be shown.Figure 22 shows repairing for targeting CISH gene The gRNA of decorations.

6 AAVS1gRNA target sequence of table

SEQ ID	Gene	GRNA sequence (5 ' to 3 ')
			82	AAVS1	GTCACCAATCCTGTCCCTAG-

Nucleic acid is instructed, for example, can refer to can be with another nucleic acid (for example, the target nucleic acid in cellular genome or preceding for guide RNA Region sequence) hybridization nucleic acid.Nucleic acid is instructed to can be RNA.Nucleic acid is instructed to can be DNA.Instruct nucleic acid that can be programmed to or set It counts into site-specific fashion in conjunction with nucleic acid sequence.Instructing nucleic acid may include a polynucleotide chain, and be referred to alternatively as Singly instruct nucleic acid.Instructing nucleic acid may include two polynucleotide chains, and is referred to alternatively as two fingers and leads nucleic acid.

Instructing nucleic acid may include one or more modifications, to provide new or enhancing feature for nucleic acid.Instruct nucleic acid It may include nucleic acid affinity tag.Instructing nucleic acid may include nucleotide analog, the nucleotide derivative of the nucleotide of synthesis, synthesis And/or the nucleotide of modification.

Instruct nucleic acid may include can hybridize with the sequence (for example, preceding region sequence) in target nucleic acid, for example positioned at 5 ' end or 3 ' ends or the nucleotide sequence (for example, spacer region) near it.Instruct the spacer region of nucleic acid can be by hybridization (i.e. base pairing) It is interacted with sequence-specific fashion and target nucleic acid.Intervening sequence can be located at before between region sequence adjacent to the 5 ' of motif (PAM) Or 3 ' side target nucleus acid hybridization.The length of intervening sequence can be at least or at least about 5,10,15,16,17,18,19,20,21, 22,23,24,25,30 or more nucleotide.The length of intervening sequence can be at most or at most about 5,10,15,16,17, 18,19,20,21,22,23,24,25,30 or more nucleotide.

Guide RNA also may include the duplex region dsRNA to form secondary structure.For example, the second level formed by guide RNA Structure may include stem (or hair clip) and ring.The length of ring and stem can change.For example, ring can be in about 3 to about 10 nucleotide In the range of length, and stem can be in the range of about 6 to about 20 base pairs lengths.Stem may include one or more 1 to about The protrusion of 10 nucleotide.The total length of second area can be in the range of about 16 to about 60 length of nucleotides.For example, ring It can be or can be about the length of 4 nucleotide, and stem can be or can be about 12 base-pairs.DsRNA duplex area Domain may include the endonuclease that can be instructed with rna binding protein such as RNA, such as Cas albumen forms the protein binding of complex Section.

Guide RNA also may include that can be tail region that is substantially single-stranded, being located at 5 ' or 3 ' ends.For example, tail region sometimes not with Any chromosome sequence in interested cell is complementary and sometimes not complementary with the rest part of guide RNA.In addition, tail The length in area can change.Tail region can be more than or more than about 4 nucleotide length.For example, the length of tail region can be Or about 5 to or to about 60 length of nucleotides in the range of.

Guide RNA can be used as RNA molecule and be introduced into cell or embryo.For example, RNA molecule can transcribe in vitro and/ Or it can be with chemical synthesis.Then guide RNA can be used as RNA molecule and be introduced into cell or embryo.Guide RNA can also be with non- RNA nucleic acid molecules, such as the form of DNA molecular are introduced into cell or embryo.For example, the DNA of coding guide RNA can be with starting Sub- control sequence is operably connected, for expressing guide RNA in interested cell or embryo.RNA coded sequence can To be operably connected with the promoter sequence identified by rna plymerase iii (Pol III).

The DNA molecular of coding guide RNA can also be linear.The DNA molecular of coding guide RNA can also be annular 's.The DNA sequence dna of coding guide RNA is also possible to a part of carrier.Some examples of carrier may include plasmid vector, phagocytosis Grain, clay, artificial/minichromosome, transposons and viral vectors.For example, the DNA of the endonuclease of coding RNA guidance is deposited It is in plasmid vector.Other non-limiting examples of suitable plasmid vector include pUC, pBR322, pET, pBluescript And its variant.In addition, carrier may include other expression control sequence (for example, enhancer sequence, Kozak sequence, polyadenylic acid Change sequence, transcription terminator etc.), selected marker sequence (for example, antibiotics resistance gene), replication orgin etc..

When the endonuclease of RNA guidance and guide RNA are both used as DNA molecular to be introduced into cell, each A part of different molecular be can be (for example, a carrier containing fusion protein coded sequence and containing guide RNA code sequence The Second support of column), or both can be a part of identical molecule (for example, the volume containing both fusion protein and guide RNA One carrier of code (and regulation) sequence).

Cas albumen such as Cas9 albumen or its any derivative can be compound in advance with guide RNA, to form ribonucleoprotein (RNP) complex.RNP complex can be introduced into primary immune cells.RNP complex can periodically be introduced.It can be in the cell cycle G1, S and/or M phase make cell and other cells Synchronous.RNP complex can be delivered in cell stage, be enhanced HDR. RNP complex can promote the reparation of homology guidance.

Guide RNA can also be modified.The modification may include chemical modification, synthetic modification, nucleotide addition and/or core Thuja acid is reduced.The modification can also enhance CRISPR genome project.Modify the chirality of changeable gRNA.In some cases, hand Property can be consistent after modification or three-dimensional pure (stereopure).Guide RNA can be synthesized.The guide RNA of synthesis can Enhance CRISPR genome project.Guide RNA can also be truncated.Truncation can be used for reducing undesirable miss the target (off-target) Mutagenesis.Truncation may include any number of nucleotide deletion.For example, to truncate may include 1,2,3,4,5,10,15,20,25,30, 40,50 or more nucleotide.Guide RNA may include the target complementarity region of any length.For example, target complementarity region can Think the length less than 20 nucleotide.Target complementarity region can be the length more than 20 nucleotide.Target complementarity region The about 5bp to about 20bp with PAM sequence direct neighbor can be targeted.Target complementarity region can target and the direct phase of PAM sequence Adjacent about 13bp.

In some cases, the effect for instructing polynucleotide can be tested by trial operation.For example, it is more to test guidance Function effect of the nucleic acid in the primary human T-Cells from three independent donors.It can be in a manner of identical with Patient Sample A Carry out reagent delivering.Effect can be determined by the way that target gene group locus is sequenced, and inserting in each donor Entering deletion frequency can achieve or more than 50%.In some cases, can by target gene group locus be sequenced come Determine effect, and the insertion and deletion frequency in each donor can achieve or more than 60%.In some cases, Ke Yitong Cross and target gene group locus be sequenced to determine effect, and the insertion and deletion frequency in each donor can achieve or More than 65%.In some cases, effect can be determined by the way that target gene group locus is sequenced, and in each confession Insertion and deletion frequency in body can achieve or more than 70%.In some cases, can by target gene group locus into Row sequencing is to determine effect, and the insertion and deletion frequency in each donor can achieve or more than 75%.

Any means can be used CRISPR system is introduced into a cell or multiple cells.In some cases, may be used To introduce CRISPR system by electroporation or nuclear transfection.For example, can be usedTransfection system (ThermoFisher Scientific electroporation) is carried out, or also can be usedNucleofector( Biosystems) by delivery of nucleic acids into cell.Adjustable Electroporation parameters are to optimize transfection efficiency and/or cell viability. Electroporation device can have the pulse of a variety of electric wave forms to be arranged, such as exponential damping, time constant and square wave.Every kind of cell type With unique best field strength (E), which depends on the pulse parameter (for example, voltage, capacitor and resistance) applied.Most The induction transmembrane voltage that is applied through of good field strength causes electro-osmosis, so that nucleic acid be made to pass through cell membrane.It in some cases, can be with Electroporative pulses voltage, electroporative pulses width, pulse number, cell density and Tip styles are adjusted to optimize transfection efficiency And/or cell viability.

In some cases, Neon transfection system can be used.Neon system can be three component electroporation devices, packet Central control module is included, it can the electroporation chamber for being wired to central control module by 3 feet long and dedicated liquid relief Device.In some cases, dedicated pipettor can be equipped with replaceable and/or disposable sterile tip.In some cases, Electroporation chamber can be equipped with replaceable and/or disposable sterile electroporation cuvette.In some cases, by system (example Such as Neon system) manufacturer provide standard electroporation buffer can be replaced with the solution or buffer for meeting GMP.One In a little situations, standard electroporation buffer can be replaced with GMP grades of phosphate buffered salines (PBS).Start sample electroporation it Before, self-diagnosable system inspection can be executed, in control module to ensure that Neon system is correctly run.In some cases, turn Dye can carry out in the indoor 1,000 grades of Biohazard Safety Equipments of 10,000 grades of cleanings of cGMP facility.Trained medical technology Personnel can use asptic technique in entire manufacturing process, and finally can be with the aseptic of test product.

In some cases, thus it is possible to vary electroporative pulses voltage is to optimize transfection efficiency and/or cell viability.Some In the case of, electroporation voltage is smaller than about 500 volts.In some cases, electroporation voltage can at least about 500 volts, at least About 600 volts, at least about 700 volts, at least about 800 volts, at least about 900 volts, at least about 1000 volts, at least about 1100 volts, at least about 1200 volts, at least about 1300 volts, at least about 1400 volts, at least about 1500 volts, at least about 1600 volts, at least about 1700 volts, at least About 1800 volts, at least about 1900 volts, at least about 2000 volts, at least about 2100 volts, at least about 2200 volts, at least about 2300 volts, extremely Few about 2400 volts, at least about 2500 volts, at least about 2600 volts, at least about 2700 volts, at least about 2800 volts, at least about 2900 volts or At least about 3000 volts.In some cases, electroporative pulses voltage needed for best transfection efficiency and/or cell viability can be It is special to cell type.For example, 1900 volts of electroporation voltage may be optimal (for example, providing most for macrophage High vigor and/or transfection efficiency).In another example, about 1350 volts of electroporation voltage is for Jurkat cell or original It may be optimal (for example, highest vigor and/or transfection efficiency are provided) for human cell's such as T cell.In some cases, A certain range of electroporation voltage may be optimal for given cell type.For example, about 1000 volts to about 1300 volts Electroporation voltage may be optimal (for example, providing highest vigor and/or transfection efficiency) for people's 578T cell.

In some cases, thus it is possible to vary electroporative pulses width is to optimize transfection efficiency and/or cell viability.Some In the case of, electroporative pulses width is smaller than about 5 milliseconds.In some cases, electroporation width can at least about 5 milliseconds, At least about 6 milliseconds, at least about 7 milliseconds, at least about 8 milliseconds, at least about 9 milliseconds, at least about 10 milliseconds, at least about 11 milliseconds, extremely About 12 milliseconds, at least about 13 milliseconds, at least about 14 milliseconds, at least about 15 milliseconds, at least about 16 milliseconds, at least about 17 milliseconds few, At least about 18 milliseconds, at least about 19 milliseconds, at least about 20 milliseconds, at least about 21 milliseconds, at least about 22 milliseconds, at least about 23 millis Second, at least about 24 milliseconds, at least about 25 milliseconds, at least about 26 milliseconds, at least about 27 milliseconds, at least about 28 milliseconds, at least about 29 Millisecond, at least about 30 milliseconds, at least about 31 milliseconds, at least about 32 milliseconds, at least about 33 milliseconds, at least about 34 milliseconds, at least about 35 milliseconds, at least about 36 milliseconds, at least about 37 milliseconds, at least about 38 milliseconds, at least about 39 milliseconds, at least about 40 milliseconds, at least About 41 milliseconds, at least about 42 milliseconds, at least about 43 milliseconds, at least about 44 milliseconds, at least about 45 milliseconds, at least about 46 milliseconds, extremely It is about 47 milliseconds, at least about 48 milliseconds, at least about 49 milliseconds or at least about 50 milliseconds few.In some cases, best transfection efficiency And/or electroporative pulses width needed for cell viability can be it is special to cell type.For example, 30 milliseconds of electroporation arteries and veins Rushing width may be optimal (for example, providing highest vigor and/or transfection efficiency) for macrophage.In another example In, about 10 milliseconds of electroporation width may be optimal (for example, providing highest vigor and/or turning for Jurkat cell Contaminate efficiency).In some cases, a certain range of electroporation width may be optimal for given cell type.For example, About 20 milliseconds to about 30 milliseconds of electroporation width may be optimal (for example, providing highest vigor for people's 578T cell And/or transfection efficiency).

In some cases, thus it is possible to vary the number of electroporative pulses is to optimize transfection efficiency and/or cell viability.One In a little situations, electroporation may include single pulse.In some cases, electroporation may include more than one pulse.In some feelings Under condition, electroporation may include 2 pulses, 3 pulses, 4 pulses, 5 pulses, 6 pulses, 7 pulses, 8 pulses, 9 Pulse or 10 or more pulse.In some cases, electroporative pulses needed for best transfection efficiency and/or cell viability Number can be it is special to cell type.For example, the electroporation with single pulse may be best for macrophage (for example, highest vigor and/or transfection efficiency are provided).In another example, the electroporation with 3 pulses is for original It may be optimal (for example, highest vigor and/or transfection efficiency are provided) for cell.In some cases, a certain range of Electroporation width may be optimal for given cell type.For example, the electroporation pair with about 1 to about 3 pulse In human cell may be optimal (for example, highest vigor and/or transfection efficiency are provided).With any nucleic acid as described herein The efficiency that delivery platform (for example, nuclear transfection or electroporation) carries out genome destruction to cell can be or can be about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or more than 99.9%.

In some cases, thus it is possible to vary the initial cell density of electroporation is to optimize transfection efficiency and/or cell viability. In some cases, the initial cell density of electroporation is smaller than about 1x10⁵A cell.In some cases, of electroporation Beginning cell density can be at least about 1x10⁵A cell, at least about 2x10⁵A cell, at least about 3x10⁵A cell, at least about 4x10⁵A cell, at least about 5x10⁵A cell, at least about 6x10⁵A cell, at least about 7x10⁵A cell, at least about 8x10⁵It is a Cell, at least about 9x10⁵A cell, at least about 1x10⁶A cell, at least about 1.5x10⁶A cell, at least about 2x10⁶It is a thin Born of the same parents, at least about 2.5x10⁶A cell, at least about 3x10⁶A cell, at least about 3.5x10⁶A cell, at least about 4x10⁶It is a thin Born of the same parents, at least about 4.5x10⁶A cell, at least about 5x10⁶A cell, at least about 5.5x10⁶A cell, at least about 6x10⁶It is a thin Born of the same parents, at least about 6.5x10⁶A cell, at least about 7x10⁶A cell, at least about 7.5x10⁶A cell, at least about 8x10⁶It is a thin Born of the same parents, at least about 8.5x10⁶A cell, at least about 9x10⁶A cell, at least about 9.5x10⁶A cell, at least about 1x10⁷It is a thin Born of the same parents, at least about 1.2x10⁷A cell, at least about 1.4x10⁷A cell, at least about 1.6x10⁷A cell, at least about 1.8x10⁷It is a Cell, at least about 2x10⁷A cell, at least about 2.2x10⁷A cell, at least about 2.4x10⁷A cell, at least about 2.6x10⁷It is a Cell, at least about 2.8x10⁷A cell, at least about 3x10⁷A cell, at least about 3.2x10⁷A cell, at least about 3.4x10⁷It is a Cell, at least about 3.6x10⁷A cell, at least about 3.8x10⁷A cell, at least about 4x10⁷A cell, at least about 4.2x10⁷It is a Cell, at least about 4.4x10⁷A cell, at least about 4.6x10⁷A cell, at least about 4.8x10⁷A cell or at least about 5x10⁷ A cell.In some cases, the initial cell density of electroporation needed for best transfection efficiency and/or cell viability can be It is special to cell type.For example, 1.5x10⁶The electroporation initial cell density of a cell may be best for macrophage (for example, highest vigor and/or transfection efficiency are provided).In another example, 5x10⁶The electroporation starting of a cell is thin Born of the same parents' density may be optimal (for example, providing highest vigor and/or transfection efficiency) for human cell.In some cases Under, a certain range of electroporation initial cell density may be optimal for given cell type.For example, 5.6x10⁶Extremely 5x10⁷The electroporation initial cell density of a cell may be optimal (for example, providing highest for human cell's such as T cell Vigor and/or transfection efficiency).

In some cases, GUIDE-Seq analysis can be carried out to determine the specificity of engineering guide RNA.In Tsai, S. et al., " GUIDE-Seq enables genome-wide profiling of off-target cleavage by CRISPR system nucleases, " Nature, it discusses through CRISPR system nuclease in 33:187-197 (2015) The General Mechanism and scheme of the GUIDE-Seq spectrum analysis of the off-target cutting of progress.In order to be missed the target frequently by next-generation sequencing assessment Rate can use Cas9mRNA and guide RNA (such as anti-CISH gRNA) transfected with human primary T cells.It can be about 72 small after transfection When separate genomic DNA from the cell of transfection, and carry out PCR amplification in site of potentially missing the target.Wellcome can be used The potential site of missing the target of Trust Sanger Insisute Genome Editing database (WGE) algorithm prediction.It can be with base In selecting the candidate to miss the target site with the sequence homology of upper target site.In some cases, gRNA and genome be can use With the site of about 4 or less mispairing between target site.It misses the target site for each candidate, two primer pairs can be designed. PCR amplification can be obtained from the cell that untreated cell (control) and Cas9/gRNA are handled.PCR expansion can be merged Increase son.TruSeq Nano DNA library reagent preparation box (Illumina) the preparation library NGS can be used.250bp can be used Sample is analyzed on Illumina HiSeq machine with opposite end workflow.In some cases, each gRNA text can be obtained About 4,000 ten thousand, the library NGS that can be mapped reading.This can be equivalent to each candidate for gRNA and miss the target about the 450 of site, The average of 000 reading.In some cases, at genomic locus, the detection for the destruction that CRISPR is mediated can be located In the frequency down to 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2% or 0.1%.

Calculating prediction can be used to select to may be most to pacify for target gene (such as PD-1 and/or CISH functionality destroys) The candidate gRNA selected entirely.Then it can be used and the focus method of guidance predicted rule of thumb by the calculating in potential site of missing the target Test candidate gRNA.In some cases, gRNA miss the target safety assessment can using next-generation deep sequencing method come point The potential site of missing the target that analysis passes through the CRISPR design tool prediction for every kind of gRNA.In some cases, can choose with GRNA (rather than gRNA of perfect matching expected target) of any sequence having less than 3 mispairing in genome.Some In the case of, it can choose with any sequence in genome having less than 50,40,30,20,10,5,4,3,2 or 1 mispairing gRNA.In some cases, computer system or software can be used for by predicting low to miss the target possibility and provide candidate gRNA's Recommend.

In some cases, site of potentially missing the target: GUIDE-Seq and target can be identified at least one of using the following method To PCR amplification, and next-generation sequencing.In addition, modified cell (such as cell of Cas9/gRNA processing) can be subjected to core Type analysis is to identify any chromosomal rearrangement or transposition.

GRNA can be introduced with any function concentration.For example, gRNA can introduce cell with 10 micrograms.In other situations Under, gRNA can be introduced with 0.5 microgram to 100 micrograms.GRNA can with 0.5,5,10,15,20,25,30,35,40,45,50, 55,60,65,70,75,80,85,90,95 or 100 micrograms introduce.

Disclosed herein is a kind of methods of preparation engineering til cell, this method comprises: introducing comprising at least one modification At least one guide RNA (gRNA)；And introduce at least one endonuclease；Wherein the gRNA include and at least one At least one sequence of endogenous gene group complementation.In some cases, modification is single base at 5 ' ends, 3 ' ends, 5 ' ends to 3 ' ends Modification, the modification of 2 '-ribose or any combination thereof.Modification can be selected from base replacement, insertion, missing, chemical modification, physical modification, Stabilisation, purifying and any combination thereof.

In some cases, it is modified to chemical modification.Modification can be selected from 5 ' adenylates, 5 ' guanosines-triphosphoric acid cap, 5 ' N7- Methylguanosine-triphosphoric acid cap, 5 ' triphosphoric acid caps, 3 ' phosphoric acid, 3 ' thiophosphoric acids, 5 ' phosphoric acid, 5 ' thiophosphoric acids, Cis-Syn type chest Glycosides dimer, tripolymer, C12 spacer region, C3 spacer region, C6 spacer region, d spacer region, PC spacer region, r spacer region, spacer region 18, the modification of spacer region 9,3 ' -3 ', 5 ' -5 ' modifications, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, Cholesterol TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT- biotin, double biotins, PC biotin, psoralea corylifolia Plain C2, psoralen C6, TINA, 3 ' DABCYL, Black Hole Quencher (black hole quencher) 1, Black Hole Quencher 2, DABCYL SE, dT-DABCYL, IRDye QC-1, QSY-21, QSY-35, QSY-7, QSY-9, carboxyl connector, thiol linker, 2 ' Dezyribonucleoside analog purine, 2 ' dezyribonucleoside analog pyrimidines, ribonucleotide analog, 2 ' -0- methylriboses Nucleoside analog, sugar-modified analog, oscillatory/universal base, fluorochrome label, 2 ' fluoro RNA, 2 ' O- methyl RNAs, Methyl phosphonate, di-phosphate ester DNA, di-phosphate ester RNA, phosphorothioate dna, thiophosphate RNA, UNA, pseudouridine -5 ' - Triphosphoric acid, 5- methylcytidine -5 '-triphosphoric acid, 3 thiophosphoric acid 2-O- methyl esters or any combination thereof.

Polynucleotide as described herein can be modified.Modification can be carried out in any position of polynucleotide.It can be to single Polynucleotide carries out more than one modification.Polynucleotide can be gone through quality control after modification.In some cases, quality control can wrap Include PAGE, HPLC, MS or any combination thereof.Modification can be displacement, insertion, missing, chemical modification, physical modification, stabilisation, Purifying or any combination thereof.Polynucleotide can also be modified by following part: 5 ' adenylates, 5 ' guanosines-triphosphoric acid cap, 5 ' N⁷Methylguanosine-triphosphoric acid cap, 5 ' triphosphoric acid caps, 3 ' phosphoric acid, 3 ' thiophosphoric acids, 5 ' phosphoric acid, 5 ' thiophosphoric acids, Cis-Syn type Thymidine dimer, tripolymer, C12 spacer region, C3 spacer region, C6 spacer region, d spacer region, PC spacer region, r spacer region, spacer region 18, the modification of spacer region 9,3 ' -3 ', 5 ' -5 ' modifications, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, Cholesterol TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT- biotin, double biotins, PC biotin, psoralea corylifolia Plain C2, psoralen C6, TINA, 3 ' DABCYL, Black Hole Quencher 1, Black Hole Quencher 2, DABCYL SE, dT-DABCYL, IRDye QC-1, QSY-21, QSY-35, QSY-7, QSY-9, carboxyl connector, thiol linker, 2 ' dezyribonucleoside analogs are fast Purine, 2 ' dezyribonucleoside analog pyrimidines, ribonucleotide analog, 2 ' -0- methylribonucleotide analogs, sugar-modified class Like object, oscillatory/universal base, fluorochrome label, 2 ' fluoro RNA, 2 ' O- methyl RNAs, methyl phosphonate, di-phosphate ester DNA, di-phosphate ester RNA, phosphorothioate dna, thiophosphate RNA, UNA, pseudouridine -5 '-triphosphoric acid, 5- methylcytidine - 5 '-triphosphoric acids or any combination thereof.The gRNA of representative 2 ' O- methyl RNAs modification is shown in FIG. 22.In some cases, it repairs Decorations may be permanent.In some cases, modification may be temporary.In some cases, a variety of repair is carried out to polynucleotide Decorations.Polynucleotide modifies the physicochemical properties of changeable nucleotide, such as its conformation, polarity, hydrophobicity, chemical reactivity, base With Thermodynamic parameters or any combination thereof.

Modification is also possible to thiophosphoric acid ester interchange.In some cases, natural phosphodiester key can be easy to by nucleus Sour enzyme is degraded rapidly；And the modification of the internucleotide linkage carried out using the displacement of thiophosphate (PS) key can be to by cell Hydrolysis caused by degradation is more stable.Modification can increase the stability of polynucleotide.Modification can also enhance biological activity.In some feelings Under condition, the RNA polynucleotide of thiophosphate enhancing can inhibit RNase A, RNA enzyme T1, calf serum nuclease or its any group It closes.These properties allow by PS-RNA polynucleotide be used for high probability in vivo or in vitro be exposed to nuclease application in.Example Such as, thiophosphate (PS) key can be introduced between the last 3-5 nucleotide at the end of polynucleotide 5 ' or 3 ' ends, this can inhibit circumscribed Nuclease degradation.In some cases, phosphorothioate bond can be added to entire polynucleotide to reduce attacking for endonuclease It hits.

In some cases, modification can be screened.Screening may include but be not limited to test immunogenicity, test poison Property, test transcriptional efficiency, test translation efficiency or any combination thereof.In some cases, modification can not be immunogenicity. Modification can not be toxicity.In some cases, candidate modification is screened before being incorporated to polynucleotide.In other situations Under, the polynucleotide with different modifying is screened, to determine the immunogenicity for adding modification, toxicity, the level of effect Or any combination.In some cases, support that the ability of polynucleotide reverse transcription is screened for modification.In some cases, It is modified to pseudouridine -5 '-triphosphoric acid (see, for example, Figure 32).In other cases, it is modified to 5- methylcytidine -5 '-triphosphoric acid (see, for example, Figure 32).Modification may also include chiral change.

It can be by a variety of methods, for example, instructing polynucleotide by automation synthesis in solid state to assemble.It is solid that standard can be used Phase dna/RNA synthesis is to construct polynucleotide.Also synthesis program can be used to construct polynucleotide.It can also close manually or in a fully automatic manner At polynucleotide.In some cases, synthesis program may include 5 '-hydroxyl oligonucleotides being converted to corresponding 5 '-H- first Phosphonate ester monoesters is then oxidized to 5 '-phosphinylidyne imidazoles alkanoic acid esters (5 '-of activation in the presence of imidazoles Phosphorimidazolidate it), and is finally reacted on solid support with pyrophosphate.The program may include synthesis Purification step afterwards, such as PAGE, HPLC, MS or any combination thereof.

In some cases, it is modified to the addition of 3 thiophosphoric acid 2-O- methyl esters, is expressed as " m ".Phosphorothioate backbone can table It is shown as " (ps) ".The addition of 3 thiophosphoric acid 2-O- methyl esters can be carried out to 1 base to 150 bases.It can be to 1 base to 4 alkali Base carries out the addition of 3 thiophosphoric acid 2-O- methyl esters.2 bases can be carried out with the addition of 3 thiophosphoric acid 2-O- methyl esters.It can be to 4 bases Carry out the addition of 3 thiophosphoric acid 2-O- methyl esters.Modification is also possible to truncate.Truncate the truncation that can be 5 bases.In some cases Under, modification can at C-terminal and N-terminal nucleotide, such as: 5 ' [mG] (ps) [mG] (ps) [mG] (ps) [mU] (ps) UC CAU UAC GGC CAG CGG UUU UAG AGC UAG AAA UAG CAA GUU AAA AUA AGG CUA GUC CGU UAU CAA CUU GAA AAA GUG GCA CCG AGU CGG UG[mC](ps)[mU](ps)[mU](ps)[mU](ps)U 3’。

Instruct polynucleotide that there can be any base frequency.For example, instruct polynucleotide can have 29 A, 17 C, 23 G, 23 U, 3 mG, 1 mC and 4 mU.Instruct polynucleotide that there can be the nucleotide base of any ratio.For example, instructing polynucleotide Can have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 1-5%, 3-8%, 5-12%, 10-15%, 8- 20%, the adenine percentage of 15-25%, 20-30%, 25-35% or at most about 30-40%.Instruct polynucleotide that can have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 1-5%, 3-8%, 5-12%, 10-15%, 8-20%, 15- 25%, the cytimidine percentage of 20-30%, 25-35% or at most about 30-40%.Instruct polynucleotide and can have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 1-5%, 3-8%, 5-12%, 10-15%, 8-20%, 15-25%, The thymidine percentage of 20-30%, 25-35% or at most about 30-40%.Instruct polynucleotide and can have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 1-5%, 3-8%, 5-12%, 10-15%, 8-20%, 15-25%, 20- 30%, the guanine percentage of 25-35% or at most about 30-40%.Instruct polynucleotide and can have 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 1-5%, 3-8%, 5-12%, 10-15%, 8-20%, 15-25%, 20-30%, The uracil percentage of 25-35% or at most about 30-40%.Instruct polynucleotide that there can be about 1 to about 100 nucleotide.Guidance Polynucleotide can have about 1 to 30 single polynucleotides.Instruct polynucleotide that can have about 1 to 10,10 to 20 or 20 to 30 Single polynucleotides.

Polynucleotide (guiding polynucleic acid) can instructed (also referred to as to instruct polynucleotide using preceding test (guide polynucleic acid)) identity and effect.It is, for example, possible to use spectrophotometric analyses, RNA Ago-Gel Analysis, LC-MS, at least one of endotoxin analysis and sterile test determine identity and effect.In some cases, identity Test can determine clinic/therapeutical uses acceptable level.For example, acceptable spectrophotometric analysis result can be 14 ± 2 L/ bottles of μ, 5.0 ± 0.5mg/mL.Acceptable spectrophotometric analysis result can also be L/ bottles of ± 2 μ of about 10-20,5.0 ± L/ bottles of ± 2 μ of 0.5mg/mL or about 10-20, about 3.0 to 7.0 ± 0.5mg/mL.Instruct acceptable clinic/treatment of polynucleotide Size can be about 100 bases.Clinic/treatment size of polynucleotide is instructed to can be about 5 bases to about 150 bases.Guidance The clinic of polynucleotide/treatment size can be about 20 bases to about 150 bases.Instruct clinic/treatment size of polynucleotide can It is about 40 bases to about 150 bases.Clinic/treatment size of polynucleotide is instructed to can be about 60 bases to about 150 alkali Base.Clinic/treatment size of polynucleotide is instructed to can be about 80 bases to about 150 bases.Instruct clinic/treatment of polynucleotide Size can be about 100 bases to about 150 bases.Clinic/treatment size of polynucleotide is instructed to can be about 110 bases to about 150 bases.Clinic/treatment size of polynucleotide is instructed to can be about 120 bases to about 150 bases.

In some cases, the quality for instructing polynucleotide can be measured.Quality measurement can be analyzed by LC-MS.Quality can It is about 32,461.0amu.The quality for instructing polynucleotide that can have about 330,000amu to about 50,000amu.Instruct polynucleotide can Quality with about 30,000amu to 40,000amu, about 40,000amu to about 50,000amu.Quality, which can be, instructs multicore The sodium salt of acid.

In some cases, the level of endotoxin for instructing polynucleotide can be measured.Endotoxic clinic/treatment is subjected to water It is flat to be smaller than 3EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 10EU/mL.Endotoxic clinic/treatment can connect 8EU/mL is smaller than by level.Endotoxic clinic/treatment acceptable level is smaller than 5EU/mL.Endotoxic clinic/treatment Acceptable level is smaller than 4EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 3EU/mL.Endotoxic clinic/ Treatment acceptable level is smaller than 2EU/mL.Endotoxic clinic/treatment acceptable level is smaller than 1EU/mL.It is endotoxic to face Bed/treatment acceptable level is smaller than 0.5EU/mL.

In some cases, instruct polynucleotide that can undergo sterile test.The clinic of sterile test/treatment acceptable level can For 0 or by culture without growth indicate.The clinic of sterile test/treatment acceptable level may be less than 0.5% growth.It is sterile The clinic of test/treatment acceptable level may be less than 1% growth.

Therapeutic scheme

Disclosed herein is the cells that can be used for therapeutic scheme.For example, subject can receive to be engineered cell as treatment A part of the therapeutic scheme of cancer or disease.For some examples, therapeutic scheme can include: operation, chemotherapy, radiotherapy, immune suppression Preparation, immunostimulant, antifungal agent, antivirotic, antibiotic or antiemetic.In some cases, cell composition can be with With bone-marrow transplantation, using chemotherapeutant such as fludarabine, external beam radiotherapy (XRT), cyclophosphamide or antibody such as OKT3 or The T cell ablation therapy joint (for example, prior to, concurrently with, or after the therapy) that CAMPATH is carried out is applied to subject.One In a little situations, the cell of amplification can be applied before the surgery or later.In some cases, operation can be tumor resection Art.It can perform the operation to separate TIL.

By the application in progress, technical staff can determine the therapeutically effective amount of the cell for application.In Under some cases, about 5x10 is applied to subject¹⁰A cell.In some cases, about 5x10¹⁰The expression of a cell be applied to by The median dose of the cell of examination person.In some embodiments, about 5x10¹⁰A cell is for causing the therapeutic response in subject to be It is required.In some embodiments, at least about 1x10 is applied to subject⁶A cell, at least about 2x10⁶A cell, at least about 3x10⁶A cell, at least about 4x10⁶A cell, at least about 5x10⁶A cell, at least about 6x10⁶A cell, at least about 6x10⁶It is a Cell, at least about 8x10⁶A cell, at least about 9x10⁶A cell, 1x10⁷A cell, at least about 2x10⁷A cell, at least about 3x10⁷A cell, at least about 4x10⁷A cell, at least about 5x10⁷A cell, at least about 6x10⁷A cell, at least about 6x10⁷It is a Cell, at least about 8x10⁷A cell, at least about 9x10⁷A cell, at least about 1x10⁸A cell, at least about 2x10⁸A cell, At least about 3x10⁸A cell, at least about 4x10⁸A cell, at least about 5x10⁸A cell, at least about 6x10⁸A cell, at least about 6x10⁸A cell, at least about 8x10⁸A cell, at least about 9x10⁸A cell, at least about 1x10⁹A cell, at least about 2x10⁹It is a Cell, at least about 3x10⁹A cell, at least about 4x10⁹A cell, at least about 5x10⁹A cell, at least about 6x10⁹A cell, At least about 6x10⁹A cell, at least about 8x10⁹A cell, at least about 9x10⁹A cell, at least about 1x10¹⁰A cell, at least about 2x10¹⁰A cell, at least about 3x10¹⁰A cell, at least about 4x10¹⁰A cell, at least about 5x10¹⁰A cell, at least about 6x10¹⁰A cell, at least about 6x10¹⁰A cell, at least about 8x10¹⁰A cell, at least about 9x10¹⁰A cell, at least about 1x10¹¹A cell, at least about 2x10¹¹A cell, at least about 3x10¹¹A cell, at least about 4x10¹¹A cell, at least about 5x10¹¹A cell, at least about 6x10¹¹A cell, at least about 6x10¹¹A cell, at least about 8x10¹¹A cell, at least about 9x10¹¹A cell or at least about 1x10¹²A cell.For example, about 5x10 can be applied to subject¹⁰A cell.In another reality In example, with 3x10⁶A cell starts, which can be expanded to about 5x10¹⁰A cell, and applied to subject.In some feelings Under condition, cell is expanded to enough numbers to be used to treat.For example, 5x10⁷A cell can undergo rapid amplifying to generate foot Enough numbers are used for therapeutical uses.In some cases, it can be 5x10 for enough numbers of therapeutical uses¹⁰It is a.Any number Aim cell, which can be transfused, is used for therapeutical uses.For example, 1x10 can be transfused to patient⁶To 5x10¹²(including endpoints thereof) number Cell.The cell as much as possible that can be generated for them can be transfused to patient.In some cases, it is infused into thin in patient Born of the same parents are simultaneously not all engineering.For example, at least 90% cell being infused into patient can be engineering.In other situations Under, at least 40% cell being infused into patient can be engineering.Reach thin necessary to treatment effectively in patients The amount of born of the same parents can be changed according to the vigor and cell of cell by the efficiency of genetic modification.In some cases, thin after genetic modification The product (for example, multiplication) of born of the same parents' vigor can correspond to can be used to be applied to the therapeutic moieties of the cell of subject (therapeutic aliquot).In some cases, the increase of cell viability can correspond to apply in patients after genetic modification With the reduction for reaching cell concentration necessary to treatment effectively.

In some cases, method may include calculating and/or being applied in subject to subject to realize therapeutic response The amount of necessary engineering cell.In some embodiments, engineering cell necessary to realizing therapeutic response is calculated Amount includes the vigor of measurement engineering cell.In some embodiments, it in order to realize therapeutic response in subject, is applied to The cell of subject is living cells.In some embodiments, in order to realize therapeutic response in subject, at least about 95%, At least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, At least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, At least about 20%, at least about 15%, at least about 10% cell is living cells.In some embodiments, in order in subject Middle realization therapeutic response, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20%, at least about 15%, at least about 10% cell is in cellular genome In there are one or more endogenous genes or part thereof being destroyed.

In some cases, transplanted cells of adopting can be monitored by quantitative PCR (qPCR).Adopt the qPCR of transplanted cells Measurement can indicate that the modified cells being present in subject after pickup are horizontal.In some cases, it is thin that streaming can be used Born of the same parents' art monitors adoptive transfer cell.For example, Flow Cytometry Assay can determine level of the 4-1BB relative to TCR.In some feelings Under condition, unicellular TCR PCR can be carried out.Can after infusion the 40th day determining adoptive transfer cell level.It can be defeated The 5th after note, 10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95,100,105,110, 115,120,125,130,135,140,145,150,155,160,165,170,175,180,185,190,195 days or at most Identify within 200 days the level of adoptive transfer cell such as modified cells.

I. immunostimulant

In some cases, immunostimulant can be introduced cell or subject.Immunostimulant can be specificity Or it is nonspecific.Specific immuno-stimulators can provide antigentic specificity, such as vaccine or antigen.Nospecific immunity thorn Immune response or stimulation immune response can be enhanced in sharp agent.Non-specific immunostimulating agents can be adjuvant.Immunostimulant can Be vaccine, colony-stimulating agent, interferon, interleukin, virus, antigen, costimulation agent, immunogenic agents, immunomodulator or Immunotherapeutic agent.Immunostimulant can be cell factor such as interleukin.One or more cell factors can with it is of the invention thin Born of the same parents are concomitantly introduced into.Cell factor can be used to promote the cytotoxic T lymphocyte (tumor specific cytotoxicity including adoptive transfer Property T lymphocyte) it is expanded in tumor microenvironment.In some cases, IL-2 can be used for promoting the amplification of cell described herein. Cell factor such as IL-15 also can be used.Also can be used immunotherapy field in other relevant cell factors, as IL-2, IL-7, IL-12, IL-15, IL-21 or any combination thereof.In some cases, it is cultivated using IL-2, IL-7 and IL-15 of the invention Cell.Interleukin can be IL-2 or Aldesleukin.Aldesleukin can be applied with low dosage or high dose.High dose Ah Ground interleukin scheme may include intravenously applying Aldesleukin for every eight hours, is such as resistant to, is continued up to about 14 about 0.037mg/ The dosage of kg (600,000IU/kg).Immunostimulant (for example, Aldesleukin) can be applied in 24 hours after cell application With.Immunostimulant (for example, Aldesleukin) can be applied in a manner of infusion by through 15 minutes for every eight hours, and p cell is defeated At most about 4 days after note.Immunostimulant (for example, Aldesleukin) can with about 100,000IU/kg, 200,000IU/kg, 300,000IU/kg、400,000IU/kg、500,000IU/kg、600,000IU/kg、700,000IU/kg、800,000IU/ The dosage of kg, 900,000IU/kg or at most about 1,000,000IU/kg are applied.In some cases, Aldesleukin can be with About 100,000IU/kg to 300,000IU/kg, 300,000IU/kg to 500,000IU/kg, 500,000IU/kg to 700, The dosage of 000IU/kg, 700,000IU/kg to about 1,000,000IU/kg are applied.Immunostimulant (for example, Aldesleukin) 1 dosage can be applied to about 14 dosage.Immunostimulant (for example, Aldesleukin) can apply at least about 1 dosage, 2 dosage, 3 dosage, 4 dosage, 5 dosage, 6 dosage, 7 dosage, 8 dosage, 9 dosage, 10 dosage, 11 Dosage, 12 dosage, 13 dosage, 14 dosage, 15 dosage, 16 dosage, 17 dosage, 18 dosage, 19 dosage Or at most about 20 dosage.In some cases, immunostimulant such as Aldesleukin can apply about 1 dosage to 3 agent Amount, 3 dosage to 5 dosage, 5 dosage to 8 dosage, 8 dosage to 10 dosage, 10 dosage to 14 dosage, 14 A dosage is to 20 dosage.In some cases, Aldesleukin can apply more than 20 dosage.In some cases, exempt from Epidemic disease stimulant such as Aldesleukin can with cell order of administration or be administered simultaneously.For example, immunostimulant can be in Yue- 14、-13、-12、-11、-10、-9、-8、-7、-6、-5、-4、-3、-2、-1、0、1、2、3、4、5、6、7、8、9、10、11、12、13 It was applied until the about the 14th day.In some cases, immunostimulant such as Aldesleukin are the about the 0th after dosed cells group It was applied to the 4th day.In some cases, immunostimulant (for example, Aldesleukin) was about 10 minutes, 15 minutes, 20 points Clock, 30 minutes, 40 minutes, 50 minutes, 1 hour, application in periods of 2 hours or at most about 3 hours.In some cases, After immunostimulant (for example, Aldesleukin) can be engineered cell to application in about 24 hours before application is engineered cell It applies within about 4 days.Immunostimulant (for example, Aldesleukin) can application be engineered cell after the -7th, -6, -5, -4, -3, - 2, it applies within -1,0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 day or at most about 20 days.

Immunostimulant such as Aldesleukin can be used as disposable bottle and provide, the bottle contain as it is sterile, White to rice white lyophilized cake 22,000,000 IU (- 1.3mg) IL-2, in addition 50mg mannitol and 0.18mg dodecyl sulphate Sodium, being buffered to pH value with about 0.17mg sodium dihydrogen phosphate and 0.89mg disodium hydrogen phosphate is 7.5 (range is 7.2 to 7.8).Bottle It can be reconstructed with 1.2mL sterile water for injection (USP), gained concentration is 18,000,000 IU/ml or 1.1mg/mL.Diluent should be aligned The side of bottle, to avoid excess foam formation.Since bottle is free of preservative, reconstituted solutions should be used in 24 hours.Weight The Aldesleukin of structure can further be diluted with 5% human serum albumins (HSA) of 50mL.Before adding RIL-2, Ying Jiang HSA is added in diluent.In vial or PVC bag, reconstituted solutions are more than 1000 times (that is, 1mg/mL is extremely Dilution 1mcg/mL) is acceptable.Aldesleukin chemical stabilization 48 under refrigerated storage temperature and room temperature (2 ° -30 DEG C) is small When.The application of Aldesleukin can be calculated based on total weight.The final dilution of Aldesleukin can be defeated through 15 minutes Note.

In some cases, immunostimulant is colony stimulating factor.Colony stimulating factor can be G-CSF (Fei Gesi Pavilion).Filgrastim can be stored in the bottle of 300mcg/ml and 480ug/1.6ml.Filgrastim can be with hypodermic Mode daily administration.Filgrastim application can be about 5mcg/kg/ days.Filgrastim application can be about 1mcg/kg/ days, non- Geseting application can be about 2mcg/kg/ days, and Filgrastim application can be about 3mcg/kg/ days, and Filgrastim is applied can be with It is about 4mcg/kg/ days, Filgrastim application can be about 5mcg/kg/ days, and Filgrastim application can be about 6mcg/kg/ days, Filgrastim application can be about 7mcg/kg/ days, and Filgrastim application can be about 8mcg/kg/ days, and Filgrastim application can Think about 9mcg/kg/ days, Filgrastim application can be about 10mcg/kg/ days.In some cases, Filgrastim can be with About 0.5mcg/kg/ days to about 1.0mcg/kg/ days, about 1.0mcg/kg/ days to 1.5mcg/kg/ days, about 1.5mcg/kg/ days extremely About 2.0mcg/kg/ days, about 2.0mcg/kg/ days to about 3.0mcg/kg/ days, about 2.5mcg/kg/ days to about 3.5mcg/kg/ days, About 3.5mcg/kg/ days to about 4.0mcg/kg/ days, the application of about 4.0mcg/kg/ days to about 4.5mcg/kg/ days dosage.It can be with Filgrastim is persistently applied daily, until neutrophil count is at least about 1.0x10⁹/ L X 3 days or at least about 5.0x10⁹/L.Immunostimulant such as Aldesleukin can the -7th after application is engineered cell, -6, -5, -4, -3, -2, -1, 0, it applies within 1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19 day or at most about the 20th day.

II. chemotherapeutics

Chemotherapeutics or chemotherapy compound can be the chemical compound for treating cancer.It can be with disclosed T cell group Closing the chemotherapy cancer agents used includes but is not limited to mitotic inhibitor (vinca alkaloids).These inhibitor include length Spring new alkali, vinblastine, eldisine and Navelbine^TM(vinorelbine, 5 '-remove first F 81097 (5 '- noranhydroblastine)).In other cases, chemotherapy cancer agents include topoisomerase I inhibitor, such as camptothecine Compound.As used herein, " Comptothecin compounds " include Camptosar^TM(irinotecan hydrochloride), Hycamtin^TM(salt Sour topotecan) and other compounds derived from camptothecine and the like.It can be used for method disclosed herein and composition Another based chemotherapy cancer agents be podophyllotoxin derivative, such as Etoposide, Teniposide and mitopodozide.In the disclosure Hold other chemotherapy cancer agents for further contemplating that referred to as alkylating agent, which be alkylated the inhereditary material in tumour cell. These cancer agents include but is not limited to cis-platinum, cyclophosphamide, mustargen, trimethylene thio-phosphamide, Carmustine, white disappear Peace, Chlorambucil, lomustine (beusterine), uracil mustard, chlomaphazin and Dacarbazine.In the disclosure Hold the antimetabolite covered as chemotherapeutics.The example of the medicament of these types includes cytarabine, fluorouracil, first ammonia butterfly Purine, purinethol, imuran and procarbazine (procarbazine).It can be used for the another of method disclosed herein and composition One based chemotherapy cancer agents include antibiotic.Example includes but is not limited to Doxorubicin, bleomycin, dactinomycin D, soft red mould Plain (daunorubicin), mithramycin, mitomycin, mitomycin C and daunomycin.There are many of these compounds can Commercially available Liposomal formulation.Present disclosure further contemplates that other chemotherapy cancer agents, including but not limited to anti-tumour antibody, reach Carbazine, azacytidine, amsacrine, melphalan, ifosfamide and mitoxantrone.

T cell disclosed herein can be with other antitumor agents, including cytotoxic agent/antineoplastic and anti-angiogenic agent It is administered in combination.Cytotoxic agent/antineoplastic may be defined as attacking and killing the medicament of cancer cell.Some cytotoxic agents/anti- Tumour medicine can be alkylating agent, be alkylated the inhereditary material in tumour cell, for example, cis-platinum, cyclophosphamide, mustargen, three Methylene thio-phosphamide, Carmustine, busulfan, Chlorambucil, lomustine, uracil mustard, chlomaphazin And Dacarbazine.Other cytotoxic agent/antineoplastics can be the antimetabolite of tumour cell, for example, cytarabine, fluorine are urinated Pyrimidine, methotrexate (MTX), purinethol, imuran and procarbazine.Other cytotoxic agent/antineoplastics can be antibiosis Element, such as Doxorubicin, bleomycin, dactinomycin D, daunorubicin, mithramycin, mitomycin, mitomycin C and Dao Nuo Mycin.There are many commercially available Liposomal formulations of these compounds.Other cytotoxic agent/antineoplastics can be silk It divides inhibitor (vinca alkaloids).These inhibitor include vincristine, vinblastine and Etoposide.Other cell toxicants Property agent/antineoplastic include taxol and its derivative, L-ASP, anti-tumour antibody, Dacarbazine, azacytidine, Amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone and eldisine.

Anti-angiogenic agent also can be used.Suitable anti-angiogenic agent for disclosed method and composition includes Anti-VEGF antibody, including humanization and chimeric antibody, anti-vegf aptamer and antisense oligonucleotides.Other angiogenesis inhibitors Including angiostatin, Endostatin, interferon, interleukin-11 (including α and β), interleukin 12, retinoic acid and metalloproteinases- 1 and -2 tissue depressant (TIMP-1 and TIMP-2).Small molecule also can be used, including topoisomerase such as razoxane, have The Topoisomerase II inhibitors of anti-angiogenesis activity.

Other anticancer agents that can be applied in combination with disclosed engineering cell include but is not limited to: Acivicin；A Rou Compare star；NSC 305884；Acronine；Adozelesin；Aldesleukin；Hexamethylmelamine；Ambomycin；Acetic acid A Mei Anthraquinone；Aminoglutethimide；Amsacrine；Anastrozole；Anthramycin；Asparaginase；Asperline；Arastin；Azacitidine； Azetepa；Azotomycin；Batimastat；Benzcarbimine；Bicalutamide；Bisantrene hydrochloride；Bisnafide；Bizelesin；Sulfuric acid Bleomycin；Brequinar sodium；Bropirimine；Busulfan；Act-C；Calusterone；Caracemide；Carbetimer；Carboplatin；Card Mo Siting；Carminomycin Hydrochloride；Carzelesin；Cedefingol；Chlorambucil；Cirolemycin；Cis-platinum；Cladribine；First How sulfonic acid Chris holds in the palm (crisnatol mesylate)；Cyclophosphamide；Cytarabine；Dacarbazine；Dactinomycin D；Hydrochloric acid is soft Erythromycin；Decitabine；Dexormaplatin；Dezaguanine；Methanesulfonic acid Dezaguanine；Diaziquone；Docetaxel；Doxorubicin；Salt Sour Doxorubicin；Droloxifene；Droloxifene citrate；Dromostanolone propionate；Duazomycin；Edatrexate；Hydrochloric acid is according to fluorine bird Propylhomoserin；Elsamitrucin；Enloplatin；Enpromate；Epipropidine；Epirubicin hydrochloride；Erbulozole；Esorubicin hydrochloride；It is female Mo Siting；Estramustine phosphate sodium；Etanidazole；Etoposide；Etoposide phosphate；Etoprine；Fenfluorene hydrochloride；Method is pricked Draw shore；Suwei A amine；Floxuridine；Fludarabine phosphate；Fluorouracil；Flurocitabine；Fosquidone；Fostriecin sodium；Ji Xita Shore；Gemcitabine hydrochloride；Hydroxycarbamide；Hydrochloric acid darubicin；Ifosfamide；Ilmofosine；Interleukin I I (including white Jie of recombination Plain II or rIL2)；Intederon Alpha-2a；Interferon Alpha-2b；Interferon alfa-n1；Alferon N；Interferon beta-I a；Interferon gamma- I b；Iproplatin；Irinotecan hydrochloride；Lanreotide acetate；Letrozole；Leuprorelin acetate；Liarozole hydrochloride；Lometrexol sodium； Lomustine；Losoxantrone hydrochloride；Masoprocol；Maytansine；Mustine hydrochlcride；Megestrol acetate；Acetic acid U.S. human relations progesterone；It is American and French Logical sequence；Menogaril；Purinethol；Methotrexate (MTX)；Methotrexate sodium；Metoprine；Meturedepa；Mitindomide；Mitocarcin (mitocarcin)；Mitocromin (mitocromin)；Mitogillin；Mitomalcin；Mitomycin；Mitosper；Meter Tuo It is smooth；Mitoxantrone hydrochloride；Mycophenolic acid；Nocodazole；Nogalamycin；Ormaplatin；Oxisuran；Taxol；Pegaspargase；Pei Li Mycin；Pentamustine；Peplomycin sulfate；Perfosfamide；Pipobroman；Piposulfan；Hydrochloric acid Piroxantrone；Plicamycin；It is general Lome is smooth；Porfimer Sodium；Porfiromycin；Prednimustine；Procarbazine hydrochloride；Puromycin；Puromycin hydrochloride；Pyrazoles furan It mutters rhzomorph；Riboprine；Rogletimide；Safingol；Hydrochloric acid Safingol；Semustine；Simtrazene；Sparfosate sodium (sparfosate sodium)；Sparsomycin；Spirogermanium hydrochloride；Spiromustine；Spiroplatin；Streptonigrin；Streptozotocin；Sulphur chlorine Phenylurea；Talisomycin；Tecogalan sodium；Tegafur；Teloxandrone hydrochloride；M-THPC；Teniposide；Teroxirone；In testis Ester；Thiapurine；Thioguanine；Thio-tepa；Riboxamide；Tirapazamine；Citric acid toremifene；Acetic acid song support Dragon；Triciribine Phosphate；Trimetrexate；Glucuronic acid Trimetrexate；Triptorelin；Tubulozole hydrochloride；Uracil mustard； Urethimine；Vapreotide；Verteporfin；Vinblastine Sulfate；Vincristine sulphate；Eldisine；Vindesine sulfate；Sulfuric acid Vinepidine；Sulfuric acid vinglycinate；Sulfuric acid leurosine；Vinorelbine tartrate；Sulfuric acid vinrosidine；Sulfuric acid vinzolidine； Vorozole；Zeniplatin；Zinostatin；Zorubicin hydrochloride.Other anticarcinogens include but is not limited to: -1,25 dihydroxy of 20- table dimension Raw element D3；5-ethinyluracil；Abiraterone；Aclarubicin；Acyl group fulvene；Gland cyclopentanol；Adozelesin；White Jie of Ah Element；ALL-TK antagonist；Hexamethylmelamine；Ambamustine；amidox；Amifostine；Amino-laevulic acid；Amrubicin；Peace Acridine；Anagrelide；Anastrozole；Andrographolide；Angiogenesis inhibitors；Antagonist D；Antagonist G；Antarelix； Anti- back side morphogenetic proteins -1 (anti-dorsalizing morphogenetic protein-1)；Antiandrogen is (preceding Column gland cancer)；Antiestrogenic；Antineoplaston；Antisense oligonucleotides；Glycine aphidicolin；Apoptogene regulator；Apoptosis is adjusted Agent；Apurinic acid；ara-CDP-DL-PTBA；Arginine deaminase；asulacrine；Atamestane；Atrimustine； axinastatin 1；axinastatin 2；axinastatin 3；Azasetron；Azalomvcin；Azatyrosine；Berry is red Mycin III derivative；balanol；Batimastat；BCR/ABL antagonist；Benzo chlorin；Benzoyl Staurosporine； Beta-lactam derivatives；β-alethine；βclamycin B；Betulinic acid；BFGF inhibitor；Bicalutamide；Bisantrene；Double a word used for translations Third piperidinyl spermine；Bisnafide；Than bent pavilion A (bistratene A)；Bizelesin；breflate；Bropirimine；Cloth piece replaces It is smooth；Buthionine sulfoximine；Calcipotriol；Calcium Phospoprotein C；Camptothecin derivative；Canary pox IL-2；Capecitabine； Formamide-amino-triazole；Carboxyltriazole；CaRest M3；CARN 700；Cartilage source inhibitor；Carzelesin；Casein kinase Inhibitor (ICOS)；Chestnut spermine；Cecropin B；Cetrorelix；Chlorin；Chloro-quinoxaline sulfonamide；Western card forefront Element；Cis- porphyrin；Cladribine；Clomifene analog；Clotrimazole；It collides mycin A (collismycin A)；Collide mycin B (collismycin B)；Combretastatin A-4 4；Combretastatin analog；conagenin；crambescidin 816；Cray this Support；Nostoc element 8；Nostoc element A derivative；curacin A；Penta anthraquinone of ring；Cycloplatin (cycloplatam)；Fill in a mycin (cypemycin)；Cytarabine alkane phosphide (cytarabine ocfosfate)；Cytolytic factor；Hexestryl diphosphate (cytostatin)；Dacliximab；Decitabine；Dehydrogenated membrane ectexin B；The Rayleigh De She；Dexamethasone；Right ifosfamide； Dexrazoxane；Dexverapamil；Diaziquone；Didemnun B；didox；Diethyl removes first spermine；Dihydro -5-azacitidine；9- Dihydro taxol；Dioxa moldin (dioxamycin)；Diphenyl spiromustine；Docetaxel；22 alcohol；Dolasetron； Doxifluridine；Droloxifene；Dronabinol；It spends Ka-7038Ⅶ SA (duocarmycin SA)；Ebselen；Ecomustine； Edelfosine；Edrecolomab (edrecolomab)；Eflornithine；Elemene；Emitefur；Epirubicin；Ai Pulie It is special；Estramustine analog；Estrogen agonist；Estrogen antagonist；Etanidazole；Etoposide phosphate；Exemestane；Method Bent azoles；Fazarabine；Suwei A amine；Filgrastim；Finasteride；Flavopiridol；Flezelastine；fluasterone；Fluorine, which reaches, to be drawn Shore；Hydrochloric acid fluorine daunomycin (fluorodaunorunicin hydrochloride)；Forfenimex；Formestane；Good fortune department is bent Star；Fotemustine；Moral porphyrin gadolinium (gadolinium texaphyrin)；Gallium nitrate；Galocitabine；Ganirelix；Gelatinase suppression Preparation；Gemcitabine；Glutathione inhibitor；hepsulfam；Heregulin；Vitro By Hexamethylene Bisacetamide；Hypericin；Yi Ban Phosphonic acids；Idarubicin；Idoxifene；Idramantone；Ilmofosine；Ilomastat；Imidazo acridone (imidazoacridone)；Imiquimod；Immunostimulatory peptides；Insulin-like growth factor-1 receptor inhibitor；Interferon excitement Agent；Interferon；Interleukin；Iobenguane；Iodo Doxorubicin；4- ipomeanol；Iroplact；Irsogladine；Foreign country's lattice azoles (isobengazole)；Different high halichondrin B (isohomohalicondrin B)；Itasetron；Add this pula Nuo Li get (jasplakinolide)；Card Harrar Reed F (kahalalide F)；Triacetic acid piece spiral shell element-N (lamellarin-N triacetate)；Lanreotide；That mycin of thunder；Lenograstim；Sulfuric acid lentinan；Leibo statin (leptolstatin)；Come Bent azoles；LIF ELISA；Leucocyte alpha interferon；Leuprorelin+estrogen+progesterone；Leuprorelin；Levamisol；Benefit Ah azoles；Linear polyamine analogues；Two glycopeptide of lipophilicity；Lipophilicity platinum compounds；lissoclinamide7；Lobaplatin；Earthworm phosphorus Rouge；Lometrexol；Lonidamine；Losoxantrone；Lovastatin；Loxoribine；Lurtotecan；Moral porphyrin lutetium (lutetium texaphyrin)；lysofylline；Cleavage of peptide；Maitansine；Graceful promise statin A；Marimastat；Masoprocol；The suppression of mammary gland silk Albumen；Matrilysin inhibitor；Matrix Metalloproteinase Inhibitors；Menogaril；Mei Balong (merbarone)； meterelin；Methioninase (methioninase)；Metoclopramide；MIF inhibitor；Mifepristone；Miltefosine；Mirimostim； The double-stranded RNA of mispairing；Mitoguazone；Mitolactol；Mitomycin analogs；Mitonafide；Step eliminating toxic element fibroblast Growth factor-saporin；Mitoxantrone；Mofarotene；Molgramostim；Human chorionic gonadotrophin monoclonal antibody；Single phosphorus Acyl lipid A+Mycobacterial cell wall sk；Mopidamol；Multiresistant genes inhibitor；Based on controlling for multiple tumor supresser gene 1 It treats；Mustard anticancer agent (mustard anticancer agent)；Indian Ocean sponge B (mycaperoxide B)；Mycobacteria Cell wall extracts；myriaporone；N- Tacedinaline；N- substituted benzamide；Nafarelin；nagrestip；Na Luo Ketone+pentazocine；napavin；naphterpin；Nartograstim；Nedaplatin；Nemorubicin；Neridronic Acid；Peptide in neutrality Enzyme；Nilutamide；Nysa mycin；Nitric oxide modulator；Nitroxide antioxidant；nitrullyn；O6-BG；It is difficult to understand Bent peptide；okicenone；Oligonucleotides；Onapristone；Ondansetron；Ondansetron；oracin；Oral cytokine inducer； Ormaplatin；Osaterone；Oxaliplatin；oxaunomycin；Taxol；Paclitaxel analogs；Paclitaxel derivatives； palauamine；palmitoylrhizoxin；Pamidronic acid；Panaxytiol；Panomifene；parabactin；Moor Ze Nipu It is fixed；Pegaspargase；Peldesine (peldesine)；The more sodium sulphate of pentose；Pentostatin；Spray bent azoles (pentrozole)；Perfluor bromine Alkane；Perfosfamide；Perilla alcohol；Azophenlyene mycin (phenazinomycin)；Phenylacetate；Inhibitors of phosphatases；Picibanil (picibanil)；Pilocarpine hydrochloride；Pirarubicin；Piritrexim；placetin A；placetin B；Plasminogen swashs Being inhibitor；Platinum complex；Platinum compounds；- three amine complex of platinum；Porfimer Sodium；Porphyromycin；Prednisone；The double a word used for translations of propyl Pyridine ketone；Prostaglandin J2；Proteasome inhibitor；Immunomodulator based on albumin A；Inhibitors of protein kinase C；Microalgae albumen Kinase C inhibitors；Inhibitors of protein tyrosine phosphatase；Purine nucleoside phosphorylase inhibitor；Alizarinopurpurin；Methoxyl group pyrazoline Acridine；Pyridoxylated Hemoglobin Polyoxyethylene conjugate (pyridoxylated hemoglobin polyoxyethylene conjugate)；Raf antagonist；Raltitrexed；Ramosetron；Ras farnesyl protein transferase inhibitors；Ras inhibitor； Ras-GAP inhibitor；Demethylation retelliptine；Etidronic Acid rhenium Re 186；Rhizomycin；Ribozyme；RII vitaminamide (RII retinamide)；Rogletimide；Rohitukine；Romurtide；Roquinimex；rubiginone B1；ruboxyl；Safingol； saintopin；SarCNU；sarcophytol A；Sargramostim；1 analogies of Sdi；Semustine；Inhibitor derived from aging 1；There is oligonucleotide；Signal transduction inhibitor；Signal transduction modulators；Single chain antigen binding protein；Sizofiran；Suo Buzuo It is raw；Sodium Borocaptate；Sodium phenylacetate；solverol；SM-binding protein；Sonermin；Sparfosic Acid；Racemomycin D (spicamycin D)；Spiromustine；Si Naipanding；Spongistatin 1 (spongistatin 1)；Squalamine；Stem cell inhibits Agent；Stem cell division inhibitor；stipiamide；Stromelysin inhibitor (stromelysin inhibitor)； sulfinosine；Potent vasoactive intestines peptide antagonists；suradista；Suramin；Spherosin；The glycosaminoglycan of synthesis； Tallimustine；Tamosifen methiodide；Tauromustine；Tazarotene；Tecogalan sodium；Tegafur； tellurapyrylium；Telomerase inhibitor；M-THPC；Temozolomide；Teniposide；Ten oxide of tetrachloro (tetrachlorodecaoxide)；Four nitrogen arteries and veins (tetrazomine)；Thallus embryonin (thaliblastine)；Thiocoraline (thiocoraline)；Thrombopoietin；Thrombopoietin mimetics；Thymalfasin；Thymopoietin receptor stimulating agent； Thymotrinan；Thyrotropic hormone；The first purpurine (tin ethyl etiopurpurin) of ethyl tin；Tirapazamine；Dichloro two Luxuriant titanium (titanocene bichloride)；topsentin；Toremifene；The myeloid-lymphoid stem cell factor；Translation inhibitor；Wei Jia Acid；Triacetyluridine；Triciribine；Trimetrexate；Triptorelin；Tropisetron；Turosteride；Tyrosine kinase inhibitor； Tyrphostin (tyrphostin)；UBC inhibitor；Ubenimex；Urogenital sinus source property growth inhibitory factor (urogenital sinus-derived growth inhibitory factor)；Urokinase receptor antagonist；Vapreotide； variolin B；Red blood cell gene therapy vector system；Velaresol；Veratramine；verdins；Verteporfin；Vinorelbine； Visa spit of fland (vinxaltine)；vitaxin；R 83842；Zanoterone；Zeniplatin；Zilascorb (zilascorb)；Only him is taken charge of This ester of fourth.Any of above chemotherapeutics can be applied with clinical effective dose.Chemotherapeutics can also be after application be engineered cell - 14th, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1,0,1,2,3,4,5,6,7,8,9,10,11, 12, it applies within 13 days or at most about the 14th day.In some cases, subject can be with to the unresponsive refractory cancer of chemotherapeutics Disease.

III. antifungal agent

In some cases, antifungal therapy is applied to the subject for receiving engineering cell.Antifungal agent can be can The drug for killing fungi or fungi being prevented to grow.The target of antifungal agent may include sterol biosynthesis, DNA biosynthesis and β- Glucan biosynthesis.Antifungal agent can also be folate synthesis inhibitor or nucleic acid crosslinking agent.Folate synthesis inhibitor can be with It is the drug based on sulfanilamide (SN).For example, folate synthesis inhibitor can be the medicament for inhibiting the fungi synthesis of folic acid, or competitive suppression Preparation.Drug or folate synthesis inhibitor based on sulfanilamide (SN) can be methotrexate (MTX) or sinomin.In some cases, Antifungal agent can be nucleic acid crosslinking agent.Crosslinking agent can inhibit DNA the or RNA process in fungi.For example, crosslinking agent can be 5-flurocytosine can be the fluorinated analogues of cytimidine.5-flurocytosine can by be converted into cytoplasm 5 FU 5 fluorouracil come Inhibit the synthesis of both DNA and RNA.Other antifungal agents can be griseofulvin.Griseofulvin is by Penicillium griseofulvum The antifungal antibiotic that (Penicillium griseofulvum) is generated.Griseofulvin inhibits the mitosis of fungi, and It can be considered as crosslinking agent.Other crosslinking agent can be allyl amine (Naftifine and Terbinafine), in squalene epoxy Inhibit ergosterol synthesis under the level of enzyme；A kind of morpholine (morpholene) derivative (Amorolfine) inhibits etembonate It is carried out at subsequent step in alcohol approach.

In some cases, antifungal agent can come from one of polyenoid, azoles, allyl amine or echinocandin.One In a little embodiments, polyene antifungal agent is that amphotericin B, candicidin, filipin, Hamycin, natamycin, system are mould Rhzomorph or rimocidin.In some cases, antifungal agent may be from azoles family.Azole antifungal agent can inhibit wool steroid 14 α of alcohol-demethylase.Azole antifungal agent can be imidazoles, such as bifonazole, butoconazole, clotrimazole, econazole, sweet smell replace Health azoles, Isoconazole, ketoconazole, luliconazole, Miconazole, Omoconazole, Oxiconazole, Sertaconazole, sulconazole or tioconazole. Azole antifungal agent can be triazole, for example, albaconazole, Chinese mugwort Fluconazole, epoxiconazole, Fluconazole, Chinese mugwort Saperconazole, Itraconazole, Posaconazole, propiconazole, ravuconazole, terconazole or voriconazole.In some cases, azoles can be thiazole, such as Ah bar It is fragrant net.Antifungal agent can be allyl amine, such as Amorolfine, Butenafine, Naftifine or Terbinafine.Antifungal agent is also It can be echinocandin, such as anidulafungin, Caspofungin or mikafen.The other medicament that can be antifungal agent can be Aurones, benzoic acid, cyclopirox (ciclopirox), Flucytosine, griseofulvin, Haloprogin (haloprogin), support naphthalene Ester, undecenoic acid, crystal violet or peru balsam.

Those skilled in the art can suitably be determined based on the fungi of infected individuals using antifungal known to which kind of Object.In some cases, subject will receive Fluconazole and be engineered the combination of TIL, and engineering TIL includes at least part The genomic knockout of gene such as CISH.Antifungal therapy can prophylactically be applied.

The Fluconazole of 200mg tablet is available.In some cases, Fluconazole can with 50mg, 100mg, 150mg, The application of the form of 200mg, 250mg, 300mg, 350mg or at most about 400mg tablet.For not being resistant to the tested of oral preparation The intravenous application of person, Fluconazole for the 2MG/ML solution of injection to occur.Fluconazole should be quiet with 200mg/ hours maximums The application of arteries and veins injection rate.In some cases, infusion rates can be about 50mg/ hours to about 500mg/ hours.Infusion rates are also Can be about 20mg/ hours to about 30mg/ hours, about 30mg/ hours to about 40mg/ hours, it is about 40mg/ hours small to about 50mg/ When, about 50mg/ hours to about 60mg/ hours, about 60mg/ hours to about 70mg/ hours, it is about 70mg/ hours small to about 80mg/ When, about 80mg/ hours to about 90mg/ hours, about 90mg/ hours to about 100mg/ hours, about 100mg/ hours to about 120mg/ Hour, about 120mg/ hours to about 140mg/ hours, about 140mg/ hours to about 160mg/ hours, about 160mg/ hours are to about 180mg/ hours, about 180mg/ hours to about 200mg/ hours, about 180mg/ hours to about 220mg/ hours, about 220mg/ hours To about 240mg/ hours, about 240mg/ hours to about 275mg/ hours.

Antifungal agent can be applied with treatment effective dose.Treatment effective dose is to treat or prevent fungal infection but to controlling Treat the invalid dosage of cancer.For example, the antifungal agent such as Fluconazole of about 10mg to about 1000mg can be applied.It can apply about 10mg、20mg、30mg、40mg、50mg、60mg、70mg、80mg、90mg、100mg、125mg、150mg、175mg、200mg、 225mg、250mg、275mg、300mg、325mg、350mg、375mg、400mg、425mg、450mg、475mg、500mg、 525mg、550mg、575mg、600mg、625mg、650mg、675mg、700mg、725mg、750mg、775mg、800mg、 The Fluconazole of 825mg, 850mg, 875mg, 900mg, 925mg, 950mg, 975mg or at most about 1000mg.400mg can be applied Fluconazole.In some cases, antifungal agent application during cell therapy or can applied before cell therapy It is carried out after cell therapy.For example, Fluconazole application can the about the 0th day after dosed cells therapy (cell therapy introduce by That day of examination person) it was carried out to the about the 4th day.Antifungal agent can be after the completion of about 14 days before cell therapy is applied to cell therapy about It applies within 14 days.Antifungal agent can Yue -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1,0, 1,2,3,4,5,6,7,8,9,10,11,12,13 days or until the about the 14th day apply.

IV. immunosuppressor

In some cases, subject can receive a part of immunosuppressor as therapeutic scheme.Immunosuppressor It can refer to radiotherapy dose, biological agent or chemical agent.In some cases, immunosuppressor may include chemical agent.For example, chemical Medicine may include at least one below: cyclophosphamide, mustargen, Chlorambucil, melphalan, ifosfamide, thio-tepa, pregnancy Melamine, busulfan, fludarabine, nitroso ureas, platinum, methotrexate (MTX), imuran, purinethol, procarbazine, Dacca Bar piperazine, Temozolomide, Carmustine, lomustine, streptozotocin, fluorouracil, dactinomycin D, anthracycline, mitomycin C, Bleomycin and mithramycin.Chemical agent can be cyclophosphamide or fludarabine.

In addition, immunosuppressor may include glucocorticoid, cytostatics, antibody, albumen is exempted from anti-suppression or its any spreads out Biology.Glucocorticoid can inhibit allergy, inflammation and autoimmune disease.Glucocorticoid can be prednisone, Sai meter Song and hydrocortisone.Immunosuppressive therapy may include any treatment for inhibiting immune system.Immunosuppressive therapy can be helped Help alleviation, minimum or the graft-rejection for eliminating recipient.For example, immunosuppressive therapy may include immunosuppressive drug. Can before the transplant, during and/or after the immunosuppressive drug that uses include but is not limited to MMF (mycophenolate (Cellcept)), ATG (antithymocyte globulin), anti-CD154 (CD4OL), anti-CD40 (2C10, ASKP1240, CCFZ533X2201), alemtuzumab (Campath), anti-CD20 (Rituximab), anti-IL-6R antibody (Torr pearl monoclonal antibody, Actemra), anti-IL-6 antibodies (the triumphant pearl monoclonal antibody (olokizumab) of sarilumab, Oulu), CTLA4-Ig (Orencia/ Orencia), Bei Laxipu (LEA29Y), sirolimus (Rapimune), everolimus, tacrolimus (Prograf), Dary Pearl monoclonal antibody (Ze-napax), basiliximab (Simulect), infliximab (Remicade), cyclosporin, deoxidation essence Guanidine rhzomorph, sCR1, cobra-venom factor, compstatin, anti-C5 antibody (according to library pearl monoclonal antibody/Soliris), Methylprednisolone, FTY720, everolimus, leflunomide, anti-IL-2R-Ab, rapamycin, anti-CXCR3 antibody, anti-ICOS Antibody, anti-OX40 antibody and anti-CD122 antibody.In addition, a kind of or more than one immunosuppressor/drug can be used together or according to Secondary use.A kind of or more than one immunosuppressor/drug can be used for inductive treatment or for maintenance therapy.It can induce and tie up The stage is held using identical or different drug.In some cases, daclizumab (Zenapax) can be used for inductive treatment, and Tacrolimus (Prograf) and sirolimus (Rapimune) can be used for maintenance therapy.Daclizumab (Zenapax) also can be used In inductive treatment, and the sirolimus (Rapimune) of the tacrolimus (Prograf) of low dosage and low dosage can be used for maintaining Treatment.Non-drug scheme also can be used to realize immunosupress, which includes but is not limited to full-body exposure, thymus gland photograph It penetrates and whole and/or partial splenectomy.

In some cases, immunosupress can be used for dosed cells inhibitor.Cytostatics can inhibit cell point It splits.Cytostatics can be purine analogue.Cytostatics can be alkylating agent, antimetabolite such as methotrexate (MTX), sulphur azoles Purine or purinethol.Cytostatics can be cyclophosphamide, mustargen, Chlorambucil, melphalan, ifosfamide, thiophene TEPA, hexamethylmelamine, busulfan, fludarabine, nitroso ureas, platinum, methotrexate (MTX), imuran, purinethol, the third card Bar hydrazine, Dacarbazine, Temozolomide, Carmustine, lomustine, streptozotocin, fluorouracil, dactinomycin D, anthracycline, silk At least one of rimocidin C, bleomycin and mithramycin.

In some cases, immunosuppressor such as fludarabine can be used as a part application of therapeutic scheme.Fludarabine Phosphate can be the purine biosynthesis nucleosides different from physiological nucleosides, the difference is that saccharide part can be arabinose without It is ribose or deoxyribose.Fludarabine can be purine antagonist antimetabolite.Fludarabine can be made in 50mg bottle Form for white, the fludarabine phosphate powder of lyophilized solid cheese formula provides.With 2mL sterile water for injection reconstruct to After concentration is 25mg/ml, the pH of solution can be 7.7.Fludarabine powder can be stablized at least 18 months at 2-8 DEG C；Work as reconstruct When, fludarabine stable at least 16 days at room temperature.Because preservative is not present, the fludarabine of reconstruct usually will be at 8 hours Interior application.About specific compatibility information, special bibliography is please referred to.Fludarabine can in serum dephosphorylation, It transports in the cell and is converted into nucleotide fludarabine triphosphoric acid；This fluoro- ara-ATP molecule of 2- is considered as the thin of drug Necessary to cellular toxicity effect.Fludarabine inhibits archaeal dna polymerase, ribonucleotide reductase, DNA primase, and can be with Interfere chain extension and RNA and protein synthesis.Fludarabine can be in 100ml0.9% sodium chloride (USP) through 15 to 30 points Clock is applied in a manner of intravenous infusion.Dosage will be based on body surface area (BSA).If ob esity (BMI > 35), drug agent Amount will be calculated using actual weight.In some cases, about 20mg/m can be applied²To about 30mg/m²Subject's body surface area Immunosuppressor such as fludarabine.In some cases, about 5mg/m can be applied²To about 10mg/m²Subject's body surface area, about 10mg/m²To about 15mg/m²Subject's body surface area, about 15mg/m²To about 20mg/m²Subject's body surface area, about 20mg/m²Extremely About 25mg/m²Subject's body surface area, about 25mg/m²To about 30mg/m²Subject's body surface area, about 30mg/m²To about 40mg/m² The immunosuppressor of subject's body surface area such as fludarabine.In some cases, about 1mg/m can be applied²、2mg/m²、3mg/ m²、4mg/m²、5mg/m²、6mg/m²、7mg/m²、8mg/m²、9mg/m²、10mg/m²、11mg/m²、12mg/m²、13mg/m²、 14mg/m²、15mg/m²、16mg/m²、17mg/m²、18mg/m²、19mg/m²、20mg/m²、21mg/m²、22mg/m²、23mg/m²、 24mg/m²、25mg/m²、26mg/m²、27mg/m²、28mg/m²、29mg/m²、30mg/m²、31mg/m²、32mg/m²、33mg/m²、 34mg/m²、35mg/m²、36mg/m²、37mg/m²、38mg/m²、39mg/m²、40mg/m²、41mg/m²、42mg/m²、43mg/m²、 44mg/m²、45mg/m²、46mg/m²、47mg/m²、48mg/m²、49mg/m²、50mg/m²、51mg/m²、52mg/m²、53mg/m²、 54mg/m²、55mg/m²、56mg/m²、57mg/m²、58mg/m²、59mg/m²、60mg/m²、61mg/m²、62mg/m²、63mg/m²、 64mg/m²、65mg/m²、66mg/m²、67mg/m²、68mg/m²、69mg/m²、70mg/m²、71mg/m²、72mg/m²、73mg/m²、 74mg/m²、75mg/m²、76mg/m²、77mg/m²、78mg/m²、79mg/m²、80mg/m²、81mg/m²、82mg/m²、83mg/m²、 84mg/m²、85mg/m²、86mg/m²、87mg/m²、88mg/m²、89mg/m²、90mg/m²、91mg/m²、92mg/m²、93mg/m²、 94mg/m²、95mg/m²、96mg/m²、97mg/m²、98mg/m²、99mg/m²To about 100mg/m²Subject's body surface area is immunized Inhibitor such as fludarabine.In some cases, immunosuppressor such as fludarabine can be in 0.9% sodium chloride of 100ml (USP) 25mg/m in²Dosage application, and through about 15 to about 30 minutes be transfused.

In some cases, immunosuppressor such as cyclophosphamide can be used as a part application of therapeutic scheme.Cyclophosphamide It can be alkylating agent derived from mustargen.Cyclophosphamide plays the role of alkylating agent after being converted into active metabolite in liver；It should Drug also has effective immunosuppressive activity.The range of serum half-life after intravenous application is 3-12 hours；It is applying It is up to 72 hours afterwards, drug and/or its metabolin can be detected in serum.After being reconstructed according to guidance with sterile water for injection, Cyclophosphamide can be stablized 24 hours at room temperature or stablize when being maintained at 2-8 DEG C 6 days.Dosage is by the body based on subject Weight.As described, if subject's obesity (BMI > 35), drug dose will be calculated using actual weight.It in some cases, can be with About 1mg/kg to about 3mg/kg, about 3mg/kg to about 5mg/kg, about 5mg/kg to about 10mg/kg, about 10mg/kg are applied to about 20mg/kg, 20mg/kg are to about 30mg/kg, about 30mg/kg to about 40mg/kg, about 40mg/kg to about 50mg/kg, about 50mg/ Kg to about 60mg/kg, about 60mg/kg to about 70mg/kg, about 70mg/kg to about 80mg/kg, about 80mg/kg to about 90mg/kg, The immunosuppressor such as cyclophosphamide of about 90mg/kg to about 100mg/kg.In some cases, it applies tested more than 50mg/kg The immunosuppressor of person such as cyclophosphamide.In some cases, can apply about 1mg/kg, 2mg/kg, 3mg/kg, 4mg/kg, 5mg/kg、6mg/kg、7mg/kg、8mg/kg、9mg/kg、10mg/kg、11mg/kg、12mg/kg、13mg/kg、14mg/kg、 15mg/kg、16mg/kg、17mg/kg、18mg/kg、19mg/kg、20mg/kg、21mg/kg、22mg/kg、23mg/kg、24mg/ kg、25mg/kg、26mg/kg、27mg/kg、28mg/kg、29mg/kg、30mg/kg、31mg/kg、32mg/kg、33mg/kg、 34mg/kg、35mg/kg、36mg/kg、37mg/kg、38mg/kg、39mg/kg、40mg/kg、41mg/kg、42mg/kg、43mg/ kg、44mg/kg、45mg/kg、46mg/kg、47mg/kg、48mg/kg、49mg/kg、50mg/kg、51mg/kg、52mg/kg、 53mg/kg、54mg/kg、55mg/kg、56mg/kg、57mg/kg、58mg/kg、59mg/kg、60mg/kg、61mg/kg、62mg/ kg、63mg/kg、64mg/kg、65mg/kg、66mg/kg、67mg/kg、68mg/kg、69mg/kg、70mg/kg、71mg/kg、 72mg/kg、73mg/kg、74mg/kg、75mg/kg、76mg/kg、77mg/kg、78mg/kg、79mg/kg、80mg/kg、81mg/ kg、82mg/kg、83mg/kg、84mg/kg、85mg/kg、86mg/kg、87mg/kg、88mg/kg、89mg/kg、90mg/kg、 91mg/kg, 92mg/kg, 93mg/kg, 94mg/kg, 95mg/kg, 96mg/kg, 97mg/kg, 98mg/kg, 99mg/kg are to about The immunosuppressor of 100mg/kg subject such as cyclophosphamide.It in some cases, can be through at least about 1 day to about 3 days, 3 days To 5 days, 5 days to 7 days, 7 days to about 10 days, 10 days to 14 days, 14 days to about 20 days application immunosuppressor such as cyclophosphamide.In Under some cases, cyclophosphamide can be about the dosage of 60mg/kg, and be diluted in 5% glucose solution of 250ml and through 1 Hour infusion.

Immunosuppressor can be the scheme of such as cyclophosphamide and fludarabine.For example, can be thin to engineering is received The subject of born of the same parents' therapy applies cyclophosphamide fludarabine scheme.It can continue 2 days and 25mg/m once a day with 60mg/kg² Continue 5 days schemes once a day to apply cyclophosphamide fludarabine scheme.Engineering cell of the invention can applied 1 hour before to 14 days application chemotherapy regimens, such as cyclophosphamide fludarabine.Chemotherapy regimen can be applied with various dose. For example, subject can receive higher predose, then receive lower dosage.Subject can receive lower initial Then dosage receives higher dosage.

In some cases, immunosuppressor can be antibody.It can be with treatment effective dose administration of antibodies.Antibody can be more Clonal antibody or monoclonal antibody.The polyclonal antibody that can be applied can be antilymphocyte or anti-thymocyte antigen.Dan Ke Grand antibody can be anti-IL-2 receptor antibody, anti-CD 25 antibody or anti-cd 3 antibodies.Anti-CD 20 antibodies can also be used.B cell disappears Melt therapy, the medicament such as reacted with CD20 (such as Rituxan), it is also possible to make immunosuppressor.

Immunosuppressor can also be that albumen is exempted from anti-suppression.Anti- suppression exempts from albumen and can be cyclosporine, tacrolimus, everolimus Or sirolimus.Other immunosuppressor can be interferon such as IFN-β, opioid, anti-TNF bonding agent, mycophenolic acid Ester (mycophenolate) or fingomode.

Immunosuppressor can also refer to radiotherapy dose.Radiotherapy may include radiation.Whole body spoke can be applied with 12Gy It penetrates.Dose of radiation may include the 12Gy intergal dose to whole body (including health tissues).Dose of radiation may include 5Gy extremely 20Gy.Dose of radiation can be 5Gy, 6Gy, 7Gy, 8Gy, 9Gy, 10Gy, 11Gy, 12, Gy, 13Gy, 14Gy, 15Gy, 16Gy, 17Gy, 18Gy, 19Gy or at most 20Gy.Radiation can be total body radiation or local body radiation.It is total body radiation in radiation In the case of, radiation can be uniform or non-uniform.For example, when radiation may be uneven, the relatively narrow region such as neck of body Portion for example than wider region can receive higher dosage by buttocks.For example, in one embodiment, subject can undergo high agent Quantify the standard care treated, then carries out autologous peripheral blood stemcell transplant.In certain embodiments, after the transfer, subject connects By the infusion of the immunocyte of amplification of the invention.The dosage of above-mentioned treatment to apply to patient will be with the treated patient's condition The recipient of definite property and treatment and change.The variation of dosage for human administration can be according to art-recognized practice It carries out.For example, the dosage of CAMPATH usually will be in the range of 1 to about 100mg, and usual daily administration is held for adult patients Continuous 1 to 30 day period.Preferred daily dosage is 1 to 10mg/ days, but in some cases, up to 40mg/ can be used It larger dose (being described in U.S. Patent number 6,120,766).

V. antibiotic agent

It can a part to subject's administration of antibiotics as therapeutic scheme.Antibiosis can be applied with treatment effective dose Element.Antibiotic can kill bacterium or inhibit the growth of bacterium.Antibiotic can be broad-spectrum antibiotic, and broad-spectrum antibiotic can be with target To extensive bacterium.The broad-spectrum antibiotic in the 3rd generation or the 4th generation can be cephalosporin or quinolone.

Antibiotic can be narrow-spectrum antibiotic, and narrow-spectrum antibiotic can target certain types of bacterium.Antibiotic such as mould Element and cephalosporin can be with target bacterial cells walls.Antibiotic such as polymyxins can be with target cell membrane.Antibiotic can interfere Required bacterial enzyme, such as following antibiotic: rifamycin, lipiarmycin, quinolone and sulfanilamide (SN).Antibiotic can also be albumen Matter synthetic inhibitor, such as macrolide, lincosamide and tetracycline.Antibiotic can also be cyclic lipopeptide such as Daptomycin, sweet Aminoacyl ring element such as tigecycline, oxazolidone such as Linezolid and lipiarmycin such as feldamycin.

In some cases, antibiotic can be 1st generation, 2nd generation, the 3rd generation, the 4th generation or the 5th generation.1st generation antibiotic can With narrow spectrum.The example of 1st generation antibiotic can be penicillin (benzyl penicillin or ospen), cephalosporin (cephazoline, Cefoxitin, cefapirin, Cephalethin, Cefradine or cefadroxil).In some cases, antibiotic can be 2nd generation.2nd generation antibiotic can be penicillin (Amoxicillin or ampicillin), cephalosporin (cefuroxime, cephalo Meng More, Cefoxitin, Cefaclor, Cefprozil, Loracarbef).In some cases, antibiotic can be for the 3rd generation.3rd generation Antibiotic can be penicillin (carbenicillin and Ticarcillin) or cephalosporin (Cefixime, ceftriaxone, cephalo thiophene Oxime, Ceftizoxime and cefotaxime).Antibiotic can also be the 4th generation antibiotic.4th generation antibiotic can be Cefepime.It is anti- Raw element can also be for the 5th generation.5th generation antibiotic can be ceftaroline or cefpiro.

In some cases, antibiotic can be bacteria wall targeting agent, cell membrane targeting agent, bacterial enzyme agent interfering, sterilization Agent, protein synthesis inhibitor or bacteriostatic agent.Bacteria wall targeting agent can be penicillin derivative (green nucleic), cephalosporin (cephem), monobactam and carbapenem.Beta-Lactam antibiotic has sterilization or bacteriostasis, and by inhibiting bacterium The synthesis of the peptidoglycan layer of cell wall and work.In some cases, antibiotic can be protein synthesis inhibitor.Albumen Matter synthetic inhibitor can be ampicillin, serve as the irreversible inhibitor of enzyme transpeptidase, and enzyme transpeptidase is bacterium production Needed for raw cell wall.It is also the last stage that ampicillin, which inhibits the third of bacteria cell wall synthesis in binary fission, Eventually lead to cell cracking；Therefore, ampicillin usually has bacteriolysis.In some cases, fungicide can be head Spore rhzomorph or quinolone.In other cases, bacteriostatic agent is trimethoprim, sulfamethoxazole or pentamidinum.

In some cases, the medicament of prevention PCP pneumonia can be applied.For example, trimethoprim can be applied With sulfamethoxazole to prevent pneumonia.Trimethoprim and sulfamethoxazole (TMP/SMX；Exemplary sulfa drug) agent Amount can be it is oral three-times-weekly daily (discontinuous day) 1, apply in the chemotherapy of the first dosage or later and continue to It is about 6 months few, until the CD4 of at least continuous 2 laboratory researches, which is counted, is greater than 200.In some cases, it can apply The trimethoprim of 160mg.About 100 to about 300mg trimethoprim can be applied.It can apply about The trimethoamine of 100mg, 125mg, 150mg, 175mg, 200mg, 225mg, 250mg, 275mg or at most about 300mg are phonetic Pyridine.In some cases, sulfamethoxazole can be applied with 800mg.The sulfalene that about 500mg to about 1000mg can be applied is disliked Azoles.Can apply about 500mg, 525mg, 550mg, 575mg, 600mg, 625mg, 650mg, 675mg, 700mg, 725mg, The sulphur of 750mg, 775mg, 800mg, 825mg, 850mg, 875mg, 900mg, 925mg, 950mg, 975mg or at most about 1000mg Amine first oxazole.In some cases, TMP/SMX scheme can be applied with therapeutically effective amount.It can be with daily administration about 1X to about 10X TMP/SMX.Can with daily administration 1X, 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 11X, 12X, 13X, 14X, 15X, 16X, The TMP/SMX of 17X, 18X, 19X or at most about 20X.In some cases, TMP/SMX can be applied by week.For example, can be with every The TMP/SMX in week application 1X, 2X, 3X, 4X, 5X, 6X or at most about 7X.TMP/SMX scheme can be in dosed cells therapy such as TIL Afterwards Yue -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1,0,1,2,3,4,5,6,7,8,9,10, 11,12,13 days or until the about the 14th day apply.

Method as described in any one of claim 37 to 48, wherein the bacteriostatic agent before TIL about 8 days to described It applies at least 4 days after TIL.

In some cases, the subject with sulfanilamide (SN) allergy can receive pentamidinum.Pentamidinum can pass through gas Mist agent application.Each atomizer 300mg pentamidinum starts to apply and monthly continue within selected the last week, until CD4 is counted Reach 200 or more in follow-up laboratory research twice in succession, and continues at least six moon after chemotherapy.Pentamidinum can be used for pre- The generation of anti-PCP infection.Pentamidinum can be provided with the freeze-dried powder of 300mg bottle, and will be applied by atomizer.It can apply With about 300mg to the pentamidinum of about 500mg.In some cases, can apply about 100mg, 200mg, 300mg, 400mg, The pentamidinum of 500mg, 600mg, 700mg or at most about 800mg.

In some cases, bacteriostatic agent such as antibiotic can be before TIL, with the TIL simultaneously or after the TIL Application.In some cases, bacteriostatic agent can be before applying the TIL about 6 after the application to the TIL in about 14 days It applies within a month.

VI. antivirotic

In some cases, antivirotic can be used as a part application of therapeutic scheme.In some cases, can to by Examination person applies a part application of the herpesviral prophylactic as therapeutic scheme.Herpesviral prophylactic can be Valaciclovir (Valtrex).Valtrex is orally available to occur herpesvirus infection for preventing the subject that HSV serology is positive. Valtrex can be provided in the form of 500mg tablet.Valaciclovir can be applied with treatment effective dose.For example, can apply About 50mg, 75mg, 100mg, 125mg, 150mg, 175mg, 200mg, 225mg, 250mg, 275mg, 300mg, 325mg, 350mg、375mg、400mg、425mg、450mg、475mg、500mg、525mg、550mg、575mg、600mg、625mg、650mg Or the Valaciclovir of at most about 700mg tablet.If subject is resistant to be orally ingested, in the final dose of fludarabine Second day later starts to take orally Valaciclovir daily with the dosage of 500mg.Antiviral therapy can dosed cells therapy such as Yue -14 after TIL therapy, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1,0,1,2,3,4,5,6,7, 8,9,10,11,12,13 days or until the about the 14th day apply.

In some cases, subject possibly can not take oral drugs to prevent bleb.In these cases, Ke Yishi Use acyclovir.The sterile injection powder that acyclovir can be used as 500mg/ bottles provides.In some cases, can have with treatment Effect amount applies acyclovir.Can be administered orally about 50mg, 75mg, 100mg, 125mg, 150mg, 175mg, 200mg, 225mg, 250mg、275mg、300mg、325mg、350mg、375mg、400mg、425mg、450mg、475mg、500mg、525mg、 The acyclovir of 550mg, 575mg, 600mg, 625mg, 650mg or at most about 700mg.Can with daily administration 1X, 2X, 3X, 4X, The acyclovir of 5X, 6X or at most about 7X.Acyclovir can after dosed cells therapy such as TIL therapy Yue -14, -13, - 12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, -1,0,1,2,3,4,5,6,7,8,9,10,11,12,13 days or until It applies within about the 14th day.In some cases, acyclovir can be applied intravenously.For example, can with 1mg/kg to about 3mg/kg, about 3mg/kg to about 5mg/kg, about 5mg/kg to about 10mg/kg, about 10mg/kg to about 20mg/kg, 20mg/kg to about 30mg/kg, About 30mg/kg to about 40mg/kg, about 40mg/kg are to about 50mg/kg, about 50mg/kg to about 60mg/kg, about 60mg/kg to about 70mg/kg, about 70mg/kg to about 80mg/kg, about 80mg/kg to about 90mg/kg, about 90mg/kg to about 100mg/kg application Ah VACV.In some cases, application is more than the acyclovir of 50mg/kg.Acyclovir can be in 10mL sterile water for injection Middle reconstruct to concentration is 50mg/mL.Reconstituted solutions should use in 12 hours.Parenteral solutions can be diluted to 7mg/mL Or lower concentration and through 1 hour infusion to avoid injury of kidney.

Disease parameters

In some cases, disease levels can determine in order or simultaneously with therapeutic scheme or cell application.Target disease The disease levels of change can be measured as follows: complete response (CR): all target lesions disappear, and part responds (PR): most with baseline Long diameter (LD) summation is reference, and the summation of the LD of target lesion at least reduces 30%, progress (PD): since since the treatment The minimum LD summation of record is reference, and the LD summation of target lesion at least increases by 20%, or one or more new lesions occurs, surely Fixed disease (SD): both without enough reductions to meet PR, also without enough increases to meet PD (with the smallest LD summation For reference).In other cases, non-targeted lesion can be measured.The disease levels of non-targeted lesion can be complete response (CR): all non-targeted lesions disappear and Tumor Marker Levels normalization, endless total regression: one or more non-targeted diseases Become and continue, be in progress (PD): one or more new lesions occurs.The clearly progress of existing non-targeted lesion.

In some cases, it can be estimated that the best global response of the subject of experience therapeutic scheme and cell application.Most Good global response can be the best response recorded since treatment to progression of disease/recurrence (for progressive disease, with oneself Treating the minimum measured value recorded since starting is reference).The best response specified (assignment) of subject can be depended on In measuring and validation criteria is reached.The time for reaching progress can measure from randomization.

The evaluation of 7. lesion of table

Target lesion	Non-targeted lesion	New lesion	Overall response
				CR	CR	It is no	CR
CR	The non-non- PD of CR/	It is no	PR
				PR	Non- PD	It is no	PR
SD	Non- PD	It is no	SD
				PD	It is any	Yes/no	PD
It is any	PD	Yes/no	PD
				It is any	It is any	It is	PD

It is designated as PR or CR state, it is necessary to confirm that the variation of measurement of tumor value, the repetition are ground by repeating research Studying carefully should carry out at least about 4 weeks after first fit response criteria.In the case where SD, follow-up measurement must research enter after with 6-8 weeks minimum interval meets SD standard at least once.In some cases, the duration of global response can be from satisfaction The time (time of first record) of the measurement standard of CR/PR starts to measure, until recurrence or progressive disease is objectively recorded (for progressive disease, with the minimum measured value that has been recorded since since the treatment for reference) until first date of disease. The duration of overall complete response can measure since the time of the measurement standard of first fit CR, until objectively recording To first date of recurrent disease.The measurement of stable disease can from treatment, until meeting progression criterion, with The minimum measured value that is recorded is reference since since the treatment.

In some cases, ruler or slide calliper rule can be used and measure and record measurable disease with metric system representation.It can To carry out all baseline estimates when starting close to treatment as much as possible.When lesion is superficial (for example, skin tag and can touch And lymph node) and when being more than at least about 10mm using the diameter that slide calliper rule obtain, lesion is considered measurable.In Under some cases, colour phhotograpy can be carried out.

In other cases, computed tomography (CT) or magnetic resonance imaging (MRI) can be used.Can to 5mm or Smaller slice thickness carries out CT.If the slice thickness of CT scan is greater than 5mm, the minimal size that can measure lesion, which should be, is cut Twice of piece thickness.In some cases, FDG-PET scanning can be used.FDG-PET can be used for assessing new lesion.In baseline When be feminine gender FDG-PET, and in follow-up for positive FDG-PET be the sign of the progressive disease (PD) based on new lesion.Base Do not have when FDG-PET and follow-up when line for positive FDG-PET: if positive FDG-PET when follow-up corresponds to the pass CT card Real new disease location, then this is PD.If positive PDG-PET when follow-up correspond to disease location pre-existing on CT and Based on anatomical images, it may not be in progress, then this may not be PD.In some cases, abnormal in remaining radiography It is considered in the case where representing fibrosis or cicatrization, FDG-PET can be used for upgrading in a manner of being similar to biopsy Response to CR.Positive FDG-PET scanning lesion refers to the affine lesion of FDG, and intake is greater than correction for attenuation image and enclosed last week Twice of the intake of tissue.

In some cases, lesion assessment can be carried out.Complete response (CR) can be the disappearance of all target lesions.Appoint The short axle of what pathologic lymph node (target or non-target) may be decreased to less than 10mm.Part response (PR) can be target disease The diameter summation of change reduces at least 30%, is reference with the baseline summation of diameter.Progressive disease (PD) can be target lesion Diameter summation increase at least 20%, with minimum summation be reference.Other than relative increase 20%, summation must also be shown The absolute increase of at least 5mm.Stable disease (SD) is both without enough reductions to meet PR, also without enough increases to accord with PD is closed, is reference with the smallest diameter summation.

In some cases, it can be estimated that non-targeted lesion.The complete response of non-targeted lesion can be tumor markers Horizontal disappearance and normalization.The size of all lymph nodes must be non-pathologic (short axle is less than 10mm).If tumour mark Will object is initially higher than normal upper limit, then they must normalization so that patient is considered as complete clinical response.The non-non- PD of CR/ is The lasting and/or Tumor Marker Levels of one or more non-targeted lesions are kept above normal limit.Progressive disease can be with It is the appearance and/or the clearly progress of existing non-targeted lesion of one or more new lesions.Specific progress should not usually win Cross target pathological condition.

In some cases, best global response can be since treatment until progression of disease/recurrence is recorded most Good response.

Toxicity criterion

In some cases, the toxicity of therapeutic scheme or cell application can be determined.Toxicity test may include therapeutic scheme Toxicity, immune effect and antitumor effect.Toxicity research can use 3.0 editions progress toxicity of CTCAE and adverse events report It accuses.Specifically early stage toxicity related with engineering cell infusion (is and then applied after cell infusion with Aldesleukin The toxicity observed before) it is usually slight and may include generating heat, feeling cold, having a headache and uncomfortable.In application white Jie of Ah Occur after element but be considered applying related toxicity with engineering cell may include immune-mediated event, such as is leucoderma, short Temporary property uveitis, hearing loss and vestibular dysfunction.It can be increased before cell application using non-clear marrow scheme and be controlled The toxicity for the treatment of, because serious bone marrow suppression occurs in subject.In some cases, administered with high dose Aldesleukin Standard method can be continued administration until 3 or 4 grades of events occur.Most common 4 grades of events are lung and renal damage, and spirit The variation of state.These toxicity there may come a time when to need to be intubated the air flue to protect subject.In some cases, fatal concurrent Disease is possible, and it may be appropriate for carrying out treatment under the background of the metastatic cancer of threat to life.

In some cases, it may be undergone with the subject that therapeutic scheme as described herein or cell products are treated and the party Case or the relevant adverse events of cell products.Adverse events can be to people using occurring in the relevant therapeutic process of drug Any reaction, side effect or accident, no matter whether the event is considered related to treatment or has clinical meaning.Some In the case of, adverse events may include by clinically showing in the event of subjects reported and physical examination or Laboratory Evaluation The anomaly of work.New disease, symptom, sign or clinically significant laboratory abnormalities or the pre-existing patient's condition or exception Deterioration can be considered as adverse events.All adverse events, including clinically significant anomaly in Laboratory Evaluation, nothing By severity how, all will be by follow-up until being down to 2 grades or lower, except lymphopenia and alopecia.If it is expected that Adverse events will not be down to 2 grades or lower, then subject can stop treating.

In some cases, therapeutic scheme can be applied together with toxicity reducing agent.Toxicity reducing agent can be fever or Vomiting reduces agent.For example, mesna can be applied to reduce the toxicity such as Nausea and vomiting and diarrhea.

Mesna can be dilute solution (1 to 20mg/mL), and can be with physics and chemical stabilization at least 24 under refrigeration Hour.At room temperature, mesna can be chemical stabilization 48-72 hours in D5W, the chemical stabilization in D5W/0.45%NaCl 48-72 hours, or chemical stabilization 24 hours in 0.9%NaCl.Mesna can be diluted to small in D5W or 0.9%NaCl In or be equal to 20mg mesna/ml fluid concentration, and intravenously applied in a manner of continuous infusion.If ob esity (BMI > 35), drug dose will be calculated using actual weight.

In other cases, support drug in addition may include ondansetron hydrochloride.Ondansetron hydrochloride can be used for changing Nausea and vomiting is controlled during treating counterplan.It may cause headache, dizziness, myalgia, it is drowsiness, do not accommodate weakness.It is more rare Side effect include pectoralgia, low blood pressure, itch, constipation and the retention of urine.In other cases, frusemide can also be applied.Furan plug Rice can be used for increasing urination during Treated with Chemotherapy with Cyclophosphamide counterplan.Adverse reaction includes dizziness, dizziness, cacesthesia, void Weak, orthostatic hypotension, photaesthesia, fash and itch.

Method of administration

The method provided herein that can be for applying therapeutic scheme to the subject with patient's condition such as cancers.In Under some cases, cell composition can be provided with unit dosage forms (for example, the TIL (packet for example destroyed with CISH comprising TIL Include self TIL) cell composition).Cell composition comprising TIL (including self TIL) with CISH (for example, for example destroy TIL cell composition) can be resuspended in the solution and be transfused application.It is provided herein to can also be including immunostimulation Agent, immunosuppressor, antibiotic, antifungal agent, antiemetic, chemotherapeutics, radiotherapy and its any combination of therapeutic scheme.Including upper Dry doubling reconstruct in aqueous solution (for example, saline solution) can be frozen by stating any therapeutic scheme.In some cases, lead to It crosses selected from subcutaneous injection, intramuscular injection, intracutaneous injection, transdermal administration, intravenous (" i.v. ") application, intranasal administration, lymphatic vessel The approach of interior injection and oral administration is treated to apply (for example, cell therapy such as TIL, such as the TIL destroyed with CISH (are wrapped Include self TIL)).It in some cases, include the cell composition of TIL to subject's infusion by microtubular in lymphatic vessel.

Many drugs can be used as liquid, capsule, tablet or chewable tablet and be administered orally.Since oral route is the most convenient It and is usually most safe and generally the least expensive, therefore be a kind of most common approach.However, since drug is usually moved by alimentary canal Dynamic mode, oral route have limitation.For the drug of oral administration, can start to absorb in the stomach function regulating of oral cavity.However, Most drugs are usually from small intestinal absorption.Drug is by intestinal wall and enters liver, then transports its target site by blood flow. Intestinal wall and liver chemically change (metabolism) many drugs, to reduce the medication amount for reaching blood flow.It therefore, is the identical effect of generation Fruit, these drugs are usually administered in intravenous injection with smaller dose.

For subcutaneous route, insert the needle into the adipose tissue immediately below skin.Drug enters thin vessels after injection (capillary) is simultaneously entrained by the blood flow.Alternatively, drug reaches blood flow by lymphatic vessel.When the higher volume of drug products of needs When, intramuscular route is better than subcutaneous route.Since muscle is located at below skin and adipose tissue, longer syringe needle is used.Medicine Object is usually injected into the muscle of upper arm, thigh or buttocks.Drug is absorbed into the blood that the speed component in blood flow depends on muscle Supply: blood supply is more rare, and drug absorption the time it takes is longer.For intravenous route, syringe needle is inserted directly into quiet Arteries and veins.Solution containing drug can be administered with single dose or by continuous infusion.For infusion, solution is by gravity (from can roll over Folded polybag) it is mobile, or more commonly, the pipe that fine flexible pipe is moved in insertion vein is passed through by infusion pump and (is led Pipe), the vein is usually in forearm.In some cases, cell or therapeutic scheme infusion application.When infusion can carry out one section Between.For example, infusion can be a period of time dosed cells or therapeutic scheme through about 5 minutes to about 5 hours.Infusion can carry out About 5 minutes, 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 1 hour, 1.5 hours, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours or at most about 5 hours a period of time.

In some embodiments, using be intravenously applied in entire body quickly and delivered in a manner of well controlling Exact dose.Intravenous application is also used to irritation solution, if the irritation solution passes through subcutaneously or intramuscularly drug administration by injection, meeting Cause pain and injury tissue.Intravenous injection is more difficult to apply than subcutaneously or intramuscularly injection, because syringe needle or conduit are inserted It may be difficult for entering vein, if especially people is fat.When intravenous administration, drug is immediately transferred in blood flow simultaneously And it is intended to than being easier to work by the administration of any other approach.Therefore, it is quiet to monitor receiving closely by health care provider Whether the people injected in arteries and veins has drug just in action or causing the sign of undesirable side effect.In addition, passing through the way The effect for the drug that diameter is given tends to the persistently shorter time.Therefore, some drugs must be administered by continuous infusion with Keep its effect constant.For intrathecal route, between two vertebras inserting the needle into lower backbone and it is inserted into around spinal cord Space.Then by infusion of medicine intraspinal tube.Usually using a small amount of local anesthetic with anesthesia injection position.When need drug to big Brain, spinal cord cover their organized layer's (meninx) and generate quickly or when partial result using this approach, for example, for treating The infection of these structures.

Liquid more smaller than the drug applied by nasal can be atomized by the drug of sucking application via oral cavity Drop, so that drug can enter lung by tracheae (windpipe) (tracheae (trachea)).The depth that they enter lung depends on The size of drop.Lesser drop can enter it is deeper, this will increase the medication amount of absorption.In the inside of lung, they are absorbed into In blood flow.The drug of skin is applied to commonly used in its partial result, and is therefore most commonly used to treatment superficial skin disorder, example Such as psoriasis, eczema, skin infection (virus, bacterium and fungi), itch and dry skin.Drug is mixed with inert matter. According to the consistency of inert matter, preparation can be ointment, creme, lotion, solution, powder or gel.

In some cases, therapeutic scheme can be given according to the weight of subject.It is being determined as fat (BMI > 35) In subject, it may be necessary to use actual weight.BMI is calculate by the following formula: BMI=weight (kg)/[height (m)]²。

The ideal body weight of male may be calculated the ideal body weight of 50kg+2.3* (the inch number more than 60 inches) or women It may be calculated 45.5kg+2.3 (the inch number more than 60 inches).The subject for being more than its ideal body weight 20% can be calculated The weight of correction.The weight of correction can be the sum of ideal body weight+(0.4x (actual weight-ideal body weight)).In some cases Under, body surface area can be used for calculating dosage.Body surface area (BSA) can be calculate by the following formula: BSA (m2)=√ height (cm) * Weight (kg)/3600.

In some cases, the pharmaceutical composition including cell therapy can be administered alone by any approach or with pharmaceutically Acceptable carrier or excipient are applied together, and such application can be carried out with single dose and multiple dose.More specifically, Pharmaceutical composition can be with various pharmaceutically acceptable inert carriers with tablet, capsule, pastille, lozenge, hand sugar (hand Candies), the forms such as powder, spray, aqueous suspension, Injectable solution, elixir, syrup are combined.Such carrier Including solid diluent or filler, sterile aqueous media and various nonpoisonous organic solvents etc..In addition, can be by commonly used in this Such oral drug preparation is suitably sweetened and/or is seasoned by various types of reagents of classification.

In some cases, therapeutic scheme can be applied together with carrier or excipient.Illustrative carrier and excipient May include glucose, sodium chloride, sucrose, lactose, cellulose, xylitol, D-sorbite, maltitol (malitol), gelatin, PEG, PVP and any combination thereof.

In some cases, the percentage of excipient such as glucose or sodium chloride can be about 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5% or at most about 15%.

This document describes the methods of the disease (for example, cancer such as human primary gastrointestinal cancers) for the treatment of recipient comprising will include engineering The one or more cells (including organ and/or tissue) for changing cell are transplanted to recipient.It is transplanted and is made by genes within cells group Standby cell can be used for treating cancer.In some embodiments, the method for treating human primary gastrointestinal cancers includes: a) from tumor sample (example Such as, the tumor sample from the subject with human primary gastrointestinal cancers) obtain tumor infiltrating lymphocyte (TIL)；B) it is anti-to identify mutation Answering property TIL；And endogenous gene in the jump reaction TIL described in Cas nucleases or part thereof.In some embodiment party In case, tumor sample is made to be subjected to sequencing analysis, such as the sequencing of full sequencing of extron group, transcript profile or combinations thereof.In some implementations In scheme, identification includes introducing TIL using the peptide comprising mutation (for example, about 15 mer mutant peptides are until about 30 mer mutants Peptide, such as 25 mer mutant peptides) pulse antigen presenting cell (APC).In some embodiments, make TIL and expression of peptides APC contacts the reactivity to determine TIL.Peptide may include the Tumor mutations that can be targeted by TIL.For example, APC can express it is more Kind peptide, some peptides codings can be used for identifying the Tumor mutations of tumor response TIL.It those can be identified as having with isolated or purified There is the TIL of tumor response, and is used for genome project.In some cases, tumor response TIL can use CRISPR System carries out genome project.CRISPR system can be used for knocking out the endogenous gene in tumor response TIL, such as CISH. CRISPR system can be used for knocking out the endogenous gene in tumor response TIL, such as PD-1.In some embodiments, identify Including the TIL to be introduced to the antigen presenting cell (APC) using the polynucleotide electroporation comprising mutation.In some embodiments In, identification further comprises detection cell factor such as IL-2, IFN-γ, IL-6, threshing, cell Proliferation etc..

143页详细技术资料下载

上一篇：一种医用注射器针头装配设备

下一篇：产品和组合物

Tumor infiltrating lymphocyte and treatment method

相关技术

网友询问留言