Novel promoter derived from organic acid-resistant yeast and method for expressing target gene using same

文档序号：788883 发布日期：2021-04-09 浏览：17次中文

阅读说明：本技术 源自耐有机酸的酵母的新型启动子及使用其表达靶基因的方法 (Novel promoter derived from organic acid-resistant yeast and method for expressing target gene using same ) 是由朴宰演李泰荣李气成欧蒂·科威斯托仁卡利·科乌兰塔于 2019-02-28 设计创作，主要内容包括：本发明涉及用于调控耐有机酸的酵母中ADH基因表达的新型启动子,以及通过使用该启动子表达与有机酸产生相关的基因来生产有机酸的方法。当使用根据本发明的新型启动子在耐有机酸的酵母中表达与有机酸产生相关的靶基因时,由于耐有机酸,菌株的生长能力不受抑制并且以高产率产生有机酸。(The present invention relates to a novel promoter for regulating the expression of ADH gene in organic acid-resistant yeast, and a method for producing organic acid by expressing a gene associated with organic acid production using the promoter. When a target gene associated with the production of an organic acid is expressed in an organic acid-resistant yeast using the novel promoter according to the present invention, the growth ability of the strain is not inhibited and the organic acid is produced at a high yield due to the organic acid resistance.)

1. A promoter comprising SEQ ID NO: 1 or SEQ ID NO: 2.

2. A recombinant vector comprising the promoter of claim 1.

3. The recombinant vector of claim 2, further comprising a terminator comprising the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.

4. The recombinant vector of claim 2, further comprising a gene encoding a target protein.

5. The recombinant vector of claim 4, wherein the target protein is a protein associated with organic acid production.

6. The recombinant vector of claim 5, wherein the target protein is malonyl-CoA-reductase or lactate dehydrogenase.

7. A recombinant microorganism into which the recombinant vector according to any one of claims 2 to 6 is introduced.

8. The recombinant microorganism of claim 7, which is a yeast.

9. The recombinant microorganism of claim 8, which is the acid-tolerant yeast YBC (KCTC13508 BP).

10. A method of producing an organic acid, the method comprising the steps of:

(a) producing an organic acid by culturing a recombinant microorganism into which the recombinant vector of claim 5 is introduced; and

(b) the resulting organic acid was collected.

11. A recombinant strain having reduced ethanol production capacity, wherein the g4423 gene in acid-tolerant yeast YBC strain (KCTC13508BP) is deleted or attenuated.

12. A genetic construct in which a promoter and a gene encoding a target gene are operably linked to each other, the promoter comprising a nucleic acid sequence comprising SEQ ID NO: 1.

13. The genetic construct of claim 12, further comprising a nucleic acid sequence comprising SEQ ID NO: 3 or SEQ ID NO: 4.

14. The genetic construct of claim 12, wherein the target protein is a protein associated with organic acid production.

15. The genetic construct of claim 12, wherein the target protein is malonyl-coa-reductase or lactate dehydrogenase.

16. A recombinant microorganism having the genetic construct of claim 12 introduced into its chromosome.

17. The recombinant microorganism of claim 16, which is a yeast.

18. The recombinant microorganism of claim 17, which is acid-tolerant yeast YBC (KCTC13508 BP).

19. A method of producing an organic acid, the method comprising the steps of:

(a) producing an organic acid by culturing a recombinant microorganism into which the genetic construct of claim 14 is introduced; and

(b) the resulting organic acid was collected.

20. A recombinant microorganism for overexpression of a target gene, wherein the target gene is inserted downstream of a promoter of g4423 in the genome of YBC strain (KCTC13508BP), and the expression of the target gene is regulated by the promoter of g 4423.

21. The recombinant microorganism of claim 20, wherein said target gene is introduced in place of said g4423 gene.

22. The recombinant microorganism of claim 20, wherein said target gene is a gene encoding a protein associated with organic acid production.

23. The recombinant microorganism of claim 22, wherein said protein associated with organic acid production is malonyl-coa-reductase or lactate dehydrogenase.

24. A method of producing an organic acid, the method comprising the steps of:

(a) producing an organic acid by culturing the recombinant microorganism of claim 22; and

(b) the resulting organic acid was collected.

25. A method of overexpressing a target gene by culturing the recombinant microorganism of claim 20.

Technical Field

The present invention relates to a novel promoter derived from an organic acid-resistant yeast, and more particularly, to a novel promoter for regulating the expression of an ADH gene in an organic acid-resistant yeast, and a method for producing an organic acid by expressing a gene associated with the production of an organic acid using the promoter.

Background

Various raw materials are converted into chemicals such as organic acid, alcohol and amine through a biological process, and people pay attention to the aspects of environmental friendliness, carbon dioxide emission reduction, sustainability, new platform chemical supply and the like. Through this biotransformation, food, cosmetic, nutraceutical and pharmaceutical related chemical products have been provided.

However, in general, the products produced by biotransformation need to be subjected to a purification process to remove impurities. In the production of organic acids, fermentation is generally performed at a neutral pH adjusted by alkali to prevent the growth of the strain from being inhibited by the produced organic acids, and then acidification is performed to isolate and purify these organic acids. Due to the purification process, a large amount of byproduct-neutralized salt is generated, and the production cost increases with the complication of the production process. The high cost burden of this purification process is a factor that hinders the entry of fermentation products into the chemical market.

When an acidic substance such as an organic acid is produced using a microorganism that can grow even at a low pH and exhibits a high fermentation capacity in order to solve the above-mentioned problems, the process of neutralizing the pH of a medium and performing acidification can be omitted, and thus, costs can be reduced by process simplification and reduction in the use of additives.

However, in many cases, the growth rate of microorganisms that survive at low pH is very low, and thus it is impossible to obtain a sufficient number of cells required for producing a substance. Therefore, these microorganisms show low raw material consumption rate, and thus are difficult to apply to industrial fermentation processes. Therefore, it is very important to select microorganisms having the property of rapidly growing at a pH lower than the pKa of the product while maintaining a high consumption rate of the raw material.

These microorganisms can be selected from various strain libraries by various selection pressures. Examples of selection pressure include tolerance at the concentration of the target product, tolerance to the concentration of the raw material, consumption rate of the raw material, pH conditions, and growth ability in a minimal medium. Selection of microorganisms can be performed manually, but when automated screening is performed, strains having excellent characteristics can be quickly selected from a large number of subjects.

Selected microorganisms have excellent selective pressure-bearing properties, but in most cases they produce other products and not the target product. Therefore, in order to impart the ability of a selected microorganism to produce a target product, the ability to genetically introduce a gene for conversion into the target product and eliminate the production of the originally produced product has been studied.

In order to impart the ability of a selected microorganism to produce a target product, a gene capable of being converted into the target product is introduced, or a method of enhancing a gene originally contained in the microorganism is used. However, in general, since the activities of the contained genes and the enzymes produced therefrom are generally low, highly active foreign genes are introduced in most cases. In addition, in this process, a promoter capable of strongly expressing the foreign DNA must be introduced.

As for usable promoters, when the target microorganism is yeast, a promoter of Saccharomyces cerevisiae (a well-known yeast) can be generally used, and various genetic engineering techniques developed for Saccharomyces cerevisiae can also be applied. In addition, a strong promoter may be selected from promoters associated with the major carbon flux of the selected microorganism, and it is necessary to apply a method that can most efficiently express a target gene by various techniques. In particular, for the selected acid-tolerant yeasts, when genetic engineering studies related to yeasts have not been conducted, the use of a promoter of Saccharomyces cerevisiae or the use of an endogenous promoter of the selected microorganism is a common method.

In general, promoters have various regulatory regions, including the core promoter region in eukaryotic bacteria, and regulatory genes are different between microorganisms. Thus, it is possible to find an optimal region while confirming the action of the promoter by selecting a sequence having a sufficient length at the 5' end of the ORF, but separate studies are required for remote control mechanisms (enhancers, silencers, etc.) or control mechanisms acting in combination.

Therefore, the present inventors have made extensive efforts to find a promoter suitable for expression of a foreign gene, to select a yeast having tolerance to an organic acid and to impart the yeast with the ability to produce a useful substance. As a result, the present inventors found that when a target gene is expressed using a promoter derived from an ethanol-producing metabolic pathway, the expression of the target gene is significantly increased, thereby increasing the production of a target product, and completed the present invention.

Disclosure of Invention

The object of the present invention is to provide a novel promoter derived from an organic acid-resistant yeast.

It is another object of the present invention to provide a recombinant vector comprising the promoter, and a recombinant microorganism into which the recombinant vector is introduced.

It is another object of the present invention to provide a gene construct in which the novel promoter and a gene encoding a target protein are operably linked to each other.

It is still another object of the present invention to provide a method for producing an organic acid using a recombinant microorganism into which a recombinant vector comprising the novel promoter and a gene associated with organic acid production has been introduced.

To achieve the above object, the present invention provides a promoter comprising SEQ ID NO: 1 or SEQ ID NO: 2.

The invention also provides a recombinant vector containing the promoter.

The present invention also provides a recombinant microorganism into which the recombinant vector is introduced.

The present invention also provides a method for producing an organic acid, comprising the steps of: (a) producing an organic acid by culturing a recombinant microorganism into which a recombinant vector is introduced; and (b) collecting the produced organic acid.

The present invention also provides a gene construct in which a promoter and a gene encoding a target gene are operably linked to each other, the promoter comprising a nucleotide sequence comprising SEQ ID NO: 1.

The present invention also provides a recombinant microorganism having a gene construct introduced into its chromosome.

The present invention also provides a method for producing an organic acid, comprising the steps of: (a) producing an organic acid by culturing a recombinant microorganism into which a gene construct is introduced; and (b) collecting the produced organic acid.

The present invention also provides a recombinant strain obtained by deleting or inactivating the g4423 gene in an acid-tolerant yeast YBC strain (KCTC13508BP) and having a reduced ethanol production capacity.

The present invention also provides a recombinant microorganism for overexpression of a target gene, wherein the target gene is inserted downstream of the promoter of g4423 in the genome of YBC strain (KCTC13508BP), and the expression of the target gene is regulated by the promoter of g 4423.

The present invention also provides a method for producing an organic acid, comprising the steps of: (a) producing an organic acid by culturing the recombinant microorganism; and (b) collecting the produced organic acid.

The present invention also provides a method for overexpressing a target gene by culturing a recombinant microorganism.

Drawings

FIG. 1 shows examples of gene cassettes for expressing one, two or three 3-HP pathway enzymes. (a) Is a universal cassette for expressing one enzyme, (b) is a cassette for introducing MCRsa1 enzyme in case of using g4423 promoter, (c) is a cassette for introducing LDH in case of using g4423 promoter, (d) is a cassette for introducing three 3-HP producing enzymes (MCR, HPDH and EUTE), (e) is a cassette for using 1-kb g4423 promoter, which is the promoter of MCR enzyme.

FIG. 2 shows examples of yeast expression plasmids for expressing one, two or three 3-HP pathway enzymes.

FIG. 3 shows the results of analysis of the expression levels of MCR genes (MCRsa1 and MCRsa2) in the constructed recombinant strain containing the promoter of Saccharomyces cerevisiae and the recombinant strain containing the promoter (1kb) of YBC strain.

FIG. 4 shows the results of analysis of the expression levels of the BDHcm gene, the HPDHec gene and the EUTEdz gene, which are other genes involved in the production of 3-HP, in the recombinant strain containing the ScTEF1p promoter.

FIG. 5 shows the results of comparing the expression levels of the MCR gene and the 3-HP production-related gene in Saccharomyces cerevisiae strains. In FIG. 5, 995-1 and 995-3 show different phenotypes of the same genotype.

FIG. 6 shows the results of performing RT-qPCR to analyze the expression levels of seven ADH gene candidates selected by genetic information of Saccharomyces cerevisiae.

FIG. 7 shows the results of analysis of glucose utilization (A) and ethanol production (B) in recombinant strain YBC-1563 from which g4423 gene was removed.

Fig. 8 shows the analysis results of the expression level of MCRsa1 in the recombinant YBC strain in which g4423 gene was replaced with MCRsa1 gene.

FIG. 9 shows the results of expression analysis of the MCRsa1 gene in which the g4423 promoter and terminator regions are located in a 1-kb truncated region.

FIG. 10 shows the results of an analysis of lactate production in recombinant YBC strains in which three LDH genes were replaced by g 4423.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, terms used in the present specification are terms that are well known in the art and are commonly used.

For bioconversion processes for producing acidic environment-producing products (e.g., organic acids) among various products, acid-resistant microorganisms, especially those that exhibit rapid growth even in acidic environments and can maintain high raw material uptake rates, are selected to reduce the complexity of downstream processes and the attendant investment costs of compounds and facilities. The selected microorganism inherently has the ability to produce the target product in many cases, and therefore it is necessary to develop various genetic engineering tools in order to effectively impart the ability to produce the target product to the target microorganism.

The promoter is a regulatory region capable of strongly expressing an exogenous target gene or expressing an exogenous target gene according to conditions, and fundamentally, it is necessary to select a promoter capable of strongly expressing a target gene. Under glucose conditions, such strong promoters are typically selected from promoters associated with glycolysis or with the production of the major fermentation product by a microorganism.

Known strong promoters include, but are not necessarily limited to, TEF1, TPI1, HXT7, TDH3, PGK1, ADH1, and PYK1, and may vary from strain to strain.

Common Crabtree-positive yeasts, including the microorganisms selected in the present invention, in many cases produce ethanol as the main fermentation product, and their promoters are also strongly expressed and function mainly under favorable fermentation conditions, i.e., under conditions of high sugar concentration.

In particular, for promoters associated with ethanol metabolism, a technique has been generally developed for the purpose of blocking ethanol production while expressing foreign genes. Therefore, when an endogenous promoter of a strain is used, there is an advantage in that an effect of blocking ethanol production and an effect of strongly expressing a foreign gene can be simultaneously achieved.

In the present invention, in order to efficiently introduce a gene involved in organic acid production to impart an organic acid-producing ability to acid-tolerant yeast YBC (KCTC13508BP), a promoter suitable for such introduction is selected. In one example of the present invention, it has been confirmed that when a gene MCR gene associated with the production of 3-hydroxypropionic acid (3-HP) is introduced using a promoter derived from Saccharomyces cerevisiae or an endogenous promoter of YBC used in the conventional art, the expression efficiency of the gene is very low. In another example of the present invention, it was confirmed that when the MCR gene is expressed using the promoter of the gene g4423 of ADH enzyme associated with ethanol production, a high expression level of the gene and excellent 3-HP productivity are achieved.

Thus, in one aspect, the invention relates to a polypeptide comprising SEQ ID NO: 1 or SEQ ID NO: 2.

The promoter of the present invention is strongly expressed in glucose culture and logarithmic growth phase, and shows good expression level even when cultured in an acidic medium. In addition, the promoter also functions well in yeast expression of heterologous genes, including genes of yeast origin, particularly genes of archaea origin and genes of bacterial origin. In particular, the promoter of the present invention is an essential promoter for producing various compounds in acid-tolerant strains, and is a promoter capable of enhancing the expression of a DNA encoding a protein affected by the promoter, particularly when the DNA is a DNA producing an organic acid. In addition, the promoter is a promoter which can strongly express even when organic acids are present inside and outside the cell.

In another aspect, the present invention relates to a recombinant vector comprising a promoter, and a recombinant microorganism having the recombinant vector introduced therein.

In the present invention, the recombinant vector may further comprise a nucleic acid sequence comprising SEQ ID NO: 3 or SEQ ID NO: 4.

In the present invention, the recombinant vector may further comprise a gene encoding a target protein, and the target protein may be a protein associated with organic acid production.

In the present invention, it has been found that 3-hydroxypropionic acid and lactic acid as organic acids can be produced, but the present invention is not necessarily limited thereto.

Examples of the genes related to organic acid production expressed using this promoter include genes encoding fumarate reductase, succinyl-CoA (coA) synthetase and phosphoenolpyruvate carboxylase in the succinate pathway (Progress of basic acid production from renewable resources: Metabolic and constructive strategies, Bioresource Technology245 (B); 1710-; genes encoding butyryl kinase, enol (enoate) reductase, adipyl-CoA transferase, and adipate semialdehyde dehydrogenase in the adipate pathway (Development of a Platform strand for Production of additive acids Yields instruments in the Localized Redox Metabolism of S.cerevisiae, Patrick Hyland.A. of Master of Applied Science, gradual Department of Chemical Engineering and Applied Chemistry, University of Toronto, 2013); a gene encoding methylmalonyl-coenzyme A reductase in the 3-hydroxyisobutyric acid pathway (Korean patent application laid-open No. 2016-0075640); genes encoding alpha-ketoisovalerate decarboxylase and potential phenylacetaldehyde dehydrogenase in the isobutyrate pathway (ChemSusChem 2011,4, 1068-1070); genes encoding Malate dehydrogenase in the Malate pathway (mallic Acid Production by Saccharomyces cerevisiae: Engineering of Pyruvate Carboxylation, Oxaloacetate Reduction, and Malate Export, appl. environ. Microbiol.,74: 2766-; and the gene encoding cis-aconitate decarboxylase in the itaconate pathway (Biochemistry of microbial acid production, Front microbiol.2013; 4: 23.). This promoter can be used for overexpression of the genes in the last step of each pathway, and this is also described in detail in the related prior art document (JP4700395B 2). In addition, the promoter can be applied to other genes in the same pathway in addition to the genes exemplified above.

The promoter of the present invention is a promoter comprising SEQ ID NO: 1, and has a strong activity even under organic acid production conditions. In addition, due to the diploid nature of YBC strains, there may be strains with sequences such as SEQ ID NO: 1, and sequences comprising these mutant sequences may also exhibit The same characteristics (The Baker's Yeast joined Genome Is Remarkable Stable in genetic Growth and Meiosis, PLoS Genet 6(9):2010, Ploidy changes and Genome stability in year, Yeast 31: 421-.

Furthermore, the terminator that functions together with the promoter of the present invention comprises SEQ ID NO: 3 or SEQ ID NO: 4.

In the present invention, examples of target proteins include, but are not limited to, malonyl-coa reductase, lactate dehydrogenase, fumarate reductase, succinyl-coa synthetase, phosphoenolpyruvate carboxylase, butyryl kinase, enol reductase, adipyl-coa transferase, adipate semialdehyde dehydrogenase, methylmalonyl-coa reductase, α -ketoisovalerate decarboxylase, latent phenylacetaldehyde dehydrogenase, malate dehydrogenase, and cis-aconitate decarboxylase.

In the present invention, the recombinant is preferably yeast, more preferably acid-tolerant yeast YBC (KCTC13508 BP).

In yet another aspect, the present invention also relates to a method for producing an organic acid, the method comprising the steps of: (a) producing an organic acid by culturing a recombinant microorganism into which a recombinant vector is introduced; and (b) collecting the produced organic acid.

In yet another aspect, the present invention relates to a gene construct in which a promoter and a gene encoding a target gene are operably linked to each other, the promoter comprising a nucleotide sequence comprising SEQ ID NO: 1 or SEQ ID NO: 2, and a recombinant microorganism into whose chromosome the gene construct is introduced.

In the present invention, the target protein may be a protein associated with organic acid production. The target protein may be selected from malonyl-coa-reductase, lactate dehydrogenase, and the like, but is not limited thereto, and any protein involved in organic acid production may be used without limitation.

In the present invention, the recombinant is preferably yeast, more preferably acid-tolerant yeast YBC (KCTC13508 BP).

In yet another aspect, the present invention relates to a method for producing an organic acid, the method comprising the steps of: (a) producing an organic acid by culturing a recombinant microorganism into which a gene construct is introduced; and (b) collecting the produced organic acid.

The promoter of the present invention constitutes a DNA construct to be introduced into yeast together with a gene encoding a target protein. These DNA constructs include constructs suitable for various yeast transformation methods known to those skilled in the art, and examples of DNA constructs for homologous recombination are shown in SEQ ID NO: 5 and SEQ ID NO: 6. the DNA construct is a biallelic deletion cassette for deletion of the g4423 gene. In addition, when the target DNA is inserted into the cassette, a gene insertion cassette for each allele is produced, which is well known to those skilled in the art.

In the present invention, the cassette may comprise SEQ ID NO: 5 or SEQ ID NO: 6, and the cassette may comprise a target gene.

In another aspect, the present invention relates to a method of overexpressing a target gene, the method comprising replacing the g4423 gene in the genome of YBC strain (KCTC13508BP) with the target gene.

In another aspect, the present invention relates to a recombinant microorganism for overexpression of a target gene, wherein the target gene is inserted into the genome of YBC strain (KCTC13508BP) downstream of the promoter of g4423, and the expression of the target gene is regulated by the promoter of g 4423.

In yet another aspect, the present invention relates to a method for producing an organic acid, the method comprising the steps of: (a) producing an organic acid by culturing the recombinant microorganism; and (b) collecting the produced organic acid.

In yet another aspect, the present invention relates to a method for overexpressing a target gene by culturing a recombinant microorganism.

In yet another aspect, the present invention relates to a recombinant strain obtained by deleting or inactivating the g4423 gene in the acid-tolerant yeast YBC strain (KCTC13508BP) and having reduced ethanol production capacity.

As used herein, "homology" refers to the percentage of identity between two amino acid portions or polynucleotide portions for comparison. The term "similarity" refers to the degree to which two amino acid sequences or polynucleotide sequences are functionally or structurally identical to each other as determined by a comparison window. Sequence homology or similarity can be determined by comparing sequences using standard software, such as a program developed based on BLAST under the names BLASTN or BLASTX (Proc. Natl. Acad. Sci. USA,90, 5873-.

The g4423 promoter may preferably have a sequence shown to be identical to SEQ ID NO: 1, 90% or more, 92% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence homology.

Any promoter can be considered to be a substantially equivalent promoter if it exhibits an equivalent level of expression efficiency while having 90% or more homology with the g4423 promoter of the present invention.

In some cases, the g4423 promoter according to the present invention may be mutated using techniques known in the art to increase the expression efficiency of a target gene.

In the present invention, the recombinant yeast may have acid resistance. To prepare the acid-tolerant recombinant yeast suitable for use in the present invention, it is preferable to use a host yeast having tolerance to organic acids.

The acid tolerant yeast may be an acid tolerant yeast selected from the genera Saccharomyces, Saccharomyces saxatilis (Kazachstania saccharomycetes), and Candida. For example, the acid-tolerant yeast may be selected from among, but not limited to, Saccharomyces cerevisiae (Saccharomyces cerevisiae), Kazachstania exigua, Saccharomyces boulardii (Kazachstania bunderi), and Candida planosa (Candida humheilis).

"acid-resistant yeast" refers to yeast that is resistant to organic acids (e.g., 3-HP or lactic acid), and acid resistance can be determined by evaluating growth in media containing various concentrations of organic acids. In other words, "acid-tolerant yeast" refers to yeast having a higher growth rate and biomass consumption rate than ordinary yeast in a medium containing an organic acid at a high concentration.

In the present invention, the term "acid-tolerant yeast" is defined as a yeast which can maintain a biomass consumption rate (sugar consumption rate, etc.) of at least 10% or a specific growth rate of at least 10% at a pH lower than the pKa value of an organic acid in a medium containing 1M or more of the organic acid, as compared with a medium containing no organic acid. More specifically, in the present invention, the term "acid-tolerant yeast" is defined as a yeast capable of maintaining a biomass consumption rate (sugar consumption rate, etc.) of at least 10% or a specific growth rate of at least 10% at a pH of 2 to 4 as compared with a pH of 7.

The recombinant yeast according to the present invention can be prepared by inserting the gene into the chromosome of the host yeast or by introducing a vector containing the gene into the host yeast according to a conventional method.

As the host yeast, a host cell into which DNA is efficiently introduced and which efficiently expresses the introduced DNA is generally used. Although acid-tolerant yeast is used in one example of the present invention, the present invention is not limited thereto, and any type of yeast may be used as long as the target DNA can be sufficiently expressed therein.

Recombinant yeast can be prepared according to any transformation method. "transformation" refers to a process of introducing DNA into a host cell and allowing the DNA to replicate therein as a chromosomal factor or by completing chromosomal integration, which is a phenomenon in which genetic changes are artificially induced by introducing foreign DNA into a cell. Typical transformation methods include electroporation, lithium acetate-PEG methods, and the like.

Further, in the present invention, any generally known genetic engineering method may be used as a method for inserting a gene into a chromosome of a host microorganism. Examples of the method include a method using a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a herpes simplex virus vector, a poxvirus vector, a lentivirus vector, a non-viral vector, and the like. "vector" refers to a DNA construct comprising a DNA sequence operably linked to suitable control sequences capable of expressing the DNA in a suitable host. The vector may be a plasmid, a phage particle or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or may, in some cases, integrate into the genome itself. Plasmids are currently the most commonly used form of vector, and linearized DNA is also the form commonly used for integration into the yeast genome.

The structure of a typical plasmid vector includes: (a) an origin of replication which allows efficient replication, whereby each host cell produces a plasmid vector; (b) an antibiotic resistance gene or an auxotrophic marker gene that allows selection of host cells transformed with a plasmid vector; and (c) restriction sites into which foreign DNA fragments can be inserted. Even without suitable restriction sites for restriction enzymes, the vector and the foreign DNA can be easily ligated when a linker or a synthetic oligonucleotide adaptor is used according to a conventional method. The use of synthetic oligonucleotide adaptors or linkers according to conventional methods allows for easy ligation of exogenous DNA fragments to the vector even in the absence of suitable restriction enzyme digestion sites in the vector.

In addition, a gene is "operably linked" when it is in a functional relationship with another nucleic acid sequence. This may be a gene and one or more regulatory sequences which are linked in a manner which allows for expression of the gene when an appropriate molecule (e.g., a transcriptional activator protein) is associated with the one or more regulatory sequences. For example, if a polypeptide is expressed as a preprotein that participates in the secretion of the polypeptide, DNA for a leader peptide or secretory leader sequence is operably linked to DNA for the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or operably linked to a coding sequence if the ribosome binding site affects the transcription of the sequence; or operably linked to a coding sequence if the ribosome binding site is positioned to facilitate translation.

Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers need not be contiguous. Conjugation is accomplished by ligation at convenient restriction enzyme sites. If such sites are not present, synthetic oligonucleotide adaptors or linkers are used according to conventional methods.

It is well known that not all vectors have the same function in expressing the DNA sequences of the present invention, and as such, not all hosts are equally suitable for containing the same expression vector. However, those skilled in the art can appropriately select from other various vectors, expression control sequences and hosts without undue experimentation without departing from the scope of the present invention. For example, a vector may be selected in consideration of the host cell in that the vector should replicate in the host cell. In addition, the copy number of the vector, the ability to control the copy number, the expression of another protein encoded by a gene in the vector (e.g., an antibiotic marker) should also be considered.

The carbon source used in the present invention may be one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomer and glycerol, but is not limited thereto.

In the present invention, the culture may be carried out under conditions under which the microorganism (e.g., E.coli) no longer functions (e.g., metabolite production is not possible). For example, the culture may be performed at pH 1.0 to 6.5, preferably pH 1.0 to 6.0, more preferably pH 2.6 to 4.0, but is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to examples. These examples are merely illustrative of the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention should not be construed as being limited by these examples.

Example 1: analysis of the expression Pattern of malonyl-CoA reductase (MCR) in YBC strains Using conventional promoters

Selection of acid-tolerant strains

The present inventors selected a group of strains having acid resistance through a test on various yeast strains (korean patent application publication No. 2017-0025315). For the selected yeast strains, lactic acid was added to the medium at the start of the culture, and a strain having the best acid resistance was selected while examining the growth rate and sugar consumption rate of the microorganisms. At this time, an experiment was carried out using an inoculum having an OD value of 4 and YP medium (20g/L peptone and 10g/L yeast extract) to which 3.5% glucose was added, and culturing at 30 ℃ and 100rpm in a 50mL flask. The lactic acid concentration at the start of the culture was varied between 0 and 80 g/L. The results are compared and analyzed and the strain YBC with the best acid resistance is selected.

The strain YBC (Kazachstania exigua sB-018c) was deposited at the depository at 11 d 4.2018 at the center for biological resources of the Korean institute of bioscience and biotechnology, accession No. KCTC13508 BP.

Expression of MCR in acid-fast strains YBC using conventional promoters

In this example, a gene encoding MCR (malonyl-CoA reductase), which is involved in the production of 3-HP (3-hydroxypropionic acid), is expressed in the YBC strain.

The malonyl-CoA pathway to produce 3-HP is a metabolic pathway in which acetyl-CoA is converted to malonyl-CoA by carboxylation and then to 3-HP by reduction (acetyl-CoA → malonyl-CoA → 3-HP). The malonyl-coa pathway has been most studied as A3-HP production pathway because intermediates generally produced by microorganisms including escherichia coli pass through the pathway (U.S. patent application publication No. US 2013/0071893a 1). malonate-CoA can be converted into 3-HP by the action of malonate reductase and 3-HP dehydrogenase, and therefore, a method for converting malonyl-CoA into 3-HP using recombinant E.coli in the presence of glucose or glycerol is well known.

In this example, experiments were performed on MCRsa1 and MCRsa2, which are highly potent genes among known MCR genes. The MCRsa1 and MCRsa2 used were synthesized using yeast codon usage based on data from a gene bank (Genbank), and information of the MCR gene used in this example is shown in table 1 below.

[ Table 1]

To introduce genes into the YBC strain, cassettes as shown in fig. 1(a) were constructed.

The cassette is constructed with an antibiotic resistance gene. In order to target a target gene, a 5 'UTR region and a 3' UTR region of the target gene are designed to have restriction enzyme sites as shown in FIG. 1 on the basis of a whole genome sequence or a partial genome sequence, and then PCR is performed. Promoters and terminators derived from Saccharomyces cerevisiae have been constructed based on known genetic information (for example, yeast (Saccharomyces) genome database). As an antibiotic resistance gene, HygR is exemplified in fig. 1 (a). However, other antibiotic resistance genes of eukaryotes may be used for the strain, and these genes may be easily constructed by those skilled in the art. Since the antibiotic resistance gene needs to be removed after use so that the next genetic manipulation can be performed, sites for Cre-loxp (lox71 and lox66) were introduced at both ends. In addition, promoters and terminators derived from the YBC strain were constructed using the same method as that for obtaining the UTR region. When a plurality of target genes are to be expressed, a cassette capable of expressing a plurality of genes as shown in FIG. 1(d) is constructed, and UTR, ORF gene and antibiotic resistance gene are constructed by crossover using restriction enzymes located at the end of each region to suit the purpose.

For donor DNA, the plasmid containing the cassette is cut using restriction enzymes or amplified by PCR, and the regions of each gene can be swapped using restriction enzymes located at each end. In addition to the method using restriction enzymes, a cassette was constructed using the Gibson Assembly method (Gibson assembly). Many products and uses are known for how to use the Gibbson assembly method. In this example, the cassette was constructed using NEB gibson assembly premix and cloning kit. Among them, oligomers related to MCR and G4423 are shown in Table 2 below.

[ Table 2]

In the case of acid-tolerant Saccharomyces cerevisiae strains, expression was carried out using the cassettes or expression plasmids (pSK-084 and/or pSK-085) shown in FIG. 2 (FIG. 2).

To introduce the constructed cassette into the YBC strain, linearized donor DNA was constructed by PCR or restriction enzyme method, and then introduced using electroporation or lithium acetate method as in usual yeast transformation. Next, selection is performed using a medium according to the auxotrophic marker or antibiotic marker used. Whether the gene is introduced into the correct locus of the chromosome is confirmed by colony selection from the selection medium, by colony PCR using ORF primers for the gene to be introduced into the target or using primers for the introduced gene. Subsequently, genomic DNA was extracted from the cultured cells and the correct genotype was determined.

These constructed strains were cultured in 250mL flasks using 20mL of selective SC-based medium (20g/L glucose) or YPD medium, respectively (30 ℃ and 250rpm), and continued until glucose and ethanol were completely consumed.

Table 3 below shows recombinant strains constructed by the above-described method, and into which the MCR gene was introduced together with a Saccharomyces cerevisiae-derived promoter (TEF1) and a YBC strain-derived promoter (FBA1 p).

[ Table 3]

The recombinant strains were cultured (30 ℃ C. and 250rpm) in 250mL flasks using 20mL YPD medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose), respectively. Cells were harvested at ethanol production and ethanol consumption, and RT-qPCR was performed for the MCR gene.

The RT-qPCR method used in this example is as follows. After extraction of RNA during exponential growth of the target strain, cDNA was produced using RNA as a template. An oligomer specific to each of the target gene and housekeeping gene (used as a reference gene) was synthesized, and qPCR was performed using the oligomer. The gene used in this experiment was ALG9, and the size of the fragment amplified using the primers was 147. + -.3 bp. The qPCR primers used in the experiments and the primers used in the examples below are shown in table 4 below.

[ Table 4] primers for qPCR

As a result, as shown in fig. 3, it was confirmed that MCR genes (MCRsa1 and MCRsa2) were expressed in the recombinant strain constructed using the acid-resistant strain YBC. The level of genes expressed using the promoter of saccharomyces cerevisiae and the promoter (1kb) of YBC strain was analyzed, and the results showed that the expression level of the genes was not high or particularly low compared to the expression level of the reference genes in qPCR. In addition, it was confirmed that the level of MCRsa2 (YBC-1413 in FIG. 3B) expressed using the 1-kb FBA promoter derived from the YBC strain (YBC FBA1p) was lower than the level of MCRsa2 expressed using the ScTEF1p promoter.

In addition, the expression of other genes associated with 3-HP production, namely BDHcm gene, HPDHec gene and EUTEdz gene, in recombinant strains YBC-061, YBC-062, YBC-067 and YBC-068 containing the ScTEF1p promoter was also analyzed.

As a result, as shown in fig. 4, it was confirmed that the expression level of these genes expressed using the ScTEF1p promoter was lower than that of the gene expressed using the endogenous promoter FBA1p of YBC strain and the promoter derived from saccharomyces cerevisiae (TEF1), similar to the MCR gene.

Furthermore, the 3-HP production by the recombinant strain was also low, and the 3-HP production by the recombinant strain containing two copies of the gene, in which the expression levels of three genes (MCRsa2, HPDH and EUTE) were all increased, was much lower than that of the YBC-1178 strain.

Example 2: analysis of 3-HP production of MCR Gene and related genes expressed by conventional promoters

The recombinant strain constructed in example 1 was analyzed for 3-HP production.

First, each recombinant strain was cultured in 25mL of YPD medium (20g/L peptone, 10g/L yeast extract and 20g/L glucose) at 250rpm and 30 ℃ in a shake flask, and 15. mu.M cerulenin (Sigma-Aldrich, USA) was added. Cerulenin functions to promote the production of 3-HP by inhibiting lipid synthesis from carboxylation of cytosolic acetyl-coa to malonyl-coa. After each recombinant strain was cultured under the above-mentioned culture conditions until glucose was completely consumed, the cell density was measured, and the production amount of major metabolites including 3-HP in the medium was analyzed. In addition, the culture is also performed under varying concentrations, media and culture conditions for specific conditions, but is not specifically described.

To analyze 3-HP in cell culture supernatants, culture supernatant samples were analyzed using a Waters Alliance e2695 HPLC system (Watts corporation, Milford, USA) in a sample size of 10. mu.l. In HPLC, an Aminex HPX-87H organic acid column (300 mm. times.7.8 mm) (Bio-Rad, USA) attached to a fast acid analysis column (100 mm. times.7.8 mm) (Bio-Rad, USA) was used for the stationary phase. The column was maintained at +55 ℃ and 5.0mM H was used₂SO₄(Merck KgaA, Germany) as eluent at a flow rate of 0.3 ml/min or 0.5 ml/min.

For the detection of 3-hydroxypropionic acid, glucose, acetic acid, succinic acid, pyruvic acid, glycerol and ethanol, a Waters 2489 dual wavelength ultraviolet (210nm) detector (Waters, milford, usa) and a Waters 2414 differential refractometer (Waters, milford, usa) were used.

As a result, as shown in Table 5 below, it was confirmed that all of the recombinant strains showed a low 3-HP yield. From this lower yield, it was confirmed that the expression efficiency of the major genes, particularly MCR, had a great influence on the production of 3-HP.

[ Table 5] production of 3-HP in recombinant YBC strains

Example 3: expression efficiency analysis of MCR gene in Saccharomyces cerevisiae

In order to compare the expression efficiency of MCR gene and related genes in Saccharomyces cerevisiae strains in which both genetic information and genetic tools were well established, the expression level of 3-HP-producing genes, particularly MCR gene with low expression efficiency, was analyzed using the RT-qPCR method described in example 1.

As a result, as shown in FIG. 5, it was confirmed that the expression level of MCRsa2 gene was low even in the recombinant strain comprising the endogenous promoter of Saccharomyces cerevisiae. Therefore, it was confirmed that it is necessary to select a novel promoter capable of increasing the expression of the MCR gene.

Example 4: expression analysis of alcohol-producing genes in YBC strains

In this example, in order to select a promoter capable of increasing the expression of an exogenous gene in the YBC strain, a promoter that regulates the expression of a gene having a high expression efficiency in the YBC strain itself is used, and the gene is replaced with the exogenous gene to be expressed.

From among genes associated with glycolysis and ethanol production, which are strongly expressed in the presence of glucose, genes that are highly efficient and do not affect growth when substituted with other genes are selected, and a promoter that regulates the expression of the ADH (alcohol dehydrogenase) gene is targeted.

In particular, genes involved in glycolysis should be eliminated so as not to directly affect the growth of the microorganism. If glycolysis-related genes are deleted or inactivated, the production of pyruvate, which plays an important role in the growth of the microorganism, is inhibited, or the balance of chain reactions is problematic, thereby adversely affecting the growth characteristics of the microorganism, resulting in a decrease in fermentation capacity. Therefore, when the target strain is an ethanologenic strain, the PDC (pyruvate dehydrogenase complex) gene or ADH gene is selected as an endogenous gene to be replaced, and PDC is used as an important pathway for producing the target compound in the target strain. Thus, the ADH gene was selected as the gene to be deleted.

Strains having a strong ethanol fermentation ability, such as yeast, have ADH having various strengths and functions. In order to identify the major ethanologenic ADHs in the yeast ADH and to select and use the corresponding promoters, several candidate genes were identified by comparing the genomic information of the YBC strain with the known information of the ADH gene of saccharomyces cerevisiae, and qPCR was performed.

7 ADH gene candidates were selected using bioinformatic information from Saccharomyces cerevisiae whole genome sequence data (see Table 6), oligomers specific for the selected genes were designed and RT-qPCR was performed (primer sequences see Table 4).

[ Table 6]

Genes with similar gene sequences in YBC compared to s.cerevisiae genome

As a result, as shown in FIG. 6, it was confirmed that the expression level of the g4423 gene was significantly higher.

A strain (YBC-1563) from which the g4423 gene was removed was constructed. Based on the information about g4423 and UTR, a gene cassette similar to that of fig. 1(a) was constructed from which the g4423 ORF was removed and which had 5 'UTR and 3' UTR and antibiotic markers. The constructed gene cassette was used as donor DNA. To construct the donor DNA, the cloning method using restriction enzymes as described above and the gibson assembly method were used. The constructed donor DNA was introduced and colonies grown in the plate corresponding to the marker gene were analyzed using ORF primers (forward primer (SEQ ID NO: 72): GAGATAGCACACCATTCACCA, reverse primer (SEQ ID NO: 73): CAACGTT72AAGTACTCTGGTGTTTG) for identification of g 4423. As a result, removal of ORF was confirmed.

The strain was cultured with 50ml of medium (containing 40g/L glucose) in a 250ml flask at 30 ℃ and 250rpm with an initial OD of 0.7 until the sugar and ethanol were completely consumed. Then, the glucose consumption and ethanol production were analyzed. As a result, it was confirmed that the ethanol production was reduced by more than 50% (FIG. 7).

Example 5: analysis of expression level of YBC recombinant constructed by substituting g4423 Gene with MCR Gene

In order to utilize the strong expression ability of the g4423 gene identified in example 4, a recombinant strain YBC-1684 was constructed by replacing the g4423 gene in the genome of YBC strain with the MCRsa1 gene, and the expression level of the MCRsa1 gene was analyzed. Based on the information about g4423 and UTR, the gene cassette of fig. 1(b) was constructed from which the g4423 ORF was removed and which had 5 'UTR and 3' UTR and antibiotic markers. In addition, the MCRsa1 sequence optimized for yeast codon usage was introduced into the ORF site of g 4423. The constructed gene cassette was used as donor DNA. To construct the donor DNA, the cloning method using restriction enzymes as described above and the gibson assembly method were used. The plasmid used in the donor DNA (pSK863) is shown in SEQ ID NO: shown at 7.

The donor DNA in the constructed cassette is amplified and introduced into the YBC strain. The grown colonies were analyzed using the following primers to identify the g4423 ORF. As a result, it was confirmed that the g4423 ORF was removed and MCRsa1 ORF was present, indicating that MCRsa1 was introduced.

Forward primer for analysis (SEQ ID NO: 74): ATGAGAAGAACTTTGAAGGCTG the flow of the air in the air conditioner,

reverse primer (SEQ ID NO: 75): TTACTTAGGGATGTAACCCTTTTCGA are provided.

The strain was cultured with 50ml of medium (containing 40g/L glucose) in a 250ml flask at 30 ℃ and 250rpm with an initial OD of 0.7 until the sugar and ethanol were completely consumed. Then, the amount of 3-HP and the amount of sugar and ethanol produced were analyzed. RT-qPCR for analyzing gene expression levels was performed under the same conditions as in example 1, and the medium was sampled during logarithmic growth. Table 7 below shows the specific genotypes of the constructed recombinant YBC strains.

[ Table 7] recombinant YBC strain constructed by replacing g4423 gene with MCRsa1 gene

As a result, as shown in fig. 8, it was confirmed that the expression level of the MCRsa1 gene in the constructed recombinant strain was similar to that of the g4423 gene and was much higher than that in the strain (control YBC-061) comprising TEF1 promoter (strong promoter derived from saccharomyces cerevisiae).

The promoter of G4423 was compared with the promoters of various ADH isozymes derived from Saccharomyces cerevisiae used in the past, and by comparing the homology, the homology was found to be very low (Table 8). A homology comparison between the promoter of G4423 and the promoters of various conventional ADH isozymes derived from Saccharomyces cerevisiae was performed, and as a result, it was found that the homology was very low (Table 8).

TABLE 8 homology comparison between the g4423 promoter region and the Saccharomyces cerevisiae ADH promoter region

Example 6: production of 3-HP in a recombinant Strain constructed by replacing the g4423 Gene with the MCRsa1 Gene

The amount of 3-HP produced in recombinant YBC-1684 with the increased expression level of the MCR gene demonstrated in example 5 was analyzed.

Compared with the results in table 3 of example 2. As shown in Table 3 above, when three core genes involved in 3-HP production were expressed using either the sctEF promoter or the FBA promoter, about 1-16mg/L of 3-HP was produced in flask cultures.

In addition, the amount of 3-HP produced was analyzed in the recombinant strain YBC-1684 and in strains constructed by inserting a gene related to 3-HP production into the strain YBC-1684 in which the g4423 site was replaced with expressed MCRsa 1.

Each strain was cultured at 30 ℃ in flasks with YP medium (20g/L peptone and 10g/L yeast extract) supplemented with 4% glucose and 15. mu.M cerulenin, and on day 5 when the sugar was completely consumed, the medium was sampled and analyzed for 3-HP production.

As a result, as shown in Table 9 below, YBC-1684 strain in which only MCRsa1 gene was inserted into g4423 site produced 200mg/L of 3-HP, whereas strain in which 3-HP production-related genes (HiBADH gene and EUTE gene) were additionally inserted into g4423 site produced 146mg/L-710mg/L of 3-HP, and the yields of 3-HP differed among colonies. Therefore, it was confirmed that the production of 3-HP in this strain was significantly higher than that in the recombinant strain in which the corresponding gene was expressed from the sctEF promoter or the FBA promoter.

[ Table 9]

From these results, it was confirmed that the g4423 promoter increased the expression of MCRsa1 gene, which had a great effect on the increase of 3-HP production. It can be seen that if the expression of the gene associated with the target compound is increased by the g4423 promoter, the yield of the target compound is increased.

Example 7: migration analysis of the g4423 promoter

The G4423 promoter and terminator regions in the genomic DNA of the YBC strain were cut into a length of 1kb, and the expression level of MCRsa1 gene for 3-HP production was analyzed. Based on the information on g4423 and UTR in the YBC strain genome, a 1kb region of the 5' UTR region of g4423 was amplified and extracted using primers, and then amplified using oSK-1412 to oSK1419 primers of table 2 above, thereby obtaining a MCRsa1 fragment with the promoter of g4423 optimized for yeast codon usage. The obtained fragment was introduced into the cassette of FIG. 1(e) capable of expressing a plurality of genes, and the plasmid (pSK-865) used was as shown in SEQ ID NO: 8. Donor DNA cassettes were amplified, purified and introduced into YBC, and the genotypes of the growing colonies were analyzed.

The expression level of MCRsa1 was confirmed to be reduced in the recombinant strain YBC-1693 obtained by the above method, as in the case of using the promoter of YBC (FBA) or the TEF1p promoter of Saccharomyces cerevisiae (FIG. 9). Thus, it is speculated that promoter action in acid tolerant strains of YBC requires longer fragments or has mechanisms (enhancers or silencers) that function even over long distances or by a combination of factors. Additional studies are needed to elucidate these mechanisms accurately.

When the g4423 gene was replaced with the target gene, two effects were obtained: the target gene can be strongly expressed and the g4423 gene associated with ethanol production is removed. Therefore, the research object of producing various compounds using the strain can be effectively accomplished.

Example 8: expression of the LDH Gene from the g4423 promoter

In this example, a recombinant YBC strain was constructed in which the g4423 gene was replaced with an LDH (lactate dehydrogenase) gene associated with lactate production in addition to the MCR gene. The constructed strains were analyzed for lactic acid productivity.

Recombinant strains were constructed so that three representative genes (LDH derived from lactobacillus helveticus (l.helveticus), LDH derived from rhizopus oryzae (r.oryzae), LDH derived from lactobacillus plantarum (l.plantarum)) were expressed from the g4423 promoter.

Based on the information on g4423 and UTR, a gene cassette similar to that shown in fig. 1(e) was constructed with the g4423 ORF removed and with 5 'UTR and 3' UTR and antibiotic markers. Based on the information from the three genes of NCBI, sequences optimized for yeast codon usage were synthesized and then introduced into the cassette using restriction enzymes (ApaI and SacI). The donor DNA in the completed cassette is amplified and introduced into the YBC strain. The grown colonies were analyzed using the following primers to identify the g4423 ORF and, as a result, it was confirmed that one allele of the g4423 ORF was removed and each LDH gene was introduced.

Lactobacillus helveticus forward primer (SEQ ID NO: 76): ATGAAAATTTTTGCTTATGG, respectively;

lactobacillus helveticus reverse primer (SEQ ID NO: 77): TTAATATTCAACAGCAATAG, respectively;

rhizopus oryzae forward primer (SEQ ID NO: 78): ATGGTTTTGCATTCTAAAGT, respectively;

rhizopus oryzae reverse primer (SEQ ID NO: 79): TTAACAAGAAGATTTAGAAA, respectively;

lactobacillus plantarum forward primer (SEQ ID NO: 80): ATGTCTTCTATGCCAAATCA, respectively;

lactobacillus plantarum reverse primer (SEQ ID NO: 81): TTATTTATTTTCCAATTCAG

The constructed recombinant strain was shake-cultured with YP (20g/L peptone and 10g/L yeast extract) medium supplemented with 4% glucose and 150mg/L uracil at 30 ℃ and 100rpm for 24 hours.

The medium was analyzed by HPLC for lactic acid and ethanol. The concentrations of glucose, ethanol and L-lactic acid in the medium were analyzed using a Bio-Rad Aminex 87-H column equipped with a Waters 1525Binary HPLC pump. Glucose and ethanol were analyzed using a Waters 2414 refractive index detector and L-lactic acid was analyzed using a Waters 2489 ultraviolet/visible light detector (210 nm). The concentration of each component was calculated using the peak area of a standard curve plotted from the concentration of each component, and the specific conditions for analysis were as follows.

1. Mobile phase conditions: 0.005M H₂SO₄Solutions of

2. Flow rate: 0.6 mL/min

3. Operating time: 40 minutes

4. Temperature of the column box: 60 deg.C

5. Detector temperature: 40 deg.C

6. Sample introduction amount: 10 μ L

7. Temperature of the tray of the automatic sampler: 4 deg.C

As a result, as shown in FIG. 10, it was confirmed that the substituted target gene exhibited LDH activity, thereby producing lactic acid.

[ preservation information ]

The name of the depository institution: korea institute of bioscience and Biotechnology

Registration number: KCTC13508BP

The preservation date is as follows: 11/4/2018

INDUSTRIAL APPLICABILITY

When a target gene involved in the production of an organic acid is expressed in an organic acid-resistant yeast using the novel promoter according to the present invention, there is an advantage in that the yeast can efficiently produce an organic acid while having tolerance to an organic acid and the growth ability of the yeast is not inhibited.

Although the present invention has been described in detail with reference to the specific features, it is apparent to those skilled in the art that the description is only of the preferred embodiment of the present invention and does not limit the scope of the present invention. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Sequence Listing free text

Accompanying electronic document

<110> SK New technology corporation

<120> novel promoter derived from organic acid-resistant yeast and method for expressing target gene using the same

<130> PP-B2157

<150> KR 10-2018-0044508

<151> 2018-04-17

<160> 81

<170> KopatentIn 2.0

<210> 1

<211> 988

<212> DNA

<213> Artificial sequence

<220>

<223> g4423 promoter region allele 1

<400> 1

gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaatacgca 60

cagaatgaac atctgattga ttaatattta tatattactt agtggcaccc ctacaaacaa 120

accaattttg aatatttctc accatcatga tatttattta gggcaagaat ttcatgtaca 180

tacgtgcgtg tactgcatag ttttgttata tgtaaataac cagcaatata tcaccaatga 240

taaatgctca gtaatttatt tggaaccaaa atagtttcag taatcaaata atacaataac 300

taacaagtgc tgattataca acagctgtta acaacacaaa cacgctctct tctattctct 360

tccctgcttg ttcgtgtggt atattcccga atttgcaatt tagaaattat attttttaaa 420

agaattgttc tccattttct ggtagtcgta agtggcaaat tggatcataa gacacaatct 480

tgttagttcg actgctaaca ccagacaaga ccgaacgaaa acagaaaaaa aagataattt 540

tgttattctg ttcaattctc tctctctttt taaggtatct ttacattaca ttacatatcc 600

caaattacaa caagagcaag aaatgaagca caacaacacg ccatctttcg tgattatttt 660

atcatttcta tatcgtaact aaattaacaa atgctatgtt tcttaatttt taatgataaa 720

tctaactgct accttaattt ctcatggaaa gtggcaaata cagaaattat atattcttat 780

tcattttctt ataattttta tcaattacca aatatatata aatgcaatta attgattgtt 840

cctgtcacat aatttttttt gtttgttacc tttattcttt atccatttag tttagttctt 900

atatctttct tttctatttc tctttttcgt ttaatctcac cgtacacata tatatccata 960

tatcaataca aataaaaatc atttaaaa 988

<210> 2

<211> 961

<212> DNA

<213> Artificial sequence

<220>

<223> g4423 promoter region allele 2

<400> 2

gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaaatacgc 60

acagaatgaa catctgattg attaatattt atatattact cagtggcacc cctacaaaca 120

aaccaatttt gaatattgtt caccatcatg atatttattt agggcaagaa tttcatgtac 180

atacgtgcgt gtactgcata gttttgttat atgaaaataa ccagcaatat atcaccaatg 240

aataaattct caataattta tttggaacca aataatgcaa taactagcaa actaagtggt 300

gattatacaa cagctgttaa caacacaaac atacgctctc ttctattatc tcttccctgc 360

ttgttcgtgt ggtatattca cgaatttgca atttagaaat tatatttttt aaaagaattg 420

ttctccattt tctggtagtc gtaagtggca aattggatca taagacacaa tcttgttagt 480

tcgactgcta acaccagaca acaccgaacg aaaacaagaa aaaataatta ttctctctct 540

ttttaaggta tcttacatta catatcccaa attacaacaa gagcaagaaa tgaggcacaa 600

caacacacca tcatctttcg tgattatttt tatcatttct atcatgtaat taaattaaca 660

aatgttaagt ttattaattt ttaatgataa atctagttgc taccttaatt tctcatggaa 720

agtggcaaat actgaaatta tttaattcta ctttcatttt cttataattt ttatcaatta 780

ccaaatatat ataaatgcaa ttaattgatt gttcctgtca cataattttt tttgtttgtt 840

acctttattc tttatccatt taatttattt cttgtatctt tcttttctat ttctcttttc 900

tgtttaatct caccgtacac atatatatcc atatatcaat acaaataaaa atcatttaaa 960

a 961

<210> 3

<211> 1017

<212> DNA

<213> Artificial sequence

<220>

<223> g4423 terminator region allele 1

<400> 3

taagtcattt aatttattct tttagaatat atttattttg tctttatttt tgaaatgtta 60

atagtctttt ttttttactt tgaacaaaaa aaagtaaaat taaaacttat cttatatacg 120

cttttaaaca ttaaactcgt taacgaatta tataatgatt ttatcgaact actttatgtt 180

tttttaatag aataatcttc tttattaata taacttacta cttcttaatc ttgttgtcct 240

ccattcgaaa ctcgagtgga acattttctg agtatctctc gcgtctgttc gtaccgtttt 300

tccaatttct ttcgggaaac ggaactggac gcattttatt tgactgttga aagggagatt 360

taatatttat atagcgagat ataacaacta acttataagt ttacacaggc tgttatcaca 420

tatatatata tatatcaaca gaggactagc tcactagact aacattagat atgtcgatgc 480

tgaaccgttt gtttggtgtt agatccattt cacaatgtgc tactcgttta caacgttcta 540

cagggacaaa tatatcagaa ggtccactaa gaattattcc acaattacaa actttctatt 600

ctgctaatcc aatgcatgat aacaatatcg acaagctaga aaatcttcta cgtaaatata 660

tcaagttacc aagtacaaac aatttattga agacacatgg gaatacatct acagaaattg 720

atccaacaaa attattacaa tcacaaaatt cttcacgtcc tttatggtta tcattcaagg 780

attatacagt gattggaggt ggttcacgtt taaaacctac tcaatacacg gaacttttat 840

ttctattgaa taaactacat agtatcgatc cacaattaat gaatgatgat attaagaacg 900

aattagctca ttattataag aatacttcac aggaaactaa taaagtcacc atccctaaat 960

tggatgaatt cggtagaagt attggaatcg gtagaaggaa atccgcaact gcaaaag 1017

<210> 4

<211> 1018

<212> DNA

<213> Artificial sequence

<220>

<223> g4423 terminator region allele 2

<400> 4

taagtcattt aatttattct tttagaatat atttattttg tctttatttt tgaaatgtta 60

atagtctttt ttttactttg aaaaaaaaaa aaagtaaaat taaacttatc ttatatacgc 120

ttttaaacat taaactcgtt aacgaattat ataatgattt tatcgaacta ctttatgttt 180

ttttaataga ataatcttct ttattaatat aacttactac ttcttaatct tgttgtcctc 240

cattcgaaac tcgagaggaa caatttctga gtctctctcg caccctttcg tacgtaccgt 300

ttttccaatt tctttcggga aacggaactg gacgcatttt atttgactgt tgaaagggag 360

atttaatatt tatatagaga gatataacaa ctaacttata agtttataca ggctgttatc 420

acatatatat atatatcaac agaggactag ctcaatagaa taacattaga tatgtcgatg 480

ctgaaccgtt tgtttggtgt tagatccatt tcacaatgtg ctactcgttt acaacgttct 540

acagggacaa atatatcaga aggtccacta agaattattc cacaattaca aactttctat 600

tctgctaatc caatgcatga taacaatatc gacaagctag aaaatcttct acgtaaatat 660

atcaagttac caagtacaaa taacttattg aagacacatg ggaatacatc tacagaaatc 720

gatccaacaa aattattaca atcacaaaat tcttcacgtc ctttatggtt atcattcaag 780

gattatacag tgattggagg tggttcacgt ttaaaaccta ctcaatacac agaactttta 840

tttctattga ataaactaca tagtatcgat ccacaattaa tgaatgatga tattaagaac 900

gaattagctc attattataa gaatacttca caggaaacta ataaagtcac catccctaaa 960

ttggatgaat tcggtagaag tattggaatc ggtagaagga aatccgcaac tgcaaaag 1018

<210> 5

<211> 6402

<212> DNA

<213> Artificial sequence

<220>

<223> g4423 deletion cassette comprising plasmid allele 1

<400> 5

cacctgacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 60

tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 120

tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc 180

gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta 240

gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 300

atagtggact cttgttccaa actggaacaa cactcaaccc tatctcggtc tattcttttg 360

atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa 420

aatttaacgc gaattttaac aaaatattaa cgcttacaat ttccattcgc cattcaggct 480

gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 540

agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 600

ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgcctgcagg 660

gttaactcag ttttctctct ttccctccac cccacgttac tctgcgaaca aaaatacgca 720

cagaatgaac atctgattga ttaatattta tatattactt agtggcaccc ctacaaacaa 780

accaattttg aatatttctc accatcatga tatttattta gggcaagaat ttcatgtaca 840

tacgtgcgtg tactgcatag ttttgttata tgtaaataac cagcaatata tcaccaatga 900

taaatgctca gtaatttatt tggaaccaaa atagtttcag taatcaaata atacaataac 960

taacaagtgc tgattataca acagctgtta acaacacaaa cacgctctct tctattctct 1020

tccctgcttg ttcgtgtggt atattcccga atttgcaatt tagaaattat attttttaaa 1080

agaattgttc tccattttct ggtagtcgta agtggcaaat tggatcataa gacacaatct 1140

tgttagttcg actgctaaca ccagacaaga ccgaacgaaa acagaaaaaa aagataattt 1200

tgttattctg ttcaattctc tctctctttt taaggtatct ttacattaca ttacatatcc 1260

caaattacaa caagagcaag aaatgaagca caacaacacg ccatctttcg tgattatttt 1320

atcatttcta tatcgtaact aaattaacaa atgctatgtt tcttaatttt taatgataaa 1380

tctaactgct accttaattt ctcatggaaa gtggcaaata cagaaattat atattcttat 1440

tcattttctt ataattttta tcaattacca aatatatata aatgcaatta attgattgtt 1500

cctgtcacat aatttttttt gtttgttacc tttattcttt atccatttag tttagttctt 1560

atatctttct tttctatttc tctttttcgt ttaatctcac cgtacacata tatatccata 1620

tatcaataca aataaaaatc atttaaaagg gcccacgtcc gagggagctc tagtacctcg 1680

taccgttcgt ataatgtatg ctatacgaag ttatcatcca ggattctgtt tagcttgcct 1740

cgtccccgcc gggtcacccg gccagcgaca tggaggccca gaataccctc cttgacagtc 1800

ttgacgtgcg cagctcaggg gcatgatgtg actgtcgccc gtacatttag cccatacatc 1860

cccatgtata atcatttgca tccatacatt ttgatggccg cacggcgcga agcaaaaatt 1920

acggctcctc gctgcagacc tgcgagcagg gaaacgctcc cctcacagac gcgttgaatt 1980

gtccccacgc cgcgcccctg tagagaaata taaaaggtta ggatttgcca ctgaggttct 2040

tctttcatat acttcctttt aaaatcttgc taggatacag ttctcacatc acatccgaac 2100

ataaacaacc atgggtaagg aaaagactca cgtttcgagg ccgcgattaa attccaacat 2160

ggatgctgat ttatatgggt ataaatgggc tcgcgataat gtcgggcaat caggtgcgac 2220

aatctatcga ttgtatggga agcccgatgc gccagagttg tttctgaaac atggcaaagg 2280

tagcgttgcc aatgatgtta cagatgagat ggtcagacta aactggctga cggaatttat 2340

gcctcttccg accatcaagc attttatccg tactcctgat gatgcatggt tactcaccac 2400

tgcgatcccc ggcaaaacag cattccaggt attagaagaa tatcctgatt caggtgaaaa 2460

tattgttgat gcgctggcag tgttcctgcg ccggttgcat tcgattcctg tttgtaattg 2520

tccttttaac agtgatcgcg tatttcgtct cgctcaggcg caatcacgaa tgaataacgg 2580

tttggttgat gcgagtgatt ttgatgacga gcgtaatggc tggcctgttg aacaagtctg 2640

gaaagaaatg cataagcttt tgccattctc accggattca gtcgtcactc atggtgattt 2700

ctcacttgat aaccttattt ttgacgaggg gaaattaata ggttgtattg atgttggacg 2760

agtcggaatc gcagaccgat accaggatct tgccatccta tggaactgcc tcggtgagtt 2820

ttctccttca ttacagaaac ggctttttca aaaatatggt attgataatc ctgatatgaa 2880

taaattgcag tttcatttga tgctcgatga gtttttctaa tcagtactga caataaaaag 2940

attcttgttt tcaagaactt gtcatttgta tagttttttt atattgtagt tgttctattt 3000

taatcaaatg ttagcgtgat ttatattttt tttcgcctcg acatcatctg cccagatgcg 3060

aagttaagtg cgcagaaagt aatatcatgc gtcaatcgta tgtgaatgct ggtcgctata 3120

ctgctgtcga ttcgatacta acgccgccat ccagtgtcga aaagtatcag caaataactt 3180

cgtataatgt atgctatacg aacggtagcg atcgctttgt ctttattttt gaaatgttaa 3240

tagtcttttt tttttacttt gaacaaaaaa aagtaaaatt aaaacttatc ttatatacgc 3300

ttttaaacat taaactcgtt aacgaattat ataatgattt tatcgaacta ctttatgttt 3360

ttttaataga ataatcttct ttattaatat aacttactac ttcttaatct tgttgtcctc 3420

cattcgaaac tcgagtggaa cattttctga gtatctctcg cgtctgttcg taccgttttt 3480

ccaatttctt tcgggaaacg gaactggacg cattttattt gactgttgaa agggagattt 3540

aatatttata tagcgagata taacaactaa cttataagtt tacacaggct gttatcacat 3600

atatatatat atatcaacag aggactagct cactagacta acattagata tgtcgatgct 3660

gaaccgtttg tttggtgtta gatccatttc acaatgtgct actcgtttac aacgttctac 3720

agggacaaat atatcagaag gtccactaag aattattcca caattacaaa ctttctattc 3780

tgctaatcca atgcatgata acaatatcga caagctagaa aatcttctac gtaaatatat 3840

caagttacca agtacaaaca atttattgaa gacacatggg aatacatcta cagaaattga 3900

tccaacaaaa ttattacaat cacaaaattc ttcacgtcct ttatggttat cattcaagga 3960

ttatacagtg attggaggtg gttcacgttt aaaacctact caatacacgg aacttttatt 4020

tctattgaat aaactacata gtatcgatcc acaattaatg aatgatgata ttaagaacga 4080

attagctcat tattataaga atacttcaca ggaaactaat aaagtcacca tccctaaatt 4140

ggatgaattc ggtagaagta ttggaatcgg tagaaggaaa tccgcaactg caaaagggcg 4200

cgcccagctt ttgttccctt tagtgagggt taatttcgag cttggcgtaa tcatggtcat 4260

agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa 4320

gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc 4380

gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc 4440

aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact 4500

cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac 4560

ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa 4620

aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg 4680

acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa 4740

gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc 4800

ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac 4860

gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac 4920

cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg 4980

taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt 5040

atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga 5100

cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct 5160

cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga 5220

ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg 5280

ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct 5340

tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt 5400

aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc 5460

tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg 5520

gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag 5580

atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt 5640

tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag 5700

ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt 5760

ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca 5820

tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg 5880

ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat 5940

ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta 6000

tgcggcgacc gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca 6060

gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct 6120

taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat 6180

cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa 6240

agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt 6300

gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa 6360

ataaacaaat aggggttccg cgcacatttc cccgaaaagt gc 6402

<210> 6

<211> 6376

<212> DNA

<213> Artificial sequence

<220>

<223> g4423 deletion cassette comprising plasmid allele 2

<400> 6