Cytochrome P450 enzyme and application thereof in synthesis of ganoderma triterpenoids
阅读说明：本技术 细胞色素p450酶及其在合成灵芝三萜类化合物中的应用 (Cytochrome P450 enzyme and application thereof in synthesis of ganoderma triterpenoids ) 是由 王猛 肖晗 袁伟 于 2020-03-24 设计创作，主要内容包括：本发明属于生物技术领域,具体涉及细胞色素P450酶及其在合成灵芝三萜类化合物中的应用。本发明获得的CYP基因GL20421可催化灵芝酸HLDOA形成一种新的天然灵芝三萜产物-式(I)所示的灵芝三萜类化合物；本发明获得的CYP基因GL21117可催化灵芝酸HLDOA形成的灵芝酸Jb,其与天然的化合物结构完全一致,具有同等的产品性能和质量。本发明通过将GL20421和GL21117基因在酿酒酵母中异源表达,实现了灵芝三萜类化合物异源生物合成,产率高,具有广泛的应用前景。(The invention belongs to the technical field of biology, and particularly relates to cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpene compounds. The CYP gene GL20421 obtained by the invention can catalyze ganoderic acid HLDOA to form a novel natural ganoderma triterpene product, namely a ganoderma triterpene compound shown in a formula (I); the CYP gene GL21117 obtained by the invention can catalyze ganoderic acid Jb formed by ganoderic acid HLDOA, has a structure completely consistent with that of a natural compound, and has the same product performance and quality. According to the invention, the genes GL20421 and GL21117 are heterologously expressed in saccharomyces cerevisiae, so that the heterologously biological synthesis of the ganoderma triterpenoid is realized, the yield is high, and the application prospect is wide.)
1. A nucleic acid molecule encoding a cytochrome P450 enzyme or a catalytically active fragment thereof, comprising the nucleotide sequence shown as SEQ ID No.1 or SEQ ID No. 3.
2. A cytochrome P450 enzyme, characterized in that its amino acid sequence is shown in SEQ ID No.2 or SEQ ID No. 4; or more than 65% homology with SEQ ID No.2 or SEQ ID No. 4.
3. A recombinant host cell comprising a heterologous nucleic acid molecule encoding the cytochrome P450 enzyme of claim 2;
preferably, the recombinant host cell is a host cell which is engineered to produce ganoderma triterpenoids;
preferably, the host cell is a prokaryotic cell or a eukaryotic cell, e.g., a bacterial cell, a yeast cell, an insect cell, a plant cell, or a mammalian cell; for example, the host cell is a Saccharomyces cell, Pichia cell or Escherichia coli cell.
4. Use of the nucleic acid molecule of claim 1 or the cytochrome P450 enzyme or recombinant host cell of claim 2 in the synthesis of a ganoderma triterpene compound;
preferably, the ganoderma lucidum triterpene compound is a compound shown in a formula (I) or a formula (II):
preferably, the nucleic acid molecule shown in SEQ ID No.1 or the cytochrome 450 enzyme coded by the nucleic acid molecule or the host cell containing the gene is used for synthesizing the ganoderma lucidum triterpenoid shown in the formula (I);
preferably, the nucleic acid molecule shown in SEQ ID No.3 or the cytochrome 450 enzyme coded by the nucleic acid molecule or the host cell containing the gene is used for synthesizing the ganoderma lucidum triterpenoid shown in the formula (II).
5. A method for synthesizing ganoderma lucidum triterpenoids is characterized by comprising the following steps: contacting the cytochrome P450 enzyme of claim 2 with ganoderic acid HLDOA to produce a ganoderma triterpene compound;
preferably, the ganoderma lucidum triterpene compound is a compound shown in a formula (I) or a formula (II):
6. the method of claim 5, wherein the synthetic method is a heterologous biosynthetic method;
preferably, the cytochrome P450 enzyme is expressed by culturing a recombinant host cell comprising a heterologous nucleic acid molecule encoding the cytochrome P450 enzyme of claim 2;
preferably, culturing the recombinant host cell to express cytochrome P450 enzyme and catalyze ganoderic acid HLDOA to generate the ganoderma triterpenoid;
preferably, the recombinant host cell is recombinant saccharomyces cerevisiae, the saccharomyces cerevisiae is cultured in a fermentation mode, and the ganoderma lucidum triterpenoid is separated from fermentation liquor.
7. The method of claim 6, wherein the fermentation medium for fermentation of recombinant Saccharomyces cerevisiae is YPD24 fermentation medium containing geneticin G418 and Hygromycin (Hygromycin).
8. The method as claimed in claim 7, wherein the fermentation medium contains geneticin G418 at a concentration of 200-800 mg/L and Hygromycin (Hygromycin) at a concentration of 100-500 mg/L.
9. The method according to any one of claims 5 to 8, wherein the temperature of the fermentation is 20 to 40 ℃.
10. A ganoderma triterpenoid compound represented by formula (I):
Technical Field
The invention belongs to the technical field of biology, and particularly relates to cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpene compounds.
Background
Triterpenoids are polymerized from six isoprene units, are widely distributed in nature in a wide variety of forms, mainly in free, glycoside or ester forms, widely found in ferns, fungi, monocotyledons and dicotyledons, and a few in the animal body (Vincken, J.P., et al., Phytochemistry,2007.68(3): p.275-97). The research shows that the triterpenoid has various biological activities such as blood sugar reduction, anti-inflammation, blood fat reduction and the like (Zhengguanhai et al, Huaxi journal of pharmacy, 2011.26(03): 294) 297), is an important lead compound for the research of anti-diabetic drugs (Kui girl et al, university of Chinese pharmacy, 2015, 46 (6): 764 770), has the characteristic of 'targeted killing' in the aspect of anti-tumor, and has obvious inhibiting effect on various tumors such as breast Cancer, lung Cancer, rectal Cancer and central nervous system Cancer (Kim, E.H., et al, Cancer Prev Res (Phila),2011.4(3): 425-34; Zhang, Y.et al, Food Chem,2013.138(1): 208-13; Yu, L., et al, Med Chem Lett,2012.22(16): 5232-8; Lanzotti, V.et al, Bioorg, 2012.20-80; Bioorg, Med Chem 3280; Bioorg, 3280, m.k., et al, Biochem Pharmacol,2013.85(11):1579-87), has become one of the focuses of recent research on antitumor drugs at home and abroad (Shanmugam, m.k., et al, Biochem Pharmacol,2013.85(11): 1579-87; szakiel, A., et al, J agricultural Food Chem,2012.60(19): 4994-; Pena-Rodriguez, L.M., et al, J Org Chem,2014.79(7): 2864-73).
Research shows that triterpenoids have several different skeleton structures, and the difference among the compounds depends on the post-modification process after skeleton formation, wherein Cytochrome P450 enzyme (CYP) plays a main role and is the key point of triterpenoid biosynthesis pathway research. The current research on the biosynthesis of triterpenoids is mainly focused on plants.
Ganoderma contains abundant triterpenes. Since 1982 (Kubota, T.T., et al., Helvetica Chimica Acta,1982.65:611-619), more than 200 Ganoderma triterpenoids have been successfully isolated and identified (Baby, S.et al., Phytocochemistry, 2015.114: 66-101). Ganoderma has remarkable effects in adjuvant tumor therapy, resisting HIV, improving immunity, delaying aging, etc. (Sliva, D., Mini Rev Med Chem,2004.4(8): 873-9). The unique effects of ganoderma lucidum are derived from a series of secondary metabolites with physiological activities in cells. Of these, Ganoderma triterpenes are of particular importance (Qin, H., et al., Bioreaction Engineering Research and Industrial Applications I: Cell industries, 2016.199-235), and are of great interest (Tang, W., et al., Life Sci,2006.80(3): 205-.
However, the growth cycle of ganoderma lucidum is too long and is easily affected by environmental factors, the yield of ganoderma lucidum triterpene compounds is too low, the procedures of extracting, separating and purifying products are complicated, and the cost is high, so that the development and utilization of ganoderma lucidum triterpene are severely limited.
Due to the lack of mature ganoderma lucidum cell gene manipulation means and the lack of cognition on genes related to the ganoderma lucidum triterpene biosynthesis pathway (Xiao, H., et al., Trends Biotechnology, 2016.34(3): 242-631 255; Xiao, H., et al., Trends in Biotechnology,2019.37(6):618-631), the great improvement of the yield of the ganoderma lucidum triterpene compounds by the transformation of ganoderma lucidum fungi through metabolic engineering also has great challenges and difficulties. At present, relevant researches on ganoderma triterpenes are in a laboratory stage, and few patent medicine reports exist. The development of novel ganoderma lucidum triterpenoids and the reduction of cost to improve the production efficiency of the ganoderma lucidum triterpenoids become two major problems for researchers.
The development of synthetic biology and the intensive research of saccharomyces cerevisiae model organisms provide a very potential path for the excavation and development of ganoderma lucidum triterpenoids. Saccharomyces cerevisiae has the characteristics of definite genome sequence, abundant gene manipulation means, capability of containing precursors of biosynthesis of various triterpene compounds, endoplasmic reticulum and a post-translational modification system for facilitating eukaryotic gene expression and the like, has remarkable advantages which are incomparable to other microorganisms in the aspect of heterologous expression of natural product biosynthesis genes of fungi and plants, particularly cytochrome P450 enzyme (Xiao, H., et al, Trends in Biotechnology,2019.37(6):618 and 631), and has been widely approved and adopted by domestic and foreign scientists (Lan, X., et al., Biotechnology Bioeng,2019.116(12):3301 and 3311; Ajikumar, P.K., Mol Pharm,2008.5(2): 167-90; Dai, Z., et al, Sci 369, 2014.4: 8; Yan, X., Cell, Res,2014.24(6): 770). By utilizing the technical means of synthetic biology, saccharomyces cerevisiae is modified, and genes possibly related to the synthesis of ganoderma lucidum triterpenoids in ganoderma lucidum are introduced into saccharomyces cerevisiae for expression, so that the deep excavation of novel ganoderma lucidum triterpenoids in ganoderma lucidum and the heterologous biosynthesis of ganoderma lucidum triterpenoids are possible.
Studies have shown that Lanosterol is synthesized in Ganoderma cells via the Mevalonate pathway (Mevalonate pathway), and that Lanosterol is a direct biosynthetic precursor of Ganoderma triterpenes via isotope tracer technology studies (Yeh, S. -f.Proc Natl Sci Council ROC (B). 1989). Cytochrome P450 enzyme CYP5150L8 can catalyze lanosterol, and a ganoderma triterpene HLDOA (ganoderic acid HLDOA) is formed through three-step oxidation reaction (Wang, W.F., et al, Biotechnol Bioeng,2018.115(7):1842-1854). However, other biosynthesis genes of the ganoderma lucidum triterpenoid are still unknown.
Disclosure of Invention
Aiming at the defects of slow growth of hosts of the existing artificial cultivated ganoderma lucidum or submerged fermentation of the ganoderma lucidum and the like, the invention provides a method for discovering a novel ganoderma lucidum triterpene compound and realizing the heterologous biosynthesis thereof based on a synthetic biology strategy, in particular to a method for realizing the heterologous biosynthesis of the ganoderma lucidum triterpene compound by excavating and identifying cytochrome P450 enzyme genes related to the biosynthesis of the ganoderma lucidum triterpene and carrying out heterologous expression in a saccharomyces cerevisiae cell.
The invention provides the following technical scheme:
the invention firstly provides a nucleic acid molecule for coding cytochrome P450 enzyme or a catalytic active fragment thereof, which comprises a nucleotide sequence shown as SEQ ID No.1(GL20421 gene) or SEQ ID No.3(GL21117 gene).
The invention also provides cytochrome P450 enzyme, the amino acid sequence of which is shown as SEQ ID No.2 or SEQ ID No. 4; alternatively, it has more than 65% homology, for example more than 70%, more than 80%, more than 90%, more than 95% or more than 99% homology with SEQ ID No.2 or SEQ ID No.4 and still retains the catalytic activity.
The nucleic acid molecule provided by the invention or cytochrome P450 enzyme coded by the nucleic acid molecule has the activity of catalyzing ganoderic acid to generate the ganoderma triterpenoid, and can realize the heterologous biosynthesis of the ganoderma triterpenoid.
The invention also provides a recombinant host cell encoding a heterologous nucleic acid molecule for any of the cytochrome P450 enzymes provided by the invention. In one embodiment, the recombinant host cell encodes the nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.3, for example the recombinant host cell expresses the cytochrome P450 enzyme shown in SEQ ID No.2 or SEQ ID No.4 by encoding the above nucleotide sequence.
According to an embodiment of the present invention, the recombinant host cell is engineered by techniques known in the art to produce ganoderma lucidum triterpenoids. For example, alteration or modification of a host cell can be accomplished by introducing a nucleic acid molecule provided herein into the host cell by homologous recombination, gene editing, or other genetic recombination techniques known in the art.
According to an embodiment of the invention, the host cell is a prokaryotic cell or a eukaryotic cell, e.g., a bacterial cell, a yeast cell, an insect cell, a plant cell or a mammalian cell. For example, the host cell is a Saccharomyces cell, Pichia cell or Escherichia coli cell. In some embodiments, the host cell is a saccharomyces cerevisiae (saccharomyces cerevisiae) cell.
The invention further provides application of the nucleic acid molecule or cytochrome P450 enzyme or recombinant host cell in synthesis of ganoderma lucidum triterpenoids.
According to an embodiment of the invention, the ganoderma triterpenoid is a compound of formula (I) or formula (II):
according to an embodiment of the present invention, GL20421 gene or cytochrome 450 enzyme encoded thereby or host cell containing the same is used for synthesizing the ganoderma lucidum triterpene compound represented by formula (I).
According to an embodiment of the present invention, the GL21117 gene or the cytochrome 450 enzyme encoded thereby or the host cell containing the gene is used for synthesizing the ganoderma lucidum triterpene compound represented by the formula (II).
The invention also provides a method for synthesizing the ganoderma lucidum triterpenoid, which comprises the following steps: the cytochrome P450 enzyme disclosed by the invention is contacted with ganoderic acid HLDOA to generate the ganoderma triterpenoid.
In one embodiment, the ganoderma lucidum triterpene compound is a compound represented by formula (I) or formula (II).
The invention also provides a synthesis method of the compound shown in the formula (I), which comprises the following steps: contacting cytochrome P450 enzyme with amino acid sequence shown in SEQ ID No.2 with ganoderic acid HLDOA to generate compound shown in formula (I).
The invention also provides a synthesis method of the compound shown in the formula (II), which comprises the following steps: contacting cytochrome P450 enzyme with amino acid sequence shown in SEQ ID No.4 with ganoderic acid HLDOA to generate compound shown in formula (II).
According to an embodiment of the invention, the synthetic method is a heterologous biosynthetic method. Specifically, the heterologous biosynthesis method comprises culturing the recombinant host cell of the invention, expressing the cytochrome P450 enzyme, and catalyzing the production of the ganoderma lucidum triterpenoid from ganoderic acid HLDOA.
According to an embodiment of the invention, the synthesis method further comprises isolating the ganoderma lucidum triterpenoid from the culture of the recombinant host cell.
According to an embodiment of the present invention, the recombinant host cell is a recombinant saccharomyces cerevisiae, the saccharomyces cerevisiae is cultured by fermentation, and the ganoderma lucidum triterpenoids are isolated from the fermentation broth.
In one embodiment, the recombinant Saccharomyces cerevisiae comprises a recombinant plasmid comprising a nucleotide sequence shown in SEQ ID No.1(GL20421 gene) or SEQ ID No.3(GL21117 gene); the recombinant plasmid contains expression vectors, nucleotide sequences shown in SEQ ID No.1 or SEQ ID No.3, promoters, terminators and other expression elements. For example, the recombinant plasmid is recombined and connected by an expression vector pRS426, a nucleotide sequence shown in SEQ ID No.1 or SEQ ID No.3, a yeast HXT7p promoter, a yeast FBA1t terminator and a KanMX gene expression cassette containing a truncated promoter Ura3(tP-Ura 3).
According to an embodiment of the invention, the saccharomyces cerevisiae further comprises at least one of genes upstream of the lanosterol biosynthesis pathway, such as tmg 1, ERG20, ERG9 and/or ERG 1.
According to an embodiment of the invention, the fermentation medium for fermentation of recombinant Saccharomyces cerevisiae is YPD24 fermentation medium containing geneticin G418 and Hygromycin (Hygromycin).
According to an embodiment of the invention, the concentration of geneticin G418 in the fermentation medium is 200-800 mg/L, such as 300-700 mg/L, such as 400-600 mg/L; the concentration of Hygromycin (Hygromycin) is 100-500 mg/L, such as 200-400 mg/L.
According to an embodiment of the invention, the temperature of the fermentation is 20-40 ℃, preferably 25-30 ℃.
The invention also provides a ganoderma lucidum triterpenoid compound shown in the formula (I).
Further, the invention also provides a synthetic method of the ganoderma lucidum triterpenoid shown in the formula (I), which comprises the following steps:
a1) taking a yeast strain YL-T3-CYP5150L8-iGLCPR-GL20421 for over-expressing GL20421 gene, streaking the yeast strain on an SC-HLU solid plate, and then putting the solid plate in an incubator for culture so as to activate thalli;
a2) after the monoclone grows well, selecting the monoclone, transferring the monoclone into an SC-HLU liquid culture medium until the bacterial liquid grows to logarithmic phase, wherein the OD600 of the bacterial liquid reaches 1-2.5;
a3) after the bacterial liquid grows well, transferring the bacterial liquid into 400mL of SC-HLU liquid culture medium, and culturing the bacterial liquid until OD600 reaches 2-2.5 to obtain fermentation seeds;
a4) the fermentation seeds were inoculated into YPD24 medium supplemented with geneticin G418 and Hygromycin (Hygromycin) for fermentation.
According to an embodiment of the present invention, in the step a1), the temperature for cultivation is 20-40 ℃.
According to an embodiment of the invention, in step a1), the cultivation time is 0.5 to 5 days, such as 1 to 3.5 days, e.g. 1.5 to 3 days.
According to an embodiment of the present invention, in the step a2), the temperature for cultivation is 20-40 ℃.
According to an embodiment of the invention, in step a2), the incubation time is 6 to 48 hours, such as 10 to 24 hours.
According to an embodiment of the invention, in step a2), the rotation speed of the cultivation is 100 to 400rpm, such as 150 to 250 rpm.
According to an embodiment of the present invention, in the step a3), the temperature for cultivation is 20-40 ℃.
According to an embodiment of the invention, in step a3), the incubation time is 6 to 48 hours, such as 10 to 24 hours.
According to an embodiment of the invention, in step a3), the rotation speed of the cultivation is 100 to 400rpm, such as 150 to 250 rpm.
According to an embodiment of the invention, in step a4), the concentration of G418 is 200 to 800mg/L, such as 300 to 700mg/L, such as 400 to 600 mg/L.
According to an embodiment of the present invention, in the step a4), the concentration of Hygromycin (Hygromycin) is 100-500 mg/L, such as 200-400 mg/L.
According to an embodiment of the present invention, in step a4), the initial bacterial cell concentration OD600 in the culture medium after inoculation of the seed solution is 0.05-0.1.
According to an embodiment of the present invention, in the step a4), the fermentation temperature is 20-40 ℃.
According to an embodiment of the invention, in step a4), the fermentation time is 1 to 10 days, such as 3 to 7 days.
According to an embodiment of the invention, in step a4), the fermentation is carried out in a shake flask rotating at a speed of 100 to 400rpm, such as 150 to 250 rpm.
The invention also provides a method for synthesizing ganoderic acid Jb shown in a formula (II) by the CYP gene GL21117, which comprises the following steps:
b1) taking a yeast strain YL-T3-CYP5150L8-iGLCPR-GL21117 for over-expressing GL21117 gene, streaking on an SC-HLU solid plate, and then placing the plate in a culture box for culture so as to activate thalli;
b2) after the monoclone grows well, selecting the monoclone, transferring the monoclone into an SC-HLU liquid culture medium until the bacterial liquid grows to logarithmic phase, wherein the OD600 of the bacterial liquid reaches 1-2.5;
b3) after the bacterial liquid grows well, transferring the bacterial liquid into 400mL of SC-HLU liquid culture medium, and culturing the bacterial liquid until OD600 reaches 2-2.5 to obtain fermentation seeds;
b4) the fermentation seeds were inoculated into YPD24 medium supplemented with G418 and Hygromycin (Hygromycin) and fermented.
According to an embodiment of the present invention, in the step b1), the temperature for cultivation is 20-40 ℃.
According to an embodiment of the invention, in step b1), the cultivation time is 0.5 to 5 days, such as 1 to 3.5 days, e.g. 1.5 to 3 days.
According to an embodiment of the present invention, in the step b2), the temperature for cultivation is 20-40 ℃.
According to an embodiment of the invention, in step b2), the incubation time is 6 to 48 hours, such as 10 to 24 hours.
According to an embodiment of the invention, in step b2), the rotation speed of the cultivation is 100 to 400rpm, such as 150 to 250 rpm.
According to an embodiment of the present invention, in the step b3), the temperature for cultivation is 20-40 ℃.
According to an embodiment of the invention, in step b3), the incubation time is 6 to 48 hours, such as 10 to 24 hours.
According to an embodiment of the invention, in step b3), the rotation speed of the cultivation is 100 to 400rpm, such as 150 to 250 rpm.
According to an embodiment of the invention, in step b4), the concentration of G418 is 200 to 800mg/L, such as 300 to 700mg/L, such as 400 to 600 mg/L.
According to an embodiment of the present invention, in the step b4), the concentration of Hygromycin (Hygromycin) is 100 to 500mg/L, such as 200 to 400 mg/L.
According to an embodiment of the present invention, in step b4), the initial bacterial cell concentration OD600 in the culture medium after inoculation of the seed solution is 0.05-0.1.
According to an embodiment of the present invention, in the step b4), the fermentation temperature is 20-40 ℃.
According to an embodiment of the invention, in step b4), the fermentation time is 1 to 10 days, such as 3 to 7 days.
According to an embodiment of the invention, in step b4), the fermentation is carried out in a shake flask rotating at a speed of 100 to 400rpm, such as 150 to 250 rpm.
Advantageous effects
According to the invention, two GL20421 and GL21117 genes participating in ganoderma triterpene synthesis are excavated from a ganoderma genome, and a saccharomyces cerevisiae engineering strain is constructed by utilizing a synthetic biology technical means, so that the heterologous biosynthesis of ganoderma triterpene substances is realized, a potential method is provided for replacing the traditional artificial cultivation or deep liquid fermentation to obtain the ganoderma triterpene substances, and a foundation is laid for further realizing the efficient biosynthesis of the ganoderma triterpene substances through metabolic engineering modification.
Specifically, the CYP gene GL20421 obtained by the invention can catalyze ganoderic acid HLDOA to form a novel unreported natural ganoderma triterpene product, namely a ganoderma triterpene compound shown in a formula (I). The CYP gene GL21117 obtained by the invention can catalyze ganoderic acid HLDOA to form ganoderic acid Jb, and the structure of the ganoderic acid Jb is completely consistent with that of a natural compound, so that the product performance and the quality can be considered to be equivalent. Studies have shown that ganoderic acid Jb can activate human platelet phospholipase C and A2 to promote platelet aggregation (Wang, C.N., et al., Eur J Pharmacol,1994.267(1): 33-42). Moreover, the growth rate of the saccharomyces cerevisiae is obviously higher than that of the ganoderma lucidum, so that the efficiency of the method for preparing the ganoderic acid Jb by catalyzing the CYP gene GL21117 is far higher than that of the method for preparing the ganoderic acid Jb by utilizing the growth of the ganoderma lucidum, and the ganoderic acid Jb is obtained by separating the ganoderic acid Jb from the ganoderma lucidum.
Drawings
FIG. 1 is a schematic diagram of expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr according to the present invention;
FIG. 2 is a schematic diagram of expression plasmid pRS426HF-GL20421-G418r of the present invention;
FIG. 3 is a schematic representation of expression plasmid pRS426HF-GL21117-G418r of the present invention;
FIG. 4 is an HPLC chromatogram of fermentation products of Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR-GL20421 strain and a control strain;
FIG. 5 is an HPLC chromatogram of fermentation products of Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR-GL21117 strain and a control strain;
FIG. 6 shows the enzyme-catalyzed product of cytochrome P450 enzyme encoded by GL20421, the ganoderma lucidum triterpene compound shown in formula (I)1H-NMR spectrum;
FIG. 7 shows the enzyme-catalyzed product of cytochrome P450 enzyme encoded by GL20421, the ganoderma lucidum triterpene compound shown in formula (I)13A C-NMR spectrum;
FIG. 8 shows DEPT spectra of enzyme-catalyzed product of cytochrome P450 enzyme encoded by GL20421, Ganoderma lucidum triterpene compound shown in formula (I);
FIG. 9 shows a COSY spectrum of a Ganoderma lucidum triterpene compound represented by formula (I) as an enzyme-catalyzed product of cytochrome P450 encoded by GL 20421;
FIG. 10 shows HSQC spectra of enzyme-catalyzed product of cytochrome P450 enzyme encoded by GL20421, Ganoderma lucidum triterpene compound shown in formula (I);
FIG. 11 shows HMBC spectra of enzyme-catalyzed product of cytochrome P450 enzyme encoded by GL20421, ganoderma lucidum triterpenoid shown in formula (I);
FIG. 12 is a schematic representation of the formation of the enzyme-catalyzed product of cytochrome P450 enzyme encoded by GL20421, the ganoderma triterpenoid of formula (I);
FIG. 13 shows the enzyme-catalyzed product of ganoderic acid Jb of cytochrome P450 encoded by GL211171H-NMR spectrum;
FIG. 14 shows the enzyme-catalyzed product of ganoderic acid Jb of cytochrome P450 encoded by GL2111713A C-NMR spectrum;
FIG. 15 is a DEPT spectrum of the enzyme-catalyzed product ganoderic acid Jb of cytochrome P450 encoded by GL 21117;
FIG. 16 is a COSY spectrum of a cytochrome P450 enzyme catalysis product ganoderic acid Jb encoded by GL 21117;
FIG. 17 is an HSQC spectrum of the enzyme-catalyzed product ganoderic acid Jb of cytochrome P450 encoded by GL 21117;
FIG. 18 is an HMBC spectrum of the enzyme-catalyzed product ganoderic acid Jb of cytochrome P450 encoded by GL 21117;
FIG. 19 is a schematic representation of the formation of the enzyme-catalyzed product ganoderic acid Jb from GL21117 encoded cytochrome P450;
FIG. 20 is a synthesis scheme of the enzyme-catalyzed production of Ganoderma lucidum triterpenoid represented by formula (I) and the enzyme-catalyzed production of Ganoderic acid Jb from GL 20421-encoded cytochrome P450.
Detailed Description
The technical solution of the present invention will be further described in detail with reference to specific embodiments. It is to be understood that the following examples are only illustrative and explanatory of the present invention and should not be construed as limiting the scope of the present invention. All the technologies realized based on the above-mentioned contents of the present invention are covered in the protection scope of the present invention.
Unless otherwise indicated, the raw materials and reagents used in the following examples are all commercially available products or can be prepared by known methods.
The method comprises the steps of firstly selecting CYP genes in a ganoderma genome which possibly participate in ganoderic acid biosynthesis, then respectively cloning the CYP genes into saccharomyces cerevisiae expression plasmids, respectively converting the saccharomyces cerevisiae expression plasmids into recombinant and modified microbial saccharomyces cerevisiae for heterologous expression, and finally screening to obtain CYP genes GL20421(SEQ ID No.1) and GL21117(SEQ ID No.3) for catalyzing ganoderic acid HLDOA to generate ganoderma triterpene through fermentation screening of the converted strains, so that the heterologous biosynthesis of the ganoderma triterpene is realized.
The CYP gene in the ganoderma genome possibly participating in biosynthesis of ganoderic acid refers to: all CYP genes in Ganoderma lucidum cells.
The heterologous expression specifically refers to: the method comprises the steps of taking ganoderma lucidum cDNA as a template, obtaining each CYP coding region sequence fragment through PCR amplification, and carrying out recombination connection on an expression vector pRS426, the CYP coding region sequence fragment, a yeast HXT7p promoter, a yeast FBA1t terminator and a KanMX gene expression cassette containing a truncated promoter Ura3(tP-Ura3) through methods such as homologous recombination and the like to obtain a series of recombinant expression plasmids pRS426HF-CYPs-G418r (s refers to different CYP genes).
The saccharomyces cerevisiae strain over-expressing the ganoderic acid HLDOA refers to: the BY4742 strain YL-T3(BY4742, delta TRP1, delta DNA:: PPGK1-tHMG1-TADH1-PTEF1-LYS2-TCYC1, TRP:: HIS-PPGK1-ERG20-TADH1-PTEF1-ERG9-TCYC1-PTDH3-ERG1-TTPL1) (obtained BY reference to (Dai, Z., et al, Sci Rep,2014.4:3698) literature) was further modified after genetic engineering. Yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr was introduced. Among them, BY4742 strain is a commercial yeast host commonly used BY those skilled in the art. On the basis, several genes tHMG1, ERG20, ERG9 and ERG1 at the upstream of the Lanosteol biosynthetic pathway are over-expressed, so that the synthesis amount of Lanosteol is improved. Introduction of pRS425-CYP5150L8-iGLCPR-Hygr expression plasmid allows the Lanosterol produced in YL-T3 cells to be further catalyzed by three steps to form ganoderic acid HLDOA.
The introduced yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr is characterized in that pRS425, a TEF1p promoter, a GL19526 gene (iGLCPR), a PGK1t terminator, a Hygromycin B gene expression cassette containing a truncated promoter Ura3(tP-Ura3) and a CYP5150L8 expression cassette are recombined and connected by a homologous recombination method on the basis of a yeast expression commercial vector pRS425 to obtain a recombinant expression plasmid pRS425-CYP5150L 8-iGLCPR-Hygr. Wherein the expression product of the GL19526 gene is a Cytochrome P450 Reductase (CPR) iGLCPR, and the CYP performs a series of catalytic oxidation functions, which often require CPR to transfer electrons from NAD (P) H. A certain degree of overexpression of CPR can better support CYP catalytic function. CYP5150L8 catalyzes Lanosterol, and forms a ganoderic acid HLDOA through three-step oxidation reaction (Wang, W.F., et al., Biotechnol Bioeng,2018.115(7):1842-1854).
The fermentation screening specifically comprises the following steps: each expression plasmid was introduced into a recombinant modified s.cerevisiae by a standard lithium acetate Transformation method (Gietz, R.D., et al., Nat Protoc,2007.2(1):31-4) or a method using a Yeast Transformation kit (Frozen-EZ Yeast Transformation II, ZYMO RESEARCH), followed by fermentation in YPD24 medium, followed by methanol extraction of the cell pellet of the fermentation product, and finally the extract was analyzed by HPLC (high performance liquid chromatography) to see whether a new peak was produced as compared with the control strain, thereby preliminarily determining whether the transformed CYP gene was the desired target gene.
The control strains refer to: and (3) transferring the pRS426HF-G418r yeast expression plasmid without the CYP gene into the recombined and modified microorganism saccharomyces cerevisiae to obtain the strain.
The YPD24 culture medium comprises 10g/L yeast powder, 20g/L beef peptone, 20g/L glucose and 40g/L glycerol. 500mg/L of G418 was simultaneously added to the medium of Saccharomyces cerevisiae containing the yeast expression plasmids pRS426HF-CYPs-G418r or pRS426HF-G418 r. For Saccharomyces cerevisiae containing pRS425-CYP5150L8-iGLCPR-Hygr Saccharomyces cerevisiae expression plasmid, 300mg/L Hygromycin (Hygromycin) was added to the medium at the same time.
Example 1
Construction of Saccharomyces cerevisiae strain overexpressing Ganoderic acid HLDOA
And transferring the yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr into saccharomyces cerevisiae YL-T3 to form recombined and transformed saccharomyces cerevisiae YL-T3-CYP5150L 8-iGLCPR. The specific operation steps are as follows:
construction of Yeast expression plasmid pRS425-CYP5150L8-iGLCPR-Hygr
1.1) based on pRS425-iGLCPR-Hygr to transform. The pRS425-iGLCPR-Hygr plasmid can be constructed by reference to the literature (Lan, Yuan, Wang, & Xiao, 2019). The plasmid pRS425-iGLCPR-Hygr was first digested with Pmel enzyme to obtain linearized plasmid vector fragments.
1.2) then using the primer pair HF-CYP5150L8-F and HF-CYP5150L8-R, and pRS426-HXT7p-CYP5150L8-FBA1t (Lan, X., et al., Biotechnol Bioeng,2019.116(12): 3301-8 de expression cassette) as a template to amplify the CYP5150L8de expression cassette containing the homologous arm. The specific sequence of the primer is shown in a sequence table 1:
table 1: primer sequence list for amplifying expression cassette of CYP5150L8 containing homologous arm
Primer name
Serial number
Sequence(5'to 3')
HF-CYP5150L8-F
SEQ ID No.5
ggcaaaggaataatctcgagtcatgtaattagttatgtca
HF-CYP5150L8-R
SEQ ID No.6
cgagcggtctaaggcggtttacttctcgtaggaacaattt
F and R represent forward and reverse primers, respectively.
1.3) the linearized pRS425-iGLCPR-Hygr vector fragment and the CYP5150L8de expression cassette fragment containing the homology arm were then ligated by homologous recombination. The method comprises the following specific steps:
1.3.1) linking System: 0.03pmol of linearized pRS425-iGLCPR-Hygr plasmid, 0.06pmol of the amplified CYP5150L8de expression cassette fragment containing the homology arm, 4. mu.L of CE II Buffer, 2. mu.L of Exnase II, and 20. mu.L of sterile water. Mixing gently to avoid air bubble, reacting at 37 deg.C for 30min, and ice-cooling for 5 min.
1.3.2) 50. mu.L of DH 5. alpha. competent cells frozen at-80 ℃ were removed and left on ice until they were completely thawed, which took about 5 min.
1.3.3) transfer the ligation products to 50. mu.L DH 5. alpha. competent cells, mix well to avoid air bubbles, stand on ice for 20min, heat shock at 42 ℃ for 60s, then stand on ice for 2min, add 900. mu.L LB medium, incubate at 37 ℃ for 60 min. Subsequently, 100ug/mL of Amp resistant LB plate was applied and the culture was carried out overnight at 37 ℃ with the incubator inverted.
1.3.4), selecting single clone to be transferred into 3mL liquid LB culture medium containing 100ug/mL Amp resistance, and culturing overnight at 37 ℃ and 220 rpm.
1.3.5) and the like, extracting plasmids, performing PCR verification by using a sequencing primer, then selecting possibly paired plasmids for sequencing, and comparing sequencing results, thereby obtaining correct recombinant plasmid pRS425-CYP5150L 8-iGLCPR-Hygr.
The sequencing primers used are shown in table 2:
table 2: sequencing primer sequence table for verifying correctness of recombinant plasmid pRS425-CYP5150L8-iGLCPR-Hygr
Primer name
Serial number
Sequence(5'to 3')
HF-CYP5150L8-CX-F
SEQ ID No.7
atttcgatgatgcagcttgg
HF-CYP5150L8-CX-R
SEQ ID No.8
acatcaaaatccacattctc
1.4) the correctly sequenced recombinant plasmid pRS425-CYP5150L8-iGLCPR-Hygr obtained above was transformed into Saccharomyces cerevisiae YL-T3 by the lithium acetate method (Gietz, R.D., et al., Nat Protoc,2007.2(1):31-4) or by the method using the Yeast Transformation kit (Frozen-EZ Yeast Transformation II, ZYMO RESARCH), and the transformed Yeast was spread on SC-His-Leu (SC-HL) solid medium (Yeast deaminated acid nitrogen source, YNB), 6.7 g/L; glucose, 20 g/L; yeast amino acid-deficient synthetic medium (SD) Y2001, 1.39 g/L; tryptophan, 76 mg/L; uracil, 76 mg/L; agar powder, 2%). Culturing at 30 ℃ for 1.5-3 days. And selecting a single clone until a transformant appears, thereby obtaining the modified saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR strain.
The saccharomyces cerevisiae YL-T3 refers to: the BY4742 strain YL-T3(BY4742, delta TRP1, delta DNA:: PPGK1-tHMG1-TADH1-PTEF1-LYS2-TCYC1, TRP:: HIS-PPGK1-ERG20-TADH1-PTEF1-ERG9-TCYC1-PTDH3-ERG1-TTPL1) is genetically engineered, wherein the BY4742 strain is a commercial yeast host commonly used BY the technical personnel in the field, and genes tHMG1, ERG20, ERG9 and ERG1 at the upstream of the wool biosynthesis pathway are overexpressed on the basis of the sterol, so that the synthesis amount of the lanosterol is improved. Specific construction methods can be obtained by reference to the literature (Dai, Z., et al., Sci Rep,2014.4: 3698).
Example 2
Construction of a Saccharomyces cerevisiae transformant Strain expressing CYP Gene
2.1) taking Ganoderma cDNA as a template, obtaining CYP gene coding region sequence segments through PCR amplification, wherein the coding region sequence segments of GL20421 and GL21117 are SEQ ID No.1 and SEQ ID No.3 respectively. Wherein the primer sequences for obtaining the sequence segments of the coding regions of the Ganoderma CYP genes GL20421 and GL21117 by amplifying from the Ganoderma cDNA are shown in Table 3.
TABLE 3 primer sequence table for amplifying coding region sequence segment of glossy ganoderma CYP gene
Primer name
Serial number
Sequence(5'to 3')
GL20421-F
SEQ ID No.9
taattttaatcaaaaagtttatgatcatcccagtagacat
GL20421-R
SEQ ID No.10
attaatttgaattaacgttttcagtctgcacgacgcaccc
GL21117-F
SEQ ID No.11
taattttaatcaaaaagtttatggcgacgttggaggaccc
GL21117-R
SEQ ID No.12
attaatttgaattaacgttttcaagaagcctgcgcatgcc
2.2) recombining and connecting an expression vector pRS426, a CYP gene coding region sequence fragment, a yeast HXT7p promoter, a yeast FBA1t terminator and a KanMX gene expression frame containing a truncated promoter Ura3(tP-Ura3) by a homologous recombination method and the like to obtain a recombinant expression plasmid pRS426HF-CYPs-G418r (s represents different CYP genes, such as GL20421 and GL 21117); the method is specifically obtained by the following steps:
i) specific construction methods for the Smal linearized pRS426-HXT7p-FBA1t-G418r plasmid and pRS426-HXT7p-FBA1t-G418r plasmid can be found in reference (Lan, X., et al, Biotechnol Bioeng,2019.116(12): 3301-3311).
ii) connecting the linearized pRS426-HXT7p-FBA1t-G418r plasmid with the sequence fragment of the coding region of the CYP gene obtained by amplification through a recombinase, and specifically comprising the following steps:
a) a connection system: 0.03pmol of linearized pRS426-HXT7p-FBA1t-G418r plasmid, 0.06pmol of amplified sequence fragment of the CYP gene coding region, 4. mu.L of CE II Buffer, 2. mu.L of Exnase II, and 20. mu.L of sterile water. Mixing gently to avoid air bubble, reacting at 37 deg.C for 30min, and ice-cooling for 5 min.
b) The procedure is as in step 1.3.2 of example 1.
c) The procedure is as in step 1.3.3 of example 1.
d) The procedure is as in step 1.3.4 of example 1.
e) After the bacterial liquid grows to a stable period, extracting plasmids, carrying out PCR verification by using a sequencing primer, then selecting possibly paired plasmids for sequencing, and comparing sequencing results, thereby obtaining correct recombinant plasmid pRS426HF-CYPs-G418 r.
The sequencing primers used are shown in table 4:
table 4: sequencing primer sequence table for verifying correctness of recombinant plasmid pRS426HF-CYPs-G418r
Primer name
Serial number
Sequence(5'to 3')
P450-CX-F
SEQ ID No.13
gccaatacttcacaatgttc
P450-CX-R
SEQ ID No.14
tcattttgtcattgaccttc
2.3) the correctly sequenced recombinant plasmid pRS426HF-CYPs-G418r (obtained as described above) was transformed into a recombinant Saccharomyces cerevisiae YL-T3-CYP5150L8-iGLCPR by a lithium acetate method (Gietz, R.D., et al, Nat Protoc,2007.2(1):31-4) (the same effect was achieved by a method using a Yeast Transformation kit (Frozen-EZ Yeast Transformation II, ZYMO RESEARCH)), and the transformed Yeast was spread on SC-His-Leu-Ura (SC-HLU) solid medium (Yeast deaminate nitrogen source (YNB)) at 6.7G/L; glucose, 20 g/L; yeast amino acid-deficient synthetic medium (SD) Y2001, 1.39 g/L; tryptophan, 76 mg/L; agar powder, 2%) were cultured. And 3, culturing in an incubator at 30 ℃ for 1.5-3 days. Until transformants appeared, single clones were selected, and thereby Saccharomyces cerevisiae strains YL-T3-CYP5150L8-iGLCPR-GL20421 and YL-T3-CYP5150L8-iGLCPR-GL21117 overexpressing CYP genes GL20421 and GL21117 were obtained.
Example 3 determination of CYP Gene and functional characterization by fermentation of Yeast transformants
Fermentation of yeast transformed strains:
3.1) fermenting each constructed transformant of the yeast transformant strain containing the CYP gene (GL20421 gene or GL21117 gene) while using an empty plasmid strain containing no CYP gene as a control. And comparing the differences of the metabolic products after fermentation, thereby primarily screening the CYP genes possibly related to ganoderma triterpene biosynthesis. The specific operation is as follows:
3.1.1) each of the transformants of the yeast transformant strain containing the CYP gene constructed in example 2 was liquid-transferred to 3mL of SC-His-Leu-Ura (SC-HLU) liquid medium (yeast reagent base without amino acids (YNB), 6.7 g/L; glucose, 20 g/L; "yeast synthetic drop-out media (SD) Y2001, 1.39 g/L; trypophan, 76mg/L), culturing in a high-throughput shaking table for 24 hours under the conditions of 30 ℃ and 850rpm and 90% humidity;
3.1.2) then liquid transferring the cultured bacterial liquid into 3mL of SC-HLU liquid culture medium again according to the proportion (volume ratio) of 3%, culturing for 12h under the condition of 30 ℃ and 850rpm and humidity of 90% until the thallus reaches the logarithmic phase, and completing the preparation of seed bacterial liquid;
3.1.3) then inoculating the seeds at a ratio of 3% (volume ratio) into YPD24 medium (yeast powder 10G/L, beef peptone 20G/L, glucose 20G/L, glycerol 40G/L) supplemented with 500mg/L of G418 and 300mg/L of Hygromycin (Hygromycin) and then fermentation culturing at 850rpm at 30 ℃ under 90% humidity for 5 days.
3.1.4) fermenting and culturing for 5 days, taking out the fermented bacterial liquid, centrifuging for 10min at 15,600g, removing the supernatant, mixing the cell precipitate with 2mL of methanol, standing at 30 ℃ and 220rpm for 30min for extraction, centrifuging for 10min at 15,600g, filtering the supernatant with a 0.22 mu m needle filter to obtain a crude extract after fermentation of the recombinant strain, and detecting and analyzing the fermentation product by HPLC.
3.2) primarily determining whether the CYP genes GL20421 and GL21117 are related to the biosynthesis of ganoderma triterpene by observing whether a new peak appears in an HPLC (high Performance liquid chromatography) map of a fermentation product.
Example 4
HPLC detection of fermentation product of Saccharomyces cerevisiae transformant
4.1) HPLC analysis method of fermentation product:
the instrument comprises the following steps: agilent 1260Infinity II HPLC analytical system, DAD (Diade array detector) detector.
A chromatographic column: kinetex Biphenyl analytical column (2.6 μm,150 mm. times.4.6 mm, Phenomenex, Torrance, Calif.).
Column temperature: 30 ℃; flow rate: 0.5 mL/min; sample introduction amount: 20 μ L, detection wavelength 214 nm.
Phase A: ultrapure water, phase B: methanol (containing 0.1% acetic acid).
The gradient elution procedure was: 0-30min, 80% -100% of phase B; 30-35min, 100% of phase B; 35-36min, 100% -80% of phase B; 36-45min, 80% of phase B.
4.2) by comparing the peak patterns of the fermentation products with those of the empty plasmid control strains, it was observed that when a recombinant plasmid containing GL20421 or GL21117 gene, i.e., pRS426HF-GL20421-G418r (FIG. 2) or pRS426HF-GL21117-G418r (FIG. 3), was introduced into the YL-T3-CYP5150L8-iGLCPR s.cerevisiae strain, the recombinant yeast strain YL-T3-CYP5150L8-iGLCPR-GL20421 had significantly different peaks from YL-T3-CYP5150L8-iGLCPR-GL21117 and the control strain (FIGS. 4 and 5)
Example 5
Separation, purification and identification of fermentation product of yeast strain overexpressing GL20421 and GL21117 genes
5.1) isolation, purification and characterization of the fermentation product of Yeast strains overexpressing the GL20421 Gene
5.1.1) taking a yeast strain YL-T3-CYP5150L8-iGLCPR-GL20421 which is frozen at the temperature of-80 ℃ and overexpresses a GL20421 gene, streaking the yeast strain YL-T3-CYP5150L8-iGLCPR-GL20421 on an SC-HLU solid plate, and then placing the solid plate in an incubator at the temperature of 30 ℃ for inverted culture for 1.5-3 days so as to activate the thallus.
5.1.2) when the monoclone grows well, selecting the monoclone, transferring the monoclone into 20mL SC-HLU liquid culture medium, culturing at 30 ℃ and 220rpm for about 24h until the bacterial liquid grows to logarithmic phase, wherein the OD600 of the bacterial liquid reaches 1-2.5.
5.1.3) after the bacterial liquid grows well, measuring the OD600 value of the bacterial liquid, transferring the bacterial liquid into a 2L shake flask of a 400mL SC-HLU liquid culture medium until the initial OD600 is 0.05, and then culturing the bacterial liquid at 30 ℃ and 220rpm for about 12 hours until the OD600 of the bacterial liquid reaches 2-2.5. At this point the fermentation seed preparation is complete.
5.1.4) inoculating fermentation: the cultured seed solution was inoculated into 10L YPD24 medium supplemented with 500mg/L of G418 and 300mg/L of Hygromycin (Hygromycin) to an initial OD600 of 0.05. 2L of large shake flasks with the filling amount of 400mL are adopted, and 25 flasks are counted. All flasks were placed at 30 ℃ and 220rpm for 5 days of fermentation.
5.1.5) after the fermentation is finished, adding ethyl acetate into the fermentation liquor according to the proportion of 1:1, sealing the membrane, and then placing on a shaking table with the temperature of 30 ℃ and the rpm of 250 to shake and extract for 1 h. Then, the mixture was taken out and centrifuged at 3300rpm at 25 ℃ for 5min using a centrifuge to promote separation. The supernatant ethyl acetate layer was collected. The lower layer was extracted again with ethyl acetate. Then combining the ethyl acetate after the two extractions, heating at 27 ℃ by using a rotary evaporator, and condensing at 9 ℃ for rotary evaporation until the ethyl acetate is basically evaporated to dryness. Then, the mixture was aspirated, and the residue was dissolved out with methanol, and the combined dissolved-out materials were approximately 20mL in volume.
5.1.6) purification by normal phase silica gel column. The method comprises the following steps:
a 34mm (inner diameter of column) by 500mm (effective column length) chromatography column was used;
the elution procedure was: 200mL of petroleum ether; petroleum ether: ethyl acetate 8:1, 200 mL; petroleum ether: ethyl acetate 2:1, 200 mL; petroleum ether: ethyl acetate 1:1, 600 mL; petroleum ether: ethyl acetate 1:2, 600 mL; petroleum ether: ethyl acetate 1:4, 400 mL; methanol, 600 mL.
During elution, 100mL was collected using a 100mL glass tube. Thereafter, 0.5mL of the solution was removed from each tube, filtered through a 0.22 μm organic syringe filter, and analyzed by HPLC. HPLC detection method is the same as 4.1 in example 4.
After detection, the collected liquid containing the ganoderma triterpenoid shown in the formula I is completely combined, then a rotary evaporator is used, heating is carried out at 27 ℃, condensation is carried out at 9 ℃ until the mixture is evaporated to dryness, then a small amount of methanol (<5mL) is used for dissolution, centrifugation is carried out at 12000rpm for 10min, and the supernatant is taken for subsequent treatment.
5.1.7) preparative purification using a preparative liquid phase.
The concentrated crude product is further purified by a preparative liquid phase, which comprises the following steps:
the instrument comprises the following steps: an Agilent 1200 series semi-preparative high performance liquid chromatograph;
a chromatographic column: 100-10-C18 column (20X250 mm) (Kromasi, Sweden);
flow rate: 10 mL/min; sample introduction amount: 600 mu L;
phase A is ultrapure water, and phase B is acetonitrile;
the gradient elution procedure was: 0-30min, 85% -90% of phase B; 30-60min, 90% -100% of phase B;
the Ganoderma triterpene compound of formula I peaks at about 14.5-15min, and is connected with 2mL centrifugal tube at the peak-appearing stage, and each tube contains about 1.5 mL.
Each tube was then analyzed by HPLC detection, as in 4.1 of example 4. Verifying the purity of the ganoderma lucidum triterpene compound shown in the formula I, merging centrifuge tubes with the purity higher than 95%, performing rotary evaporation and evaporation to dryness, dissolving the mixture into 1.5mL centrifuge tubes by using 1mL of methanol (the weight of the centrifuge tubes needs to be weighed before adding), performing vacuum evaporation at 45 ℃ to obtain powder, weighing the powder again, and determining the weight of a pure product.
5.1.8) the purified material was analyzed by UPLC-APCI-MS, which was characterized by 437.3480 predominating m/z in the cation mode and a strong 455.3583 signal. The m/z of the ganoderic acid HLDOA is mainly 439.3577 in the cation mode.
5.1.9) the purified material was further subjected to NMR (nuclear magnetic resonance spectroscopy) detection to confirm the structure of the new product. By carefully analyzing the spectrograms of the one-dimensional carbon spectrum, the one-dimensional hydrogen spectrum, COSY, HSQC and HMBC, the structure of the new compound is finally determined to be different from the reported compound, and the new compound is the ganoderma triterpenoid compound shown in the formula I and is a new natural ganoderma triterpenoid product. The one-dimensional carbon spectrum and hydrogen spectrum data of the compound of formula I are shown in table 5. Of the product1H-NMR、13The C-NMR, DEPT, COSY, HSQC and HMBC spectra are shown in FIGS. 6 to 11. FIG. 12 is a schematic diagram of GL20421 catalysis product, Ganoderma lucidum triterpene compound formation shown in formula I.
TABLE 5 preparation of Ganoderma lucidum triterpenes1H-NMR、13C-NMR data
5.2) isolation, purification and characterization of the fermentation product of Yeast strains overexpressing the GL21117 Gene
5.2.1) taking a yeast strain YL-T3-CYP5150L8-iGLCPR-GL21117 which is frozen at the temperature of-80 ℃ and overexpresses a GL21117 gene, streaking the yeast strain YL-T3-CYP5150L8-iGLCPR-GL21117 on an SC-HLU solid plate, and then placing the solid plate in an incubator at the temperature of 30 ℃ for inverted culture for 1.5-3 days so as to activate the thalli.
5.2.2) the procedure is the same as 5.1.2.
5.2.3) the operation steps are the same as 5.1.3.
5.2.4) the procedure is as in 5.1.4.
5.2.5) the procedure is as in 5.1.5.
5.2.6) purification by normal phase silica gel column. The method comprises the following steps:
a 34mm (inner diameter of column) by 500mm (effective column length) chromatography column was used;
the elution procedure was: 200mL of petroleum ether; petroleum ether: ethyl acetate 8:1, 200 mL; petroleum ether: ethyl acetate 2:1, 200 mL; petroleum ether: ethyl acetate 1:1, 600 mL; petroleum ether: ethyl acetate 1:2, 600 mL; petroleum ether: ethyl acetate 1:4, 400 mL; methanol, 600 mL.
During elution, 100mL was collected using a 100mL glass tube. Thereafter, 0.5mL of the solution was removed from each tube, filtered through a 0.22 μm organic syringe filter, and analyzed by HPLC. HPLC detection method is the same as 4.1 in example 4.
After detection, the collected liquid containing ganoderic acid Jb is completely combined, then a rotary evaporator is used for heating at 27 ℃, condensation at 9 ℃ is carried out for rotary evaporation till evaporation is carried out, then a small amount of methanol (<5mL) is used for dissolution, centrifugation is carried out at 12000rpm for 10min, and the supernatant is taken for subsequent treatment.
5.2.7) was prepared using a preparative liquid phase.
The concentrated crude product is further purified by a preparative liquid phase, which comprises the following steps:
the instrument comprises the following steps: an Agilent 1260 series liquid chromatograph. A DAD detector with a detection wavelength of 214 nm;
a chromatographic column: YMC-Pack ODS-A,20x250 mm,5um,12 nm;
flow rate: 10 mL/min; sample introduction amount: 800 mu L;
phase A: ultrapure water, phase B: methanol;
the gradient elution procedure was: 0-50min, 80% -100% of phase B; 50-60min, 100% phase B; 60-60.5min, 100% -80% of phase B; 60.5-70min, 80% of phase B.
Collecting fractions within a period of 20.5-27.5 min. Collect one tube every 0.5 min. The collection time per tube can be shortened properly in the second purification, and one tube can be collected in 0.25 min. The fractions from each tube were then analyzed by HPLC using the same method as 4.1 in example 4. Verifying the purity of ganoderic acid Jb (compound shown in formula II), combining the collected liquid in the collecting tube with the purity higher than 95%, performing rotary evaporation to dryness, and dissolving in a centrifuge tube with methanol less than 10mL (the weight of two centrifuge tubes is required to be weighed before adding). Vacuum evaporating to obtain powder, weighing, and determining the weight of the pure product.
5.2.8) pure material was analyzed by UPLC-APCI-MS, which has a predominant m/z of 453.3353 in the cation mode and a strong signal of 435.3260. 435.3260 is likely to be the signal generated by 453.3353 for dehydration of the substance. The m/z of the ganoderic acid HLDOA is mainly 439.3577 in the cation mode.
5.2.9) the purified material was further subjected to NMR detection to confirm the structure of the new product. By carefully analyzing the spectrograms of the one-dimensional carbon spectrum, the one-dimensional hydrogen spectrum, COSY, HSQC and HMBC, the structure of the new compound is finally determined to be completely consistent with the reported ganoderic acid Jb, and the new compound is a ganoderma triterpenoid compound naturally existing in ganoderma. The one-dimensional carbon spectrum and hydrogen spectrum data are shown in Table 6.1H-NMR、13The C-NMR, DEPT, COSY, HSQC and HMBC spectra are shown in FIGS. 13 to 18. FIG. 19 is a schematic diagram of GL21117 catalyzing the formation of the product ganoderic acid Jb.
TABLE 6 of Ganoderic acid Jb1H-NMR、13C-NMR data:
experiments show that the two cytochrome oxidase genes capable of catalyzing the ganoderic acid HLDOA are obtained, as shown in figure 20, GL20421 can catalyze the ganoderic acid HLDOA to form a novel ganoderma triterpenoid compound shown in formula I. GL21117 can catalyze ganoderic acid HLDOA to form ganoderic acid Jb. The genes GL20421 and GL21117 are expressed in yeast respectively, so that the heterologous biosynthesis of the ganoderma lucidum triterpenoid and the ganoderic acid Jb shown in the formula I is realized. Saccharomyces cerevisiae is a mature strain for industrial production, and aiming at the fact that Saccharomyces cerevisiae has a mature genetic operation technical means, fermentation yield of ganoderma triterpenoids can be greatly improved through metabolic engineering modification and fermentation process optimization, so that the invention provides a ganoderic acid heterologous biosynthesis technology with wide industrial application prospect.
The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiment. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> institute of Tianjin Industrial Biotechnology, China academy of sciences, Shanghai university of transportation
<120> cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoids
<130> CPCN20110138
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 1626
<212> DNA
<213> GL20421
<400> 1
atgatcatcc cagtagacat tgtatcgccc ctatctgtct ggcaggtcgc cgccgtcctc 60
accgcggtct acttcgccca cagcttcgtc cgcgcccgcc gcaaggccgc ccgcgagacg 120
cctcttgcgt gtcctccaag gcagagctgg ctcttcggca tccgcaacct tatcgcaggc 180
aaccccgagg ccggctccat ctacgaggcc tggatcgagg aatacgggtc cgtctaccgc 240
gtccccgcac cactggggtc cacccgggtc atcctcaccg atcccaaggc gatcgcgcac 300
ttctactcgg tcgagacgtg gacgtatgtg cagacgaagc tcgcgagggt cgcgattgag 360
ggcctgttgg gccgtgggtt gctttgggcg gaaggggagt ctcataaacg gcaacgcaag 420
gcgatatccc ccgccttcag caacattgcc attcgaaggc ttacctccgt gttctacgac 480
tccgtctaca agctcaagac caattgggac aaccaattgg cttcagtgga tttcgccacg 540
atagatgtac agaaatggat gaaccacgtc tcccttgaca gtatcggcat cgcgggattc 600
tctcatgact ttggctccct cgaaggcaag cactccgctg tcgccgaagt attcgatgcc 660
atgggtcatg tcaagccggg catctttacc gctgcggccc tcttcttcgg caatgtcttc 720
cccgtcctct ggcgtctccc cacagaaacg cgccgtctcc aactgaagct gaataagtgt 780
atggaggaga tcgctgtacc cctgctggag aacacgcgca atgagatgag gggtctaggc 840
gagaagggta aggaggagaa gagtatcatt ggcctgttga ttaaggcgga ggatgccaat 900
tcaagcctgc aaatgtctca ggaagagatc atggcccaga tgaaggtgct aatcttggca 960
ggatacgaaa ctacgtcaat cagtctcacg tgggccctca tcgagttatc acgcaagcca 1020
gagacccagg aacgccttcg tgaggagctg aaagaggagt tcccgaacgc ggatccaacc 1080
tgggaacagc tcacgaacgg ctccggtcta cattacctcg acgccgtcgt gcacgagatc 1140
ctcagactcc acgcgccgct caacgtcacc actcgtgttg ccgcaaagga tgacgtcatt 1200
ccactctcca cacccttgcg cctcccaact ggcgagctca ccgaccacgt cgccatcacc 1260
gagggccaag aggtcaccgt gcccatcagc tgcatgaaca ccgccgtcgc attctggggc 1320
cccgacgcac gcgagttccg cccggaacgc tggctcaacg aagacgggct cccgaagaag 1380
gcgcaggaga ttcaggggca ccgccacctg ctcaccttcg tcgacgggca ccgcatctgt 1440
ctcgggcgcg gctttgcgct agcagagttc aaggccgtgc tcggggtgtt gatcaagaac 1500
taccagttcg agctgccgga cgggccagag accaagatcg agttctgtcg tggggtcctt 1560
ccgcgcccgc gcgtcgtcgg cgagaagggc gcgaacctcc cgatgcgggt gcgtcgtgca 1620
gactga 1626
<210> 2
<211> 541
<212> PRT
<213> GL20421
<400> 2
Met Ile Ile Pro Val Asp Ile Val Ser Pro Leu Ser Val Trp Gln Val
1 5 10 15
Ala Ala Val Leu Thr Ala Val Tyr Phe Ala His Ser Phe Val Arg Ala
20 25 30
Arg Arg Lys Ala Ala Arg Glu Thr Pro Leu Ala Cys Pro Pro Arg Gln
35 40 45
Ser Trp Leu Phe Gly Ile Arg Asn Leu Ile Ala Gly Asn Pro Glu Ala
50 55 60
Gly Ser Ile Tyr Glu Ala Trp Ile Glu Glu Tyr Gly Ser Val Tyr Arg
65 70 75 80
Val Pro Ala Pro Leu Gly Ser Thr Arg Val Ile Leu Thr Asp Pro Lys
85 90 95
Ala Ile Ala His Phe Tyr Ser Val Glu Thr Trp Thr Tyr Val Gln Thr
100 105 110
Lys Leu Ala Arg Val Ala Ile Glu Gly Leu Leu Gly Arg Gly Leu Leu
115 120 125
Trp Ala Glu Gly Glu Ser His Lys Arg Gln Arg Lys Ala Ile Ser Pro
130 135 140
Ala Phe Ser Asn Ile Ala Ile Arg Arg Leu Thr Ser Val Phe Tyr Asp
145 150 155 160
Ser Val Tyr Lys Leu Lys Thr Asn Trp Asp Asn Gln Leu Ala Ser Val
165 170 175
Asp Phe Ala Thr Ile Asp Val Gln Lys Trp Met Asn His Val Ser Leu
180 185 190
Asp Ser Ile Gly Ile Ala Gly Phe Ser His Asp Phe Gly Ser Leu Glu
195 200 205
Gly Lys His Ser Ala Val Ala Glu Val Phe Asp Ala Met Gly His Val
210 215 220
Lys Pro Gly Ile Phe Thr Ala Ala Ala Leu Phe Phe Gly Asn Val Phe
225 230 235 240
Pro Val Leu Trp Arg Leu Pro Thr Glu Thr Arg Arg Leu Gln Leu Lys
245 250 255
Leu Asn Lys Cys Met Glu Glu Ile Ala Val Pro Leu Leu Glu Asn Thr
260 265 270
Arg Asn Glu Met Arg Gly Leu Gly Glu Lys Gly Lys Glu Glu Lys Ser
275 280 285
Ile Ile Gly Leu Leu Ile Lys Ala Glu Asp Ala Asn Ser Ser Leu Gln
290 295 300
Met Ser Gln Glu Glu Ile Met Ala Gln Met Lys Val Leu Ile Leu Ala
305 310 315 320
Gly Tyr Glu Thr Thr Ser Ile Ser Leu Thr Trp Ala Leu Ile Glu Leu
325 330 335
Ser Arg Lys Pro Glu Thr Gln Glu Arg Leu Arg Glu Glu Leu Lys Glu
340 345 350
Glu Phe Pro Asn Ala Asp Pro Thr Trp Glu Gln Leu Thr Asn Gly Ser
355 360 365
Gly Leu His Tyr Leu Asp Ala Val Val His Glu Ile Leu Arg Leu His
370 375 380
Ala Pro Leu Asn Val Thr Thr Arg Val Ala Ala Lys Asp Asp Val Ile
385 390 395 400
Pro Leu Ser Thr Pro Leu Arg Leu Pro Thr Gly Glu Leu Thr Asp His
405 410 415
Val Ala Ile Thr Glu Gly Gln Glu Val Thr Val Pro Ile Ser Cys Met
420 425 430
Asn Thr Ala Val Ala Phe Trp Gly Pro Asp Ala Arg Glu Phe Arg Pro
435 440 445
Glu Arg Trp Leu Asn Glu Asp Gly Leu Pro Lys Lys Ala Gln Glu Ile
450 455 460
Gln Gly His Arg His Leu Leu Thr Phe Val Asp Gly His Arg Ile Cys
465 470 475 480
Leu Gly Arg Gly Phe Ala Leu Ala Glu Phe Lys Ala Val Leu Gly Val
485 490 495
Leu Ile Lys Asn Tyr Gln Phe Glu Leu Pro Asp Gly Pro Glu Thr Lys
500 505 510
Ile Glu Phe Cys Arg Gly Val Leu Pro Arg Pro Arg Val Val Gly Glu
515 520 525
Lys Gly Ala Asn Leu Pro Met Arg Val Arg Arg Ala Asp
530 535 540
<210> 3
<211> 1515
<212> DNA
<213> GL21117
<400> 3
atggcgacgt tggaggaccc tcaggcgctc atcctcgctg gtgtcgcgac cctagtcgca 60
atatggatag tacgatggaa gaccaaccca ctaagttcga ttcccaccgt cggtggatcg 120
gatgcgccag ggctgtcgat attggcatgg ctcaacttct tgcgccgcgg gaaggacttg 180
ctccaggagg gttaccaaaa gtatcatggc tcgacgttca agatcgctct tttcgaccaa 240
tggcttgttg tgttttccgg gtccaatatg gtcgacgagc ttatgaggcg gcccgatagt 300
gagttatcgt tcttggaggg cattgaagaa gtagtccaca tgaagtacac tgtcgggcac 360
gaagccttgg gcgacccgta ccacgtcggg attatcaaag agaagcttac gcgcatgctt 420
cctaccgttc tcccggactt gaccgaagag ttggcgatat ccgtgcaaga atacatcccc 480
acccaaggcg acgaatggac cgccgtgaat gtgatgacga cgatgcaaaa gatcgtcgcc 540
agggccagca accgtgtctt cgtcggactt ccactttgtc gcaatgagga gtttttggca 600
ttgccccttc gcttcacgtt ggatgtgatg aaagacatgg tagtcatgag catcactccg 660
gacattttga agaggcccgt tggtcatctg gttagcaacg caaggcggac tatggcgcaa 720
gccatgaagt atatccaacc tgtgatcgcc gagaggaagg cgaacatgaa ggacttgggt 780
gaggactggt ccgacaagcc gaatgacgtg cttcagtggg tcatcgacga agccgtccgc 840
cggaaccact ccgacgtcag cgtcgtcgag cgaatattcc tcgtcaactt tgcagccatc 900
cacacctcct ccaccaacat gacccatgtg ctttacgacc tggcctcaag accggagtgt 960
attcaaccac tccgagagga gatcgaaggt atcgtcgcaa cagacggttg gagcaagtca 1020
gccattgcca agatgtggaa gcttgacagc ctgttcaggg agtcttcgcg gtaccacggg 1080
atctccctca ttggcctgat gcgcaagtcc gtgaaagaca tcaccctcag cgacgggacg 1140
ttcatcccga agggcaccgt gctcgcgact gctgcgcggc cgatgcacca cgacggctcg 1200
aaatacgcca acgcggacgt gctcgacccg ttccgcttcg agaggatgcg gcacggcgag 1260
ggcgagggcc tgaagcacca gttcgtcaac acttccaacg acttcgtctc cttcggccac 1320
ggcaagcacg catgcccggg acggttcttc gcggcgagcg agctgaaggc gctgctcgcg 1380
tacatcctca tcaactacga tatcaagctt gggggggacg gcacccggcc ggcgaacttt 1440
tactatggca cgaacgtcgt cccgtctgtc accggacagg tgctgttcag gaaacggcat 1500
gcgcaggctt cttga 1515
<210> 4
<211> 504
<212> PRT
<213> GL21117
<400> 4
Met Ala Thr Leu Glu Asp Pro Gln Ala Leu Ile Leu Ala Gly Val Ala
1 5 10 15
Thr Leu Val Ala Ile Trp Ile Val Arg Trp Lys Thr Asn Pro Leu Ser
20 25 30
Ser Ile Pro Thr Val Gly Gly Ser Asp Ala Pro Gly Leu Ser Ile Leu
35 40 45
Ala Trp Leu Asn Phe Leu Arg Arg Gly Lys Asp Leu Leu Gln Glu Gly
50 55 60
Tyr Gln Lys Tyr His Gly Ser Thr Phe Lys Ile Ala Leu Phe Asp Gln
65 70 75 80
Trp Leu Val Val Phe Ser Gly Ser Asn Met Val Asp Glu Leu Met Arg
85 90 95
Arg Pro Asp Ser Glu Leu Ser Phe Leu Glu Gly Ile Glu Glu Val Val
100 105 110
His Met Lys Tyr Thr Val Gly His Glu Ala Leu Gly Asp Pro Tyr His
115 120 125
Val Gly Ile Ile Lys Glu Lys Leu Thr Arg Met Leu Pro Thr Val Leu
130 135 140
Pro Asp Leu Thr Glu Glu Leu Ala Ile Ser Val Gln Glu Tyr Ile Pro
145 150 155 160
Thr Gln Gly Asp Glu Trp Thr Ala Val Asn Val Met Thr Thr Met Gln
165 170 175
Lys Ile Val Ala Arg Ala Ser Asn Arg Val Phe Val Gly Leu Pro Leu
180 185 190
Cys Arg Asn Glu Glu Phe Leu Ala Leu Pro Leu Arg Phe Thr Leu Asp
195 200 205
Val Met Lys Asp Met Val Val Met Ser Ile Thr Pro Asp Ile Leu Lys
210 215 220
Arg Pro Val Gly His Leu Val Ser Asn Ala Arg Arg Thr Met Ala Gln
225 230 235 240
Ala Met Lys Tyr Ile Gln Pro Val Ile Ala Glu Arg Lys Ala Asn Met
245 250 255
Lys Asp Leu Gly Glu Asp Trp Ser Asp Lys Pro Asn Asp Val Leu Gln
260 265 270
Trp Val Ile Asp Glu Ala Val Arg Arg Asn His Ser Asp Val Ser Val
275 280 285
Val Glu Arg Ile Phe Leu Val Asn Phe Ala Ala Ile His Thr Ser Ser
290 295 300
Thr Asn Met Thr His Val Leu Tyr Asp Leu Ala Ser Arg Pro Glu Cys
305 310 315 320
Ile Gln Pro Leu Arg Glu Glu Ile Glu Gly Ile Val Ala Thr Asp Gly
325 330 335
Trp Ser Lys Ser Ala Ile Ala Lys Met Trp Lys Leu Asp Ser Leu Phe
340 345 350
Arg Glu Ser Ser Arg Tyr His Gly Ile Ser Leu Ile Gly Leu Met Arg
355 360 365
Lys Ser Val Lys Asp Ile Thr Leu Ser Asp Gly Thr Phe Ile Pro Lys
370 375 380
Gly Thr Val Leu Ala Thr Ala Ala Arg Pro Met His His Asp Gly Ser
385 390 395 400
Lys Tyr Ala Asn Ala Asp Val Leu Asp Pro Phe Arg Phe Glu Arg Met
405 410 415
Arg His Gly Glu Gly Glu Gly Leu Lys His Gln Phe Val Asn Thr Ser
420 425 430
Asn Asp Phe Val Ser Phe Gly His Gly Lys His Ala Cys Pro Gly Arg
435 440 445
Phe Phe Ala Ala Ser Glu Leu Lys Ala Leu Leu Ala Tyr Ile Leu Ile
450 455 460
Asn Tyr Asp Ile Lys Leu Gly Gly Asp Gly Thr Arg Pro Ala Asn Phe
465 470 475 480
Tyr Tyr Gly Thr Asn Val Val Pro Ser Val Thr Gly Gln Val Leu Phe
485 490 495
Arg Lys Arg His Ala Gln Ala Ser
500
<210> 5
<211> 40
<212> DNA
<213> HF-CYP5150L8-F
<400> 5
ggcaaaggaa taatctcgag tcatgtaatt agttatgtca 40
<210> 6
<211> 40
<212> DNA
<213> HF-CYP5150L8-R
<400> 6
cgagcggtct aaggcggttt acttctcgta ggaacaattt 40
<210> 7
<211> 20
<212> DNA
<213> HF-CYP5150L8-CX-F
<400> 7
atttcgatga tgcagcttgg 20
<210> 8
<211> 20
<212> DNA
<213> HF-CYP5150L8-CX-R
<400> 8
acatcaaaat ccacattctc 20
<210> 9
<211> 40
<212> DNA
<213> GL20421-F
<400> 9
taattttaat caaaaagttt atgatcatcc cagtagacat 40
<210> 10
<211> 40
<212> DNA
<213> GL20421-R
<400> 10
attaatttga attaacgttt tcagtctgca cgacgcaccc 40
<210> 11
<211> 40
<212> DNA
<213> GL21117-F
<400> 11
taattttaat caaaaagttt atggcgacgt tggaggaccc 40
<210> 12
<211> 40
<212> DNA
<213> GL21117-R
<400> 12
attaatttga attaacgttt tcaagaagcc tgcgcatgcc 40
<210> 13
<211> 20
<212> DNA
<213> P450-CX-F
<400> 13
gccaatactt cacaatgttc 20
<210> 14
<211> 20
<212> DNA
<213> P450-CX-R
<400> 14
tcattttgtc attgaccttc 20