Antibody or antigen binding fragment thereof and application thereof
阅读说明：本技术 一种抗体或其抗原结合片段及其应用 (Antibody or antigen binding fragment thereof and application thereof ) 是由 王征 徐云霞 郑雷雷 于 2021-09-07 设计创作，主要内容包括：本发明公开了一种抗体或其抗原结合片段及其应用。具体涉及一种抗体或其抗原结合片段,所述抗体包括重链可变区(VHH),所述重链可变区包括以下根据Kabat编号的互补决定区(CDR)或其突变：氨基酸序列如SEQ ID NO:9所示的CDR1；氨基酸序列如SEQ ID NO:13所示的CDR2；和氨基酸序列如SEQ ID NO:11或14所示的CDR3；其中,所述突变为在所述VHH的CDR1、CDR2、CDR3的氨基酸序列的基础上分别具有5、4、3、2或1个氨基酸的插入、缺失或替换。本发明制备获得的抗体对包含如SEQ ID NO:1所示的人α链的抗原具有高亲和力结合,序列新颖。(The invention discloses an antibody or an antigen binding fragment thereof and application thereof. In particular, an antibody or antigen binding fragment thereof, comprising a heavy chain variable region (VHH) comprising the following Complementarity Determining Regions (CDRs) numbered according to Kabat, or mutations thereof: CDR1 having an amino acid sequence set forth in SEQ ID NO. 9; CDR2 having an amino acid sequence set forth in SEQ ID NO. 13; and CDR3 having an amino acid sequence set forth in SEQ ID NO. 11 or 14; wherein the mutation is an insertion, deletion or substitution of 5, 4, 3, 2 or 1 amino acid on the basis of the amino acid sequences of CDR1, CDR2 and CDR3 of the VHH, respectively. The antibody prepared by the invention has high affinity binding to the antigen containing the human alpha chain shown as SEQ ID NO. 1, and has novel sequence.)
1. An antibody or antigen-binding fragment thereof, wherein the antibody comprises a heavy chain variable region (VHH), wherein the heavy chain variable region comprises the following Complementarity Determining Regions (CDRs) numbered according to Kabat or mutations thereof: CDR1 having an amino acid sequence set forth in SEQ ID NO. 9; CDR2 having an amino acid sequence set forth in SEQ ID NO. 13; and, CDR3 having an amino acid sequence set forth in SEQ ID NO. 11 or 14;
wherein the mutation is an insertion, deletion or substitution of 5, 4, 3, 2 or 1 amino acid on the basis of the amino acid sequences of CDR1, CDR2 and CDR3 of the VHH, respectively.
2. The antibody or antigen-binding fragment thereof of claim 1, wherein:
the mutation of the CDR1 is an amino acid substitution of R2N/G, T3L, F4V/A, S5D, S6V/R/G/N, Y7D/H and/or A8N/D on the amino acid sequence shown as SEQ ID NO. 9, and the amino acid sequence is preferably shown as any one of SEQ ID NO. 12, 15, 18, 21, 22 and 25;
and/or the mutation of the CDR2 is an amino acid substitution with M2T/S/N, W3Q, D6G and/or S7N on the amino acid sequence shown as SEQ ID NO. 13, and the amino acid sequence is preferably shown as any one of SEQ ID NO. 10, 16, 19, 23 and 26;
and/or the mutation of the CDR3 is an amino acid substitution with L4I/T or deletion, Q5D, E6G/V, and/or E7Q/S/P on the amino acid sequence shown as SEQ ID NO. 14, or an amino acid substitution with G9D and/or Y14F on the amino acid sequence shown as SEQ ID NO. 11, wherein the amino acid sequence is preferably shown as any one of SEQ ID NO. 17, 20, 24 and 27.
3. The antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the heavy chain variable region comprises the following Complementarity Determining Regions (CDRs) numbered according to Kabat:
a CDR1 amino acid sequence set forth in SEQ ID NO. 9; a CDR2 amino acid sequence set forth in SEQ ID NO. 10; and, the CDR3 amino acid sequence shown in SEQ ID NO. 11;
or, a CDR1 amino acid sequence as set forth in SEQ ID NO. 12; a CDR2 amino acid sequence set forth in SEQ ID NO. 13; and, the CDR3 amino acid sequence shown in SEQ ID NO. 14;
or, a CDR1 amino acid sequence set forth in SEQ ID NO. 15; a CDR2 amino acid sequence set forth in SEQ ID NO. 16; and, the CDR3 amino acid sequence shown in SEQ ID NO. 17;
or, the CDR1 amino acid sequence shown as SEQ ID NO. 18; a CDR2 amino acid sequence set forth in SEQ ID NO. 19; and, the CDR3 amino acid sequence shown in SEQ ID NO. 20;
or, a CDR1 amino acid sequence as set forth in SEQ ID NO. 21; a CDR2 amino acid sequence set forth in SEQ ID NO. 13; and, the CDR3 amino acid sequence shown in SEQ ID NO. 14;
or, the CDR1 amino acid sequence shown as SEQ ID NO. 22; a CDR2 amino acid sequence set forth in SEQ ID NO. 23; and, the CDR3 amino acid sequence shown in SEQ ID NO. 24;
alternatively, the CDR1 amino acid sequence shown as SEQ ID NO. 25; a CDR2 amino acid sequence set forth in SEQ ID NO. 26; and, the CDR3 amino acid sequence shown in SEQ ID NO. 27.
4. The antibody or antigen-binding fragment thereof of any one of claims 1-3, wherein the heavy chain variable region further comprises the framework region (FWR) of an alpaca antibody or human antibody.
5. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, wherein the antibody or antigen-binding fragment thereof is a VHH, a heavy chain antibody, a bispecific antibody or a multispecific antibody, preferably a VHH.
6. The antibody or antigen-binding fragment thereof of claim 5, wherein the VHH comprises an amino acid sequence as set forth in any one of SEQ ID NOs 2-8.
7. An isolated nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of claims 1-6.
8. A recombinant expression vector comprising the isolated nucleic acid of claim 7; preferably, the recombinant expression vector is a plasmid, cosmid, phage, or viral vector, preferably a retroviral vector, a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector.
9. A transformant comprising the recombinant expression vector of claim 8 in a host cell; preferably, the host cell is a yeast such as saccharomyces cerevisiae, a mold, a bacterium, or a cellular expression system.
10. A chimeric antigen receptor comprising the antibody or antigen-binding fragment thereof of any one of claims 1-6.
11. A genetically modified cell comprising the chimeric antigen receptor of claim 10;
preferably, the genetically modified cell is a eukaryotic cell, preferably an isolated human cell; more preferably immune cells such as T cells, or NK cells.
12. A method of making the antibody or antigen-binding fragment thereof of any one of claims 1-6, comprising the steps of: culturing the transformant according to claim 9, and obtaining the antibody or the antigen-binding fragment thereof from the culture.
13. An antibody drug conjugate comprising an antibody moiety comprising the antibody or antigen-binding fragment thereof of any one of claims 1-6 and a conjugate moiety;
preferably, the conjugate moiety comprises a detectable label, drug, toxin, cytokine, radionuclide, enzyme, or combination thereof, and the antibody moiety and conjugate moiety are conjugated via a chemical bond or linker.
14. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1-6, the chimeric antigen receptor of claim 10, the genetically modified cell of claim 11, and/or the antibody drug conjugate of claim 13;
preferably:
the pharmaceutical composition further comprises a pharmaceutically acceptable carrier; and/or the pharmaceutical composition is in a liquid dosage form, a gas dosage form, a solid dosage form and a semisolid dosage form, and/or the pharmaceutical composition can be administered through oral administration, injection administration, nasal administration, transdermal administration or mucosa administration.
15. A kit comprising kit a and kit B, wherein:
the kit a comprises the antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, the chimeric antigen receptor according to claim 10, the genetically modified cell according to claim 11, the antibody drug conjugate according to claim 13, and/or the pharmaceutical composition according to claim 14;
the kit B contains one or more selected from the group consisting of a hormonal agent, a targeted small molecule agent, a proteasome inhibitor, an imaging agent, a diagnostic agent, a chemotherapeutic agent, a radiotherapeutic agent, an immunosuppressive agent, an oncolytic drug, a cytotoxic agent, a cytokine, an activator of a costimulatory molecule, an inhibitor of an inhibitory molecule, and a vaccine.
16. A kit comprising the antibody or antigen-binding fragment thereof of any one of claims 1-6, the chimeric antigen receptor of claim 10, the genetically modified cell of claim 11, the antibody drug conjugate of claim 13, and/or the pharmaceutical composition of claim 14;
preferably, the kit further comprises (i) a means for administering the antibody or antigen-binding fragment thereof or chimeric antigen receptor or genetically modified cell or antibody drug conjugate or pharmaceutical composition; and/or (ii) instructions for use.
17. Use of an antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, a chimeric antigen receptor according to claim 10, a genetically modified cell according to claim 11, an antibody drug conjugate according to claim 13, a pharmaceutical composition according to claim 14, a kit of parts according to claim 15 and/or a kit of parts according to claim 16 for the preparation of a medicament for the treatment and/or prevention of a protein-mediated disease or disorder comprising an amino acid sequence as set forth in SEQ ID No. 1.
18. Use of the antibody or antigen binding fragment thereof according to any one of claims 1 to 6 for the detection of a protein comprising the amino acid sequence shown as SEQ ID No. 1, preferably said protein is selected from one or more of FSH, HCG, TSH, FSH-CTP and hLH.
19. A method for detecting a protein comprising an amino acid sequence as set forth in SEQ ID No. 1, comprising the step of detecting using an antibody or antigen-binding fragment thereof according to any one of claims 1 to 6, a chimeric antigen receptor according to claim 10, a genetically modified cell according to claim 11, an antibody drug conjugate according to claim 13, a pharmaceutical composition according to claim 14, a kit according to claim 15 and/or a kit according to claim 16.
Technical Field
The invention relates to the technical field of nano antibodies, in particular to an antibody or an antigen binding fragment thereof, and a preparation method and application of the antibody or the antigen binding fragment thereof.
Background
The anterior pituitary hormones include Human Chorionic Gonadotropin (HCG), Follicle Stimulating Hormone (FSH), follicle stimulating hormone CTP fusion protein (FSH-CTP), human luteinizing hormone (hLH), hormone secreted by anterior pituitary (TSH), which are all combined by alpha and beta units through ionic bonds and hydrophobic bonds, wherein the alpha subunit is a subunit shared by the anterior pituitary hormones, and the beta subunits are different and can be distinguished in immune activity.
HCG is a glycoprotein produced by the syncytiotrophoblast of placental chorion. The detection of HCG level in serum can provide clinical basis for diagnosis, differential diagnosis and prognosis judgment of HCG-related diseases such as early pregnancy, ectopic pregnancy, hydatidiform mole, incomplete abortion, spermatogonial testicular cancer and the like.
FSH is a gonadotropin released from the anterior pituitary and is important for mature follicular development in women and sperm development in men. The determination of serum follicle stimulating hormone has important significance for understanding the endocrine function of pituitary, indirectly understanding the functional states of hypothalamus and ovary, predicting ovulation time and diagnosing and treating infertility and endocrine diseases. The FSH-CTP refers to a CTP fusion protein of FSH, which functions to prolong the in vivo half-life of FSH.
hLH is a gonadotropic hormone secreted by the adenohypophysis, which acts primarily on the gonads, leading to follicle maturation, and further secretion of androgens, ovulation and the generation and maintenance of the corpus luteum. Can be clinically used for identifying the cause of amenorrhea, monitoring the ovulation period and the like. The monitoring of the ovulation period is helpful for diagnosing infertility and researching the action mechanism of contraceptive drugs.
TSH is one of the hormones secreted by the anterior pituitary, and its main function is to control and regulate the activity of the thyroid gland. The measurement of thyroid stimulating hormone in serum (plasma) is one of the important indicators for the diagnosis and treatment of hyperthyroidism and hypothyroidism and for the study of the hypothalamic-pituitary-thyroid axis. The kit is an indispensable tool in diagnosing thyroid hypofunction, and differentially diagnosing primary and secondary (hypothalamic or prolapsing) hypothyroidism and the like. TSH can be used as index for determining therapeutic effect in treating hyperthyroidism and hypothyroidism. In addition, it can be used to observe the storage function of pituitary TSH, and further distinguish between hypothalamic and pituitary lesions. TSH testing is a preliminary screening test to ascertain thyroid function. Small changes in free thyroid concentration will result in significant adjustment of TSH concentration in the opposite direction.
The hormone content in blood is low, and a sensitive, efficient and highly stable detection antibody is needed to effectively detect or monitor the hormone content in blood. The related antibodies of the prior art have the defects of low binding activity and the like, and no antibody capable of efficiently binding a common alpha chain such as HCG, FSH, hLH, TSH, FSH-CTP and the like exists.
One naturally occurring light chain-deficient antibody, the heavy chain antibody (hcAb), is present in alpaca serum. Whereas single domain heavy chain antibodies (sdabs) refer to genetically engineered antibodies consisting of only heavy chain antibody Variable regions (Variable regions), also known as VHH antibodies (Variable domains of heavywain-chain antibodies, VHH antibodies) or nanobodies (Nb) or single domain antibodies. Compared with the traditional antibody, the single domain antibody has the advantages of small molecular weight, high stability, good water solubility and the like.
Disclosure of Invention
The invention provides an antibody or an antigen binding fragment thereof, a preparation method thereof, and application thereof in detecting the heterodimeric protein or preparing a medicament, in order to overcome the defects of poor binding activity of the antibody and the heterodimeric protein comprising an alpha chain (SEQ ID NO:1) such as FSH, HCG, TSH, hLH, FSH-CTP and the like in the prior art. The antibody has good binding activity and high sensitivity to protein molecules (such as FSH, HCG, TSH, hLH, FSH-CTP and the like) containing the sequence shown as SEQ ID NO. 1, and the method is convenient and simple to operate when detecting the protein molecules (such as FSH, HCG, TSH, hLH, FSH-CTP and the like) containing the sequence shown as SEQ ID NO. 1.
The invention provides in a first aspect an antibody comprising a heavy chain variable region (VHH), wherein the heavy chain variable region comprises the following Complementarity Determining Regions (CDRs) numbered according to Kabat, or mutations thereof: CDR1 having an amino acid sequence set forth in SEQ ID NO. 9; CDR2 having an amino acid sequence set forth in SEQ ID NO. 13; and, CDR3 having an amino acid sequence set forth in SEQ ID NO. 11 or 14; wherein the mutation is an insertion, deletion or substitution of 5, 4, 3, 2 or 1 amino acid on the basis of the amino acid sequences of CDR1, CDR2 and CDR3 of the VHH, respectively.
Preferably, the mutation of the CDR1 is an amino acid substitution having R2N/G, T3L, F4V/A, S5D, S6V/R/G/N, Y7D/H, and/or A8N/D in the amino acid sequence shown as SEQ ID NO. 9, and the amino acid sequence is preferably shown as any one of SEQ ID NO. 12, 15, 18, 21, 22, 25; the mutation of the CDR2 is an amino acid substitution with M2T/S/N, W3Q, D6G and/or S7N on the amino acid sequence shown as SEQ ID NO. 13, and the amino acid sequence is preferably shown as any one of SEQ ID NO. 10, 16, 19, 23 and 26; the mutation of the CDR3 is an amino acid substitution with L4I/T or deletion, Q5D, E6G/V, and/or E7Q/S/P on the amino acid sequence shown as SEQ ID NO. 14, or an amino acid substitution with G9D and/or Y14F on the amino acid sequence shown as SEQ ID NO. 11, and the amino acid sequence is preferably shown as any one of SEQ ID NO. 17, 20, 24 and 27.
In a preferred embodiment, the heavy chain variable region comprises the sequence: a CDR1 amino acid sequence set forth in SEQ ID NO. 9; a CDR2 amino acid sequence set forth in SEQ ID NO. 10; and, the CDR3 amino acid sequence shown in SEQ ID NO. 11.
In a preferred embodiment, the heavy chain variable region comprises the sequence: a CDR1 amino acid sequence set forth in SEQ ID NO. 12; a CDR2 amino acid sequence set forth in SEQ ID NO. 13; and, the CDR3 amino acid sequence shown in SEQ ID NO. 14.
In a preferred embodiment, the heavy chain variable region comprises the sequence: a CDR1 amino acid sequence set forth in SEQ ID NO. 15; a CDR2 amino acid sequence set forth in SEQ ID NO. 16; and, the CDR3 amino acid sequence shown in SEQ ID NO. 17.
In a preferred embodiment, the heavy chain variable region comprises the sequence: 18, the CDR1 amino acid sequence shown as SEQ ID NO; a CDR2 amino acid sequence set forth in SEQ ID NO. 19; and, the CDR3 amino acid sequence shown in SEQ ID NO: 20.
In a preferred embodiment, the heavy chain variable region comprises the sequence: a CDR1 amino acid sequence set forth in SEQ ID NO: 21; a CDR2 amino acid sequence set forth in SEQ ID NO. 13; and, the CDR3 amino acid sequence shown in SEQ ID NO. 14.
In a preferred embodiment, the heavy chain variable region comprises the sequence: a CDR1 amino acid sequence set forth in SEQ ID NO. 22; a CDR2 amino acid sequence set forth in SEQ ID NO. 23; and, the CDR3 amino acid sequence shown in SEQ ID NO. 24.
In a preferred embodiment, the heavy chain variable region comprises the sequence: a CDR1 amino acid sequence set forth in SEQ ID NO. 25; a CDR2 amino acid sequence set forth in SEQ ID NO. 26; and, the CDR3 amino acid sequence shown in SEQ ID NO. 27.
See table 1 for details.
Table 1: CDR sequences corresponding to different antibodies (according to Kabat definition rules)
Antibodies
CDR1
SEQ NO ID:
CDR2
SEQ NO ID:
CDR3
SEQ NO ID:
Protein 2
GRTFSSYA
9
ITWSGDST
10
AARDRADSGSWWDY
11
Protein 3
GNLFSVDA
12
IMWSGDST
13
AARLQEEGWWDY
14
Protein 4
GGTFDRYN
15
IMWSGDNT
16
AARIQEQGWWDY
17
Protein 5
GRTASGYA
18
IMWSGGST
19
AARTDGSGWWDY
20
Protein 6
GRTVSSHA
21
IMWSGDST
13
AARLQEEGWWDY
14
Protein 7
GRTFSSYD
22
INWSGGST
23
AARQVPGWWDY
24
Protein 8
GRTFSNYA
25
ISQSGGST
26
AARDRADSDSWWDF
27
It is well known in the art that CDRs of an antibody can be defined in the art by a variety of methods, such as Kabat definition rules based on sequence variability (see Kabat et al, immunological protein sequences, fifth edition, national institutes of health, Besserda, Md. (1991)) and Chothia definition rules based on the position of the structural loop region (see J Mol Biol 273:927-48,1997), among others. In the present application, the amino acid sequences of the CDRs listed above are shown according to the Kabat definition rules, but it will be understood by those skilled in the art that the terms "CDR" and "complementarity determining region" of a given antibody or region thereof (e.g., variable region) are understood to encompass complementarity determining regions as defined by any one of the CDR definition rules known to those skilled in the art, unless otherwise specified. Although the scope of the present invention is defined based on the sequence shown in the Kabat definition rules, the amino acid sequences corresponding to the definition rules of other CDRs should also fall within the scope of the present invention.
The heavy chain variable region preferably further comprises a framework region (FWR) of an alpaca antibody or a human antibody.
Preferably, the antibody or antigen-binding fragment thereof is a VHH, a heavy chain antibody, a bispecific antibody or a multispecific antibody, preferably a VHH.
More preferably, the VHH comprises an amino acid sequence as set forth in any one of SEQ ID NO 2-8.
In a preferred embodiment, the VHH is an amino acid sequence as shown in any one of SEQ ID NOs 2-8.
In a preferred embodiment, the antibody or antigen-binding fragment thereof targets a protein comprising the amino acid sequence shown in SEQ ID NO. 1, preferably the protein comprising the amino acid sequence shown in SEQ ID NO. 1 is selected from one or more of FSH, HCG, TSH, FSH-CTP and hLH.
In a second aspect, the invention provides an isolated nucleic acid encoding an antibody or antigen-binding fragment thereof according to the first aspect of the invention.
The preparation method of the nucleic acid is a preparation method which is conventional in the field, and preferably comprises the following steps: obtaining the nucleic acid molecule for coding the antibody by a gene cloning technology, or obtaining the nucleic acid molecule for coding the antibody by an artificial complete sequence synthesis method.
Those skilled in the art know that the base sequence encoding the amino acid sequence of the above antibody may be appropriately introduced with substitutions, deletions, alterations, insertions or additions to provide a polynucleotide homolog. The polynucleotide homologue of the present invention may be prepared by substituting, deleting or adding one or more bases of a gene encoding the antibody sequence within a range in which the activity of the antibody is maintained.
In a third aspect, the invention provides a recombinant expression vector comprising an isolated nucleic acid as described in the second aspect of the invention.
The recombinant expression vector can be obtained by methods conventional in the art, namely: the nucleic acid molecules described herein are constructed by ligating them to various expression vectors. The expression vector is any vector conventionally used in the art so long as it can carry the aforementioned nucleic acid molecule. Preferably, the recombinant expression vector is a plasmid, cosmid, phage, or viral vector, preferably a retroviral vector, a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector.
In a fourth aspect, the present invention provides a transformant comprising the recombinant expression vector according to the third aspect of the present invention in a host cell.
The preparation method of the transformant may be a preparation method conventional in the art, for example: transforming the recombinant expression vector into a host cell. The host cell of the transformant is a variety of host cells which are conventional in the art, as long as the recombinant expression vector is stably self-replicating and the nucleic acid carried by the recombinant expression vector can be efficiently expressed. The recombinant expression plasmid is transformed into a host cell to obtain a recombinant expression transformant preferred in the present invention. Wherein the transformation method is a transformation method conventional in the art, preferably a chemical transformation method, a thermal shock method or an electric transformation method.
Preferably, the host cell is a yeast such as saccharomyces cerevisiae, a mold, a bacterium, or a cellular expression system.
In a fifth aspect, the invention provides a chimeric antigen receptor comprising an antibody or antigen-binding fragment thereof according to the first aspect of the invention.
In a sixth aspect, the invention provides a genetically modified cell comprising a chimeric antigen receptor according to the fifth aspect of the invention.
Preferably, the genetically modified cell is a eukaryotic cell, preferably an isolated human cell; more preferably immune cells such as T cells, or NK cells.
In a seventh aspect, the present invention provides a method for producing an antibody or antigen-binding fragment thereof according to the first aspect, comprising the steps of: culturing the transformant according to the fourth aspect of the present invention, and obtaining the antibody or the antigen-binding fragment thereof from the culture.
In an eighth aspect, the present invention provides an antibody drug conjugate comprising an antibody moiety comprising an antibody according to the first aspect of the present invention or an antigen-binding fragment thereof, and a conjugate moiety.
Preferably, the conjugate moiety comprises a detectable label, drug, toxin, cytokine, radionuclide, enzyme, or combination thereof, and the antibody moiety and conjugate moiety are conjugated via a chemical bond or linker.
In a ninth aspect, the present invention provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof according to the first aspect of the invention, a chimeric antigen receptor according to the fifth aspect of the invention, a genetically modified cell according to the sixth aspect of the invention and/or an antibody drug conjugate according to the eighth aspect of the invention.
Preferably:
the pharmaceutical composition further comprises a pharmaceutically acceptable carrier; and/or the pharmaceutical composition is in a liquid dosage form, a gas dosage form, a solid dosage form and a semisolid dosage form, and/or the pharmaceutical composition can be administered through oral administration, injection administration, nasal administration, transdermal administration or mucosa administration.
The tenth aspect of the present invention provides a kit comprising kit a and kit B, wherein:
the kit a comprises an antibody or antigen-binding fragment thereof according to the first aspect of the invention, a chimeric antigen receptor according to the fifth aspect of the invention, a genetically modified cell according to the sixth aspect of the invention, an antibody drug conjugate according to the eighth aspect of the invention and/or a pharmaceutical composition according to the ninth aspect of the invention;
the kit B contains one or more selected from the group consisting of a hormonal agent, a targeted small molecule agent, a proteasome inhibitor, an imaging agent, a diagnostic agent, a chemotherapeutic agent, a radiotherapeutic agent, an immunosuppressive agent, an oncolytic drug, a cytotoxic agent, a cytokine, an activator of a costimulatory molecule, an inhibitor of an inhibitory molecule, and a vaccine.
An eleventh aspect of the invention provides a kit comprising an antibody or antigen-binding fragment thereof according to the first aspect of the invention, a chimeric antigen receptor according to the fifth aspect, a genetically modified cell according to the sixth aspect, an antibody drug conjugate according to the eighth aspect and/or a pharmaceutical composition according to the ninth aspect.
Preferably, the kit further comprises (i) a means for administering the antibody or antigen-binding fragment thereof or chimeric antigen receptor or genetically modified cell or antibody drug conjugate or pharmaceutical composition; and/or (ii) instructions for use.
In a twelfth aspect, the present invention provides a use of an antibody or an antigen-binding fragment thereof according to the first aspect of the present invention, a chimeric antigen receptor according to the fifth aspect of the present invention, a genetically modified cell according to the sixth aspect of the present invention, an antibody drug conjugate according to the eighth aspect of the present invention, a pharmaceutical composition according to the ninth aspect of the present invention, a kit according to the tenth aspect of the present invention and/or a kit according to the eleventh aspect of the present invention for the manufacture of a medicament for the treatment and/or prevention of a protein-mediated disease or condition comprising an amino acid sequence as set forth in SEQ ID No. 1.
Preferably, the protein containing the amino acid sequence shown as SEQ ID NO. 1 is selected from one or more of FSH, HCG, TSH, FSH-CTP and hLH.
In a thirteenth aspect, the invention provides the use of an antibody according to the first aspect of the invention, or an antigen-binding fragment thereof, for the detection of a protein comprising an amino acid sequence as shown in SEQ ID NO. 1.
Preferably, the protein is selected from one or more of FSH, HCG, TSH, FSH-CTP and hLH.
In a fourteenth aspect, the present invention provides a method for detecting a protein comprising an amino acid sequence as shown in SEQ ID NO. 1, which comprises the step of detecting using an antibody or an antigen-binding fragment thereof according to the first aspect of the present invention, a chimeric antigen receptor according to the fifth aspect of the present invention, a genetically modified cell according to the sixth aspect of the present invention, an antibody drug conjugate according to the eighth aspect of the present invention, a pharmaceutical composition according to the ninth aspect of the present invention, a kit according to the tenth aspect of the present invention and/or a kit according to the eleventh aspect of the present invention.
In the present application, the term "multispecific antibody" is used in its broadest sense to encompass antibodies having polyepitopic specificity. These multispecific antibodies include, but are not limited to: an antibody comprising a heavy chain variable region (VH), wherein the VH unit has polyepitopic specificity; an antibody having two or more VH regions, each VH unit binding to a different target or to a different epitope of the same target; an antibody having two or more single variable regions, each single variable region binding to a different target or a different epitope of the same target; full length antibodies, antibody fragments, bispecific antibodies (diabodies), and triabodies (triabodies), antibody fragments linked together covalently or non-covalently, and the like.
In this application, the term "heavy chain antibody" refers to an antibody comprising only one heavy chain variable region (VHH) and two conventional CH2 and CH3 regions, also known as HCAbs.
In the present application, the term "VHH (single domain antibody)", also called "nanobody", refers to a VHH structure cloned from a heavy chain antibody, which is the smallest unit known to bind to a target antigen.
The positive progress effects of the invention are as follows:
the antibody of the invention has good binding activity and high sensitivity to protein molecules (such as FSH, HCG, TSH, hLH, FSH-CTP and the like) containing the sequence shown as SEQ ID NO. 1. The antibody is convenient and fast in method and simple in operation when detecting protein molecules such as FSH, HCG, TSH, hLH, FSH-CTP and the like containing sequences shown in SEQ ID NO. 1.
Drawings
FIG. 1 is a diagram of a cycle of amplification electrophoresis after reverse transcription of VHH extracted RNA, where M represents Marker and lanes 1-5 represent 5 groups of RNA extractions, respectively.
FIG. 2 is a diagram of two rounds of amplification electrophoresis after reverse transcription of VHH extracted RNA, where M represents Marker, and lanes 1-2 represent the second round of PCR amplification electrophoresis after gel cutting recovery in lanes 1 and 2 of FIG. 1, respectively.
FIG. 3 is a histogram of VHH extracted RNA library volume titer.
FIG. 4 shows the colony PCR identification of the insertion rate of the target gene in the library.
FIG. 5 shows the results for VHH expression of different binding alpha subunits, lanes 1-7 corresponding to proteins 2-8, respectively.
Detailed Description
The invention immunizes Bactrian camels with HCG and then uses the camel peripheral blood lymphocytes to establish a VHH phage library directed against HCG heavy chain antibodies. In the subsequent test, HCG and hLH are coated on enzyme label plate, and immune nanometer antibody phage library is screened with phage display technology to obtain specific nanometer antibody gene for HCG and hLH common alpha chain, and the gene is transferred to colibacillus to establish nanometer antibody strain capable of being expressed in colibacillus and perform gene sequence identification.
Example 1: immune animal and phage library construction
1. Immunizing animals
Taking healthy adult alpaca, mixing HCG with an adjuvant, immunizing by adopting a subcutaneous injection mode, wherein the immunization program is shown in table 2, and collecting alpaca peripheral blood for constructing a phage display library in the seventh day after the third boosting immunization.
TABLE 2 immunization procedure
2. Alpaca lymphocyte separation:
adding 6mL of lymphocyte separation solution into a 15mL centrifuge tube, adding an equal volume of whole blood sample, and centrifuging at the normal temperature of 800g for 20 min; carefully sucking the white blood cells suspended in the middle layer into a new centrifuge tube,adding 2 times volume of PBS, and centrifuging at normal temperature for 15min at 800 g; carefully discarding the supernatant, adding erythrocyte lysate, and lysing erythrocytes; centrifuging at normal temperature for 15min at 450g, removing supernatant, counting, and counting according to 10 g7The lymphocytes were lysed well by adding 2mL Trizol and were ready for use.
3. Total RNA extraction
Adding 1/5 volumes of chloroform into the lysate, shaking vigorously for 20s for full emulsification, and standing on ice for 10 min; centrifuging at 4 deg.C and 12000g for 10min, and transferring the supernatant to another fresh centrifuge tube; adding isopropanol with the same volume, mixing well, and standing on ice for 10 min; centrifuging at 4 deg.C and 12000g for 10min, removing supernatant, adding 75% ethanol, and mixing; centrifuging at 4 deg.C and 12000g for 10min, and removing supernatant; drying at room temperature for 5min, adding appropriate amount of RNase-free water to dissolve precipitate, and storing at-80 deg.C after RNA precipitate is completely dissolved.
4. Antibody gene amplification
The nested first round PCR system is shown in Table 3 below:
TABLE 3
Reaction procedure: 94 ℃ for 5 min; 30 cycles of 98 deg.C, 10s, 50 deg.C, 15s, 72 deg.C, 1 min; after the reaction is finished, gel electrophoresis is carried out, and the target fragment of about 700bp is recovered by tapping. Wherein the Alpvh-LD sequence (5'-3') is as follows: CTTGGTGGTCCTGGCTGC (SEQ ID NO: 28); CH (CH)2-the R sequence (5'-3') is as follows: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 29). The results are shown in FIG. 1.
Nested second round PCR is shown in Table 4 below: 94 ℃ for 5 min; 30 cycles of 98 deg.C, 10s, 57 deg.C, 15s, 72 deg.C, 45 s.
TABLE 4
Wherein the sequence of AlpVh-F1 (5'-3') (SEQ ID NO:30) is as follows:
CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC；
the sequence of AlpVHH-R1(5'-3') (SEQ ID NO:31) is as follows:
CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG；
the sequence of AlpVHH-R2(5'-3') (SEQ ID NO:32) is as follows:
CATGCCATGACTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG。
after the second reaction, gel electrophoresis (as shown in FIG. 2), tapping to recover the target fragment, and performing double enzyme digestion.
5. Library construction
5.1 cleavage of vector and target fragment
The target fragment double cleavage system (160. mu.L system) is shown in Table 5:
TABLE 5
The vector double enzyme system (160. mu.L) is shown in Table 6:
TABLE 6
5.2 ligation System of vector and fragment of interest is shown in Table 7:
TABLE 7
Ligation was performed overnight at 16 ℃ and 5. mu.L (1/10 amount) of 3M CH was added3COONa (pH 5.2) and 125 μ L (2.5 times) of cold anhydrous ethanol, standing at-20 deg.C for 30-60min, centrifuging at 12000g to recover precipitate, washing with 70% cold ethanol, drying at room temperature, dissolving in 15 μ L to removeAnd (5) adding the mixture into water.
6. Electric conversion
Performing electric shock transformation for 10 times, immediately adding 1mL 2YT culture medium (preheated at 37 deg.C) into the electric shock cup for resuscitation after electric shock, sucking out electric shock product, washing the electric shock cup with 2YT culture medium to obtain total 100mL resuscitation product, resuscitating at 37 deg.C and 180rpm for 45min, and diluting 100 μ L gradient to 10 μ L-3And 10-4The number of library transformants was determined, plated on 90mm plates, centrifuged the rest, resuspended by adding 8mL of 2YT, and plated on 8 200mm plates. The next day F-mix primer library 10 on plates with the number of pool transformants determined-4There were 132 clones with a stock size of 1.32X 109(132×1000×104) (ii) a Fnew primer library 10-4A total of 110 clones, 1.1X 109(110×1000×104) As shown in fig. 3.
7. Colony PCR verification of insertion rate
48 clones are randomly picked from a titer plate of the library capacity for identification, and the results show that the insertion rates are all 100 percent, as shown in figure 4, wherein the target gene band is 700bp, and the Marker band size is 5000, 3000, 2000, 1500, 1000, 750, 500, 250 and 100bp once.
Example 2: antibody screening
1. Affinity panning
1) The HCG antigenDiluting with carbonate buffer solution with pH of 9.6 to final concentration of 5 μ g/mL, adding into enzyme-labeled wells at 100 μ L/well, coating 8 wells (4 wells for second round screening) with each target molecule, and coating overnight at 4 deg.C;
2) discarding the coating solution, washing with PBS for 3 times, adding 300 μ L of 3% BSA-PBS blocking solution into each well, and blocking at 37 deg.C for 1 h;
3) washing with PBS for 3 times, adding 100 μ L phage library, and incubating at 37 deg.C for 1 h;
5) unbound phage were aspirated, washed 6 times with PBST and 2 times with PBS;
6) adding 100 mu L Gly-HCl eluent, incubating at 37 deg.C for 8min, and eluting specifically bound phage; transferring the eluent into a 1.5mL sterile centrifuge tube, and quickly neutralizing with 10 μ L Tris-HCl neutralization buffer;
7) 10 μ L of the eluate was subjected to gradient dilution, titer was determined, and the recovery from the panning was calculated, and the remaining eluates were mixed and amplified and purified for the next round of affinity panning, with the panning conditions changed as shown in Table 8.
TABLE 8 affinity panning conditions
TABLE 9 acid wash two-round screen recovery with HCG as target protein
Recovery rate is recovery amount/library input amount; enrichment is the yield of the last round of recovery.
2. Amplification of post-panning libraries
1) Mixing elutriation eluate with 5mL of E.coli 2738 culture (New England Biolabs) in early logarithmic growth stage, standing at 37 deg.C for 15min, and shake-culturing at 220r/min for 45 min; centrifuging at 1000g for 15min, removing supernatant, resuspending with 500. mu.l 2 XYT and spreading on 200mm 2 XYT-GA plate;
2) scraping bacteria with 10ml 2 XYT liquid culture medium, adding 500 μ l suspension into 50ml 2 XYT liquid culture medium, and shaking at 37 deg.C for 30 min; adding M13K07 helper phage (Addgene, cat #119819) according to the proportion of cell: phase 1:20, standing at 37 ℃ for 30min, and shaking and culturing at 220r/min for 30 min; subpackaging the culture in a centrifuge tube, centrifuging at 25 deg.C and 5000r/min for 10min, resuspending the cell precipitate in 50mL 2 XYT-AK liquid culture medium, and shake-culturing at 30 deg.C and 230r/min overnight;
3) centrifuging the overnight culture at 4 deg.C and 10000r/min for 20min, transferring the supernatant to a new centrifuge tube, adding 1/5 volume of PEG-NaCl, mixing, and culturing at 4 deg.C for more than 2 hr;
4) centrifuging at 4 deg.C and 10000r/min for 20min, removing supernatant, suspending the precipitate in 1mL PBS, adding 1/5 volume PEG/NaCl, mixing, and culturing at 4 deg.C for more than 1 h;
5) centrifuging at 4 deg.C and 12000r/min for 2min, removing supernatant, suspending the precipitate in 200 μ L PBS to obtain amplification product, and determining titer for next round of panning or analysis.
3. Identification and analysis of specific phage clones
3.1 identification of phagemids
1) From the second round of panning eluate titer plate, randomly pick 96 single clones with sterile toothpick and inoculate in 1mL 2 XYT-A, 37 degrees C, 220r/min shake culture for 8 h.
2) Taking 200. mu.L of the culture, and carrying out cell: phase 1: adding M13K07 phage at the ratio of 20, standing at 37 deg.C for 15min, and shake-culturing at 220r/min for 45 min.
3) Supplemented with 2 XYT-AK in a volume of 800. mu.L, and cultured overnight at 30 ℃ with vigorous shaking.
4) The next day, centrifugation was carried out at 12000rpm for 2min, and the supernatant was collected and used for monoclonal ELISA identification.
3.2 identification of Positive phage clones
1) Mixing HCGOr a hLH antigenRespectively diluting with carbonate buffer solution with pH value of 9.6 to final concentration of 2 μ g/mL, adding into enzyme-labeled well at 100 μ L/well, and coating overnight at 4 deg.C;
2) discarding the coating solution, washing with PBST for 3 times, adding 200 μ L of 5% skimmed milk into each well, and sealing at 37 deg.C for 1 h;
3) PBST washing 3 times, each hole is added with 50 μ L phage culture liquid supernatant and 50 μ L5% skimmed milk, incubated for 1h at 37 ℃;
4) PBST was washed 6 times, and 100 μ L/well was added with horseradish peroxidase-labeled anti-M13 antibody (Abcam, cat no: ab235228), 1h at 37 ℃;
5) PBST wash plate 6 times. Adding TMB color development solution for color development, culturing at 37 deg.C for 7min, adding stop solution at 50 μ L/well to stop reaction, and measuring OD value at 450 nm.
The final results were 7 higher affinity sequences No. 1, No. 13, No. 24, No. 25, No. 48, No. 62, and No. 70 (Table 10). The 7 positive clones were sequenced, and the amino acid sequences corresponding to the obtained sequences are specifically shown in table 10 below.
TABLE 10 HCG and hLH antigen phase ELISA identification and corresponding sequences
Example 3: antibody expression and binding identification
1. Sequence Synthesis and expression
The sequence obtained by the screening was expressed and tested for affinity to the antigen containing the alpha subunit, and the VHH sequence 1G9E [ PMID:24739391 ] was selected as a positive control. The codon optimization of Escherichia coli preference is entrusted to Nanjing King Shirui Biotechnology GmbH, N-terminal methionine and C-terminal 6 × histidine tag (VHH-sgs-HHHHHHHH) are added, polynucleotide sequences for coding SEQ ID NO 2-8 and 1G9E are synthesized, the polynucleotide sequences are inserted into a pET32a expression vector, and a recombinant plasmid for polypeptide expression is obtained after correct sequencing. The prepared recombinant plasmid was electrically transformed into E.coli BL21 Star (DE3) and inoculated onto LB agarose plates containing 100. mu.g/ml ampicillin. After culturing at 37 ℃ overnight until colonies grew out, individual colonies were picked up and inoculated into 3ml of LB medium containing 100. mu.g/ml ampicillin and cultured at 37 ℃ overnight at 250 rpm. The overnight culture was inoculated into 50ml of LB medium containing 100. mu.g/ml ampicillin, cultured at 37 ℃ until OD600 reached 0.4 to 0.6, and then 0.1mM IPTG was added to continue the culture overnight. And finally, centrifugally collecting the bacterial precipitates of the culture, carrying out ultrasonic cell breaking treatment after the bacterial precipitates are resuspended to 100g/L by PBS, and centrifugally collecting supernatant after cell breaking. The supernatant was purified by nickel column. The purified protein was pipetted into PBS (pH 7.0) using ultrafiltration centrifuge tubes. The purity of the obtained protein was evaluated by SDS-PAGE, and as shown in FIG. 5, it was found that the purity was 97% or more for each of the 8 sequences.
2. Purified protein binding Activity evaluation
Enzyme labelingPlates were incubated with 2. mu.g/ml HCGCoating at 2-8 ℃ overnight; then, the plate was washed 3 times with PBST (PBS containing 0.05% Tween 20, pH7.4), and the washed plate was blocked with 300. mu.l of a blocking solution (PBST containing 1% BSA) at 37 ℃ for 2 hours and then washed with PBST.
Sample dilution: samples were diluted to 200ng/ml starting, 2-fold for 10 spots, and loaded into 96-well plates at 100. mu.l/well duplicate wells.
The ELISA plate was incubated at 37 ℃ for 1h with shaking, washed with PBST, 40ng/ml of Anti-6 XHis tag antibody (HRP) (Abcam, cat # AB1187) was added to the plate, incubated at 37 ℃ for 1h with shaking, washed with PBST, added with TMB (tetramethyllbenzidine) as a chromogenic substrate for HRP, incubated for 15min, and incubated with 2N H2SO4And (6) terminating. Absorbance at 450nm was measured with a microplate reader. EC50 values were calculated using a 4-parameter equation.
TABLE 11 EC50 values for ELISA assays
SEQ ID NO:
EC50(ng/ml)
SEQ ID NO:
EC50(ng/ml)
2
10.28
6
13.75
3
25.90
7
14.01
4
5.05
8
23.46
5
9.46
1G9E
N/A*
Injecting: the ELISA detection of the 1G9E sample does not form a complete 4-parameter curve, the OD value at a high concentration point is far lower than that of other VHHs, saturation is not achieved, and no EC50 data exist.
As shown in Table 11, it was revealed that VHHs of SEQ ID Nos. 2 to 8 have different binding activities to FSH and HCG, and both binding activities were much greater than 1G 9E.
SEQUENCE LISTING
<110> Suzhou Cheng Ji pharmaceutical Co., Ltd
<120> antibody or antigen-binding fragment thereof and use thereof
<130> P21016406C
<160> 32
<170> PatentIn version 3.5
<210> 1
<211> 92
<212> PRT
<213> Artificial Sequence
<220>
<223> alpha chain sequence
<400> 1
Ala Pro Asp Val Gln Asp Cys Pro Glu Cys Thr Leu Gln Glu Asn Pro
1 5 10 15
Phe Phe Ser Gln Pro Gly Ala Pro Ile Leu Gln Cys Met Gly Cys Cys
20 25 30
Phe Ser Arg Ala Tyr Pro Thr Pro Leu Arg Ser Lys Lys Thr Met Leu
35 40 45
Val Gln Lys Asn Val Thr Ser Glu Ser Thr Cys Cys Val Ala Lys Ser
50 55 60
Tyr Asn Arg Val Thr Val Met Gly Gly Phe Lys Val Glu Asn His Thr
65 70 75 80
Ala Cys His Cys Ser Thr Cys Tyr Tyr His Lys Ser
85 90
<210> 2
<211> 121
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 2
<400> 2
Gln Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr
20 25 30
Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val
35 40 45
Ala Ala Ile Thr Trp Ser Gly Asp Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Asp Arg Ala Asp Gly Ser Ser Trp Trp Asp Tyr Trp Gly
100 105 110
Gln Gly Thr Gln Val Thr Val Ser Ser
115 120
<210> 3
<211> 119
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 3
<400> 3
Gln Val Gln Val Ala Glu Ser Gly Gly Gly Leu Val Gln Ser Gly Gly
1 5 10 15
Ser Met Asn Leu Ser Cys Thr Ala Ser Gly Asn Leu Phe Ser Val Asp
20 25 30
Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Glu Glu Arg Glu Ala Val
35 40 45
Ala Ala Ile Met Trp Ser Gly Asp Ser Thr Tyr Tyr Ala Asn Ala Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Leu Gln Glu Glu Gly Trp Trp Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Gln Val Thr Val Ser Ser
115
<210> 4
<211> 119
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 4
<400> 4
Gln Val Arg Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Gly Thr Phe Asp Arg Tyr
20 25 30
Asn Val Ala Trp Phe Arg Gln Ala Pro Gly Glu Glu Arg Glu Ala Val
35 40 45
Ala Ser Ile Met Trp Ser Gly Asp Asn Thr Tyr Tyr Ala Asn Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Ile Gln Glu Gln Gly Trp Trp Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Gln Val Thr Val Ser Ser
115
<210> 5
<211> 119
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 5
<400> 5
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Ala Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Ala Ser Gly Tyr
20 25 30
Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val
35 40 45
Ala Ala Ile Met Trp Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Thr Asp Gly Ser Gly Trp Trp Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Gln Val Thr Val Ser Ser
115
<210> 6
<211> 119
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 6
<400> 6
Gln Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Val Ser Ser His
20 25 30
Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Glu Glu Arg Glu Ala Val
35 40 45
Ala Ala Ile Met Trp Ser Gly Asp Ser Thr Tyr Tyr Ala Asn Ala Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Leu Gln Glu Glu Gly Trp Trp Asp Tyr Trp Gly Gln Gly
100 105 110
Thr Gln Val Thr Val Ser Ser
115
<210> 7
<211> 118
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 7
<400> 7
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Arg Thr Phe Ser Ser Tyr
20 25 30
Asp Met Gly Trp Phe Arg Gln Ala Pro Gly Glu Glu Arg Glu Ala Val
35 40 45
Ala Ala Ile Asn Trp Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Ser Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Gln Val Pro Gly Trp Trp Asp Tyr Trp Gly Gln Gly Thr
100 105 110
Gln Val Thr Val Ser Ser
115
<210> 8
<211> 121
<212> PRT
<213> Artificial Sequence
<220>
<223> protein 8
<400> 8
Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly
1 5 10 15
Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Asn Tyr
20 25 30
Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Glu Glu Arg Glu Ala Val
35 40 45
Ala Ala Ile Ser Gln Ser Gly Gly Ser Thr Tyr Tyr Ala Ser Ser Val
50 55 60
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
65 70 75 80
Leu Lys Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys
85 90 95
Ala Ala Arg Asp Arg Ala Asp Asp Ser Ser Trp Trp Asp Phe Trp Gly
100 105 110
Gln Gly Ala Gln Val Thr Val Ser Ser
115 120
<210> 9
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 2
<400> 9
Gly Arg Thr Phe Ser Ser Tyr Ala
1 5
<210> 10
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR2 of protein 2
<400> 10
Ile Thr Trp Ser Gly Asp Ser Thr
1 5
<210> 11
<211> 14
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR3 of protein 2
<400> 11
Ala Ala Arg Asp Arg Ala Asp Ser Gly Ser Trp Trp Asp Tyr
1 5 10
<210> 12
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 3
<400> 12
Gly Asn Leu Phe Ser Val Asp Ala
1 5
<210> 13
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR2 of protein 3
<400> 13
Ile Met Trp Ser Gly Asp Ser Thr
1 5
<210> 14
<211> 12
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR3 of protein 3
<400> 14
Ala Ala Arg Leu Gln Glu Glu Gly Trp Trp Asp Tyr
1 5 10
<210> 15
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 4
<400> 15
Gly Gly Thr Phe Asp Arg Tyr Asn
1 5
<210> 16
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR2 of protein 4
<400> 16
Ile Met Trp Ser Gly Asp Asn Thr
1 5
<210> 17
<211> 12
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR3 of protein 4
<400> 17
Ala Ala Arg Ile Gln Glu Gln Gly Trp Trp Asp Tyr
1 5 10
<210> 18
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 5
<400> 18
Gly Arg Thr Ala Ser Gly Tyr Ala
1 5
<210> 19
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR2 of protein 5
<400> 19
Ile Met Trp Ser Gly Gly Ser Thr
1 5
<210> 20
<211> 12
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR3 of protein 5
<400> 20
Ala Ala Arg Thr Asp Gly Ser Gly Trp Trp Asp Tyr
1 5 10
<210> 21
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 6
<400> 21
Gly Arg Thr Val Ser Ser His Ala
1 5
<210> 22
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 7
<400> 22
Gly Arg Thr Phe Ser Ser Tyr Asp
1 5
<210> 23
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR2 of protein 7
<400> 23
Ile Asn Trp Ser Gly Gly Ser Thr
1 5
<210> 24
<211> 11
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR3 of protein 7
<400> 24
Ala Ala Arg Gln Val Pro Gly Trp Trp Asp Tyr
1 5 10
<210> 25
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR1 of protein 8
<400> 25
Gly Arg Thr Phe Ser Asn Tyr Ala
1 5
<210> 26
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR2 of protein 8
<400> 26
Ile Ser Gln Ser Gly Gly Ser Thr
1 5
<210> 27
<211> 14
<212> PRT
<213> Artificial Sequence
<220>
<223> CDR3 of protein 8
<400> 27
Ala Ala Arg Asp Arg Ala Asp Ser Asp Ser Trp Trp Asp Phe
1 5 10
<210> 28
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Alpvh-LD sequence (5'-3')
<400> 28
cttggtggtc ctggctgc 18
<210> 29
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> CH2-R sequence (5'-3')
<400> 29
ggtacgtgct gttgaactgt tcc 23
<210> 30
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> AlpVh-F1 sequence (5'-3')
<400> 30
catgccatga ctgtggccca ggcggcccag ktgcagctcg tggagtc 47
<210> 31
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> AlpVHH-R1(5'-3') sequence
<400> 31
catgccatga ctcgcggccg gcctggccat gggggtcttc gctgtggtgc g 51
<210> 32
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> AlpVHH-R2(5'-3') sequence
<400> 32
catgccatga ctcgcggccg gcctggccgt cttgtggttt tggtgtcttg gg 52
- 上一篇：一种医用注射器针头装配设备
- 下一篇：β2-微球蛋白多抗血清的制备方法