Rootstock improvement method and application
阅读说明：本技术 一种砧木改良方法及应用 (Rootstock improvement method and application ) 是由 李天忠 王胜男 王圣元 郝理 于 2020-12-11 设计创作，主要内容包括：本发明属于生物嫁接技术领域,涉及一种砧木改良方法及应用,包括：步骤1：合成传递基因；步骤2：将合成传递基因与功能基因构建到载体上；步骤3：以农杆菌侵染方式转基因的烟草为砧木,野生番茄为接穗,进行异源嫁接；步骤4：取嫁接口及不同位置茎段及花,提取植物总RNA,反转录成cDNA,RT-PCR检测SlZFP2-tRNA～(Met)和SlZFP2-3×CTCT等在异源嫁接体系中的运输情况；步骤5：调查转基因砧木上野生型番茄的分枝及开花情况。方法可应用在果树转基因砧木育种中,通过砧木转基因定点高效改良接穗性状,人为操控砧木基因,影响接穗性状,提高调控效率,缩短育种年限,减少人力物力成本,普遍应用于各类植物。(The invention belongs to the technical field of biological grafting, and relates to a stock improvement method and application, which comprises the following steps: step 1: synthesizing a transmission gene; step 2: constructing a synthetic transmission gene and a functional gene on a carrier; and step 3: taking tobacco with transgene in an agrobacterium infection mode as a stock and wild tomatoes as scions, and carrying out heterologous grafting; and 4, step 4: taking the graft port and stem segments and flowers at different positions, extracting total RNA of the plant, performing reverse transcription to obtain cDNA, and detecting SlZFP2-tRNA by RT-PCR Met And SlZFP2-3 × CTCT and the likeTransportation conditions in the grafting system; and 5: and (5) investigating the branching and flowering conditions of the wild tomato on the transgenic rootstock. The method can be applied to breeding of fruit tree transgenic stocks, the scion character is efficiently improved at fixed points through the rootstock transgenosis, the rootstock gene is manually controlled, the scion character is influenced, the regulation efficiency is improved, the breeding period is shortened, the manpower and material resource cost is reduced, and the method is generally applied to various plants.)
1. A rootstock improvement method is characterized by comprising the following steps:
step 1: synthetic transgene tRNAMet、3×CTCT、3×CTCTt；
The transfer gene tRNAMetThe gene sequence of (A) is shown as sequence 1 in the sequence table;
the gene sequence of the transfer gene 3 xCTCT is shown as a sequence 2 in a sequence table;
the gene sequence of the transfer gene 3 xCTCTT is shown as a sequence 3 in a sequence table;
step 2: cloning functional gene SlZFP2 for promoting branching and early flowering, and constructing the synthetic transfer gene and the functional gene in the step 1 on a pCAMBIA1305 vector together for subsequent fusion expression;
the gene sequence of the functional gene SlZFP2 is shown as a sequence 4 in a sequence table;
and step 3: transgenic overexpression of pCAMBIA1305-SlZFP2-tRNA in tobacco by adopting agrobacterium infection modeMetThe transgenic tobacco is used as a stock, the wild tomato is used as a scion, and tomato/tobacco heterologous grafting is carried out;
and 4, step 4: taking a grafting opening and stem segments and flowers at different positions above and below the grafting opening, extracting total RNA of the plant, performing reverse transcription to obtain cDNA, and detecting SlZFP2-tRNA by RT-PCRMetThe transportation conditions of SlZFP2-3 xCTCT and 3 xCTCTt in a tomato/tobacco heterologous grafting system;
and 5: and (5) investigating the branching and flowering conditions of the wild tomatoes on different transgenic stocks.
2. The method of improving rootstock according to claim 1, wherein: the transfer gene tRNA described in step 1MetIs a protogenic tRNAMetAdding SalI and BglII enzyme cutting sites at two ends of the sequence respectively;
step 1, the transmission gene 3 xCTCT is formed by respectively adding SalI and BglII enzyme cutting sites at two ends of an original gene 3 xCTCT sequence;
the 3 xCTCTt of the transfer gene in the step 1 is formed by respectively adding SalI and BglII enzyme cutting sites at two ends of an original gene 3 xCTT sequence.
3. The method of improving rootstock according to claim 2, wherein: the specific steps of constructing the synthetic transmission gene and the functional gene together on the pCAMBIA1305 vector in the step 2 are as follows:
s21, transferring the transferable gene fragment tRNA in the step 1MetCarrying out double enzyme digestion on the 3 xCTCT, the 3 xCTCTt and the pCAMBIA1305 vector by adopting SalI and BglII together to form an enzyme digestion product;
s22, carrying out agarose gel electrophoresis detection on the enzyme digestion product, and recovering a target fragment by using an Axgen recovery kit;
s23, ligation of the recovered target fragment to pCAMBIA1305 vector with T4 ligase to construct pCAMBIA1305-tRNAMetpCAMBIA1305-3 × CTCT and pCAMBIA1305-3 × CTCTTA delivery vehicle;
the specific steps of cloning functional gene SlZFP2 for promoting branching and early flowering in step 2 are as follows:
s24, extracting RNA of tomato and tobacco leaves by adopting a CTAB method;
s25, carrying out reverse transcription on the RNA extracted in the step S24 into cDNA by adopting a PrimeScript 1st Strand cDNA Synthesis Kit;
s26, designing a primer clone tomato SlZFP2 gene full-length sequence, wherein the primer sequence is as follows:
SlZFP2-F：ATGAGTTATGAACCAAACACGG；
SlZFP2-R：TTAAAGCCTTAATGACAAATCAAG。
4. the method of improving rootstock according to claim 3, wherein: the specific steps of step 3 are as follows:
s31, designing a primer, adding an enzyme cutting site to a recovery product of SlZFP2 through PCR amplification, wherein the sequence of the primer is as follows:
adding an upstream primer sequence of a restriction enzyme site SalI:
GTCGACATGAGTTATGAACCAAACACGG；
adding a downstream primer sequence of a digestion site SpeI:
ACTAGTTTAAAGCCTTAATGACAAATCAAG；
s32, agarose gel electrophoresis detection and recovery, and pCAMBIA1305-tRNAMetCarrying out double enzyme digestion on pCAMBIA1305-3 xCTCT and pCAMBIA1305-3 xCTCTt vectors respectively, connecting overnight at 16 ℃ by adopting T4 ligase, transferring into E.coli DH5 alpha competent cells, picking single clone the next day, and shaking bacteria to extract plasmids;
s33, preparing competent cells of Agrobacterium tumefaciens GV 3101;
s34, transforming agrobacterium tumefaciens competent cells;
s35, transgenic tobacco;
s36, identifying the tobacco transgenic positive plant, taking the positive seedling leaf, and extracting DNA by a CTAB method;
s37, grafting tomato/transgenic tobacco in the field.
5. The method of improving rootstock according to claim 4, wherein: the specific steps of step 4 are as follows:
s41, detecting the transmissibility of the functional gene in the tomato/tobacco field grafting system;
the method comprises the following specific steps:
s411, grafting the tomatoes and the tobaccos in a field;
s412, the grafting opening is healed, when new leaves of the tomato grow out, the sealing film at the grafting opening is removed, and old leaves are continuously removed to enable the new leaves of the scion to grow;
s413, after 1 month, sampling tomato leaves and stems and tobacco leaves and stems, grinding by adopting liquid nitrogen, extracting RNA, and performing reverse transcription to obtain cDNA;
s414, verifying the transmission condition of the GAI and ZFP2 genes by adopting an RT-PCR mode, wherein the specific primer sequences of the genes in the tobacco and the tomato are as follows:
SlZFP2-F：ATGAGTTATGAACCAAACACGG；
SlZFP2-R：ACCATGACTAGTATGGCTCGGAC；
NtZFP2-F：GCTTATCAAGAAATGAACTTAGCTT；
NtZFP2-R：GCTCAATTCAGTAGTAACAAACCTAG；
SlGAI-F：CTCTAATGGTGCTGTTTCTTCAGG；
SlGAI-R：GGTACTTGTTCGATGATTTTGTGAG；
NtGAI-F：AGCATGTTATCTGAGCTCAACAAC；
NtGAI-R：TTGCATCTGCTGTTAGTGGTACAC；
SlActin-F：GGAATGGGACAGAAGGAT；
SlActin-R：CAGTCAGGAGAACAGGGT；
NtActin-F：TTGCCTGATGGACAAGTTATTACC；
NtActin-R：TAGGAGCCAAAGCCGTGATT；
s42, detecting the transferability of mRNA and fusion gene transport vector transferred between scions;
the method comprises the following specific steps:
s421, using SlZFP2 gene as fusion expressed functional gene and transferrable gene tRNAMet3 xCTCT and 3 xCTCTt for fusion expression to construct mRNA transport carrierTransforming tobacco plants;
s422, grafting the wild tomato serving as a scion onto a transgenic stock, sampling a scion stem segment to extract RNA after grafting for 2 weeks, and performing transitive identification by nested PCR, wherein the primer sequence is as follows:
F：ACACGGCCTTAAACCTAAGTCTATC；
R：ATCCTGGTGCCTCCCTGTTAG；
nested PCR forward primer sequence:
TCATCAACCCCTTTAAGCCCGGTTG；
tomato branched gene SlZFP2-tRNAMetThe nested PCR reverse primer sequence of (a):
CGATCCTGGGACCTGTGGGTTATGG；
nested PCR reverse primer sequence of tomato branch gene SlZFP2-3 × CTCT:
GCAGAAGAAAAGAAGATGTTAACAAG；
nested PCR reverse primer sequence of tomato branch gene SlZFP2-3 × CTCTT:
GATGCAGAAGAAAAGTTAAAGCCTTAATGACAAATC；
s423, sampling the rootstock stem, the grafting opening, the scion stem segment with different distances from the grafting opening, the stem tip, the branch stem, the branch leaf and the flower tissue, and detecting the transmission distance of the fusion segment and the plant part transmitted to the fusion segment.
6. The method of improving rootstock according to claim 4, wherein: the specific steps of step S35 are as follows:
s351, taking tobacco leaves, and washing the tobacco leaves for 2-3 hours by using running water;
s352, rinsing the glass substrate for 30 seconds by using 75% ethanol in a super clean bench, and washing the glass substrate for 2 times by using sterilized water;
s353, rinsing with 2% NaClO for 6min, and washing with sterilized water for 5-6 times;
s354, cutting the leaves on two sides into squares with the size of 0.5cm multiplied by 0.5cm along the main vein, paving the squares on a pre-culture medium, and culturing for 48 hours at 25 ℃ under the light;
s355, selecting positive clones of transformed Agrobacterium, inoculating in 5mL YEP liquid medium containing Rif and Kan, culturing overnight at 28 ℃ and 200rpm to OD600＝0.6-0.8；
S356, 6000rpm 5min to collect the bacteria, abandoning the supernatant, resuspending with 50ml YEP liquid culture medium containing Rif and Kan, culturing at 28 ℃ and 200rpm for 3-4h to OD600＝0.6-0.8；
S357, collecting bacteria at 6000rpm for 5min, discarding the supernatant, resuspending the supernatant in 30mL of liquid MS culture medium, and culturing at 28 ℃ and 200rpm for 3-4 h;
s358, placing the pre-cultured leaves in a bacterial liquid, slightly shaking for 1min, taking out, sucking redundant bacterial liquid in sterile filter paper, and placing the sterile filter paper back to the original pre-culture medium for dark culture at 25 ℃ for 48 h;
s359, transferring the culture medium into a bacterium-removing solid culture medium, and continuing culturing under light;
s3510, cutting and inoculating the seedlings to a Cef-containing culture medium after the seedlings grow out.
7. The method of improving rootstock according to claim 5, wherein: the specific steps of step 5 are as follows:
s51, performing phenotype analysis on tomato scion branches regulated and controlled by the transgenic tobacco rootstocks;
the method comprises the following specific steps: observing the branching condition of tomato scions on different fusion fragment transgenic tobacco after grafting for 3 months;
s52, fusing transferable fragments with early flowering functional genes to regulate flowering phase characters;
the method comprises the following specific steps: and (4) further counting the flowering time of the grafting system, and regulating and controlling the flowering phase of the tomatoes.
8. The method of improving rootstock according to claim 6, wherein: the specific steps of step S36 are as follows:
s361, grinding leaves in liquid nitrogen, adding 700 μ L CTAB extracting solution containing 0.2% beta-mercaptoethanol preheated at 60 ℃;
s362, about 30min at 65 ℃, 700 μ L chloroform: isoamyl alcohol 24:1, vortex for 15 s;
s363, centrifuging at room temperature of 13000rpm for 10min, and transferring the supernatant into a new centrifuge tube;
s364, adding isopropanol with the same volume, fully and uniformly mixing, and precipitating at-20 ℃ for more than 30 min;
s365, centrifuging at 13000rpm at room temperature for 10min, rinsing with 70% ethanol for 2 times, and drying in the air;
s366, adding 30 mu L ddH2Dissolving O;
s367, identifying positive plants by using specific transregional primers, extracting RNA from the positive plants, identifying RNA level positive plants by using the specific transregional primers, wherein the primer sequences are as follows:
pCAMBIA1305-F：GCCGTCTAGAGTTAGATGGTTAAC；
pCAMBIA1305-R：GCAAGACCGGCAACAGGATTCAATC。
9. the method of rootstock improvement according to claim 8, wherein: the specific steps of step S37 are as follows:
s371, transplanting transgenic tobacco and tomato plants with the same growth size into soil;
s372, after the stock grows for 1 month, removing leaves at the top end of the stock by using an operation blade in a flat cutting mode, longitudinally cutting the stock stem to form a downward 2-3cm cut, only keeping 1-2 leaves at the top end of the scion, cutting the bottom of the stem segment of the scion into a wedge shape by using a scalpel, inserting the wedge into the cut of the stock, and tightly winding a grafting opening by using a sealing film;
s373, removing the sealing film after grafting survival, grafting for 1-2 months, and quickly freezing a sample in liquid nitrogen for subsequent RNA extraction.
10. Use of the method of rootstock improvement according to any one of claims 1 to 9 for breeding transgenic rootstocks.
Technical Field
The invention belongs to the technical field of biological grafting, relates to a rootstock improvement method and application, in particular to a method for regulating and controlling the agronomic characters of scions by carrying functional genes on long-distance transfer fragments between rootstocks and scions, and more particularly relates to a technology for regulating and controlling related characters of the scions by fusing important agronomic character functional gene genetic transformation with rootstock transfer mRNA (messenger ribonucleic acid) fragments.
Background
Grafting is the most main asexual propagation mode of horticultural crops; after grafting, the interaction between the stock and the scion can affect the growth and development, resistance, flowering, fruit yield, quality and the like of the tree body. In actual production, the scion is mainly regulated and controlled by the rootstock, and the selection of the proper rootstock is the key for ensuring the success of fruit tree cultivation. The selection of good rootstocks is generally achieved by means of actual-plant seed selection, crossbreeding, mutation breeding and the like, and the good properties of rootstock varieties are maintained by asexual propagation in the later period (proposed by li tianzhou et al in 2008; proposed by sha guanli et al in 2015), and in recent years, rootstocks are improved by means of genetic engineering, DNA (deoxyribonucleic acid) molecular marking technology and the like (proposed by han et al in 2014). However, the above method can only obtain excellent rootstocks through natural artificial screening, cannot be directionally applied to actual production, and has the problem that transgenic food is not accepted by the public.
With the discovery of mRNA transfer between rootstock and scion in recent years, the phenotype regulation mechanism between the rootstock and the scion is gradually clear, and a theoretical basis is provided for the fixed-point improvement of the rootstock. However, most of the phenotype-associated genes are not known, or the functional genes themselves do not have transmissibility, so that the goal of site-directed regulation of scion traits through rootstocks is difficult to realize. In the research on the long-distance mRNA transportation between the scions, some special mRNA structures are found to have higher transmission efficiency. Therefore, the characteristics of high transmission efficiency of the mRNA with the special structure can be utilized, and non-transferable functional genes are fused to regulate and control characters among the rootstock and the scion, so that the rootstock is efficiently improved at a fixed point.
Less research has been conducted earlier on the delivery of functional genes that are carried by mRNA; in 2001, Kim et al expressed the transgene LeT6 and PYROPHOSPHATE dependent phosphofructokinase PFP (PYROPHOSPHATE-DEPENDENT PHOSPHOFRUCTOKINASE) by fusion to transform tomato, and found that the tomato leaves were transformed from normal leaves to rat ear leaves, and when the normal leaf tomato was grafted onto the rat ear leaves, the leaves of the scion also showed the rat ear leaf phenotype; in 2007, Kudo and Harada found on potatoes that when wild-type potatoes were grafted on tomatoes causing the behavior of mouse ear leaves, the scions also developed mouse ear leaves; in 2016, Zhang et al expressed the functional gene DMC1(DISRUPTION OF MEDIATIC CONTROL1) associated with meiosis in a fusionMetTransforming tobacco plants, grafting wild tobacco thereon, comparing the scions with controls, finding that: a large number of abortive pollens appeared, indicating that RNA (ribonucleic acid) can be transported long distances into the floral organs and translated into functional proteins.
Although the mRNA carries functional gene to regulate and control the phenotype of the scion, the method has the problems of unobvious effect on the regulation and control of the scion character, low efficiency, no industrial significance of most characters and the like, and cannot be finally applied to the actual production of the regulation and control of important agronomic characters between scions.
The invention utilizes the mRNA fragment with high transmission efficiency to be fused and expressed with important agronomic character genes which are not transmitted in the industry to construct an mRNA transport carrier, and the scion phenotype is regulated and controlled through the genetic transformation of the stock transport carrier, thereby finally achieving the purpose of improving the stock. The prior related technologies all have the problems of low transmission efficiency, unobvious regulation phenotype, incapability of being applied to industry and the like, and the high-efficiency transmission of the mRNA fragment applied by the invention can improve the transmission efficiency to more than 90%. The invention can be applied to the breeding of fruit tree transgenic stocks, and solves the problem of molecular breeding which is difficult to improve the scion character at fixed points and high efficiency through stock transgenosis; the scion character is influenced by manually controlling the rootstock genes, so that the aims of improving the regulation efficiency, shortening the breeding period and reducing the cost of manpower and material resources are fulfilled; meanwhile, the problems that the scion is directly transgenic and the like which are not recognized by the public and have a large dispute are solved, and the method has the characteristic of being generally applied to various plants.
Disclosure of Invention
In order to solve the technical problems in the background technology, the application provides a method for regulating and controlling the agronomic characters of scions by long-distance transfer segments between rootstock and scions and functional genes, and the specific technical scheme is as follows:
a method for improving rootstock (namely a method for regulating and controlling the agronomic characters of scions by long-distance transmission segments between rootstock and scions and carrying functional genes) comprises the following steps:
step 1: synthetic transgene tRNAMet、3×CTCT、3×CTCTt，
Wherein 3 × CTCTT represents 3 × (CTCT: tRNA)Met)；
The transfer gene tRNAMetThe gene sequence of (A) is shown as sequence 1 in the sequence table;
the gene sequence of the transfer gene 3 xCTCT is shown as a sequence 2 in a sequence table;
the gene sequence of the transfer gene 3 xCTCTT is shown as a sequence 3 in a sequence table;
step 2: cloning functional gene SlZFP2 for promoting branching and early flowering, and constructing the synthetic transfer gene and the functional gene in the step 1 on a pCAMBIA1305 vector together for subsequent fusion expression;
the gene sequence of the functional gene SlZFP2 is shown as a sequence 4 in a sequence table;
and step 3: transgenic overexpression of pCAMBIA1305-SlZFP2-tRNA in tobacco by adopting agrobacterium infection modeMetThe transgenic tobacco is used as a stock, the wild tomato is used as a scion, and tomato/tobacco heterologous grafting is carried out;
and 4, step 4: taking a grafting opening and stem segments and flowers at different positions above and below the grafting opening, extracting total RNA of the plant, performing reverse transcription to obtain cDNA, and detecting SlZFP2-tRNA by RT-PCRMet、SlZFP2-3×CTCT、SlZFP2-3×CTThe transportation condition of CTt in a tomato/tobacco heterologous grafting system;
and 5: and (5) investigating the branching and flowering conditions of the wild tomatoes on different transgenic stocks.
Based on the technical scheme, the transfer gene tRNA in step 1MetIs a protogenic tRNAMetAdding SalI and BglII enzyme cutting sites at two ends of the sequence respectively;
step 1, the transmission gene 3 xCTCT is formed by respectively adding SalI and BglII enzyme cutting sites at two ends of an original gene 3 xCTCT sequence;
the 3 xCTCTt of the transfer gene in the step 1 is formed by respectively adding SalI and BglII enzyme cutting sites at two ends of an original gene 3 xCTT sequence.
On the basis of the technical scheme, the specific steps of constructing the synthetic transmission gene and the functional gene on the pCAMBIA1305 vector together in the step 2 are as follows:
s21, transferring the transferable gene fragment tRNA in the step 1MetCarrying out double enzyme digestion on the 3 xCTCT, the 3 xCTCTt and the pCAMBIA1305 vector by adopting SalI and BglII together to form an enzyme digestion product;
s22, carrying out agarose gel electrophoresis detection on the enzyme digestion product, and recovering a target fragment by using an Axgen recovery kit;
s23, ligation of the recovered target fragment to pCAMBIA1305 vector with T4 ligase to construct pCAMBIA1305-tRNAMetpCAMBIA1305-3 × CTCT and pCAMBIA1305-3 × CTCTT;
the specific steps of cloning functional gene SlZFP2 for promoting branching and early flowering in step 2 are as follows:
s24, extracting RNA of tomato and tobacco leaves by adopting a CTAB method;
s25, carrying out reverse transcription on the RNA extracted in the step S24 into cDNA by adopting a PrimeScript 1st Strand cDNA Synthesis Kit;
s26, designing a primer clone tomato SlZFP2 gene full-length sequence, wherein the primer sequence is as follows:
SlZFP2-F：ATGAGTTATGAACCAAACACGG；
SlZFP2-R：TTAAAGCCTTAATGACAAATCAAG。
on the basis of the technical scheme, the specific steps of the step 3 are as follows:
s31, designing a primer, adding an enzyme cutting site to a recovery product of SlZFP2 through PCR amplification, wherein the sequence of the primer is as follows:
adding an upstream primer sequence of a restriction enzyme site SalI:
GTCGACATGAGTTATGAACCAAACACGG；
adding a downstream primer sequence of a digestion site SpeI:
ACTAGTTTAAAGCCTTAATGACAAATCAAG；
s32, agarose gel electrophoresis detection and recovery, and pCAMBIA1305-tRNAMetCarrying out double enzyme digestion on pCAMBIA1305-3 xCTCT and pCAMBIA1305-3 xCTCTt vectors respectively, connecting overnight at 16 ℃ by adopting T4 ligase, transferring into E.coli DH5 alpha competent cells, picking single clone the next day, and shaking bacteria to extract plasmids;
s33, preparing competent cells of Agrobacterium tumefaciens GV 3101;
s34, transforming agrobacterium tumefaciens competent cells;
s35, transgenic tobacco;
s36, identifying the tobacco transgenic positive plant, taking the positive seedling leaf, and extracting DNA by a CTAB method;
s37, grafting tomato/transgenic tobacco in the field.
On the basis of the technical scheme, the specific steps of the step 4 are as follows:
s41, detecting the transmissibility of the functional gene in the tomato/tobacco field grafting system;
the method comprises the following specific steps:
s411, grafting the tomatoes and the tobaccos in a field;
s412, the grafting opening is healed, when new leaves of the tomato grow out, the sealing film at the grafting opening is removed, and old leaves are continuously removed to enable the new leaves of the scion to grow;
s413, after 1 month, sampling tomato leaves and stems and tobacco leaves and stems, grinding by adopting liquid nitrogen, extracting RNA, and performing reverse transcription to obtain cDNA;
s414, verifying the transmission condition of the GAI and ZFP2 genes by adopting an RT-PCR mode, wherein the specific primer sequences of the genes in the tobacco and the tomato are as follows:
SlZFP2-F：ATGAGTTATGAACCAAACACGG；
SlZFP2-R：ACCATGACTAGTATGGCTCGGAC；
NtZFP2-F：GCTTATCAAGAAATGAACTTAGCTT；
NtZFP2-R：GCTCAATTCAGTAGTAACAAACCTAG；
SlGAI-F：CTCTAATGGTGCTGTTTCTTCAGG；
SlGAI-R：GGTACTTGTTCGATGATTTTGTGAG；
NtGAI-F：AGCATGTTATCTGAGCTCAACAAC；
NtGAI-R：TTGCATCTGCTGTTAGTGGTACAC；
SlActin-F：GGAATGGGACAGAAGGAT；
SlActin-R：CAGTCAGGAGAACAGGGT；
NtActin-F：TTGCCTGATGGACAAGTTATTACC；
NtActin-R：TAGGAGCCAAAGCCGTGATT；
s42, detecting the transferability of mRNA and fusion gene transport vector transferred between scions;
the method comprises the following specific steps:
s421, using SlZFP2 gene as fusion expressed functional gene and transferrable gene tRNAMet3 × CTCT and 3 × CTCTT are subjected to fusion expression to construct an mRNA transport vector to transform a tobacco plant;
s422, grafting the wild tomato serving as a scion onto a transgenic stock, sampling a scion stem segment to extract RNA after grafting for 2 weeks, and performing transitive identification by nested PCR, wherein the primer sequence is as follows:
F：ACACGGCCTTAAACCTAAGTCTATC；
R：ATCCTGGTGCCTCCCTGTTAG；
nested PCR forward primer sequence (CSF):
TCATCAACCCCTTTAAGCCCGGTTG；
tomato branched gene SlZFP2-tRNAMetThe nested PCR reverse primer sequence of (1), namely SlZPF2-t (CSR) -:
CGATCCTGGGACCTGTGGGTTATGG；
nested PCR reverse primer sequence of tomato branched gene SlZFP2-3 × CTCT namely SlZPF2-3CU (CSR) -:
GCAGAAGAAAAGAAGATGTTAACAAG；
nested PCR reverse primer sequence of tomato branched gene SlZFP2-3 × CTCTT is SlZPF2-3Cut (CSR) -:
GATGCAGAAGAAAAGTTAAAGCCTTAATGACAAATC；
s423, sampling the rootstock stem, the grafting opening, the scion stem segment with different distances from the grafting opening, the stem tip, the branch stem, the branch leaf and the flower tissue, and detecting the transmission distance of the fusion segment and the plant part transmitted to the fusion segment.
On the basis of the above technical solution, the specific steps of step S35 are as follows:
s351, taking tobacco leaves, and washing the tobacco leaves for 2-3 hours by using running water;
s352, rinsing the glass substrate for 30 seconds by using 75% ethanol in a super clean bench, and washing the glass substrate for 2 times by using sterilized water;
s353, rinsing with 2% NaClO for 6min, and washing with sterilized water for 5-6 times;
s354, cutting the leaves on two sides along the main vein into squares with the size of 0.5cm multiplied by 0.5cm, paving the squares on a pre-culture medium, and culturing for 48 hours at 25 ℃ under the light.
S355, selecting positive clones of transformed Agrobacterium, inoculating in 5mL YEP liquid medium containing Rif and Kan, culturing overnight at 28 ℃ and 200rpm to OD600＝0.6-0.8；
S356, 6000rpm 5min to collect the bacteria, abandoning the supernatant, resuspending with 50ml YEP liquid culture medium containing Rif and Kan, culturing at 28 ℃ and 200rpm for 3-4h to OD600＝0.6-0.8；
S357, collecting bacteria at 6000rpm for 5min, discarding the supernatant, resuspending the supernatant in 30mL of liquid MS culture medium, and culturing at 28 ℃ and 200rpm for 3-4 h;
s358, placing the pre-cultured leaves in a bacterial liquid, slightly shaking for 1min, taking out, sucking redundant bacterial liquid in sterile filter paper, and placing the sterile filter paper back to the original pre-culture medium for dark culture at 25 ℃ for 48 h;
s359, transferring the culture medium into a bacterium-removing solid culture medium, and continuing culturing under light;
s3510, cutting and inoculating the seedlings to a Cef-containing culture medium after the seedlings grow out.
On the basis of the technical scheme, the specific steps of the step 5 are as follows:
s51, performing phenotype analysis on tomato scion branches regulated and controlled by the transgenic tobacco rootstocks;
the method comprises the following specific steps: observing the branching condition of tomato scions on different fusion fragment transgenic tobacco after grafting for 3 months;
s52, fusing transferable fragments with early flowering functional genes to regulate flowering phase characters;
the method comprises the following specific steps: and (4) further counting the flowering time of the grafting system, and regulating and controlling the flowering phase of the tomatoes.
On the basis of the above technical solution, the specific steps of step S36 are as follows:
s361, grinding leaves in liquid nitrogen, adding 700 μ L CTAB extracting solution containing 0.2% beta-mercaptoethanol preheated at 60 ℃;
s362, about 30min at 65 ℃, 700 μ L chloroform: isoamyl alcohol 24:1, vortex for 15 s;
s363, centrifuging at room temperature of 13000rpm for 10min, and transferring the supernatant into a new centrifuge tube;
s364, adding isopropanol with the same volume, fully and uniformly mixing, and precipitating at-20 ℃ for more than 30 min;
s365, centrifuging at 13000rpm at room temperature for 10min, rinsing with 70% ethanol for 2 times, and drying in the air;
s366, adding 30 mu L ddH2Dissolving O;
s367, identifying positive plants by using specific transregional primers, extracting RNA from the positive plants, identifying RNA level positive plants by using the specific transregional primers, wherein the primer sequences are as follows:
pCAMBIA1305-F (i.e., 1305-F, also known as the forward identifying primer designed on the 1305 vector or 1305-F):
GCCGTCTAGAGTTAGATGGTTAAC；
pCAMBIA1305-R (i.e., 1305-R, also known as reverse identification primer on the 1305 vector):
GCAAGACCGGCAACAGGATTCAATC。
on the basis of the above technical solution, the specific steps of step S37 are as follows:
s371, transplanting transgenic tobacco and tomato plants with the same growth size into soil;
s372, after the stock grows for 1 month, removing leaves at the top end of the stock by using an operation blade in a flat cutting mode, longitudinally cutting the stock stem to form a downward 2-3cm cut, only keeping 1-2 leaves at the top end of the scion, cutting the bottom of the stem segment of the scion into a wedge shape by using a scalpel, inserting the wedge into the cut of the stock, and tightly winding a grafting opening by using a sealing film;
s373, removing the sealing film after grafting survival, grafting for 1-2 months, and quickly freezing a sample in liquid nitrogen for subsequent RNA extraction.
The rootstock improvement method is applied to the breeding of the transgenic rootstock.
The invention has the following beneficial technical effects:
the method provided by the invention can be applied to breeding of fruit tree transgenic rootstocks, and the molecular breeding technology for efficiently improving the scion character at fixed points through rootstock transgenosis is adopted, so that the rootstock genes are artificially controlled to influence the scion character, and the aims of improving the regulation efficiency, shortening the breeding period and reducing the cost of manpower and material resources are fulfilled; meanwhile, the problem that the scion is directly transgenic, so that public disapproval and a large dispute are caused is avoided. The method disclosed by the invention has the characteristic of being capable of being generally applied to various types of plants.
Drawings
The invention has the following drawings:
FIG. 1 is a schematic diagram showing the construction of a CoYMV promoter transgenic mRNA transport vector and the statistics of fusion fragment transmission;
FIG. 2(a) is a schematic diagram of a tomato/tobacco field grafting system;
FIG. 2(b) is a schematic diagram showing the transitivity of PCR detection of the GAI and ZFP2 genes;
FIG. 3(a) is a schematic diagram of wild type tomato/transgenic tobacco field grafting sampling;
FIG. 3(b) shows PCR detection tRNAMet、3×CTCT、3×(CTCT:tRNAMet) The transmission distance and transmission tissue schematic diagram of the fusion SlZFP2 gene are shown;
FIG. 4(a) is a first schematic diagram of field branch phenotype observation of wild type tomato/transgenic tobacco;
FIG. 4(b) is a schematic diagram of the observation of wild type tomato/transgenic tobacco field branching phenotype;
FIG. 4(c) is a schematic diagram of the observation of the wild type tomato/transgenic tobacco field branching phenotype;
FIG. 4(d) is a fourth schematic view of the observation of the wild type tomato/transgenic tobacco field branching phenotype;
FIG. 5 is a statistical representation of the branching phenotype in a wild type tomato/transgenic tobacco field;
FIG. 6 is a statistical representation of flowering locus phenotype in a wild type tomato/transgenic tobacco field.
Detailed Description
The present invention will be further described with reference to the following examples, but the present invention is not limited to the following examples.
Example 1: process for obtaining transmissible gene sequence and constructing delivery vector
1. Deliverable gene sequence acquisition
tRNAMet、3×CTCT、3×(CTCT:tRNAMet) Is synthesized by a biological technology limited company, and SalI and BglII enzyme cutting sites are respectively added at both ends of a sequence, and the sequence is shown in the Wen dust.
2. Transmissible vector construction (as shown in FIG. 1)
Transferring gene fragment tRNA with enzyme cutting siteMet、3×CTCT、3×(CTCT:tRNAMet) The double enzyme digestion is carried out by adopting SalI and BglII together with a pCAMBIA1305 vector, and the reaction system is shown as the following table:
carrying out agarose gel electrophoresis detection on the enzyme digestion product, and recovering a target size fragment by using the Axgen recovery kit, wherein the steps are as follows:
(1) putting the cut gel block into a 2mL centrifuge tube, adding 500 mu L of DE-A, dissolving the gel block at 65 ℃ until the gel block is completely dissolved, adding 250 mu L of DE-B, and adding the mixed solution into a recovery column;
(2) centrifuging at 12000rpm for 30s, and discarding the waste liquid in the recovery column;
(3) adding 500 μ L rinsing solution PW1, centrifuging at 12000rpm for 30s, and discarding the waste liquid in the recovery column;
(4) adding 700 μ L of rinsing solution PW2, centrifuging at 12000rpm for 30s, discarding the waste liquid in the recovery column, and repeating the steps for 2 times;
(5) putting the recovery column back into the collection tube, centrifuging at 12000rpm for 2min, and blow-drying the residual ethanol;
(6) placing the recovery column in a new 1.5mL centrifuge tube, adding 35 μ L EB eluent preheated at 65 deg.C, and standing at room temperature for 2 min;
(7) centrifuge at 12000rpm for 2 min.
The recovered target fragment was ligated with pCAMBIA1305 vector using T4 ligase (purchased from TAKARA), thereby constructing pCAMBIA1305-tRNAMet、pCAMBIA1305-3×CTCT、pCAMBIA1305-3×(CTCT:tRNAMet) Three deliverable carriers, the reaction system is shown in the following table:
mixing the reaction system evenly and staying overnight at 16 ℃; add the ligation into 50. mu.L E.coli DH 5. alpha. competent cells (purchased from holo-gold biotechnology, Inc.) and let stand on ice for 20 min; thermally shocking at 42 deg.C for 45s, and standing on ice for 2 min; adding 200 μ L of non-resistant LB culture medium, and performing shaking culture at 37 deg.C and 160rpm for 1 h; the cells were collected by centrifugation at 4500rpm for 3min, 150. mu.L of the supernatant was discarded, the cells were resuspended in the remaining medium, spread evenly on Kan-resistant solid LB medium, and cultured overnight by inversion at 37 ℃.
The next day, single clones were picked up in 200. mu.L of Kan-resistant LB medium, after shaking culture at 37 ℃ and 200rpm for 6h, PCR identification was performed, positive bacterial liquid was picked up for sequencing (Biotechnology Co., Ltd.), the strains with the correct sequencing were shaken again, and the same volume of glycerol was added and stored at-80 ℃ for future use.
3. Transmissible plasmid extraction
The strain with the correct sequencing was inoculated into 5mL of LB medium with Kan resistance, cultured with shaking overnight at 37 ℃ and 200rpm, and the plasmid was extracted the next day (Axygen plasmid extraction kit).
(1) Adding the bacterial liquid into a 2mL centrifuge tube, centrifuging at 12000rpm for 30s for multiple times for bacterial collection, and discarding the supernatant;
(2) adding Buffer S1 into the precipitate, and mixing by vortex oscillation;
(3) adding Buffer S2 into the solution, and slightly reversing and mixing for 10 times;
(4) adding Buffer S3 into the solution, immediately and slightly reversing and mixing evenly for 10 times;
(5) centrifuging at 12000rpm for 10min, and adding the supernatant onto an adsorption column;
(6) standing for 2min, centrifuging at 12000rpm for 30s, and discarding the waste liquid;
(7) adding 500 μ L rinsing solution PW1, centrifuging at 12000rpm for 30s, and discarding the waste liquid in the adsorption column;
(8) adding 700 μ L rinsing solution PW2, centrifuging at 12000rpm for 30s, discarding the waste liquid in the adsorption column, and repeating the steps for 2 times;
(9) placing the adsorption column back into the collection tube, centrifuging at 12000rpm for 2min, and blow-drying the residual ethanol;
(10) placing the adsorption column in a new 1.5mL centrifuge tube, adding 70 μ L EB eluent preheated at 65 deg.C, and standing at room temperature for 2 min;
(11) centrifuging at 12000rpm for 2min, and storing at-20 ℃ for subsequent construction of the functional fusion vector.
Example 2 deliverable fragment fusion of branch function Gene regulates branching trait
1. Tomato and tobacco RNA extraction
In order to amplify the full-length sequence of the SlZFP2 gene, the RNA of tomato and tobacco leaves is extracted by a CTAB method, and the method comprises the following specific steps:
(1) CTAB is preheated at 65 ℃, and 20 mu L of beta-mercaptoethanol is added into each 1mL of CTAB;
(2) grinding a sample in liquid nitrogen, putting 0.5g of the sample into a 2mL RNA-free enzyme centrifuge tube, adding 1mL preheated CTAB, performing vortex oscillation for 30s, and performing 65 ℃ water bath for 10 min;
(3) add 1mL of CI (chloroform: isoamyl alcohol 24: 1) and vortex;
(4) placing in precooled 4 deg.C centrifuge at 13000rpm for 10 min;
(5) taking the supernatant, adding equal volume of CI, and gently mixing;
(6) 13000rpm for 10min in a 4 ℃ centrifuge;
(7) collecting supernatant, adding 2 times volume of isopropanol, and heating at-20 deg.C for more than 30 min;
(8) 13000rpm for 10min in a 4 ℃ centrifuge;
(9) discarding the supernatant, washing the precipitate with 1mL of 75% ethanol (prepared with DEPC water) for 2 times, and centrifuging at 4 deg.C for 5min at 13000 rpm;
(10) blowing dry the residual ethanol, adding 40 μ L DEPC water for dissolving, removing DNA with DNase I, and keeping the system as shown in the following table at 37 ℃ for 30 min;
(11) adding 550 μ L DEPC water and 600 μ L CI, reversing, mixing, and centrifuging at 4 deg.C for 10min at 13000 rpm;
(12) taking the supernatant, adding 2 times of volume of absolute ethyl alcohol, and keeping the temperature at-20 ℃ for 1 h;
(13) 13000rpm for 15min in a 4 ℃ centrifuge;
(14) discarding the supernatant, washing the precipitate with 1mL of 75% ethanol (prepared with DEPC water) for 2 times, and centrifuging at 4 deg.C for 5min at 13000 rpm;
(15) blow-drying the residual ethanol, adding 30 μ L DEPC water for dissolving, and storing at-80 deg.C for use.
2. Reverse transcription of RNA into cDNA
The extracted total RNA of the plant is reversely transcribed into cDNA by using a PrimeScript 1st Strand cDNA Synthesis Kit (Promega Bio), and the reaction system is as follows:
the mixture is applied on ice, gently pipetted and mixed, and placed into a PCR instrument at 70 ℃ for 10min and 4 ℃ for forever. Then adding the following reaction system:
operating on ice, gently sucking, mixing, placing into PCR instrument, storing at 42 deg.C for 1h, 70 deg.C for 10min, and-20 deg.C.
3. Full-length cloning of functional gene SlZFP2
Designing a primer to clone the full-length sequence of the tomato SlZFP2 gene, wherein the primer sequence is as follows:
the above primers were synthesized by Biotechnology Ltd.
The PCR system and procedure are shown in the following table:
2 XEs Taq MasterMix (Dye) was purchased from (Beijing Kang is a century Biotechnology Co., Ltd., CW0682S)
And (3) carrying out agarose gel electrophoresis detection on the PCR product, recovering a target size fragment by using an Axgen recovery kit, and connecting PMD19-T by using the reaction system as follows:
connecting for 2h at 16 ℃, transferring into E.coli DH5 alpha competent cells, picking a single clone the next day, sending the single clone to the Biotechnology Limited company for sequencing, shaking bacteria liquid with correct sequencing, and extracting plasmids by the method.
4. Construction of functional Gene delivery vector (shown in FIG. 1)
Respectively constructing functional genes SlZFP2 into pCAMBIA1305-tRNAMet、pCAMBIA1305-3×CTCT、pCAMBIA1305-3×(CTCT:tRNAMet) On a carrier. Designing primers, adding an enzyme cutting site to a recovery product of SlZFP2 through PCR amplification, wherein the primer sequences are as follows:
agarose gel electrophoresis detection and recovery, and pCAMBIA1305-tRNAMet、pCAMBIA1305-3×CTCT、pCAMBIA1305-3×(CTCT:tRNAMet) The vectors are respectively subjected to double enzyme digestion, are connected overnight at 16 ℃ by adopting T4 ligase, are transferred into E.coli DH5 alpha competent cells, and are picked up on the next day, and are shaken to extract plasmids, and the method is the same as the method.
5. Preparation of competent cell of Agrobacterium tumefaciens GV3101
(1) Streaking Agrobacterium on YEP + Rif solid medium, culturing at 28 deg.C for 2-3 d;
(2) selecting a single clone, inoculating the single clone into 5mL of liquid YEP + Rif culture medium, and carrying out shake culture at 28 ℃ and 200rpm for 12 h;
(3) collecting bacteria at 5000rpm for 5min, transferring into 50mL liquid YEP culture medium, shaking and culturing at 28 deg.C and 200rpm overnight to OD600The value is 0.6-0.8;
(4) collecting bacteria in a 50mL centrifuge tube at 5000rpm for 5min, and discarding the supernatant;
(5) resuspending the mycelia with 10mL of 0.15M NaCl solution, and standing on ice for 20 min;
(6) collecting bacteria at 4 deg.C and 5000rpm for 5min, and discarding supernatant;
(7) with 1mL of precooled 0.02Mol CaCl2Gently resuspending the solution;
(8) subpackaging into precooled 1.5mL centrifuge tubes, adding equal volume of glycerol into each tube at-80 ℃ for later use, wherein each tube contains 100 mu L of glycerol.
6. Agrobacterium competent cell transformation
(1) Respectively adding pCAMBIA1305-SlZFP2-tRNAMet、pCAMBIA1305-SlZFP2-3×CTCT、pCAMBIA1305-SlZFP2-3×(CTCT:tRNAMet) Adding 1-2 μ L of plasmid into 100 μ L of competent cells, and standing on ice for 30 min;
(2) placing competent cells with plasmid into liquid nitrogen for 1 min;
(3) placing in metal bath at 37 deg.C for 5 min;
(4) placing on ice for 2 min;
(5) adding 500 μ L of non-resistant YEP liquid culture medium, and performing shake culture at 28 deg.C and 160rpm for 4-6 h;
(6) collecting bacteria at 4000rpm, sucking 300 mu L of supernatant, resuspending the rest bacteria liquid, coating on YFP + Rif + Kan solid culture medium, and culturing overnight at 28 ℃;
7. tobacco transgenosis
(1) Taking tobacco leaves, and washing with running water for 2-3 h;
(2) rinsing with 75% ethanol for 30s in a super clean bench, and washing with sterilized water for 2 times;
(3) rinsing with 2% NaClO for 6min, and washing with sterilized water for 5-6 times;
(4) the leaves are cut into 0.5cm × 0.5cm square along the main vein, spread on a pre-culture medium, and cultured at 25 deg.C for 48 hr.
(5) Selecting positive clone of transformed Agrobacterium, inoculating in 5mL YEP liquid culture medium containing Rif and Kan, culturing at 28 deg.C 200rpm overnight to OD600＝0.6-0.8；
(6) Collecting bacteria at 6000rpm for 5min, discarding supernatant, resuspending with 50ml YEP liquid culture medium containing Rif and Kan, culturing at 28 deg.C and 200rpm for 3-4 hr to OD600＝0.6-0.8；
(7) Collecting bacteria at 6000rpm for 5min, discarding supernatant, resuspending with 30mL liquid MS culture medium, culturing at 28 deg.C and 200rpm for 3-4 h;
(8) placing the pre-cultured leaf in a bacterial liquid, slightly shaking for 1min, taking out, sucking redundant bacterial liquid in sterile filter paper, and placing the sterile filter paper back to the original pre-culture medium for dark culture at 25 ℃ for 48 h;
(9) transferring into a solid medium without bacteria, and continuing culturing under light;
(10) and cutting and inoculating the regenerated seedlings in a Cef-containing culture medium after the regenerated seedlings grow out.
8. Tobacco transgenic positive strain identification
Taking positive seedling leaves, and extracting DNA by a CTAB method, wherein the method comprises the following steps:
(1) grinding the leaves in liquid nitrogen, adding 700 μ L of CTAB extract containing 0.2% beta-mercaptoethanol preheated at 60 deg.C;
(2) about 30min at 65 ℃, 700 μ L chloroform: isoamyl alcohol 24:1, vortex for 15 s;
(3) centrifuging at room temperature of 13000rpm for 10min, and transferring the supernatant into a new centrifuge tube;
(4) adding isovolumetric isopropanol, mixing well, precipitating at-20 deg.C for more than 30 min;
(5) centrifuging at 13000rpm for 10min at room temperature, rinsing with 70% ethanol for 2 times, and air drying;
(6) add 30. mu.L of ddH2Dissolving O;
(7) identifying positive plants by using the specific transregional primers, extracting RNA from the positive plants, and identifying the RNA level positive plants by using the specific transregional primers. The primer sequences are as follows:
9. tomato/transgenic tobacco field grafting
Transplanting transgenic tobacco and tomato plants with the same growth size into soil, after the plants grow for 1 month, removing leaves at the top end of the stock by using an operation blade in a flat cutting mode, then longitudinally cutting the stock stem to form a downward 2-3cm cut, only keeping 1-2 leaves at the top end of the scion, cutting the bottom of the stem segment of the scion into a wedge shape by using an operation knife, inserting the wedge shape into the cut of the stock, tightly winding a grafting opening by using a sealing film, paying attention to moisture preservation and timely removing the sprout of the stock. And removing the sealing film in time after the grafting survives, and quickly freezing a sample in liquid nitrogen for subsequent RNA extraction after grafting for 1-2 months.
10. Transmission detection of functional gene in tomato/tobacco field grafting system
Grafting tomatoes and tobaccos in the field, healing grafting joints, removing a sealing film at the grafting joints when new leaves of the tomatoes grow out, continuously removing old leaves to enable the new leaves of the scions to grow (as shown in figure 2 (a)), sampling leaves and stem sections of the tomatoes and leaves and stem sections of the tobaccos about 1 month, grinding by using liquid nitrogen, extracting RNA (a plant total RNA extraction kit (Bomader biotechnology Co., Ltd)) and then carrying out reverse transcription to obtain cDNA, and verifying the transmission conditions of GAI (known transmissible gene is positive control) and ZFP2 genes by using an RT-PCR (reverse transcription-polymerase chain reaction) mode. The specific primer sequences of the genes in the tobacco and the tomato are as follows:
the results show that: tomato's own SlGAI and tobacco's NtGAI, but not NtZFP2 in tobacco, could be detected in tomato scion leaves and stems, while tobacco's own NtGAI and tomato SlGAI, but not SlZFP2 in tomato, could also be detected in tobacco rootstocks (as shown in fig. 2 (b)). Therefore, it is demonstrated that GAI gene can be transferred in two directions in tomato and tobacco grafting system, while ZFP2 functional gene can not be transferred in the grafting system.
11. Transit detection of mRNA and fusion gene transport vector between scions
Since it has been demonstrated previously by tomato/tobacco that the ZFP2 functional gene cannot be transferred over long distances, we used the SlZFP2 gene as a fusion expressed functional gene with the transferable tRNAMet、3×CTCT、3×(CTCT:tRNAMet) Carrying out fusion expression to construct mRNA transport vector to transform tobacco plants. Wild tomato is used as a scion to be grafted on a transgenic stock, after 2 weeks of grafting, the stem of the scion is sampled to extract RNA, transitive identification is carried out through nested PCR, and the primer sequences are as follows:
the results show that: SlZFP2 full-length non-transmission and SlZFP2 fusion tRNAMet、3×CTCT、3×(CTCT:tRNAMet) The fragments may then be delivered (as shown in fig. 1).
At the same time, 8 weeks after grafting, a rootstock stem, a grafting opening, a scion stem segment with different distances from the grafting opening, and tissues such as a stem tip, a branch stem, a branch leaf, flowers and the like are sampled (as shown in fig. 3 (a)), GU represents the grafting opening, ST represents the rootstock, and SC represents the scion; the transmissible distance of the fusion fragment and the plant part to which the fusion fragment is transferred are detected, and as a result, the following results are found: the fused fragment can be transferred to stem tips in long distance and stems 60cm away from the grafting opening in height, wherein the SlZFP2-tRNAMetAnd SlZFP2-3 × (CTCT: tRNA)Met) Can be delivered into the flower organ, while SlZFP2-3 × CTCT does not detect fused fragments in the flower organ (as shown in FIG. 3 (b)).
12. Phenotypic analysis of tomato scion branches regulated by transgenic tobacco rootstock
And (3) observing the branching condition of the tomato scions on the transgenic tobacco with different fusion fragments after grafting. The results show that SlZFP2-tRNAMet、SlZFP2-3×CTCT、SlZFP2-3×(CTCT:tRNAMet) The branch number of the tomato scion on the transgenic tobacco is obviously increased compared with that of the tomato scion on the SlZFP2 transgenic tobacco, and the branch number of the tomato scion on the SlZFP2-3 x (CTCT: tRNA)Met) The phenotype was most pronounced (as shown in FIG. 4, where asterisks indicate branching). The results show that the transferable fragment fuses the functional gene SlZFP2 of the non-transferable branch into the scion, and finally the functional protein is translated in the scion to increase the branches.
Example 3 deliverable fragment fusion early flower functional Gene regulates flowering phase trait (as shown in FIG. 6)
In earlier researches, SlZFP2 can regulate and control the flowering phase of tomatoes while regulating and controlling tomato branches, so that the flowering time of the grafting system is further counted.
The results show that: SlZFP2-tRNAMet、SlZFP2-3×CTCT、SlZFP2-3×(CTCT:tRNAMet) Compared with the control SlZFP2, the tomato scion taking the transgenic tobacco as the rootstock obviously flowers earlier, and SlZFP2-3 x (CTCT: tRNA)Met) The phenotype was most pronounced (as shown in figure 5). The above results indicate that the deliverable fragment is fused with non-deliverable fragmentThe transferred SlZFP2 early flowering functional gene is transferred into the scion, and finally translated into functional protein in the scion to lead the flowering phase to be advanced.
The above examples illustrate: tRNAMet、3×CTCT、3×(CTCT:tRNAMet) As a transmissible gene, a non-transmissible functional gene SlZFP2 can be carried to be transferred from a rootstock to a scion and finally translated into functional protein to play a role, wherein the SlZFP2-3 x (CTCT: tRNA)Met) The regulation and control function is most obvious, and the method can be used for carrying and researching more functional genes for regulating and controlling the color of the fruit peel, the size of the fruit, cold resistance, drought resistance and the like in the follow-up process, and finally achieves the purpose of regulating and controlling various characters of the scion only through rootstock genetic transformation.
Although the invention has been described in detail above with reference to a general description and specific embodiments, it will be apparent to those skilled in the art that modifications or improvements may be made on the basis of the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Those not described in detail in this specification are within the knowledge of those skilled in the art.
<110> university of agriculture in China
<120> rootstock improvement method and application
<130> 2020
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 84
<212> DNA
<213> Artificial sequence
<400> 1
gtcgacatca gagtggcgca gcggaagcgt ggtgggccca taacccacag gtcccaggat 60
cgaaacctgg ctctgatatc taga 84
<210> 2
<211> 446
<212> DNA
<213> Artificial sequence
<400> 2
gtcgaccttt tcttctgcat cttcttcttc agttggtgtg aatctttctc ttctttccga 60
ccgaagccaa actaaatcct actgtttttc cctttgtcac ttgttaacat cttatctttc 120
attatattgt tctctctctt ctgctccacc agctggcttt tcttctgcat cttcttcttc 180
agttggtgtg aatctttctc ttctttccga ccgaagccaa actaaatcct actgtttttc 240
cctttgtcac ttgttaacat cttatctttc attatattgt tctctctctt ctgctccacc 300
agctggcttt tcttctgcat cttcttcttc agttggtgtg aatctttctc ttctttccga 360
ccgaagccaa actaaatcct actgtttttc cctttgtcac ttgttaacat cttatctttc 420
attatattgt tctctctctt tctaga 446
<210> 3
<211> 630
<212> DNA
<213> Artificial sequence
<400> 3
gtcgaccttt tcttctgcat cttcttcttc agttggtgtg aatctttctc ttctttccga 60
ccgaagccaa actaaatcct actgtttttc cctttgtcac ttgttaacat cttatctttc 120
attatattgt tctctctctt atcagagtgg cgcagcggaa gcgtggtggg cccataaccc 180
acaggtccca ggatcgaaac ctggctctga tacttttctt ctgcatcttc ttcttcagtt 240
ggtgtgaatc tttctcttct ttccgaccga agccaaacta aatcctactg tttttccctt 300
tgtcacttgt taacatctta tctttcatta tattgttctc tctcttatca gagtggcgca 360
gcggaagcgt ggtgggccca taacccacag gtcccaggat cgaaacctgg ctctgatact 420
tttcttctgc atcttcttct tcagttggtg tgaatctttc tcttctttcc gaccgaagcc 480
aaactaaatc ctactgtttt tccctttgtc acttgttaac atcttatctt tcattatatt 540
gttctctctc ttatcagagt ggcgcagcgg aagcgtggtg ggcccataac ccacaggtcc 600
caggatcgaa acctggctct gatatctaga 630
<210> 4
<211> 492
<212> DNA
<213> Artificial sequence
<400> 4
atgagttatg aaccaaacac ggccttaaac ctaagtctat caagaaatga tcttttattt 60
gaccaatcat catcatcatc atcatcaacc cctttaagcc cggttgagcc acgtgttttt 120
tcttgcaatt attgtagaag aaagttttat agttcacaag ctctaggagg acaccagaat 180
gctcataaac tcgaaagaac cctagccaag aagagtaggg agttgagttc aaccctacgc 240
gggcctcatt ctagttggtc aaatcatagt aatagtaata ataatagtaa tagtaataat 300
cattgctcgt tgagccctag tggtccgagc catactagtc atggtcatgg tcatggtgct 360
aggtttgtta caaataatga tttaataagc tatggaagaa gagagatgat gatgagttat 420
gaatcaatga aaaatggtca tgagagtgtt caagaggatt ttggacatct tgatttgtca 480
ttaaggcttt aa 492