Inhibition of cytokine release syndrome in chimeric antigen receptor cell therapy
阅读说明：本技术 嵌合抗原受体细胞疗法中细胞因子释放综合征的抑制 (Inhibition of cytokine release syndrome in chimeric antigen receptor cell therapy ) 是由 M·库珀 J·F·迪珀西奥 A·卡特 于 2019-05-31 设计创作，主要内容包括：本文公开了对由携带嵌合抗原受体(CAR)的免疫效应细胞诸如CAR-T细胞分泌的细胞因子/趋化因子/转录因子进行基因编辑或内源性抑制以用于减轻细胞因子释放综合征和/或CAR-T相关神经病的方法。这些方法包括将所述CAR插入细胞因子基因的基因座中,从而阻断其表达。本文还公开了具有插入细胞因子的基因座中的CAR的携带(CAR)的免疫效应细胞,以及使用免疫疗法以降低的细胞因子释放综合征和/或CAR-T相关神经病发病率治疗疾病的方法。(Disclosed herein are methods of gene editing or endogenous inhibition of cytokines/chemokines/transcription factors secreted by Chimeric Antigen Receptor (CAR) -bearing immune effector cells, such as CAR-T cells, for use in alleviating cytokine release syndrome and/or CAR-T related neuropathies. These methods comprise inserting the CAR into the cytokine gene locus, thereby blocking its expression. Also disclosed herein are CAR-bearing immune effector cells having a CAR inserted into a cytokine locus, and methods of treating diseases with reduced cytokine release syndrome and/or CAR-T related neuropathy incidence using immunotherapy.)
1. An immune effector cell bearing a Chimeric Antigen Receptor (CAR) that lacks a cytokine or chemokine or transcription factor involved in cytokine release syndrome.
2. The cell of claim 1, wherein the cytokine or chemokine or transcription factor deficiency is achieved by deletion or inhibition of a gene encoding the cytokine or chemokine or transcription factor.
3. The cell of claim 2, wherein the deletion or inhibition is achieved by inserting the CAR into the locus of the cytokine or chemokine or transcription factor gene.
4. The cell of claim 3, wherein the CAR is part of a construct that further comprises a selectable marker.
5. The cell of claim 4, wherein the selectable marker comprises a Green Fluorescence (GFP) gene, a YFP gene, a tCD34 gene, or a tEGFR gene.
6. The cell of claim 1, wherein said cytokine or chemokine or transcription factor deficiency is achieved by deletion or inhibition of said cytokine or chemokine gene with a transcription activator-like effector nuclease (TALEN), Zinc Finger Nuclease (ZFN), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edit.
7. The cell of claim 1, wherein deletion or inhibition is achieved using CRISPR.
8. The cell of claim 1, wherein deletion or inhibition is achieved using Cas 9-CRISPR.
9. The cell of claim 8, wherein the Cas9 is delivered into the cell as an mRNA or protein.
10. The cell of claim 8, wherein the Cas9 is delivered into the cell as mRNA.
11. The cell of claim 8, wherein the Cas9 is delivered into the cell as a protein.
12. The cell of any one of claims 6-11, wherein a guide rna (grna) targeting the gene to be deleted or inhibited is delivered simultaneously with the Cas 9.
13. The cell of any one of claims 9-12, wherein the delivery is by electroporation.
14. The cell of claim 1, wherein the cytokine or chemokine or transcription factor deficiency is achieved by inhibiting the cytokine or chemokine or transcription factor gene transcript by transfecting one or more types of small interfering RNA (siRNA).
15. The cell of claim 1, wherein the cytokine or chemokine or transcription factor deficiency is achieved by inhibiting the cytokine or chemokine or transcription factor gene transcript by transducing one or more types of short hairpin rnas (shrnas).
16. A Chimeric Antigen Receptor (CAR) -bearing immune effector cell expressing at least one CAR, wherein:
the at least one CAR is inserted into the locus of a cytokine or chemokine or transcription factor gene;
deletion or repression of said cytokine or chemokine or transcription factor gene by a method selected from the group consisting of transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits;
inhibiting said cytokine or chemokine or transcription factor by expressing a scFv with an Endoplasmic Reticulum (ER) binding tether to bind to said cytokine or chemokine in the ER and prevent secretion;
inhibition of the cytokine or chemokine or transcription factor gene transcript by transfection of small interfering rna (sirna); or
-inhibition of the cytokine or chemokine or transcription factor gene transcript by transduction with short hairpin rna (shrna).
17. The cell of any one of claims 1-15, wherein the cell is selected from chimeric antigen receptor T cells (CAR-T), iNKT cells carrying CARs (iNKT-CAR), and Natural Killer (NK) cells carrying CARs (NK-CAR), or macrophages carrying CARs.
18. The cell of claim 17, wherein the cell is CAR-T.
19. The cell of claim 18, wherein the cell is a bi-or tandem CAR-T.
20. The cell of claim 17, wherein the cell is an iNKT-CAR.
21. The cell of claim 20, wherein the cell is a bi-or tandem iNKT-CAR.
22. The cell of claim 17, wherein the cell is a CAR-macrophage.
23. The cell of claim 22, wherein the cell is a bi-or tandem CAR-macrophage.
24. The cell of any one of claims 1-23, wherein the cytokine or chemokine or transcription factor promotes the development of cytokine release syndrome.
25. The cell of claim 1, wherein the cytokine or chemokine or transcription factor is selected from those described in table 10.
26. The cell of claim 25, wherein the cytokine or chemokine or transcription factor is produced by a T cell that activates or localizes a myeloid cell.
27. The cell of claim 25, wherein the cytokine or chemokine or transcription factor is a T cell surface receptor gene that activates myeloid cells or CAR-T cells.
28. The cell of claim 2, wherein the gene deleted or inhibited is a T cell surface receptor integrated into CAR-T cell signaling.
29. The cell of claim 1, wherein the cytokine or chemokine or transcription factor drives T cell/CAR-T cell differentiation.
30. The cell of claim 1, wherein the cytokine or chemokine is a transcription factor that drives T cell/CAR-T cell differentiation.
31. The cell of claim 1, wherein the cytokine or chemokine or transcription factor is selected from the group consisting of MCP1(CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, Il-4, and IFN γ.
32. The cell of claim 31, wherein the cytokine or chemokine or transcription factor is GM-CSF.
33. The cell of claim 32, wherein the cell is a CAR-T cell lacking GM-CSF.
34. The cell of claim 32, wherein the cell is an iNKT-CAR cell lacking GM-CSF.
35. The cell of claim 1, wherein the immune effector cell to be used is harvested from a healthy donor.
36. The cell of claim 35, wherein the donor is a human.
37. The cell of claim 1, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on a malignant cell.
38. The cell of claim 37, wherein the one or more antigens expressed on malignant cells are selected from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56, and CD1 a.
39. The cell of any one of claims 1-38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on malignant T cells.
40. The cell of claim 39, wherein the antigen is selected from the group consisting of CD2, CD3 epsilon, CD4, CD5, CD7, TCRA, and TCR beta.
41. The cell of any one of claims 1-38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on malignant B cells.
42. The cell of claim 41, wherein the antigen is selected from the group consisting of CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD38, and CD 45.
43. The cell of claim 42, wherein the antigen is selected from the group consisting of CD19 and CD 20.
44. The cell of any one of claims 1-38, wherein said chimeric antigen receptor specifically binds at least one antigen expressed on malignant mesothelial cells.
45. The cell of claim 44, wherein the antigen is mesothelin.
46. The cell of any one of claims 1-38, wherein the chimeric antigen receptor specifically binds at least one antigen expressed on malignant plasma cells.
47. The cell of claim 46, wherein the antigen is selected from BCMA, CS1, CD38, and CD 19.
48. The cell of claim 37, wherein the chimeric antigen receptor expresses an extracellular portion of an APRIL protein that is a ligand for BCMA and TACI that is effective to co-target BCMA and TACI.
49. The cell of any one of claims 1-48, wherein the CAR-T cell further comprises a suicide gene.
50. The cell of any one of claims 1-49, wherein endogenous T cell receptor-mediated signaling is negligible in said cell.
51. The cell of claim 50, wherein the cell does not induce alloreactivity or graft-versus-host disease.
52. The cell of any one of claims 1-51, wherein the cell does not cause suicide.
53. A method of treating cancer in a patient with reduced cytokine release syndrome and/or incidence of CAR-T associated neuropathy comprising administering the cell of any of claims 1-52.
54. The method of claim 53, wherein the cancer is a hematologic malignancy.
55. The method of claim 54, wherein the hematologic malignancy is a T cell malignancy.
56. The method of claim 55, wherein the T cell malignancy is T cell acute lymphoblastic leukemia (T-ALL).
57. The method of claim 55, wherein the T cell malignancy is non-Hodgkin's lymphoma.
58. The method of claim 54, wherein the hematological malignancy is multiple myeloma.
59. The method of claim 54, wherein the hematologic malignancy is AML.
60. The method of claim 53, wherein the cancer is a solid tumor.
61. The method of claim 60, wherein the cancer is cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
62. A method of preventing or reducing cytokine release syndrome or CAR-T related neuropathy in a patient receiving chimeric antigen receptor T cell (CAR-T), an iNKT cell carrying a CAR (iNKT-CAR), a natural killer (NK-CAR) cell carrying a CAR, or a macrophage carrying a CAR (CAR-macrophage) immunotherapy comprising administering the cell of any one of claims 1-52 as immunotherapy.
63. The method of claim 62, wherein the patient is being treated for cancer.
64. The method of claim 63, wherein the cancer is a hematologic malignancy.
65. The method of claim 64, wherein the hematologic malignancy is a T cell malignancy.
66. The method of claim 65, wherein the T cell malignancy is T cell acute lymphoblastic leukemia (T-ALL).
67. The method of claim 65, wherein the T cell malignancy is non-Hodgkin's lymphoma.
68. The method of claim 64, wherein the hematological malignancy is multiple myeloma.
69. The method of claim 64, wherein the hematologic malignancy is AML.
70. The method of claim 62, wherein the cancer is a solid tumor.
71. The method of claim 70, wherein the cancer is cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
72. A method of blocking expression of a cytokine or chemokine or transcription factor gene in a chimeric antigen receptor T cell (CAR-T), an iNKT cell carrying a CAR (iNKT-CAR), a Natural Killer (NK) cell carrying a CAR (NK-CAR), or a macrophage carrying a CAR (CAR-macrophage), comprising inserting a CAR into the locus of the cytokine or chemokine or transcription factor gene.
73. The method of claim 72, wherein blocking expression of the cytokine or chemokine or transcription factor gene does not reduce CAR-T cell mediated killing.
74. A method of making a CAR-T (immune effector) cell that does not cause or promote CRS or CAR-T related neuropathy (CAN), comprising deleting or inhibiting a cytokine or chemokine or transcription factor gene.
75. The method of claim 74, wherein deleting or inhibiting the cytokine or chemokine or transcription factor gene does not reduce CAR-T cell mediated killing.
76. The cell of claim 74, wherein the deletion or inhibition is achieved by inserting the CAR into a locus of the cytokine or chemokine or transcription factor gene.
77. The method of claim 74, wherein the CAR is part of a construct that further comprises a selectable marker.
78. The method of claim 78, wherein the selectable marker comprises a Green Fluorescence (GFP) gene, a YFP gene, a tCD34 gene, or a tEGFR gene.
79. The method of claim 74, wherein inserting a CAR with a selectable marker into the cytokine or chemokine or transcription factor gene allows for one-step purification of TCR-negative cells.
80. The method of claim 74, wherein inserting a CAR with a selectable marker into the cytokine or chemokine or transcription factor gene allows for one-step purification of CAR + cytokine negative cells.
81. The method of claim 74, wherein the deletion or inhibition is achieved using transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits.
82. The method of claim 74, wherein said deletion or inhibition is effected using CRISPR.
83. The method of claim 74, wherein said deletion or inhibition is effected using Cas 9-CRISPR.
84. The method of claim 83, wherein the Cas9 is delivered into the cell as an mRNA or a protein.
85. The method of claim 83, wherein the Cas9 is delivered into the cell as mRNA.
86. The method of claim 83, wherein the Cas9 is delivered into the cell as a protein.
87. The method of claim 74, wherein a guide RNA (gRNA) targeting the gene to be deleted or inhibited is delivered simultaneously with the Cas 9.
88. The method of claim 74, wherein the delivering is by electroporation.
89. The method of claim 74, wherein said deletion or inhibition is effected by transducing one or more types of short hairpin RNAs (shRNAs) to inhibit said cytokine or chemokine or transcription factor gene transcript.
90. The method of claim 74, wherein said deletion or inhibition is effected by transducing a construct encoding a blocker of Protein Expression (PEBL).
91. The method of claim 90, wherein the construct encodes an antibody-derived single chain variable fragment specific for the cytokine, chemokine or TF gene.
92. The method of any of claims 53-91, wherein the deletion of the cytokine, chemokine, or transcription factor gene does not reduce CAR-T mediated killing.
93. The method of claim 74, wherein the CAR to be inserted comprises a donor template.
94. The method of claim 93, wherein donor template comprises adeno-associated virus (AAV), single-stranded DNA, or double-stranded DNA.
Drawings
Figure 1-shows the concept of inserting a CAR into the gene of a cytokine to block its translation, thereby deleting it or reducing its levels, thereby preventing or reducing the cytokine release syndrome and/or immune effector cell-related neuropathy that carries the CAR (CAR-T related neuropathy).
Figure 2-time line showing a method of treating a hematologic malignancy using CAR-T cells disclosed herein. Those skilled in the art will appreciate that there may be some flexibility in the time frame shown.
Figure 3-shows AAV donor constructs used to insert CD34 into the GM-CSF locus.
Figure 4-shows the WC40 plasmid vector used to insert GFP into the CD3 epsilon locus.
Figure 5-shows AAV donor constructs used to insert GFP into the CD3 epsilon locus.
Figure 6-shows CAR19-GM-CSF PEBL-trCD34 construct.
Figure 7-shows IL-6 expression in GM-CSF knock-out, wild type and control T cells, iDC cells, T cells + iDC, T cells + beads and iDC + beads + T cells at 24 hours.
Figure 8-shows IL-6 expression in CAR19 GM-CSF knock-out, CAR19, and control CAR19, iDC only, MQ activated only, MC only, RAMOS only, CAR19+ iDC, CAR19+ activated MQ, CAR19+ MQ, CAR19+ RAMOS, iDC + RAMOS + CAR-T, activated MQ + RAMOS + CAR-T, and MQ + RAMOS + CAR-T at 24 hours.
Figure 9-shows IL-6 expression in GM-CSF knock-out, wild type and control T cells, iDC cells, T cells + iDC, T cells + beads and iDC + beads + T cells at 48 hours.
Figure 10-shows IL-6 expression in CAR19 GM-CSF knock-out, CAR19, and control CAR19, iDC only, MQ activated only, MC only, RAMOS only, CAR19+ iDC, CAR19+ activated MQ, CAR19+ MQ, CAR19+ RAMOS, iDC + RAMOS + CAR-T, activated MQ + RAMOS + CAR-T, and MQ + RAMOS + CAR-T at 48 hours.
Figure 11-shows the setup of ELISA plates for detection of specific markers for CAR-T cells.
Figure 12a and figure 12 b-shows the results of an ELISA assay to detect specific markers for CAR-T cells. Fig. 12a shows the upper half of the ELISA plate and fig. 12b shows the lower half of the plate. In each of rows A-H, from top to bottom, the subrows represent [450] test, [540] reference, optical path, 450, 540, correction [450] and correction [540 ].
Detailed Description
Thus, disclosed herein as embodiment 1 is an immune effector cell bearing a Chimeric Antigen Receptor (CAR) that lacks cytokines or chemokines or transcription factors involved in cytokine release syndrome.
The following disclosure will detail embodiments, alternatives and uses of cytokine-deficient cells, and the use of such cells in the treatment of diseases, such as immunotherapy and adoptive cell transfer. Accordingly, the following additional embodiments are provided herein.
Embodiment 2-the cell of embodiment 1, wherein said cytokine or chemokine or transcription factor deficiency is achieved by deletion or inhibition of a gene encoding said cytokine or chemokine or transcription factor.
Embodiment 3-the cell of any of embodiments 1 or 2, wherein said deletion or inhibition is effected by inserting said CAR into the locus of said cytokine or chemokine or transcription factor gene.
Embodiment 4-the cell of any of embodiments 1-3, wherein the CAR is part of a construct that further comprises a selectable marker.
Embodiment 5-the cell of any one of embodiments 1 to 4, wherein the selectable marker comprises a Green Fluorescence (GFP) gene, a Yellow Fluorescence (YFP) gene, a truncated CD34(tCD34) gene, or a truncated egfr (tfegfr) gene.
Embodiment 6-the cell of any one of embodiments 1 to 5, wherein the cytokine or chemokine or transcription factor deficiency is achieved by deletion or suppression of the cytokine or chemokine gene with a transcription activator-like effector nuclease (TALEN), Zinc Finger Nuclease (ZFN), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits.
Embodiment 7-the cell of any one of embodiments 1 to 6, wherein the deletion or inhibition is effected using CRISPR.
Embodiment 8-the cell of any one of embodiments 1 to 7, wherein the deletion or inhibition is effected using Cas 9-CRISPR.
Embodiment 9-the cell of any one of embodiments 1 to 8, wherein the Cas9 is delivered into the cell as mRNA or protein.
Embodiment 10-the cell of any one of embodiments 1 to 9, wherein the Cas9 is delivered into the cell as mRNA.
Embodiment 11-the cell of any one of embodiments 1 to 10, wherein the Cas9 is delivered into the cell as a protein.
Embodiment 12-the cell of any one of embodiments 1 to 11, wherein a guide rna (grna) targeting the gene to be deleted or inhibited is delivered simultaneously with the Cas 9.
Embodiment 13-the cell of any one of embodiments 1 to 12, wherein the delivery is by electroporation.
Embodiment 14-the cell of any one of embodiments 1 to 13, wherein the cytokine or chemokine or transcription factor deficiency is achieved by transfection with one or more types of small interfering rna (sirna) to inhibit the cytokine or chemokine or transcription factor gene transcript.
Embodiment 15-the cell of any one of embodiments 1 to 14, wherein the cytokine or chemokine or transcription factor deficiency is achieved by inhibiting the cytokine or chemokine or transcription factor gene transcript by transducing one or more types of short hairpin rna (shrna).
Embodiment 16-a Chimeric Antigen Receptor (CAR) -bearing immune effector cell expressing at least one CAR, wherein:
the at least one CAR is inserted into the locus of a cytokine or chemokine or transcription factor gene;
deleting or inhibiting the cytokine or chemokine or transcription factor gene by a method selected from the group consisting of transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs), and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits;
inhibiting the cytokine or chemokine or transcription factor by expressing a scFv with an Endoplasmic Reticulum (ER) binding tether to bind to the cytokine or chemokine in the ER and prevent secretion;
inhibiting the cytokine or chemokine or transcription factor gene transcript by transfection of small interfering rna (sirna); or
The cytokine or chemokine or transcription factor gene transcript is inhibited by transduction of short hairpin rna (shrna).
Embodiment 17-the cell of any one of embodiments 1 to 16, wherein the cell is selected from a chimeric antigen receptor T cell (CAR-T), an iNKT cell carrying a CAR (iNKT-CAR), and a Natural Killer (NK) cell carrying a CAR (NK-CAR), or a macrophage carrying a CAR.
Embodiment 18-the cell of any one of embodiments 1 to 17, wherein the cell is CAR-T.
Embodiment 19-the cell of any one of embodiments 1 to 18, wherein the cell is a bi-or tandem CAR-T.
Embodiment 20-the cell of any one of embodiments 1-17, wherein the cell is an iNKT-CAR.
Embodiment 21-the cell of any one of embodiments 1-20, wherein the cell is a bi-or tandem iNKT-CAR.
Embodiment 22-the cell of any one of embodiments 1 to 17, wherein the cell is a CAR-macrophage.
Embodiment 23-the cell of any one of embodiments 1 to 22, wherein the cell is a bi-or tandem CAR-macrophage.
Embodiment 24-the cell of any one of embodiments 1 to 23, wherein the cytokine or chemokine or transcription factor promotes the development of cytokine release syndrome.
Embodiment 25-the cell of any one of embodiments 1 to 24, wherein the cytokine or chemokine or transcription factor is selected from those described in table 10.
Embodiment 26-the cell of any one of embodiments 1 to 25, wherein the cytokine or chemokine or transcription factor is produced by a T cell that activates or localizes a myeloid cell.
Embodiment 27-the cell of any one of embodiments 1 to 26, wherein the cytokine or chemokine or transcription factor is a T cell surface receptor gene that activates myeloid cells or CAR-T cells.
Embodiment 28-the cell of any one of embodiments 1-27, wherein the gene deleted or inhibited is a T cell surface receptor integrated into CAR-T cell signaling.
Embodiment 29-the cell of any one of embodiments 1 to 28, wherein the cytokine or chemokine or transcription factor drives T cell/CAR-T cell differentiation.
Embodiment 30-the cell of any one of embodiments 1 to 29, wherein the cytokine or chemokine is a transcription factor that drives T cell/CAR-T cell differentiation.
Embodiment 31-the cell of any one of embodiments 1 to 30, wherein the cytokine or chemokine or transcription factor is selected from MCP1(CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, Il-4, and IFN γ.
Embodiment 32-the cell of any one of embodiments 1 to 31, wherein the cytokine or chemokine or transcription factor is GM-CSF.
Embodiment 33-the cell of any one of embodiments 1 to 32, wherein the cell is a CAR-T cell lacking GM-CSF.
Embodiment 34-the cell of any one of embodiments 1 to 33, wherein the cell is an iNKT-CAR cell lacking GM-CSF.
Embodiment 35-the cell of any one of embodiments 1 to 34, wherein the immune effector cell to be used is harvested from a healthy donor.
Embodiment 36-the cell of any one of embodiments 1 to 35, wherein the donor is a human.
Embodiment 37-the cell of any one of embodiments 1 to 36, wherein the chimeric antigen receptor specifically binds to at least one antigen expressed on a malignant cell.
Embodiment 38-the cell of any one of embodiments 1 to 37, wherein the one or more antigens expressed on malignant cells are selected from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56, and CD1 a.
Embodiment 39-the cell of any one of embodiments 1-38, wherein the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant T cells.
Embodiment 40-the cell of any one of embodiments 1 to 39, wherein the antigen is selected from the group consisting of CD2, CD3 epsilon, CD4, CD5, CD7, TCRA, and TCR beta.
Embodiment 41-the cell of any one of embodiments 1-38, wherein the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant B cells.
Embodiment 42-the cell of any one of embodiments 1 to 41, wherein the antigen is selected from the group consisting of CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD38, and CD 45.
Embodiment 43-the cell of any one of embodiments 1 to 42, wherein the antigen is selected from the group consisting of CD19 and CD 20.
Embodiment 44-the cell of any one of embodiments 1 to 38, wherein the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant mesothelial cells.
Embodiment 45-the cell of any one of embodiments 1 to 44, wherein the antigen is mesothelin.
Embodiment 46-the cell of any one of embodiments 1-38, wherein the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant plasma cells.
Embodiment 47-the cell of any one of embodiments 1 to 46, wherein the antigen is selected from BCMA, CS1, CD38, and CD 19.
Embodiment 48-the cell of any one of embodiments 1 to 47, wherein the chimeric antigen receptor expresses an extracellular portion of an APRIL protein that is a ligand for BCMA and TACI that effectively co-targets BCMA and TACI.
Embodiment 49-the cell of any one of embodiments 1 to 48, wherein the CAR-T cell further comprises a suicide gene.
Embodiment 50-the cell of any one of embodiments 1 to 49, wherein endogenous T cell receptor mediated signaling is negligible in the cell.
Embodiment 51-the cell of any one of embodiments 1 to 50, wherein the cell does not induce alloreactivity or graft-versus-host disease.
Embodiment 52-the cell of any one of embodiments 1 to 51, wherein the cell does not cause suicide (fratricide).
Embodiment 53-a method of treating cancer in a patient with reduced cytokine release syndrome and/or incidence of CAR-T related neuropathy comprising administering the cell of any of embodiments 1 to 52.
Embodiment 54-the method of embodiment 53, wherein the cancer is a hematologic malignancy.
Embodiment 55-the method of any one of embodiments 53-54, wherein the hematologic malignancy is a T cell malignancy.
Embodiment 56-the method of any one of embodiments 53-55, wherein the T cell malignancy is T cell acute lymphoblastic leukemia (T-ALL).
Embodiment 57-the method of any one of embodiments 53 to 56, wherein the T cell malignancy is non-hodgkin's lymphoma.
Embodiment 58-the method of any one of embodiments 53-57, wherein the hematological malignancy is multiple myeloma.
Embodiment 59-the method of any one of embodiments 53-58, wherein the hematological malignancy is AML.
Embodiment 60-the method of any one of embodiments 53 to 59, wherein the cancer is a solid tumor.
Embodiment 61-the method of any one of embodiments 53 to 60, wherein the cancer is cervical, pancreatic, ovarian, mesothelioma, and lung cancer.
Embodiment 62-a method of preventing or reducing cytokine release syndrome or CAR-T related neuropathy in a patient receiving chimeric antigen receptor T-cells (CAR-T), iNKT cells carrying a CAR (iNKT-CAR), Natural Killer (NK) cells carrying a CAR (NK-CAR), or macrophages carrying a CAR (CAR-macrophages) immunotherapy comprising administering the cells of any one of embodiments 53 to 61 as immunotherapy.
Embodiment 63-the method of any one of embodiments 53 to 62, wherein the patient is being treated for cancer.
Embodiment 64-the method of any one of embodiments 53-63, wherein the cancer is a hematologic malignancy.
Embodiment 65-the method of any one of embodiments 53 to 64, wherein the hematologic malignancy is a T cell malignancy.
Embodiment 66-the method of any one of embodiments 53-65, wherein the T cell malignancy is T cell acute lymphoblastic leukemia (T-ALL).
Embodiment 67-the method of any one of embodiments 53-66, wherein the T cell malignancy is non-hodgkin's lymphoma.
Embodiment 68-the method of any one of embodiments 53 to 67, wherein the hematological malignancy is multiple myeloma.
Embodiment 69-the method of any one of embodiments 53-68, wherein the hematological malignancy is AML.
Embodiment 70-the method of any one of embodiments 53-69, wherein the cancer is a solid tumor.
Embodiment 71-the method of any one of embodiments 53 to 70, wherein the cancer is cervical, pancreatic, ovarian, mesothelioma, and lung cancer.
Embodiment 72-a method of blocking expression of a cytokine or chemokine or transcription factor gene in a chimeric antigen receptor T cell (CAR-T), an iNKT cell carrying a CAR (iNKT-CAR), a Natural Killer (NK) cell carrying a CAR (NK-CAR), or a macrophage carrying a CAR (CAR-macrophage), comprising inserting a CAR into the locus of the cytokine or chemokine or transcription factor gene.
Embodiment 73-the method of any one of embodiments 53 to 72, wherein blocking the expression of the cytokine or chemokine or transcription factor gene does not reduce CAR-T cell mediated killing.
Embodiment 74-a method of making a CAR-T (immune effector) cell that does not cause or promote CRS or CAR-T related neuropathy (CAN), comprising deleting or inhibiting a cytokine or chemokine or transcription factor gene.
Embodiment 75-the method of any one of embodiments 53 to 74, wherein deleting or inhibiting the cytokine or chemokine or transcription factor gene does not reduce CAR-T cell mediated killing.
Embodiment 76-the method of any of embodiments 53-75, wherein said deletion or inhibition is effected by inserting said CAR into the locus of said cytokine or chemokine or transcription factor gene.
Embodiment 77-the method of any one of embodiments 53-76, wherein the CAR is part of a construct that further comprises a selectable marker.
Embodiment 78-the method of any one of embodiments 53 to 77, wherein the selectable marker comprises a Green Fluorescence (GFP) gene, a YFP gene, a tCD34 gene, or a tfegfr gene.
Embodiment 79-the method of any of embodiments 53-78, wherein insertion of the CAR with the selectable marker into the cytokine or chemokine or transcription factor gene allows for one-step purification of TCR-negative cells.
Embodiment 80-the method of any of embodiments 53-79, wherein insertion of a CAR with a selectable marker into the cytokine or chemokine or transcription factor gene allows for one-step purification of CAR + cytokine-negative cells.
Embodiment 81-the method of any one of embodiments 53 to 80, wherein said deletion or inhibition is effected using transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits.
Embodiment 82-the method of any one of embodiments 53 to 81, wherein said deletion or inhibition is effected using CRISPR.
Embodiment 83-the method of any one of embodiments 53 to 82, wherein said deletion or inhibition is effected using Cas 9-CRISPR.
Embodiment 84-the method of any one of embodiments 53-83, wherein the Cas9 is delivered into the cell as an mRNA or protein.
Embodiment 85-the method of any one of embodiments 53-84, wherein the Cas9 is delivered into the cell as mRNA.
Embodiment 86-the method of any one of embodiments 53-85, wherein the Cas9 is delivered into the cell as a protein.
Embodiment 87-the method of any one of embodiments 53-86, wherein a guide rna (grna) targeting the gene to be deleted or inhibited is delivered simultaneously with the Cas 9.
Embodiment 88-the method of any one of embodiments 53 to 87, wherein said delivering is by electroporation.
Embodiment 89-the method of any one of embodiments 53 to 88, wherein said deletion or inhibition is effected by transducing one or more types of short hairpin rnas (shrnas) to inhibit said cytokine or chemokine or transcription factor gene transcript.
Embodiment 90-the method of any one of embodiments 531 to 89, wherein said deletion or inhibition is effected by transducing a construct encoding a Protein Expression Blocker (PEBL).
Embodiment 91-the method of any one of embodiments 53 to 90, wherein the construct encodes an antibody-derived single chain variable fragment specific for the cytokine, chemokine or TF gene.
Embodiment 92-the method of any one of embodiments 53 to 91, wherein the deletion of the cytokine, chemokine, or transcription factor gene does not reduce CAR-T mediated killing.
Embodiment 93-the method of any one of embodiments 53 to 92, wherein the CAR to be inserted comprises a donor template.
Embodiment 94-the method of any one of embodiments 53 to 93, wherein the donor template comprises adeno-associated virus (AAV), single-stranded DNA, or double-stranded DNA.
Disclosed herein is an immune effector cell bearing a Chimeric Antigen Receptor (CAR) that lacks a cytokine.
In certain embodiments, cytokine deficiency is achieved by ablation of a cytokine gene or a chemokine gene or a transcription factor gene.
In certain embodiments, ablation is achieved by inserting the CAR into the locus of a cytokine/chemokine/transcription factor gene.
In certain embodiments, the CAR is part of a construct that further comprises a selectable marker.
In certain embodiments, cytokine deficiency is achieved by deleting or inhibiting the cytokine/chemokine/transcription factor gene with transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits.
In certain embodiments, cytokine deficiency is achieved by transfection of small interfering rna (sirna) to inhibit cytokine/chemokine/transcription factor gene transcripts.
Also disclosed herein is a Chimeric Antigen Receptor (CAR) -bearing immune effector cell that expresses at least one CAR, wherein:
insertion of at least one CAR into the locus of a cytokine/chemokine/transcription factor gene;
deletion or suppression of cytokine/chemokine/transcription factor genes by a method selected from the group consisting of transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) edits;
inhibition of cytokines by expression of scFv with an Endoplasmic Reticulum (ER) binding tether to bind to cytokines in the ER and prevent secretion; or
Inhibition of cytokine/chemokine/transcription factor gene transcripts by small interfering rna (sirna) transfection.
In certain embodiments, the cell is selected from a chimeric antigen receptor T cell (CAR-T), an iNKT cell carrying a CAR (iNKT-CAR), and a Natural Killer (NK) cell carrying a CAR (NK-CAR).
In certain embodiments, the cell is CAR-T.
In certain embodiments, the cell is a bi-or tandem CAR-T.
In certain embodiments, the cell is an iNKT-CAR.
In certain embodiments, the cell is a bi-or tandem iNKT-CAR.
In certain embodiments, the cytokine promotes the development of cytokine release syndrome.
In certain embodiments, the cytokine is selected from the group consisting of MCP1(CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, IL-4, and IFN γ.
In certain embodiments, the cytokine is GM-CSF.
In certain embodiments, the cell is a CAR-T cell lacking GM-CSF.
In certain embodiments, the cell is an iNKT-CAR cell that lacks GM-CSF.
In certain embodiments, the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant T cells.
In certain embodiments, the antigen is selected from the group consisting of CD2, CD3 epsilon, CD4, CD5, CD7, TCRA, and TCR beta.
In certain embodiments, the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant B cells.
In certain embodiments, the antigen is selected from CD19 and CD 20.
In certain embodiments, the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant mesothelial cells.
In certain embodiments, the antigen is mesothelin.
In certain embodiments, the chimeric antigen receptor specifically binds to at least one antigen expressed on malignant plasma cells.
In certain embodiments, the antigen is selected from BCMA, CS1, CD38, and CD 19.
In certain embodiments, the chimeric antigen receptor expresses the extracellular portion of an APRIL protein that is a ligand for BCMA and TACI that effectively co-targets BCMA and TACI.
In certain embodiments, the CAR-T cell further comprises a suicide gene.
In certain embodiments, endogenous T cell receptor-mediated signaling is negligible in the cell.
In certain embodiments, the cells do not induce alloreactivity or graft-versus-host disease.
In certain embodiments, the cell does not cause suicide.
Also disclosed herein is a method of treating cancer in a patient with reduced cytokine release syndrome and/or incidence of CAR-T related neuropathy comprising administering an immune effector cell bearing a Chimeric Antigen Receptor (CAR) as disclosed herein.
In certain embodiments, the cancer is a hematologic malignancy.
In certain embodiments, the hematologic malignancy is a T cell malignancy.
In certain embodiments, the T cell malignancy is T cell acute lymphoblastic leukemia (T-ALL).
In certain embodiments, the T cell malignancy is non-hodgkin's lymphoma.
In certain embodiments, the hematological malignancy is multiple myeloma.
In certain embodiments, the cancer is a solid tumor.
In certain embodiments, the cancer is cervical cancer, pancreatic cancer, ovarian cancer, mesothelioma, and lung cancer.
Also disclosed herein is a method of preventing or reducing cytokine release syndrome, CAR-T related neuropathy in a patient receiving chimeric antigen receptor T cell (CAR-T), iNKT cell carrying CAR (iNKT-CAR), or Natural Killer (NK) cell carrying CAR (NK-CAR) immunotherapy comprising administering as immunotherapy an immune effector cell carrying a Chimeric Antigen Receptor (CAR) as disclosed herein.
Also disclosed herein is a method of blocking expression of a cytokine/chemokine/transcription factor gene in a chimeric antigen receptor T cell (CAR-T), an iNKT cell carrying a CAR (iNKT-CAR), or a Natural Killer (NK) cell carrying a CAR (NK-CAR), comprising inserting the CAR into the locus of the cytokine/chemokine/transcription factor gene.
CAR-bearing immune effector cells
A Chimeric Antigen Receptor (CAR) is a recombinant fusion protein comprising: 1) an extracellular ligand-binding domain, i.e., an antigen recognition domain, 2) a transmembrane domain, and 3) a signaling domain.
Methods for CAR design, delivery and expression, and manufacture of clinical-grade CAR-T cell populations are known in the art. See, e.g., Lee et al, Clin. cancer Res.,2012,18(10): 2780-90. An engineered chimeric antigen receptor polynucleotide encoding a CAR comprises: a signal peptide, an antigen recognition domain, at least one co-stimulatory domain, and a signaling domain.
The antigen-specific extracellular domain of the chimeric antigen receptor recognizes and specifically binds to an antigen, typically a surface-expressed antigen of a malignant tumor. An "antigen-specific extracellular domain" (or equivalently, an "antigen-binding domain") specifically binds an antigen when, for example, it binds the antigen with an affinity constant or interaction affinity (KD) of between about 0.1pM to about 10 μ M, preferably about 0.1pM to about 1 μ M, more preferably about 0.1pM to about 100 nM. Methods for determining interaction affinity are known in the art. The antigen-specific extracellular domain of a CAR suitable for use in the present disclosure can be any antigen-binding polypeptide, a wide variety of which are known in the art. In some cases, the antigen binding domain is a single chain fv (scfv). Other antibody-based recognition domains (cabvhh (camelid antibody variable domain) and humanized versions thereof, IgNAR VH (shark antibody variable domain) and humanized versions thereof, sdAb VH (single domain antibody variable domain) and "camelized" antibody variable domains are applicable in some cases, T Cell Receptor (TCR) -based recognition domains such as single chain TCRs (scTv, single chain double domain TCRs comprising va V β) are also applicable.
The chimeric antigen receptors of the present disclosure also comprise an "intracellular domain" that provides an intracellular signal to an immune effector cell carrying the CAR upon binding of the antigen to the antigen-specific extracellular domain. The intracellular signaling domain of the chimeric antigen receptor of the present disclosure is responsible for activating at least one effector function of the T cell in which the chimeric receptor is expressed. The term "effector function" refers to the specialized function of differentiated cells such as iNKT cells. Effector functions of iNKT cells may be, for example, NK transactivation, T cell activation and differentiation, B cell activation, dendritic cell activation and cross-presentation activity, and macrophage activation. Thus, the term "intracellular domain" refers to the portion of the CAR that transduces effector function signals upon antigen binding to the extracellular domain and directs iNKT cells to perform specialized functions. Non-limiting examples of suitable intracellular domains include the zeta chain of the T cell receptor or any of its homologs (e.g., η, δ, γ, or ε), the MB 1 chain, 829, Fe Rill, Fe R1, as well as combinations of signaling molecules such as CD3 zeta and CD28, CD27, 4-1BB, DAP-10, OX40, and combinations thereof, and other similar molecules and fragments. Intracellular signaling portions of other members of the activin family, such as fcyriii and fceri, can be used. Although the entire intracellular domain will generally be employed, in many cases the use of the entire intracellular polypeptide will not be required. To the extent that a truncated portion of an intracellular signaling domain is available, the truncated portion can be used in place of the entire chain, so long as it still transduces effector function signals. Thus, the term intracellular domain is intended to include any truncated portion of the intracellular domain sufficient to transduce effector function signals.
Typically, the antigen-specific extracellular domain is linked to the intracellular domain of the chimeric antigen receptor by a "transmembrane domain". The transmembrane domain traverses the cell membrane, anchors the CAR to the T cell surface, and links the extracellular domain to an intracellular signaling domain, thereby affecting expression of the CAR on the T cell surface. The chimeric antigen receptor may further comprise one or more co-stimulatory domains and/or one or more spacers. "costimulatory domains" are derived from the intracellular signaling domains of costimulatory proteins, which enhance cytokine production, proliferation, cytotoxicity, and/or persistence in vivo. A "peptide hinge" connects an antigen-specific extracellular domain to a transmembrane domain. The transmembrane domain is fused to a costimulatory domain, optionally, the costimulatory domain is fused to a second costimulatory domain, and the costimulatory domain is fused to a signaling domain not limited to CD3 ζ. For example, the inclusion of a spacer domain between the antigen-specific extracellular domain and the transmembrane domain, and between multiple scfvs in the case of a tandem CAR, can affect the flexibility of the antigen-binding domain, and thus the CAR function. Suitable transmembrane domains, co-stimulatory domains and spacers are known in the art.
Engineered CARs can be introduced into CAR-bearing immune effector cells using a retrovirus that efficiently and stably integrates a nucleic acid sequence encoding a chimeric antigen receptor into the target cell genome. Other methods known in the art include, but are not limited to, lentiviral transduction, transposon-based systems, direct RNA transfection, and CRISPR/Cas systems (e.g., type I, type II, or type III systems using suitable Cas proteins such as Cas3, Cas4, Cas 54 (or CasE d), Cas4, Cas 64, Cas8a 4, Cas 84, Cas4, casllod, CasF, cassg, CasH, Csy 4, Cse4 (or cscsa), Cse4 (or CasE b), Cse4 (or CasE e), Cse4 (or Csc), Csc 4, Csa 4, Csn 4, Csm4, cs3672, cs3636363672, Csc 4, Csx 4, cs3672, Csc 4, cs3672, cs36x 4, cs3672, cscs36x 4, cs36x 4, cs3672, cscscscs3672, cscscscscscscs3672, cscscscs3672, cscscscsc 4, Csc 4. Zinc Finger Nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can also be used. See, for example, Shearer RF and Saunders DN, "Experimental design for stable genetic management in a macromolecular cell lines, lentiviruses and alternatives," Genes Cells 2015, 1 month; 20(1):1-10.
Manipulation of PI3K signaling can be used to prevent alterations in CAR-T cell differentiation caused by constitutive CAR self-signaling and to promote development of long-lived memory T cells. Pharmacological blockade of PI3K during CAR-T manufacture and ex vivo expansion can abrogate the development of preferential effector T cells and restore the CAR-T effect/memory ratio to the rate observed in empty vector transduced T cells, which can improve T cell persistence and therapeutic activity in vivo. Inhibition of p110 δ PI3K enhances the efficacy and memory of tumor-specific therapeutic CD 8T cells, while inhibition of p110 α PI3K increases cytokine production and anti-tumor responses.
This is proposed because the presence of the CAR on the surface of the T cell can alter its activation and differentiation even in the absence of ligand. Constitutive self-signaling by CARs in relation to scFv framework and signaling domains can lead to aberrant T cell behavior, including altered differentiation and decreased survival. This is important because CAR-T cell effectiveness in patients is directly related to its in vivo lifespan. The presence of the CD28 co-stimulatory domain increases CAR-T cell depletion caused by persistent CAR self-signaling; the effect of the 4-1BB co-stimulatory domain is less. In addition, CD 3-zeta significantly enhanced constitutive activation of PI3K, AKT, mTOR and glycolytic pathways and promoted the formation of short-lived effector cells relative to central/stem memory cells. See, e.g., Zhang W, et al, "Modulation of PI3K signaling to improve CAR T cell function," Oncotarget, 11.9.2018; 9(88):35807-35808.
A CAR antigen. Suitable antigens to be genomically edited in the iNKT cells disclosed herein and recognized by the CARs of the iNKT-CARs disclosed herein include antigens specific for hematological malignancies. These may include T cell specific antigens and/or antigens that are not specific for T cells. The antigen is specifically bound by a chimeric antigen receptor of an iNKT-CAR cell, and the antigen that is lacking in the iNKT-CAR cell is an antigen expressed on malignant T cells, preferably an antigen that is overexpressed on malignant T cells (i.e., T cells derived from a T cell malignancy) compared to non-malignant T cells. Examples of such antigens include CD2, CD3 epsilon, CD4, CD5, CD7, TRAC and TCR beta.
T cell malignancies include malignancies derived from T cell precursors, mature T cells or natural killer cells. Examples of T cell malignancies include T cell acute lymphoblastic leukemia/lymphoma (T-ALL), T cell Large Granular Lymphocytic (LGL) leukemia, human T cell leukemia virus type 1 positive (HTLV-1+) adult T cell leukemia/lymphoma (ATL), T cell prolymphocytic leukemia (T-PLL), and various Peripheral T Cell Lymphomas (PTCL), including but not limited to, angioimmunoblastic T cell lymphoma (AITL), ALK positive anaplastic large cell lymphoma, and ALK negative anaplastic large cell lymphoma.
Suitable CAR antigens may also include antigens present on the surface of multiple myeloma cells, i.e., malignant plasma cells, such as BCMA, CS1, CD38, and CD 19. Alternatively, the CAR can be designed to express the extracellular portion of the APRIL protein, i.e., ligands for BCMA and TACI, that co-target effectively to BCMA and TACI to treat multiple myeloma.
Additional examples of antigens suitable for genome editing in the iNKT cells disclosed herein and recognized by the CARs of the iNKT-CARs disclosed herein are given in tables 1-10 below. These include CD2, CD3 epsilon, CD4, CD5, CD7, TRAC, TCR beta, BCMA, CS1, and CD 38.
Resistance to suicide. CAR-T, iNKT, NK and other CAR-bearing immune effector cells contemplated by the present disclosure optionally lack one or more antigens to which the chimeric antigen receptor specifically binds and are thus suicide resistant. In some embodiments, one or more antigens of the cell are modified such that the chimeric antigen receptor no longer specifically binds to the one or more modified antigens. For example, an epitope of one or more antigens recognized by the chimeric antigen receptor may be modified by one or more amino acid changes (e.g., substitutions or deletions), or an epitope may be deleted from an antigen. In other embodiments, the expression of one or more antigens is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more in the cell. Methods for reducing the expression of a protein are known in the art and include, but are not limited to, modifying or replacing a promoter operably linked to a nucleic acid sequence encoding the protein. In other embodiments, the cell is modified such that one or more antigens are not expressed, for example, by deleting or disrupting a gene encoding one or more antigens. In each of the above embodiments, the CAR-bearing immune effector cell may lack one or preferably all of the antigens to which the chimeric antigen receptor specifically binds. Methods for genetically modifying cells to lack one or more antigens are well known in the art and non-limiting examples are provided above. In an exemplary embodiment, CRISPR/cas9 gene editing can be used to modify a cell to lack one or more antigens. Zinc Finger Nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) can also be used. See, for example, Shearer RF and Saunders DN, "Experimental design for stable genetic management in a macromolecular cell lines, lentiviruses and alternatives," Genes Cells 2015, 1 month; 20(1):1-10.
Avoidance of allogenic (allogenic) sex. CAR-T, iNKT, NK and other CAR-bearing immune effector cells contemplated by the present disclosure may further lack endogenous T Cell Receptor (TCR) signaling due to the deletion of a portion of the T Cell Receptor (TCR) -CD3 complex. In various embodiments, it may be desirable to eliminate or inhibit endogenous TCR signaling in CAR-bearing immune effector cells disclosed herein. For example, when using allogeneic T cells to generate CAR-T cells, reducing or eliminating endogenous TCR signaling in the CAR-T cells can prevent or reduce graft versus host disease (GvHD). Methods for abrogating or inhibiting endogenous TCR signaling are known in the art and include, but are not limited to, deletion of a portion of the TCR-CD3 receptor complex, e.g., the TCR Receptor Alpha Chain (TRAC), the TCR Receptor Beta Chain (TRBC), CD3 epsilon CD3 gamma CD3 delta, and/or CD3 zeta. Deletion of a portion of the TCR receptor complex can block TCR-mediated signaling, and thus can allow safe use of allogeneic T cells as a source of CAR-T cells, without causing life-threatening GvHD.
A suicide gene. Alternatively, or in addition, CAR-bearing immune effector cells encompassed by the present disclosure may further comprise one or more suicide genes. As used herein, "suicide gene" refers to a nucleic acid sequence introduced into a cell by standard methods known in the art, which when activated results in the death of the cell. If desired, the suicide gene can help effectively track and eliminate CAR-bearing immune effector cells in vivo. Promotion of killing by activation of a suicide gene can be performed by methods known in the art. Suitable suicide gene therapy systems known in the art include, but are not limited to, various herpes simplex virus thymidine kinase (HSVtk)/Ganciclovir (GCV) suicide gene therapy systems or inducible caspase 9 proteins. In an exemplary embodiment, the suicide gene is a CD 34/thymidine kinase chimeric suicide gene.
Components that may be included in the CARs as described herein are provided below in tables 1 and 2.
TABLE 1 amino acid sequences of different CAR components.
TABLE 2 variable heavy chain (V) of scFvH) And variable light chain (V)L) The amino acid sequence of (a).
Single CAR-T cells
In certain embodiments, the present disclosure provides an engineered T cell comprising a single CAR that specifically binds an antigen or cell surface protein, wherein the T cell optionally lacks the antigen or cell surface protein (e.g., a CD7CART Δ CD7 cell). In a non-limiting example, the absence of an antigen or cell surface protein is caused by: (a) a modification of an antigen or cell surface protein expressed by a T cell such that the chimeric antigen receptor no longer specifically binds to the modified antigen or cell surface protein (e.g., an epitope of one or more antigens recognized by the chimeric antigen receptor can be modified by one or more amino acid changes (e.g., substitutions or deletions), or the epitope can be deleted from the antigen), (b) a modification of a T cell such that expression of the antigen or cell surface protein is reduced in the T cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, or (c) a modification of the T cell such that the antigen or cell surface protein is not expressed (e.g., by deletion or disruption of a gene encoding the antigen or cell surface protein). In each of the above embodiments, the CAR-T cell may lack one or preferably all antigens or cell surface proteins to which the chimeric antigen receptor specifically binds. Methods of genetically modifying T cells to lack one or more antigens or cell surface proteins are well known in the art and non-limiting examples are provided herein. In the embodiments described below, the T cell is modified using the CRISPR-Cas9 system such that it lacks one or more antigens. Any of these may be achieved by the methods disclosed herein. In additional embodiments, the T cell comprises a suicide gene.
For example, CARs of CD 7-specific CAR-T cells can be generated by cloning commercially synthesized anti-CD 7 single-chain variable fragments (scFv) into third generation CAR scaffolds with CD28 and/or 4-1BB internal signaling domains. An extracellular hCD34 domain may be added after the P2A peptide to enable detection of CAR after viral transduction and purification using anti-hCD 34 magnetic beads. CARs can be made specific for other malignant T cell antigens in a similar manner.
CAR-T cells encompassed by the present disclosure may further lack endogenous T Cell Receptor (TCR) signaling due to the deletion of a portion of the T Cell Receptor (TCR) -CD3 complex. In various embodiments, it may be desirable to eliminate or inhibit endogenous TCR signaling in the CAR-T cells disclosed herein. For example, when using allogeneic T cells to generate CAR-T cells, reducing or eliminating endogenous TCR signaling in the CAR-T cells can prevent or reduce graft versus host disease (GvHD). Methods for ablating or inhibiting endogenous TCR signaling are known in the art and include, but are not limited to, deleting a portion of the TCR-CD3 receptor complex, e.g., the TCR Receptor Alpha Chain (TRAC), the TCR receptor beta chain (TCR) or a subtype thereof, TCR, CD3, CD3, and/or CD 3. Deletion of a portion of the TCR receptor complex can block TCR-mediated signaling, and thus can allow safe use of allogeneic T cells as a source of CAR-T cells, without causing life-threatening GvHD.
In addition, CAR-T cells contemplated by the present disclosure can further comprise one or more suicide genes as described herein.
In a similar manner, other single CAR-T cells can be constructed and are given in table 3 below.
Table 3: single CAR and CAR-T
Disclosed are embodiments of CAR amino acid sequences that can be expressed on the surface of CAR-T cells that are edited by genomes derived from cytotoxic T cells, memory T cells, or gamma delta (γ δ) T cells.
TABLE 4 amino acid sequence of a single Chimeric Antigen Receptor (CAR).
Tandem CAR-T cells
Tandem CAR-T cells (tCAR-T) are T cells having a single chimeric antigen polypeptide comprising two different extracellular ligand-binding (antigen/protein recognition) domains capable of interacting with two different cell surface molecules (e.g., antigens/proteins), wherein the extracellular ligand-binding domains are linked together by one or more flexible linkers and share one or more costimulatory domains, wherein binding of the first or second extracellular ligand-binding domains will signal through the one or more costimulatory domains and the signal transduction domain.
In certain embodiments, the T cells lack one or more antigens or cell surface proteins (e.g., CD7 and CD2 for CD 7-CD 2-tCAR CD7 CD2 cells, or CD2 for CD 3-CD 2-tCAR CD3 CD2 cells). In a non-limiting example, the absence of an antigen or cell surface protein is caused by: (a) a modification of an antigen or cell surface protein expressed by a T cell such that the chimeric antigen receptor no longer specifically binds to the modified antigen or cell surface protein (e.g., an epitope of one or more antigens recognized by the chimeric antigen receptor can be modified by one or more amino acid changes (e.g., substitutions or deletions), or the epitope can be deleted from the antigen), (b) a modification of a T cell such that expression of the antigen or cell surface protein is reduced in the T cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, or (c) a modification of the T cell such that the antigen or cell surface protein is not expressed (e.g., by deletion or disruption of a gene encoding the antigen or cell surface protein). In each of the above embodiments, the CAR-T cell may lack one or preferably all antigens or cell surface proteins to which the chimeric antigen receptor specifically binds. Methods of genetically modifying T cells to lack one or more antigens or cell surface proteins are well known in the art and non-limiting examples are provided herein. In the embodiments described below, the T cell is modified using the CRISPR-Cas9 system such that it lacks one or more antigens or cell surface proteins. Any of these may be achieved by the methods disclosed herein. In additional embodiments, the T cell comprises a suicide gene.
Tandem CAR-T cells for genome editing, i.e., CD2 × CD3-tCART Δ CD2 Δ CD3 ∈ tcars can be generated by cloning commercially synthesized anti-CD 2 single-chain variable fragments (scFv) and anti-CD 3 single-chain variable fragments (scFv) separated by a peptide linker into lentiviral vectors comprising, e.g., generation 2 or generation 3 CAR scaffolds with CD28 and/or 4-1BB internal signaling domains. An extracellular hCD34 domain may be added after the P2A peptide to enable detection of CAR after viral transduction and purification using anti-hCD 34 magnetic beads. Tcas can be made specific for other malignant T cell antigens in a similar manner.
Tandem CARs can have different linker structures, i.e., linear or hairpin, and the hairpin linker can optionally comprise a (Cys ═ Cys) double-stranded bond (DSB).
A linear tandem CAR-T cell comprises a Chimeric Antigen Receptor (CAR) polypeptide comprising a first signal peptide, a first extracellular ligand-binding domain, a second extracellular ligand-binding domain, a hinge region, a transmembrane domain, one or more costimulatory domains, and a signal transduction domain, wherein the first extracellular ligand-binding antigen-recognition domain and the second extracellular ligand-binding antigen-recognition domain have affinity for an antigen on a different cell surface molecule, i.e., a cancer cell (e.g., a malignant T cell, a B cell, or a plasma cell); and wherein the linear tandem CAR-T cell has one or more genetic modifications, deletions or disruptions resulting in reduced expression of a cell surface molecule in the linear tandem CAR-T cell.
In another embodiment, the signal peptide is a signal peptide from human CD 8.
In a third embodiment, the first extracellular ligand-binding domain comprises a single chain antibody fragment (scFv), which comprises a light (V)L) Harmony weight (V)H) Variable fragment, named VH1 and VL1 and linked by a linker (e.g., GGGGS). In some embodiments, the linker peptide is repeated 2,3, 4, 5, or 6 times. In some embodiments, the first antigen recognition domain may be selected from: 1) vH1-(GGGGS)3-4-VL1 or 2) VL1-(GGGGS)3-4-VH1。
In some embodiments, the second extracellular ligand-binding domain comprises a single chain antibody fragment (scFv), which comprises a light (V)L) Harmony weight (V)H) Variable fragment, named VH2 and VL2 and linked by a linker (e.g., GGGGS). In some embodiments, the linker peptide is repeated 2,3, 4, 5, or 6 times. In some embodiments, the first antigen recognition domain may be selected from: 1) vH2-(GGGGS)3-4–VL2 or 2) VL2-(GGGGS)3-4-VH2。
In a further embodiment, the first antigen recognition domain and the second antigen recognition domain are linked by a short 5 amino acid linker peptide (GGGGS). In some embodiments, the linker peptide is repeated 2,3, 4, 5, or 6 times.
Tandem CAR constructs
In one embodiment, the first extracellular ligand-binding domain antigen recognition comprises a single chain antibody fragment (scFv) comprising a heavy (V)H) And light (V)L) Variable fragment, named VH1 and VL1 and linked by a linker (e.g., GGGGS), to target a cell surface molecule, i.e., an antigen expressed on malignant cells.
In certain embodiments, heavy (V) of an antigen expressed on malignant T cells is targetedH) And light (V)L) Variable fragment, named VH1 and VL1 selected from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56, and CD1 a.
In certain embodiments, the second extracellular ligand-binding domain antigen recognition comprises a single chain antibody fragment (scFv) comprising a heavy (V)H) And light (V)L) Variable fragment, named VH2 and VL2 and linked by a linker (e.g., GGGGS) and targets a cell surface molecule, i.e., an antigen expressed on malignant cells.
In certain embodiments, heavy (V) of an antigen expressed on malignant T cells is targetedH) And light (V)L) Variable fragment, named VH2 and VL2, is selected from BCMA, CS1, CD38, CD138, CD19, CD33, CD123, CD371, CD117, CD135, Tim-3, CD5, CD7, CD2, CD4, CD3, CD79A, CD79B, APRIL, CD56 and CD1a, and is different from the variable weight of the first extracellular ligand-binding domain of the CAR molecule (V) and (V) is not identical to the variable weight of the first extracellular ligand-binding domain of the CAR molecule (V)H1) And light sequence (V)L1)。
Additional examples of tandem CARs are given below in table 5.
Table 5: tandem CAR and CAR-T
In some embodiments, provided herein can be hairpin tandem CAR constructs, such as including, but not limited to, V incorporating CD2 and CD3 scFvHAnd VLDomain constructs (table 6).
TABLE 6 hairpin tandem CAR constructs targeting CD2 and CD 3.
Dual CAR-T cells
In certain embodiments, the present disclosure provides an engineered T cell having two different chimeric antigen receptor polypeptides with affinity for different antigens or cell surface proteins expressed within the same effector cell, wherein each CAR acts independently. The CAR can be expressed from a single or multiple polynucleotide sequences that specifically bind different antigens or cell surface proteins, wherein the T cells lack the antigen or cell surface protein to which the CAR binds (e.g., CD7 × CD2-dCAR Δ CD7 Δ CD2 cells). In a non-limiting example, the absence of an antigen or cell surface protein is caused by: (a) a modification of an antigen or cell surface protein expressed by a T cell such that the chimeric antigen receptor no longer specifically binds to the modified antigen or cell surface protein (e.g., an epitope of one or more antigens recognized by the chimeric antigen receptor can be modified by one or more amino acid changes (e.g., substitutions or deletions), or the epitope can be deleted from the antigen), (b) a modification of a T cell such that expression of the antigen or cell surface protein is reduced in the T cell by at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more, or (c) a modification of the T cell such that the antigen or cell surface protein is not expressed (e.g., by deletion or disruption of a gene encoding the antigen or cell surface protein). In each of the above embodiments, the CAR-T cell may lack one or preferably all antigens or cell surface proteins to which the chimeric antigen receptor specifically binds. Methods of genetically modifying T cells to lack one or more antigens or cell surface proteins are well known in the art and non-limiting examples are provided herein. In the embodiments described below, the T cell is modified using the CRISPR-Cas9 system such that it lacks one or more antigens or cell surface proteins. Any of these may be achieved by the methods disclosed herein. In additional embodiments, the T cell comprises a suicide gene.
For genome editingThe dual CAR-T cells of (a), dCAR of CD2 + CD3 e-dCART Δ CD2 Δ CD3e, can be generated by: cloning of a commercially synthesized anti-CD 2 single-chain variable fragment into a lentiviral vector comprising, for example, a generation 2 or 3 CAR backbone with a CD28 and/or 4-1BB internal signaling domain and cloning of a commercially synthesized anti-CD 3 epsilon single-chain variable into a lentiviral vector comprising a further generation 2 or 2 with a CD28 and/or 4-1BB internal signaling domain3Substituted CAR skeletonPhase (C)Into a lentiviral vector, thereby generating a plasmid in which both CAR constructs are expressed from the same vector. An extracellular hCD34 domain may be added after the P2A peptide to enable detection of CAR after viral transduction and purification using anti-hCD 34 magnetic beads. Tcas can be made specific for other malignant T cell antigens in a similar manner.
In a similar manner, other dual CARs may be constructed and are given in tables 5-7 below.
In one embodiment, a dual CAR-T cell comprises (i) a first Chimeric Antigen Receptor (CAR) polypeptide comprising a first signal peptide, a first antigen recognition domain, a first hinge region, a first transmembrane domain, a first costimulatory domain, and a first signaling domain; and (ii) a second chimeric antigen receptor polypeptide comprising a second signal peptide, a second antigen recognition domain, a second hinge region, a second transmembrane domain, a second costimulatory domain, and a second signaling domain; wherein the first antigen recognition domain and the second antigen recognition domain have affinity for different target antigens; and wherein the dual CAR-T cell has one or more gene disruptions resulting in reduced expression of the target antigen in the dual CAR-T cell.
In a second embodiment, the first signal peptide is the CD8a signal sequence.
In a third embodiment, the first antigen recognition domain is the variable region of immunoglobulin heavy and light chains (designated V)H1 and VL1) The fusion protein of (4) is linked to the first antigen recognition domain via a5 amino acid short linker peptide (GGGGS). In some embodiments, this linker peptide is repeated 3 or 4 times. In some embodiments, the first antigen recognition domain may be selected from VH1-(GGGGS)3-4-VL1 or VL1-(GGGGS)3-4-VH1。
In some embodiments, the first hinge region comprises CD8 a.
In some embodiments, the first transmembrane domain is CD8 or CD 28.
In some embodiments, the first co-stimulatory domain comprises 4-1BB, CD28, or a combination of both, i.e., 4-1BB-CD28 or CD28-4-1BB, in either order.
In some embodiments, the first signaling domain is a CD3 ζ or CD3 ζ dipeptide, i.e., CD3 ζ -CD3 ζ.
In some embodiments, the second signal peptide is the CD8a signal sequence of SEQ NO. 1.
In some embodiments, the second antigen recognition domain is the variable region of immunoglobulin heavy and light chains (designated V)H2 and VL2) The fusion protein of (3) is linked to the second antigen recognition domain via a5 amino acid short linker peptide (GGGGS). In some embodiments, this linker peptide is repeated 3 or 4 times. In some embodiments, the second antigen recognition domain may be selected from VH2-(GGGGS)3-4-VL2 or VL2-(GGGGS)3-4-VH2。
In some embodiments, the second hinge region comprises CD8 a.
In some embodiments, the second transmembrane domain is CD8 or CD 28.
In some embodiments, the second co-stimulatory domain comprises 4-1BB, CD28, or a combination of both, i.e., 4-1BB-CD28 or CD28-4-1BB, in either order.
In some embodiments, the second signaling domain is a CD3 ζ or CD3 ζ dipeptide, i.e., CD3 ζ -CD3 ζ.
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VVH1-(GGGGS)3-4-VL1 and second antigen recognition Domain fusion protein VH2-(GGGGS)3-4-VL2。
In some embodiments, the CAR polypeptide packageFusion protein V containing first antigen recognition structural domainL1-(GGGGS)3-4–VH1 and second antigen recognition Domain fusion protein VL2-(GGGGS)3-4–VH2。
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VVH2-(GGGGS)3-4-VL2 and second antigen recognition Domain fusion protein VH1-(GGGGS)3-4-VL1。
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VL2-(GGGGS)3-4–VH2 and second antigen recognition Domain fusion protein VL1-(GGGGS)3-4–VH1。
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VH1-(GGGGS)3-4-VL1 and second antigen recognition Domain fusion protein VL2-(GGGGS)3-4–VH2。
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VL1-(GGGGS)3-4–VH1 and second antigen recognition Domain fusion protein VH2-(GGGGS)3-4-VL2。
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VH2-(GGGGS)3-4-VL2 and second antigen recognition Domain fusion protein VL1-(GGGGS)3-4–VH1。
In some embodiments, the CAR polypeptide comprises a first antigen recognition domain fusion protein VL2-(GGGGS)3-4–VH2 and second antigen recognition Domain fusion protein VH1-(GGGGS)3-4-VL1。
In some embodiments, the CAR polypeptide comprises at least one high efficiency cleavage site, wherein the high efficiency cleavage site is selected from the group consisting of P2A, T2A, E2A, and F2A.
In some embodiments, the CAR polypeptide comprises a suicide gene.
In some embodiments, the CAR polypeptide comprises a mutated cytokine receptor.
In some embodiments, the dual CAR-T cells target two antigens selected from the group consisting of CD5, CD7, CD2, CD4, CD3, CD33, CD123(IL3RA), CD371 (CLL-1; CLEC12A), CD117(c-kit), CD135(FLT3), BCMA, CS1, CD38, CD79A, CD79B, CD138 and CD19, APRIL, and TACI.
Additional examples of dual CARs are given below in table 7.
Table 7: dual CAR and dCAR-T
Deletion or suppression of cytokine/chemokine/transcription factor genes
Cytokine Release Syndrome (CRS) is caused by the massive, rapid release of cytokines by immune cells in response to immunotherapy (or other immune stimuli). Thus, decreasing the level of released cytokines will prevent or reduce the development and/or maintenance of CRS. This may be achieved by modification, disruption or deletion of one or more cytokine/chemokine/transcription factor genes as disclosed herein. One method of achieving this is gene ablation (gene silencing), in which gene expression is eliminated by alteration or deletion of gene sequence information. This can be achieved using genetic engineering tools known in the art, such as transfection of transcription activator-like effector nucleases (TALENs), Zinc Finger Nucleases (ZFNs), CRISPRs, and small interfering rnas (sirnas).
Another technique is to express scfvs with Endoplasmic Reticulum (ER) binding tethers to bind cytokines in the ER and prevent secretion. A specific construct called a blocker of Protein Expression (PEBL) prevents transport of the target protein to the cell membrane. The PEBL constructs can be readily combined with other genetic modification systems for ex vivo cellular processing of immune cells. Short hairpin RNAs or small hairpin RNAs (shRNA/hairpin vectors) are artificial RNA molecules with tight hairpin bends that can be used to silence expression of a target gene (i.e., an antigen) by RNA interference (RNAi). Expression of shrnas in cells is typically achieved by delivery of plasmids or by viral or bacterial vectors.
Cytokines or chemokines that may be deleted from an immune effector cell as disclosed herein, for example, by targeted transduction of a CAR into the gene sequence of the cytokine, include, but are not limited to, the following: XCL, CCL, CXCL, CX1 alpha, IL-1 beta, IL-1RA, IL-18, IL-2, IL-4, IL-7, IL-9, IL-13, IL-15, IL-3, IL-5, GM-CSF, IL-6, IL-11, G-CSF, IL-12, LIF, OSM, IL-10, IL-20, IL-14, IL-16, IL-17, IFN-alpha, IFN-beta, IFN-gamma, CD154, TNF-beta, TNF-alpha-beta, TNF-beta-alpha-beta-LT, 4-1BBL, APRIL, CD153, CD178, GITRL, LIGHT, OX40, TALL-1, TRAIL, TWEAK, TRANCE, TGF- β 1, TGF- β 2, TGF- β 3, Epo, Tpo, Flt-3L, SCF, M-CSF, MSP, A2, ACKR, ACVR2, ACVRL, ADIPOQ, AGER, AGRN, AIMP, AREG, BMP8, BMPR, C10orf, C1QTNF, C, CCL, CSF, FLR, CXCR 109, CD, CCR 40, CD, CER, CHRD, CKLF, CLCF, BMTM, FASTM, TM, CSF, CTTM, CTF, CMGDF, CX, CXCR, CMFCF, CXCR, FACF, CXCR, FACF, CXCR, FALF, FASTM, FALF, FAST, CXCR, FAF, FALF, 36 9, GPI, GREM1, GREM2, GRN, HAX1, HFE 1, HMGB1, HYAL 1, IFNA1, IFNAR1, IFNB1, IFNE, IFNG, IFNGR1, IFNK, IFNL1, IFNW1, IL10 1, IL11 1, IL12 1, IL12RB1, IL17 1, IL18 1, IL-19, IL1F1, IL1R1, IL1 RAIL 72, 36IL 1, 1, LYSLNTIL 1 BP1, SLNTIL 72, SLNTIL 1, FLIL 1, FLIL 1, FLL 1, FLIL 1, 36FLIL 1, 36FLIL 1, 36363672, 1, 3636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363636363672, 3636363672, 36363636363636363636363636363672, 1, 3636363636, THPO, TIMP1, TNF, TNFRSF11, TNFRSF1A, TNFRSF9, TNFRSF10, TNFRSF11, TNFRSF 12, TNFRSF 12-, TNFRSF 13, TNFRSF 13B, TNFRSF 14, TNFRSF 15, TNFRSF 18, TNFRSF 4, TNFRSF 8, TNFRSF9, TRIM16, TSLP, TWSG1, TXLNA, VASN, VEGFA, VSTM1, WFIKN 1, WFIKN 2, WNT1, WNT2, WNT5A, WNT7A, and ZFP 36.
In some embodiments, the cytokine is selected from the group consisting of MCP1(CCL2), MCP-2, GM-CSF, G-CSF, M-CSF, Il-4, and IFN γ.
In certain embodiments, transcription factors that may be deleted from an immune effector cell as disclosed herein include AHR, BCL6, FOXP3, GATA3, MAF, RORC, SPI1, and TBX 21.
The sequences of these genes are known and available in the art, and may include, for example, those provided in table 10.
Selection of priority target genes
Cytokine/chemokine gene targets of particular interest that are deleted or inhibited (e.g., ablated, knocked-out, KO) in CAR-T cells to mitigate CRS have been divided into groups based on biological function. The development of CRS is dependent on CAR-T cell activation and subsequent cytokine release, which triggers immune system dysregulation in the receptor of CAR-T cell therapy. Several studies have shown that receptor myeloid activation is essential for the development of CRS.
The first group of potential genes in CAR-T to be KO are surface receptors that activate myeloid cells (e.g., CD40L) when engaged with them in a normal immune response. The second group is cytokines (e.g., GM-CSF) released from CAR-T cells that activate myeloid cells. In both categories, the goal is to prevent CAR-T cell signaling, which will activate receptor myeloid cells and trigger CRS.
A third class of targets are endogenous T cell receptors (e.g., endogenous CD28) that integrate into CAR-T receptors to increase T cell activation (possibly in the absence of tumor targets). The objective is to reduce activation of CAR-T by non-tumor interactions such as activated myeloid cells that may engage CD28 on activated T cells, thereby expanding cytokine production and subsequent myeloid activation of T cells.
The fourth and fifth class of gene KO targets are transcription factors and cytokines that drive CAR-T cell differentiation and subsequent functional characteristics. CAR-T cells that are phenotypically similar to normal cytotoxic T cells (CTLs, usually identified by CD8 expression) are capable of directly killing tumors through T cell-mediated effector functions. CTL were supported and maintained by T helper cells (expressing CD 4). Importantly, a subset of T helper cells can support (i.e., Th1 cells) or inhibit (i.e., Th2 cells) CTLs. Other T cells (such as tregs) may also inhibit CTL development and function. The goal is to target cytokines or transcription factors in the CAR-T population that will result in differentiation of the CAR-T into a non-cytotoxic T cell population. In addition, Th2 cells produce cytokines (such as GM-CSF and IL-4), which are indicative markers of CRS. It is likely that the CAR-T phenotype, which does not optimally kill tumor cells, will be activated by the CAR-T receptor, producing signals that drive CRS in the host, increasing the time required for tumor killing, and requiring higher CAR-T cell doses than optimized "killing" products. Thus, knocking out or ablating (or suppressing) transcription factors (such as GATA3) or cytokines (such as IL-4) will prevent (or reduce) Th2 bias (bias) and reduce CRS.
Another issue of interest with regard to myeloid-activating cytokines and optimized CAR-T cell differentiation is the potential to mitigate CAR-T neurotoxicity. Neurotoxicity occurs in a small population of CAR-T receptors with CRS. Studies have shown that patients with CRS who have progressed to neurotoxicity have elevated IL-5 and ferritin levels (Santomasso et al, 2017 and Philip et al, 2019). These two biomarkers suggest that mast cell activation may be associated with CNS complications. IL-5 is a key cytokine produced by Th2 cells, eosinophils, and mast cells. Excessive levels of ferritin are observed in mastocytosis and several diseases associated with mast cell disorders. In addition, many mast cell diseases include disorders of the nervous system. In view of elevated IL-5, ferritin levels, and neurotoxicity in some patients, reducing mast cell activation by cytokines such as IL-5, or preventing development of Th2 cells that drive IL-5 dependent mast cell activation, may also reduce the neurological complications observed in CRS receptors. With respect to CNS complications, CX3CR1 and OX40 were also highlighted due to the high T cell burden previously exhibited in the CNS. CX3CR1 is a T cell chemokine receptor that primarily directs T cells and potentially CAR-T cells into the CNS. OX40 is a T cell receptor that promotes activation through cell-cell interactions with OX40L on eosinophils and mast cells.
Thus, in certain embodiments, the cytokine is selected from the group consisting of CCL2(MCP1), MCP-2, GM-CSF, G-CSF, M-CSF, Il-4, and IFN γ.
Indications and standard of care for CAR-T therapy
In some embodiments, the genome-edited immune effector cells disclosed herein and/or produced using the methods disclosed herein express one or more Chimeric Antigen Receptors (CARs) and can be used as a medicament, i.e., for treating a disease. In many embodiments, the cell is a CAR-T cell.
The cells disclosed herein and/or produced using the methods disclosed herein can be used in immunotherapy and adoptive cell transfer for use in treating or manufacturing a medicament for treating cancer, autoimmune diseases, infectious diseases, and other conditions.
The cancer may be a hematological malignancy or a solid tumor. Hematological malignancies include leukemia, lymphoma, multiple myeloma, and subtypes thereof. Lymphomas can be classified in a variety of ways, often based on the underlying type of malignant cells, including hodgkin's lymphoma (typically a Reed-Sternberg cell cancer, but sometimes also originating from B cells; all other lymphomas are non-hodgkin's lymphomas), B cell lymphoma, T cell lymphoma, mantle cell lymphoma, burkitt's lymphoma, follicular lymphoma, and other lymphomas as defined herein and known in the art.
B cell lymphomas include, but are not limited to, Diffuse Large B Cell Lymphoma (DLBCL), Chronic Lymphocytic Leukemia (CLL)/Small Lymphocytic Lymphoma (SLL), and other lymphomas as defined herein and known in the art.
T cell lymphomas include T cell acute lymphoblastic leukemia/lymphoma (T-ALL), Peripheral T Cell Lymphoma (PTCL), T cell chronic lymphocytic leukemia (T-CLL) Sezary (Sezary) syndrome, and other lymphomas as defined herein and known in the art.
Leukemias include acute myelogenous (or myelogenous) leukemia (AML), chronic myelogenous (or myelogenous) leukemia (CML), acute lymphocytic (or lymphoblastic) leukemia (ALL), Chronic Lymphocytic Leukemia (CLL) hairy cell leukemia (sometimes classified as lymphoma), and other leukemias as defined herein and known in the art.
Plasma cell malignancies include lymphoplasmacytic lymphomas, plasmacytomas, and multiple myelomas.
In some embodiments, the medicament may be for treating cancer in a patient, in particular for treating a solid tumor, such as melanoma, neuroblastoma, glioma or carcinoma, such as a brain tumor, head and neck tumor, breast tumor, lung tumor (e.g., non-small cell lung cancer, NSCLC), reproductive tract (e.g., ovary) tumor, upper gastrointestinal tumor, pancreas tumor, liver tumor, kidney system (e.g., kidney) tumor, bladder tumor, prostate tumor and colorectal tumor.
In another embodiment, the medicament may be for the treatment of cancer in a patient, in particular for the treatment of hematological malignancies selected from multiple myeloma and Acute Myeloid Leukemia (AML) and T cell malignancies selected from T cell acute lymphoblastic leukemia (T-ALL), non-hodgkin's lymphoma and T cell chronic lymphocytic leukemia (T-CLL).
In some embodiments, the cells can be used to treat autoimmune diseases, such as lupus, autoimmune (rheumatoid) arthritis, multiple sclerosis, transplant rejection, crohn's disease, ulcerative colitis, dermatitis, and the like. In some embodiments, the cell is a chimeric autoantibody receptor T cell, or CAAR-T displaying an antigen or fragment thereof and not an antibody fragment; in this form of adoptive cell transfer, B cells causing autoimmune disease will attempt to attack the engineered T cells, which will kill them in response.
In some embodiments, the cells may be used to treat infectious diseases, such as HIV and tuberculosis.
In another embodiment, the CAR-T cells of the present disclosure can undergo robust in vivo T cell expansion and can persist for extended amounts of time.
In some embodiments, treatment of a patient with a CAR-T cell of the present disclosure can be ameliorating, curative, or prophylactic. It may be part of an autoimmune therapy or part of an allogeneic immunotherapy treatment. Autologous means that the cells, cell lines or cell populations used to treat the patient are derived from the patient or from Human Leukocyte Antigen (HLA) compatible donors. Allogeneic refers to cells or cell populations used to treat a patient that are not derived from the patient, but rather are derived from a donor.
Treatment of cancer with the CAR-T cells of the present disclosure may be combined with one or more therapies selected from: antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, radiation therapy, laser therapy, and radiation therapy.
Administration of the CAR-T cells or CAR-T cell populations of the present disclosure is by aerosol inhalation, injection, ingestion, infusion, implantation, or transplantation. The CAR-T cell compositions described herein, i.e., single CAR, dual CAR, tandem CAR, can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intramedullary, intramuscularly, by intravenous or intralymphatic injection, or intraperitoneally. In one embodiment, the cell composition of the present disclosure is preferably administered by intravenous injection.
Administration of the CAR-T cell or CAR-T cell population may consist of: administration 104-109Individual cells/kg body weight, preferably 105To 106Individual cells per kg body weight, including all integer values of cell numbers within those ranges. The CAR-T cells or CAR-T cell population can be administered in one or more doses. In another embodiment, the effective amount of the CAR-T cell or population of CAR-T cells is administered as a single dose. In another embodiment, an effective amount of cells is administered as more than one dose over a period of time. The timing of administration is within the discretion of the medical care provider and depends on the clinical condition of the patient. The CAR-T cells or CAR-T cell population can be obtained from any source, such as a blood bank or donor. Although the needs of patients vary, determination of the optimal range of effective amounts of a given CAR-T cell population for a particular disease or condition is within the skill of the art. An effective amount refers to an amount that provides a therapeutic or prophylactic benefit. The dosage administered will depend on the age, health and weight of the subject, the type of concurrent treatment (if any), the frequency of treatment and the nature of the desired effect.
In another embodiment, an effective amount of the CAR-T cells or population of CAR-T cells or a composition comprising those CAR-T cells is administered parenterally. Administration may be intravenous. Administration of the CAR-T cells or CAR-T cell populations or compositions comprising those CAR-T cells can be performed directly by intratumoral injection.
In one embodiment of the disclosure, the CAR-T cells or CAR-T cell population are administered to the patient in conjunction with (e.g., prior to, concurrently with, or subsequent to) any number of related therapeutic modalities, including but not limited to treatment with cytokines, or expression of cytokines from within the CAR-T, which enhance T cell proliferation and persistence and include but are not limited to IL-2, IL-7, and IL-15.
In a second embodiment, the CAR-T cells or CAR-T cell populations of the present disclosure may be used in combination with agents that inhibit immunosuppressive pathways, including, but not limited to, inhibitors of TGF- β, interleukin 10(IL-10), adenosine, VEGF, indoleamine 2,3 dioxygenase 1(IDO1), indoleamine 2, 3-dioxygenase 2(IDO2), tryptophan 2-3-dioxygenase (TDO), lactate, hypoxia, arginase, and prostaglandin E2.
In another embodiment, the CAR-T cells or CAR-T cell populations of the present disclosure may be used in combination with T cell checkpoint inhibitors including, but not limited to, anti-CTLA 4 (Ipilimumab)), anti-PD 1 (Pembrolizumab), Nivolumab (Nivolumab), seaprimab (cemipimab)), anti-PDL 1 (Atezolizumab), avilamab (Avelumab), de wauzumab), anti-PDL 2, anti-BTLA, anti-LAG 3, anti-TIM 3, anti-VISTA, anti-TIGIT, and anti-KIR.
In another embodiment, the CAR-T cells or CAR-T cell populations of the present disclosure can be used in combination with T cell agonists, including but not limited to antibodies that stimulate CD28, ICOS, OX-40, CD27, 4-1BB, CD137, GITR, and HVEM.
In another embodiment, the CAR-T cells or CAR-T cell populations of the present disclosure can be used in combination with a therapeutic oncolytic virus, including but not limited to, a retrovirus, picornavirus, rhabdovirus, paramyxovirus, reovirus, parvovirus, adenovirus, herpesvirus, and poxvirus.
In another embodiment, the CAR-T cells or CAR-T cell populations of the present disclosure can be used in combination with an immune stimulation therapy, such as a toll-like receptor agonist, including but not limited to TLR3, TLR4, TLR7, and TLR9 agonists.
In another embodiment, the CAR-T cells or CAR-T cell populations of the present disclosure can be used in combination with a stimulator of an interferon gene (STING) agonist, such as cyclic GMP-AMP synthase (cGAS).
Immune effector cell hypoplasia, particularly T cell hypoplasia, is also a problem following adoptive cell transfer therapy. When the malignancy being treated is a T cell malignancy and the CAR-T cells target T cell antigens, normal T cells and their antigen-expressing precursors will be depleted and the immune system will be compromised. Thus, the methods used to manage these side effects are concomitant with therapy. Such methods include selecting and retaining non-malignant T cells or precursors, whether autologous or allogeneic (optionally engineered to cause or be non-rejected), for subsequent expansion and reinfusion into the patient following CAR-T cell depletion or inactivation. Alternatively, a subset of TCR-bearing cells are identified and killed, such as normal and malignant TRBC1+Rather than TRBC2+Cells, or alternatively, TRBC2+Rather than TRBC1+Cellular CAR-T cells can be used to eradicate T cell malignancies while preserving enough normal T cells to maintain normal immune system function.
Definition of
As used herein, the following terms have the meanings indicated. Other definitions may appear throughout the specification.
When disclosing ranges of values and using "from n1… to n2"or" n1… and n2(in which n is a number of1And n2Is a number), this notation is intended to include the numbers themselves and ranges therebetween unless otherwise indicated. This range can be an integer or continuous range between and including the endpoints. For example, a range of "from 2 to 6 carbons" is intended to include two, three, four, five, and six carbons, as carbons are integer units. By contrast, for example, a range of "from 1 to 3. mu.M (micromolar)," is intended to include 1. mu.M, 3. mu.M andall numbers in between to any significant number of digits (e.g., 1.255 μ M, 2.1 μ M, 2.9999 μ M, etc.).
As used herein, the term "about" is intended to define the numerical value modified by it, indicating that the value is a variable within the margin of error. When a particular margin of error is not set forth, such as the standard deviation of the mean value given in a data diagram or table, the term "about" should be understood to mean that the range of values recited is intended to be encompassed, and that the range encompassed is the rounding up or down of the number in question, taking into account the significant figure.
The term "activation" (and other morphological changes thereof) with respect to a cell is generally understood to be synonymous with "stimulation" and, as used herein, refers to a treatment of a cell that results in expansion of a population of cells. In T cells, activation is typically achieved by exposure to CD2 and CD28 (sometimes also including CD2) agonists, typically antibodies, optionally coated on magnetic beads or conjugated to a colloidal polymer matrix.
As used herein, the term "antigen" is a cell surface protein that is recognized by (i.e., is the target of) a T cell receptor or chimeric antigen receptor. In the traditional sense, an antigen is a substance recognized by an antibody, usually a protein, but in the case of CARs, the CAR comprises an antibody-derived domain, such as a light chain (V) that recognizes one or more antigensL) And heavy chain (V)H) In other words, the definitions overlap.
The term "cancer" refers to a malignant or abnormal growth of cells in vivo. Many different cancers can be characterized or identified by specific cell surface proteins or molecules. Thus, in general, a cancer according to the present disclosure may refer to any malignancy that may be treated with immune effector cells, such as CAR-T cells as described herein, wherein the immune effector cells recognize and bind to cell surface proteins on the cancer cells. As used herein, cancer may refer to a hematological malignancy, such as multiple myeloma, T cell malignancy, or B cell malignancy. T cell malignancies may include, but are not limited to, T cell acute lymphoblastic leukemia (T-ALL) or non-Hodgkin's lymphoma. Cancer may also refer to solid tumors such as, but not limited to, cervical, pancreatic, ovarian, mesothelioma, and lung cancer.
As used herein, a "cell surface protein" is a protein (or protein complex) that is expressed by a cell, at least in part, on the surface of the cell. Examples of cell surface proteins include TCR (and subunits thereof) and CD 7.
The term "combination therapy" refers to the administration of two or more therapeutic agents to treat a therapeutic condition or disorder described in the present disclosure. Such administration encompasses co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule with a fixed ratio of active ingredients, or in multiple, separate capsules for each active ingredient. Furthermore, such administration also encompasses the use of each type of therapeutic agent in a sequential manner. In either case, the treatment regimen will provide the beneficial effects of the drug combination in treating the conditions or disorders described herein.
The term "composition" as used herein refers to a population of immunotherapeutic cells in combination with one or more therapeutically acceptable carriers.
As used herein, the term "disease" is meant to be generally synonymous with, and used interchangeably with, the terms "disorder", "syndrome" and "condition" (as in medical conditions), in that they each reflect an abnormal condition of the human or animal body or a part of the body that impairs normal function, is typically manifested by distinct signs and symptoms, and causes a reduction in the life span or quality of life of the human or animal.
The term "donor template" refers to reference genomic material that a cell uses as a template to repair a double strand break through a Homology Directed Repair (HDR) DNA repair pathway. The donor template comprises a DNA fragment (comprising the gene, CAR or marker to be expressed) to be inserted into the genome, with two homology arms flanking the double-strand break site. In some embodiments, the donor template can be adeno-associated virus, single-stranded DNA, or double-stranded DNA.
As used herein, the term "self-killing" refers to a process that occurs when a CAR-T cell (or other immune effector cell carrying a CAR) becomes and is killed by the target of another CAR-T cell that contains the same chimeric antigen receptor as the target of the CAR-T cell, as the targeted cell expresses an antigen that is specifically recognized by the chimeric antigen receptor on both cells. A CAR-T comprising a chimeric antigen receptor that lacks the antigen to which the chimeric antigen receptor specifically binds will be "suicide resistant".
As used herein, the term "genome edited" or "gene edited" refers to the addition, deletion, or modification (e.g., disruption) of a gene or portion of a genome to render it non-functional. Thus, in certain embodiments, a "genome-edited T cell" is a T cell that: it adds a gene that recognizes at least one antigen, such as CAR; and/or a gene that lacks an antigenic gene, such as that recognized by the CAR, and/or a gene of the TCR or a subunit thereof is disrupted.
As used herein, a "healthy donor" is a donor that does not have a malignancy (particularly a hematological malignancy, such as a T-cell malignancy).
As used herein, "immature dendritic cells" or "idcs" refer to immature dendritic cells.
The term "therapeutically acceptable" refers to substances that are suitable for use in contact with the tissues of a patient and that do not produce undue toxicity, irritation, and allergic response commensurate with a reasonable benefit/risk ratio and effective for their intended use.
The term "therapeutically effective" is intended to define the amount of active ingredient that is used to treat a disease or disorder or to achieve a clinical endpoint.
The term "patient" is generally synonymous with the term "subject" and includes all mammals, including humans.
A "malignant B cell" is a B cell derived from a B cell malignancy. B cell malignancies include, but are not limited to (DLBCL), Chronic Lymphocytic Leukemia (CLL)/Small Lymphocytic Lymphoma (SLL), and B cell precursor Acute Lymphoblastic Leukemia (ALL).
In the context of bringing a composition of matter (such as an antibody) into intimate contact with another composition of matter (such as a cell), as used herein, the term "exposed" is intended to be synonymous with "incubated with.
A "malignant T cell" is a T cell derived from a T cell malignancy. The term "T cell malignancy" refers to a broad, highly heterogeneous group of malignancies derived from T cell precursors, mature T cells, or natural killer cells. Non-limiting examples of T cell malignancies include T cell acute lymphoblastic leukemia/lymphoma (T-ALL), human T cell leukemia virus type 1 positive (HTLV-1+) adult T cell leukemia/lymphoma (ATL), T cell prolymphocytic leukemia (T-PLL), adult T cell lymphoma/leukemia (HTLV-1 associated), aggressive NK cell leukemia, Anaplastic Large Cell Lymphoma (ALCL), ALK positive, Anaplastic Large Cell Lymphoma (ALCL), ALK negative, angioimmunoblastic T cell lymphoma (AITL), breast implant associated anaplastic large cell lymphoma, NK cell chronic lymphoproliferative disorders, nasal extranodal/T cell lymphoma, NK cell lymphoma, follicular T cell lymphoma, hepatosplenic T cell lymphoma, Inert T-cell lymphoproliferative disorders of the gastrointestinal tract, Monomorphic epitopic intestinal T-cell lymphomas (monogenic epitopic intestinal T-cell lymphomas), mycosis fungoides, intranodal and peripheral T-cell lymphomas with TFH phenotype, peripheral T-cell lymphomas (PTCL), NOS, Primary cutaneous alpha/beta T-cell lymphomas, Primary cutaneous CD8+ invasive epidermophilic T-cell lymphomas, Primary cutaneous acromatic CD8+ T-cell lymphomas (Primary cutaneous cervical aclanic CD8+ T-cell lymphomas), Primary cutaneous CD4+ small/medium T-cell lymphoproliferative disorders [ Primary cutaneous anaplastic large cell lymphoma (C-ALCL), lymphoid papules (lymphopapasises) ], Sezary syndrome (Sezary syndrome), subcutaneous lipomatoid T cell lymphoma, childhood systemic EBV + T cell lymphoma, and T cell large granular lymphocytic leukemia (LGL).
A "malignant plasma cell" is a plasma cell derived from a plasma cell malignancy. The term "plasma cell malignancy" refers to a malignancy in which abnormal plasma cells are overproduced. Non-limiting examples of plasma cell malignancies include lymphoplasmacytic lymphoma, plasmacytoma, and multiple myeloma.
As used herein, "suicide gene" refers to a nucleic acid sequence introduced into a CAR-T cell by standard methods known in the art, which when activated results in death of the CAR-T cell. If desired, the suicide gene can help track and eliminate (i.e., kill) CAR-T cells in vivo. Promotion of CAR-T cell killing by activation of a suicide gene can be achieved by standard methods known in the art. Suicide gene systems known in the art include, but are not limited to, several herpes simplex virus thymidine kinase (HSVtk)/Ganciclovir (GCV) suicide gene therapy systems and inducible caspase 9 protein. In one embodiment, the suicide gene is a chimeric CD 34/thymidine kinase.
As used herein, an "immune effector cell" is a leukocyte that can modulate an immune response. Immune effector cells include T cells, B cells, Natural Killer (NK) cells, iNKT cells (constant T cell receptor alpha natural killer T cells), and macrophages. Immune effector cells bearing a T Cell Receptor (TCR) include, of course, T cells, as well as cells that have been engineered to express a T cell receptor. Immune effector cells may be obtained or derived/generated from any suitable source, such as including but not limited to healthy donors, peripheral blood mononuclear cells, cord blood, and induced pluripotent stem cells (ipscs).
As used herein, an "immune effector cell carrying a CAR" is an immune effector cell that has been transduced with at least one CAR. A "CAR-T cell" is a T cell that has been transduced with at least one CAR; the CAR-T cell can be a single, double, or tandem CAR-T cell. CAR-T cells can be autologous, meaning that they are engineered from the subject's own cells, or allogeneic, meaning that the cells are derived from a healthy donor and, in many cases, engineered so as not to elicit a host-versus-graft or graft-versus-host response.
As used herein and generally used in the art, "chimeric antigen receptor" or "CAR" refers to a recombinant fusion protein having an extracellular ligand-binding domain, a transmembrane domain, and a signaling domain that directs a cell to perform a specialized function when the extracellular ligand-binding domain binds to a component present on a target cell. For example, the CAR can have antibody-based specificity for a desired antigen (e.g., a tumor antigen) that has an intracellular domain that activates a T cell receptor to produce a chimeric protein that exhibits specific anti-target cell immune activity. The first generation CARs included an extracellular ligand binding domain and a signaling domain, typically CD3 ζ or fcsry. Second generation CARs were constructed on the basis of the first generation CAR constructs by including an intracellular co-stimulatory domain (usually 4-1BB or CD 28). These co-stimulatory domains help to enhance the cytotoxicity and proliferation of CAR-T cells compared to first generation CARs. Third generation CARs include multiple costimulatory domains, primarily to increase proliferation and persistence of CAR-T cells. Chimeric antigen receptors are distinguished from other antigen binding agents by their ability to bind MHC independent antigens and transduce activation signals through their intracellular domains.
The term "CAR-iNKT cell" (equivalently, iNKT-CAR) refers to an iNKT cell that expresses a chimeric antigen receptor. A double iNKT-CAR cell (equivalently, iNKT-dCAR) is an iNKT-CAR cell that expresses two different chimeric antigen receptor polypeptides having affinity for different target antigens expressed within the same effector cell, wherein each CAR acts independently. The CAR can be expressed from a single or multiple polynucleotide sequences. Tandem iNKT-CAR cells (equivalently, iNKT-tcas) are iNKT-CAR cells with a single chimeric antigen polypeptide comprising two different antigen recognition domains with affinity for different targets, wherein the antigen recognition domains are connected by a peptide linker and share a common co-stimulatory domain, and wherein binding of either antigen recognition domain will signal through the common co-stimulatory domain and signaling domain.
The term "chimeric antigen receptor T cell" (equivalently, CAR-T) refers to a T cell that expresses a chimeric antigen receptor.
The term dual CAR-T (dCAR-T) refers to a CAR-T cell that expresses two different chimeric antigen receptor polypeptides having affinity for different target antigens expressed within the same effector cell, wherein each CAR acts independently. The CAR can be expressed from a single or multiple polynucleotide sequences.
The term tandem CAR-T (tCAR-T) refers to a single chimeric antigen polypeptide comprising two different antigen recognition domains with affinity for different targets, wherein the antigen recognition domains are connected by a peptide linker and share a common co-stimulatory domain, wherein binding of either antigen recognition domain will signal through the common co-stimulatory domain and signaling domain.
As used herein, chimeric antigen receptor Natural Killer (NK) cells (equivalently, NK-CARs) will have similar meanings as defined for CAR-T and iNKT-CARs.
As used herein, a chimeric antigen receptor macrophage (equivalently, CAR-macrophage) will have a similar meaning to the definition of CAR-T, iNKT-CAR and NK-CAR.
As used herein, the term "cytokine release syndrome" refers to a condition that may occur following treatment with some type of immunotherapy, such as monoclonal antibodies and CAR-T or other CAR-bearing immune effector cells. The cytokine release syndrome is caused by a large and rapid release of cytokines into the blood from immune cells affected by immunotherapy. Symptoms of CRS include fever, fatigue, loss of appetite, muscle and joint pain, nausea, vomiting, diarrhea, rash, shortness of breath, increased heart beat, hypotension, epilepsy, headache, confusion, hallucinations, tremors and loss of coordination. CRS may appear in the range of mild to fatal and may be ranked by severity as follows:
level 1: mild response, no indication of discontinuation of infusion; not indicating intervention
Stage 2: indicating a therapy or infusion interruption, but responding rapidly to symptomatic treatment (e.g., antihistamines, NSAIDS, anesthetics, intravenous infusion); prophylactic medication indicating a duration of 24h
3, level: prolonged (e.g., not reacting quickly to symptomatic medication and/or brief discontinuation of infusion); the primary improvement of the post-symptomatic recurrence; hospitalization as indicated by clinical sequelae (e.g., impaired renal function, lung infiltration)
4 stage: consequences of life; indicating support for pressure or ventilation
Stage 5: death was caused by death
See, for example, "Common terminologic Criteria for additive Events, CTCAE) v4.03 edition," National Institutes of Health (National Institutes of Health) and National Cancer Institute (National Cancer Institute), 6 months and 14 days 2010; lee DW et al, "Current contexts in the diagnostics and management of cytokine release syndrome," Blood 2014124 (2): 188-95.
As used herein, the term "CAR-T related neuropathy" refers to neuropathy that occurs after CAR-T therapy is administered to a patient, typically after the intervening cytokine release syndrome has developed and resolved. The term is relatively new, primarily because CAR-T therapy is relatively new; see, e.g., Vasthie P and Breitbart WS, "Chinese anti receiver T-cell neuropsychiatric toxin in acid lysine lymphoblastic leukoderma," Palliat Support Care.2017, 8 months; 15(4):499-503. Thus, CAR-T related neuropathy should be understood at this time to be equivalent to the term "CAR-bearing immune effector cell-related neuropathy" as similar neuropathy may result from therapy with, for example, iNKT-CARs or NK-CARs.
As used herein, a "cytokine" is one of a class of small (-5-20 kDa) soluble signaling proteins that are synthesized and secreted by certain cells of the immune system at variable and occasionally locally high concentrations, and that signal and affect those cells by binding to receptors on other cells. "chemokines" are chemotactic cytokines, i.e., a sub-species of cytokines capable of inducing chemotaxis in responding cells in the vicinity.
As used herein, "lacking" a cytokine or protein refers to the absence of a sufficient amount of the cytokine or protein to cause the cytokine or protein to elicit its normal effects. For example, a cell "devoid of" GM-CSF ("GM-CSF-deficient" cell) may completely lack GM-CSF, but it may also express a negligible amount of GM-CSF, such that the presence of GM-CSF may not contribute in any meaningful way to the development or maintenance of the cytokine release syndrome.
The term "deletion" as used herein in reference to the effect of editing a gene or its protein product refers to the alteration or loss of a portion of the sequence of the DNA encoding the protein to reduce or prevent expression of the protein product. In the same context, the term "inhibit" refers to a reduction in the expression of a protein product; and in the same context, the term "ablation" refers to Knocking Out (KO) or preventing expression of the protein product. The absence encompasses inhibition and ablation.
As used herein, a "secretable protein" is a protein secreted by a cell that has an effect on other cells. For example, secretable proteins include cytokines, chemokines, and transcription factors.
As used herein, a "selectable marker" refers to a marker that allows differentiation between different cell types, such as cells into which a CAR has been successfully inserted (i.e., genetically edited or modified cells). Selectable markers are well known in the art and are readily available using materials and methods. In some embodiments, a suitable selective marker according to the present disclosure may be a fluorescent protein gene, such as including but not limited to a Green Fluorescent (GFP) gene or a Yellow Fluorescent Protein (YFP) gene. In some embodiments, the selectable marker may be a splice variant of the CD34 gene, such as a truncated CD34(tCD34) gene or a truncated egfr (tfegfr) gene. In some embodiments, a selectable marker described herein, such as GFP or other selectable markers known and available in the art, can be inserted alone into a gene as described herein (i.e., without a CAR), or can be inserted as a component of a construct comprising the selectable marker and a CAR.
As used herein, a "short hairpin RNA" or "small hairpin RNA" (shRNA) is an artificial RNA molecule, typically about 80 base pairs long and having a tight hairpin bend, that can be used to silence target gene expression by processing into siRNA within a cell, which in turn knockdown gene expression. ShRNA can integrate into genomic DNA and provide stable and sustained expression.
As used herein, "transduction" is the process of introducing exogenous DNA into a cell by a virus or viral vector such as a plasmid, for example, by short hairpin rna (shrna); which typically provides persistent or permanent silencing of the gene. This can be accomplished by methods known in the art, including electroporation.
Transfection is the process of intentionally introducing purified nucleic acid into eukaryotic cells (e.g., small interfering RNA (siRNA)); which transiently silences a gene by RNA interference of mRNA transcripts. "transduction" is the process of introducing foreign DNA into cells by viruses or viral vectors such as plasmids, for example, by short hairpin rna (shrna); which typically provides persistent or permanent silencing of the gene. Both can be achieved by methods known in the art, including electroporation.
Examples
The invention will be further illustrated by the following examples.
Example 1-method of blocking gene translation by CAR insertion.
Figure 1 shows cytokine gene deletion by targeting a locus in the cytokine gene using Cas9/CRISPR, followed by insertion of a Cas construct using homology directed repair. Optionally, the CAS construct will comprise a marker, such as a selective marker as described herein. One challenge of this concept is the difficulty in selecting and sorting edited cells from those that still express cytokines/chemokines. One way to address this problem is to insert a CAR construct comprising a marker into the gene that has been deleted. It has previously been demonstrated that insertion of CAR19 into the TRAC gene allows selection of TRAC-negative, CAR-positive cells. This will allow sorting of cells that express both car and cytokine deprivation. Another alternative would be to express shRNA from the CAR construct that would degrade the RNA encoding the cytokine without altering the genome. Markers on the CAR construct (such as truncated CD34 markers) can be used to select cells that down-regulate cytokines and express the CAR, i.e., CAR + cytokine negative.
As shown in figure 2, CAR-bearing immune effector cells (e.g., CAR-T) will be activated for two days, followed by gene editing to delete the target cytokine gene and transduce the CAR.
Example 2-general method for making genome edited CAR-bearing immune effector cells
Additional details regarding the manner in which CAR-bearing immune effector cells are prepared are known in the art, for example, as disclosed in WO2018027036a 1.
The following general steps can be taken to provide CAR-bearing immune effector cells. As one skilled in the art will recognize, certain steps may or may not be performed in the order listed below, although different efficiencies may result.
Step 1. cells are harvested, isolated and purified, for example, by magnetic selection using labeled antibody-coated magnetic beads (available, for example, from Miltenyi Biotec) that bind to cell-specific proteins. For T cells, anti-CD 3/CD28 beads can be used. Other purification techniques are known in the art and may be used.
Step 3. cells are then activated. There are several ways to activate immune effector cells. For example, anti-CD 3/CD28 beads can be used to activate T cells for two days, after which the beads are removed. Alternatively, antibodies may be used.
Step 4. antigens targeted by CAR can be deleted from the cell surface or their expression inhibited to prevent subsequent suicide. Target deletion can be achieved by electroporation using Cas9 mRNA and a gRNA for the target. However, other techniques may be used to inhibit expression of the target. These include other genome editing techniques such as TALENs, ZFNs, RNA interference, and priming for internal binding of antigens to prevent cell surface expression. Deletion of the target may not be required in every case. Examples of grnas that can be used include those shown in tables 8-10, as well as other examples known in the art.
Table 8: guide RNA sequences for removal of surface antigens on immune effector cells
RNA; (ps) indicates phosphorothioate. Underlined bases indicate the target sequence.
The cells can then be transduced with a CAR that targets (i.e., recognizes) one or more antigens or protein targets, e.g., with a lentivirus comprising the CAR construct. Any other suitable transduction/transfection method may be used, for example transfection using a DNA-integrated viral or non-viral vector comprising a transposable element, or transient expression of a non-DNA-integrated polynucleotide, such as mRNA, or insertion of a CAR polynucleotide into a nuclease active site using homologous or non-homologous recombination.
Step 6. the CAR-bearing immune effector cells are then cultured to expand their population.
Example 3-method of making genome edited immune effector cells carrying tandem CARs
In a variation of the protocol in the above examples, tCAR cells recognizing both antigens can be prepared. In step 4, both antigens can be deleted or inhibited from the cell surface as described above, but electroporated with gRNA and Cas9 mRNA for each of the two targets. Then in step 5, the cells are transduced with CARs recognizing both targets.
Example 4-method of making genome edited Dual CAR-bearing immune Effector cells
In variations of the protocol in the above examples, dCAR cells can be prepared that target both antigens. This variant will comprise two separate CARs, each recognizing a different antigen.
Example 5-methods of making and testing genome-edited CAR-T cells with suppressed expression of cytokines or chemokines
The following steps can be taken to provide genome-edited CAR-T cells in which expression and/or secretion of a particular cytokine or chemokine is inhibited. This example describes the preparation of CD 19-targeted CAR-T lacking expression of GM-CSF. As one skilled in the art will recognize, certain steps may or may not be performed in the order listed below, although different efficiencies may result.
If an in vivo CRS experiment is performed, tumors are injected into SCID-Beige mice (luciferase-containing 3e6 Raji). This should be done 3 weeks prior to CAR-T infusion into mice.
T cell activation (day 0).
T cells were purified by leukapheresis chamber using the Miltenyi human pan T isolation kit (Miltenyi human PanT isolation kit) and then resuspended in culture medium. Cells were counted and the number of human T cell activated CD3/CD28 beads required to obtain a bead to cell ratio of 3:1 was determined. The beads were washed 2x with T cell media, then the cells were diluted in hXcyte media at 1.256 cells/mL. Human T cell activated CD3/CD28 beads were added. To each well of the 6-well plate, 1.256 cells/mL of the solution were aliquoted at 4 mL/well. Cells were incubated at 37 ℃.
CRISPR (day 2).
Target deletion can be achieved by electroporation using Cas9 mRNA and a gRNA for the target. However, other techniques may be used to inhibit expression of the target. These include other genome editing techniques such as TALENs, RNA interference, and priming for internal binding of antigens to prevent cell surface expression. Examples of grnas that can be used include those shown in tables 8-10, as well as other examples known in the art.
Sample ID
gRNA#1
Cas9
Nuclear transfection buffer P3
20μg gGM-CSF
15μg Cas9 mRNA
100μl
Table 9: guide RNA sequences for CRS reduction
RNA; (ps) indicates phosphorothioate. Underlined bases indicate the target sequence.
Table 10: additional guide RNA sequences for reducing CRS incidence
Denotes cytokines/chemokines produced by T cells activating or localizing myeloid cells
Expression of T cell surface receptor genes activating myeloid cells or CAR-T cells
Indicates a T cell surface receptor integrated into CAR-T cell signaling, and thus endogenous receptors are redundant
^ represents cytokines driving differentiation of T cells/CAR-T cells
Bold rows represent transcription factors driving T cell/CAR-T cell differentiation
Example 6 protocol-Nuclear transfection Using Nuclear transfection Instrument 4D (nucleofector 4D)
4X10 was used for each reaction6And (4) cells. The procedure sets the EO-115-100. mu.l transfection volume and adds all supplements to the NucleofectorTMSolution P3. By filling the appropriate number of wells with the desired volume of recommended medium (2 ml in a 6-well plate) and humidifying at 37 deg.C/5% CO2Pre-incubation/equilibration plates in an incubatorCell culture plates were prepared. Beads were removed magnetically (twice to ensure complete removal) and cells were counted and cell density determined. The desired number of cells were centrifuged at 90Xg for 10 min at room temperature and the supernatant was completely removed. The cells were then resuspended in PBS (1ml) and transferred to a microfuge tube, and the desired number of cells were centrifuged at 90xg for 10 minutes at room temperature. The supernatant was completely removed and the cell pellet was carefully resuspended in 4D Nucleofector at complete room temperatureTMSolution P3, 4X10 per 100 μ l6). 20 μ g of gRNA (gGM-CSF) was added to 15 μ g of Cas9 mRNA per tube. Then, 100 μ l cells were added to Cas9/gRNA per tube, gently mixed and all material was transferred to NucleocuvetteTMIn (1). The cuvette was tapped to remove air bubbles. Electroporation was performed using the procedure (Human T cell stim EO-115). After the operation is finished, the special tool is used for converting NucleocuvetteTMCarefully remove from the holder's container. Cells were resuspended in pre-warmed medium. The medium was then removed from the target well, added to the cuvette, and then pipetted gently up and down two to three times. And then transferred to a well. The process was repeated with medium from the same well and incubated at 37 ℃.
CAR transduction (day 2).
The genome-edited CAR-T cells can then be transduced with one or more CARs that target (i.e., recognize) one or more targets, e.g., with a lentivirus comprising a CAR construct. Any other suitable transduction method may be used.
Protocol-transduction of T cells with lentivirus: one microliter of polybrene was added per milliliter of medium (8mg/ml stock). The desired amount of virus is then added to give the desired m.o.i.. The cells and virus were mixed and returned to the 37 ℃ incubator.
Transduction efficiency was evaluated (day 10).
This was then done by taking 5x10 from each sample5Individual cells and analyzed by flow cytometry to assess the transduction efficiency of the cell sample. The samples were washed with RB and 3 μ Ι of anti-CD 34 PE antibody (to detect CAR, since the construct contained human truncated CD34) was added. Then, 5u was addedl CD3 APC, cells were washed, and flow cytometry was performed. CAR-T cells should be CD3 epsilon positive, CD34 positive.
Evaluation of gene deletion.
To assess gene deletion, 5x10 was harvested from each sample5And (4) carrying out cell separation, and extracting DNA of the cells. Gene editing efficiency was assessed by target sequencing of the target locus using either TIDE analysis or deep sequencing.
Assessment of tumor burden and cytokine levels.
T cells were harvested (day 11). Tumor burden can be imaged in mice using bioluminescent imaging. I.p. injection of 3x10 per mouse7And (c) CAR-T.
Serum cytokine levels (day 12) were measured using, for example, a Luminex multiplex cytokine profiling assay (Luminex multiplex cytokine profiling assay) to examine the elevation of CRS-associated cytokines. A 4h chromium release assay against target cells (Raji) can be performed to assess in vitro activity (day 11).
Example 7 additional examples of CAR-bearing immune Effector cells
Several types of Chimeric Antigen Receptor (CAR) -bearing immune effector cells lacking cytokines can be prepared using the methods described above. Examples are given in tables 11-13 below.
Table 11.
Table 12.
Table 13.
Example 8 biological assay
The following assays, or variants thereof, can be used to assess the efficacy of the cytokine-deficient Chimeric Antigen Receptor (CAR) -bearing immune effector cells disclosed herein.
T-ALL. The efficacy of cells was tested in a xenogeneic model of T-ALL: 1x105Individual Click Beetle Red luciferase (CBR) -labeled CCRF-CEM T-ALL (99% CD7+, obtained by FACS) cells will be i.v. injected into NSG receptors followed by i.v. infusion of 2x10 on day +46To 1x107An immune effector cell carrying CAR7 or a non-targeted immune effector cell control cell carrying CAR 19. Mice receiving immune effector cells carrying CAR7 will exhibit significantly prolonged survival and reduced tumor burden as determined by bioluminescent imaging compared to mice receiving immune effector cells carrying CART19 or mice injected with tumor alone.
Multiple myeloma. The efficacy of iNKT-CAR-CS1 was tested in a heterogeneous model of multiple myeloma: 5x105Individual Click Beetle Red luciferase (CBR) -labeled mm.1s (99% CS1+, obtained by FACS) cells will be i.v. injected into NSG receptors followed by i.v. infusion 2x10 on days +4 or +14 or +286To 1x107Individual iNKT-CAR-CS1 or non-targeted iNKT-CAR19 control cells. Mice receiving iNKT-CAR-CS1 will exhibit significantly prolonged survival and reduced tumor burden as determined by bioluminescent imaging, compared to mice receiving iNKT-CAR19 or mice injected with tumor alone.
In vivo models of cytokine release syndrome and neurotoxicity.
An in vivo mouse model of CRS is disclosed by Giavridis et al, "CAR T cell-induced cytokine release syndrome and inactivated by IL-1Block," Nat Med 2018, month 5, day 28. For example, to initiate CRS as a model system, tumor cells were injected intraperitoneally into immunodeficient mice and allowed to develop tumors. The mice were then given cancer cell-targeted CAR-T cells and monitored for several days to induce the onset of CRS, then the mice were sacrificed and cells and tissues obtained for analysis. Mice can also be treated with CRS and monitored for success or failure of treatment (i.e., administration of antibodies to cytokines produced as a result of administration of CAR-T cells).
Assays suitable for monitoring CRS in this model may include monitoring weight change of mice following administration of CAR-T cells, percent survival of mice, serum levels of inflammatory factors (i.e., murine SAA3 (equivalent to human C-reactive protein)), cytokine levels before and after administration of CAR-T cells, the species of origin of pro-inflammatory cytokines (i.e., human versus murine cytokines); and/or percent survival of mice treated with CAR-T cells that receive antibodies to a particular cytokine.
Mice that eventually die from CRS symptoms or complications may be classified as having severe CRS, while mice that survive, but lose more than 10% weight may be classified as having non-severe CRS. Using this model, monocytes and macrophages were found to be the major source of IL-6 in CRS.
Another model that can be used to assess CRS and CAR-T related neuropathy is disclosed in Norelli, "monomer-derived IL-1 and IL-6 area differential required for cytokine-release syndrome and neurogenic dual to CAR T cells," Nat Med 2018, 5 months 28. In this model, human stem cells, such as Hematopoietic Stem and Progenitor Cells (HSPCs), are injected into humanized NSG mice, which are immunocompromised transgenic mice that express human stem cell factor, GM-CSF and IL-3 to support and enhance the hematopoiesis of the injected human stem cells. Mice were given tumor cells as targets for subsequent administration of CAR-T cells, and then monitored for CRS symptoms. After injection of CAR-T cells, these mice exhibited typical CRS symptoms, including high fever and elevated levels of certain cytokines (such as IL-1 and/or IL-6) associated with CRS. Control of CRS in these mice can be achieved by blocking receptors for cytokines using, for example, antibodies, depleting cytokine-expressing cell types, or administering antagonists to cytokines. As described above, monocytes have been identified as the primary source of CRS (pro-CRS) cytokine IL-6, and depletion of monocytes eliminates CRS and protects mice from death due to CRS.
Other CRS animal models are known in the art and may also be used as deemed appropriate.
Method for inducing and testing cytokine release syndrome for control purposes
In one model, IL-7 can be injected directly into a mouse or other animal model for control purposes to induce or elicit CRS, as described herein. In another example, recombinant or transgenic IL-7 can be expressed in cells to result in increased IL-7 signaling.
In another example, a cytokine receptor that constitutively signals (such as an IL-7 receptor) can be engineered into an immune effector cell such that the immune effector cell itself triggers IL-7 signaling, but is unresponsive to extracellular IL-7 and avoids causing IL-7 signaling by surrounding lymphocytes. In addition, the co-expression of constitutively signaling IL-7 receptors with CARs recognizing specific diseases or tumor antigens leads to an increase in T cell proliferation, survival and antitumor activity. Constitutive expression of the IL-7 receptor enables transmission of IL-7 signaling without the need for IL-7 ligands or common gammacChain (a component of the native IL-7 receptor) and IL-7R α. This can be achieved by engineering cysteines and/or prolines into the transmembrane domain of the IL-7 ra chain, which leads to homodimerization of IL-7 ra and subsequent phosphorylation of JAK1/JAK1, which in turn activates downstream signaling of IL-7.
Provided below are examples of methods for making and testing genome-edited CAR-T cells that are incapable of inducing CRS by inserting a selectable marker into a gene-edited locus.
Example 9 insertion of CAR into T cell receptor Gene
The CAR or any protein of interest can be inserted into a gene of a T cell receptor. MacLeod et al ("Integration of a CD19CAR into the TCR Alpha Chain Locus sequences Production of allogenic Gene-Edited CAR T Cells," molecular Therapy 25(4): page 949-961, 2017) report the generation of Allogeneic CAR T Cells by direct insertion of CAR transgenes into native TCR loci using engineered homing endonucleases and AAV donor templates. anti-CD 19CAR T cells generated in this way did not express endogenous cell surface TCRs, exhibited potent effector function in vitro, and mediated clearance of CD19+ tumors in an in vivo mouse model. The resulting gene-edited CAR T cells showed potent anti-tumor activity in both in vitro and in vivo in preclinical models, suggesting that these cells have the potential to be safely and effectively used as adoptive cell therapy in unrelated patients with CD19+ hematological malignancies.
Example 10 anti-cytokine/chemokine antibodies to reduce CRS
Introduction of immune effector cells into a patient or subject to treat cancer often results in CRS due to the production and secretion of cytokines and/or chemokines by the immune effector cells. One way to prevent CRS is to administer to the patient or subject an antibody that recognizes a particular CRS-inducing cytokine or chemokine, such that the amount of circulating cytokine/chemokine is reduced. For example, administration of anti-GMCSF antibodies reduces GMCSF secretion and thus effectively reduces CRS as reported by Sachdeva et al, (J Biol Chem 294(14):5430-5437, 2019). Thus, administration of antibodies that recognize specific cytokines and/or chemokines can prevent or reduce the occurrence of CRS in a patient or subject.
Example 11 insertion of CAR into the GMCSF Gene
One exemplary way to prevent CRS is to insert a CAR into a gene for a cytokine or chemokine that is associated with the priming or elongation of CRS. Disruption or ablation of the cytokine or chemokine gene in the CAR-T or other immune effector cell prevents the particular cytokine or chemokine from causing CRS. An example of such a gene is GMCSF, but other genes involved in causing or prolonging CRS may also be disrupted in this or similar ways as described herein. Disruption of the GMCSF gene is described at least in Sachdeva et al (J Biol Chem 294(14):5430-5437,2019) and a description of the preparation and testing of CAR-T cells inserted with GM-CSF gene is provided below. Briefly, TALENs or other gene editing enzymes can be designed or engineered to target selected cytokine or chemokine genes in CAR-T cells and to monitor gene expression by methods known in the art. It was reported that CAR-T cells had significantly reduced expression and secretion of cytokine or chemokine genes, which means that the occurrence of CRS would be reduced. In addition, the method was found to maintain both proliferative capacity and anti-tumor activity of CAR-T cells as assessed by the transwell assay and continuous killing assay.
In addition to deletion of genes such as GM-CSF using gene editing, antibodies to cytokines or chemokines that cause or promote CRS may also be used. For example, an antibody that recognizes a GM-CSF protein can be administered to a patient or subject receiving CAR-T therapy. Such practices are known in the art, specifically the use of the IL-6R antagonist tolizumab (tocilizumab) to reduce CRS caused by IL-6 signaling, but other antibodies or antagonists that recognize cytokines or chemokines, or antagonists of their receptors, may be used as deemed appropriate by the clinician. An appropriate antibody will bind to a circulating cytokine or chemokine, and an antagonist will bind to a natural receptor for the cytokine or chemokine, thereby preventing downstream CRS activity in the subject. In some cases, both methods can be used in a subject, i.e., the CAR is inserted into a gene of a cytokine or chemokine to inactivate the gene, and an antibody to the same cytokine or chemokine is also administered to the subject. This method has been shown to be effective while not adversely affecting CAR-T cell activity in vivo or in vitro (Sterner et al, "GM-CSF inhibition processes cell release syndrome and neo-inflammation process CAR-T cell function in enterprises," Blood 133:697-709, 2019).
Example 12-methods of making and testing genome-edited CAR-T cells incapable of inducing CRS by inserting a selectable marker into a gene-edited locus
Tumors were injected in SCID-Beige mice (luciferase-containing 3e6 Raji) if in vivo CRS experiments were performed. This should be done 3 weeks prior to CAR-T infusion into mice.
The following steps can be taken to provide a genome edited CRS resistant CAR-T cell, wherein the CAR is expressed from a gene edited locus with a selectable marker disclosed herein. Selection and purification of edited cells based on deletion of the gene encoding the internal or secreted protein is not possible, and therefore a selective marker is required to enrich for this genetic modification. This example describes the preparation of CD19CART Δ GMCSF Δ CD3 epsilon cells, where deletion of GM-CSF mitigates the risk of CRS and deletion of CD3 epsilon prevents TCR signaling and Graft Versus Host Disease (GVHD). As one skilled in the art will recognize, certain steps may or may not be performed in the order listed below, although different efficiencies may result.
Step 1: t cell activation (day 0)
T cells were purified from the leukapheresis chamber using the Miltenyi human pan T isolation kit. Resuspended in culture medium. The cells were counted. The number of human T cell activated CD3/CD28 beads required to obtain a bead to cell ratio of 3:1 was determined. Beads were washed 2x with T cell culture medium. Cells were diluted in hXcell medium at 1.256 cells/mL. Human T cell activated CD3/CD28 beads were added. 4 mL/well of 1.256 cells/mL solution was aliquoted into 6-well plates. Cells were incubated at 37 ℃.
Step 2: CRISPR (day 2)
The target gene is typically deleted and the CAR is inserted into the gene editing locus. DNA double strand breaks can be repaired using homology directed repair using a donor template to repair the break and insert the desired sequence into the edited locus. Target deletion can be achieved by electroporation using Cas9 mRNA and a gRNA for the target. The donor template may be a DNA plasmid, or a double stranded linear DNA, or a single stranded linear DNA with homology to the DNA surrounding the double stranded break electroporated with Cas 9/gRNA. In this example, the homology arms align to either side of the double strand break induced by the gRNA GM-CSF. In addition, viral vectors such as AAV may be used as a source of donor templates. However, other techniques may be used to induce DNA double strand breaks. These include other genome editing techniques such as TALENs and meganucleases.
The sequences of gRNAs for GM-CSF and CD3 epsilon are as follows:
hGMCSF gRNA：5’_2′OMe(U(ps)A(ps)C(ps))UCAGGUUCAGGAGACGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC2′OMe(U(ps)U(ps)U(ps)U_3’(SEQ ID NO:50)
CD3εgRNA：5’_2′OMe(A(ps)G(ps)G(ps))GCAUGUCAAUAUUACUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC2′OMe(U(ps)U(ps)U(ps)U 3’(SEQ ID NO:47)
nuclear transfection was performed using a nuclear transfectator 4D:
for 15 μ g of cas9 mRNA per tube, a nuclear transfection protocol was performed as described above (example 6) using 20 μ g of each gRNA (GGM-CSF and gCD3 ε).
And step 3: transduction of T cells with AAV vectors comprising HDR repair constructs to introduce CAR and selectable marker into GM-CSF locus
The sequences of the vector components described herein are provided in the sequence Listing, such as including but not limited to SEQ ID NO 3048 and 3064. For example, use 1x104And 1x1062-4h after electroporation of the MOIs in between, a recombinant AAV6 donor vector (FIG. 3, comprising ITR-right homology arm (SEQ ID NO:51), EF1a promoter (SEQ ID NO:52), CAR19 p2a trCD34(SEQ ID NO:53), left homology arm (SEQ ID NO:54), ITR (SEQ ID NO:55)) was added to the cell culture.
And 4, step 4: evaluation of CRISPR Activity and Td efficiency (day 10)
Remove 5x10 from each sample5Individual cells, and analyzed by flow cytometry. Wash the sample with RB. Mu.l of anti-CD 34 PE antibody was added (this detects the insertion of the TrCD34 tag in the GM-CSF locus). Add 5. mu.l CD3 APC and 2. mu.l anti-FAB BV421 (CAR transduction was detected). And (6) washing. Flow cytometry was performed. Cells should be CD3 epsilon negative, CD34 positive and FAB + positive. T cells were harvested (day 11).
Purification of CAR-T cells. TCR-negative cells can be purified using TCRa/b negative selection to remove TCR-positive cells. The CD34 positive selection can be used on Miltenyi Automacs to enrich for GM-CSF deficient cells. This enriched GM-SCF-cells and removed TCR + cells.
And 5: evaluation of CAR-T Activity in vivo
I.p. injection of 3x10 per mouse7And (c) CAR-T. Serum cytokine levels were assessed. (day 12, day 13, day 14) serum cytokine levels were measured using Luminex multiplex cytokine profiling to check for CRS correlationAn increase in cytokines. A 4h chromium release assay for target cells (Raji) was performed to assess in vitro activity (day 11).
Example 13 confirmation of GFP expression when EGFP is integrated into the CD3e locus of Jurkats under the control of the CD3e promoter
GFP can be inserted directly into the CD3e locus of the Jurkat cell line using the following protocol details.
Several days before: the plasmid was digested with PST1 (fig. 4). Two fragments (3.5kb and 2.6kb) were generated after digestion. Purification was performed using a gel extraction kit (gel extraction kit), and ethanol precipitation was performed. Resuspend at 500 ng/. mu.l. This gave the donor template ' DNA ' in the table below '
AAV was prepared and titrated. The sequences of AAV are shown in FIG. 5 and are provided in SEQ ID NOs __ - __. This resulted in the donor template 'AAV' in the table below.
The donor template 'plasmid' is shown in the table below.
Day 0:
jurkats were harvested and counted. Cells were centrifuged at 100g spin for 10 min. Cells were transferred to 1.5m microcentrifuge tubes and washed in PBS. Cells were centrifuged at 100Xg spins for 10 minutes. Resuspended in preheated buffer SE. To a tube containing gRNA/Cas9 was added 100 μ Ι. Transfer to a nuclear cuvette (nucleocuvette) and shock (zap) on 4D using Jurkat program. Transfer to pre-warmed medium in 2ml of corresponding medium in 6-well plates. Returned to the incubator and expanded for 4 days.
Table 14.
Day 4: FACS was performed on cells against GFP and CD3 APC. The editing efficiency of loss of CD3 and integration of AAV-GFP donor was assessed by GFP fluorescence.
Example 14-methods of making and testing genome edited CAR-T cells by inserting CAR into the CD3e locus
The following steps may be taken to provide a genome edited CAR-T cell in which the CAR is expressed from a gene edited locus (CAR-T) disclosed herein. This example describes the preparation of CD7CART Δ CD7 Δ CD3 epsilon cells. As one skilled in the art will recognize, certain steps may or may not be performed in the order listed below, although different efficiencies may result.
Step 1: t cell activation (day 0)
T cells were purified from the leukapheresis chamber using the Miltenyi human pan T isolation kit. Resuspended in culture medium. The cells were counted. The number of human T cell activated CD3/CD28 beads required to obtain a bead to cell ratio of 3:1 was determined. Beads were washed 2x with T cell culture medium. Cells were diluted in hXcell medium at 1.256 cells/mL. Human T cell activated CD3/CD28 beads were added. 4 mL/well of 1.256 cells/mL solution was aliquoted into 6-well plates. Cells were incubated at 37 ℃.
Step 2: CRISPR (day 2)
The target gene is typically deleted and the CAR is inserted into the gene editing locus. DNA double strand breaks can be repaired using homology directed repair using a donor template to repair the break and insert the desired sequence into the edited locus. Target deletion can be achieved by electroporation using Cas9 mRNA and a gRNA for the target. The donor template may be a DNA plasmid, or a double stranded linear DNA, or a single stranded linear DNA with homology to the DNA surrounding the double stranded break electroporated with Cas 9/gRNA. In addition, viral vectors such as AAV may be used as a source of donor templates. However, other techniques may be used to induce DNA double strand breaks. These include other genome editing techniques such as TALENs and meganucleases.
Nuclear transfection was performed using a nuclear transfectator 4D:
for 15 μ g Cas9 per tube, a nuclear transfection protocol was performed as described above (example 6) using 20 μ g of each gRNA (gCD7 and gCD 3).
And step 3: transduction of T cells with AAV vectors comprising HDR repair constructs
At 1x104And 1x1062-4h after electroporation at the MOI in between, recombinant AAV6 (or other AAV serotype) donor vector is added to the cell culture.
And 4, step 4: evaluation of CRISPR Activity and Td efficiency (day 10)
Remove 5x10 from each sample5Individual cells, and analyzed by flow cytometry. Wash the sample with RB. 3 μ l of anti-CD 34 PE antibody was added (this detects CAR, as the construct contains human truncated CD 34). Add 5. mu.l of CD3 APC and 2. mu.l of CD7 BV 421. And (6) washing. Flow cytometry was performed. Cells should be CD3 epsilon negative, CD7 negative, and CD34 positive. T cells were harvested (day 11).
Purification of CAR-T cells. CD34+ (CAR +) and TCR negative cells can be purified in a single step using positive selection of CD34+ cells on Miltenyi automatics. This enriches CAR + cells and removes TCR + cells (as CAR insertion disrupts TCR signaling).
And 5: evaluation of CAR-T Activity in vivo
Tumors were injected in NSG mice (5x 10) if in vivo imaging experiments were performed (day 7)5MOLT3 or HH: comprising luciferase).
Tumor burden was imaged in mice using bioluminescent imaging. I.v. injection 2x10 into each mouse via tail vein6Individual CD34+ CAR-T cells, or a 4h chromium release assay was performed for target cells (MOLT3 or HH) (day 11). Those skilled in the art will appreciate that there may be some flexibility in the time frame specified.
Example 15 cytokine/chemokine Gene silencing Using shRNA
Similar to siRNA, short hairpin RNAs can be used to knock down or eliminate the expression of cytokine/chemokine/transcription factor genes in immune effector cells.
Cherkassky et al ("Human CAR T cells with cell-intrinsic PD-1 checkpoint blocked resistant tumor-mediated inhibition," J Clin Investig 2016; 126: 3130-. In addition, CD19 specific CARs with PD-1shRNA lentiviral cassettes have been tested for use in CD19 positive B cell lymphomas. Tables 15 and 16 provide a list of useful shrnas and their sequences.
TABLE 15 5 'to 3' (Forward) shRNA sequences for silencing cytokine/chemokine genes to reduce CRS incidence
TABLE 16 3 'to 5' (inverted) shRNA sequences for silencing cytokine/chemokine genes to reduce CRS incidence
Example 16-method of making and testing cells lacking expression of specific cytokines using Protein Expression Blockers (PEBL) -CAR19-GM-CSF PEBL
Tumors were injected in SCID-Beige mice (luciferase-containing 3e6 Raji) if in vivo CRS experiments were performed. This should be done 3 weeks prior to CAR-T infusion into mice.
The following steps may be taken to provide CRS resistance. Since cytokines are secreted proteins, selective markers are needed to enrich for this genetic modification. This example describes the preparation of cellular CAR19-GM-CSF PEBL, where blockade of GM-CSF secretion mitigates the risk of CRS. As one skilled in the art will recognize, certain steps may or may not be performed in the order listed below, although different efficiencies may result.
Step 1: t cell activation (day 0)
T cells were purified from the leukapheresis chamber using the Miltenyi human pan T isolation kit. Resuspended in culture medium. The cells were counted. The number of human T cell activated CD3/CD28 beads required to obtain a bead to cell ratio of 3:1 was determined. Beads were washed 2x with T cell culture medium. Cells were diluted in hXcell medium at 1.256 cells/mL. Human T cell activated CD3/CD28 beads were added. 4 mL/well of 1.256 cells/mL solution was aliquoted into 6-well plates. Incubate at 37 ℃.
Step 2: transduction of T cells with PEBL CAR (day 1)
T cells are transduced with a CAR that targets (i.e., recognizes) one or more antigen or protein targets, e.g., a lentivirus comprising a CAR construct targeting CD19, in combination with an anti-GM-CSF PEBL. Expression from polycistronic vectors is preferred, allowing expression of CD34 to label CAR and PEBL expression. However, expression can be achieved using the same viral vector that expresses CAR and PEBL separately, or by independent transduction of separate vectors comprising CAR and PEBL. The CAR PEBL complex can be inserted directly into the targeted location of the genome using any other suitable transduction method, e.g., AAV, retrovirus, etc., or by using homology directed repair and a donor vector comprising the construct.
And step 3: evaluation of Td efficiency (day 10)
Remove 5x10 from each sample5Individual cells, and analyzed by flow cytometry. Wash the sample with RB. 3 μ L of anti-CD 34 PE antibody was added. Add 5. mu.L of CD3 APC and 2. mu.L of anti-FAB BV421 (CAR transduction was detected). And (6) washing. Flow cytometry was performed. Cells should be CD34 positive, indicating CAR and PEBL expression from polycistronic vectors. T cells were harvested (day 11).
Purification of CAR-T cells. CD34 positive selection can be used on Miltenyi Automacs to enrich for CAR + (CD34+) and cells lacking GC-CSF (PEBL +). This enriched GC-CSF-inhibited cells and CAR + cells.
And 4, step 4: evaluation of CAR-T Activity
I.p. injection of 3x10 per mouse7And (c) individual CAR-T cells. Serum cytokine levels were assessed. Serum cytokine levels were measured using Luminex multiplex profiling (day 12, day 13, day 14) to examine the elevation of CRS-associated cytokines. A4 hour chromium release assay for target cells (Raji) was performed to assess in vitro activity (day 11).
PEBL constructs targeting GM-CSF are provided in figure 6 and tables 17 and 18.
Example 17-in vitro CRS assay for testing the efficacy of CRS-induced following GM-CSF deletion in CART19
Cell line: CRS were assessed in an in vitro assay using the CD19 positive B-ALL cell line RAMOS. Prior to assay, RAMOS cells were stably transfected with GFP using lentiviral transduction and cultured in RPMI + 10% FBS + penicillin/streptomycin (Pen/Strep).
Isolation of normal donor monocytes and T cells: primary human T cells and monocytes were isolated from normal healthy human donors. T cells were isolated from PBMCs using CD4+ CD8+ selection (Miltenyi Biotec) and monocytes were isolated using Miltenyi Biotec classical Monocyte Isolation beads (Miltenyi Biotec class Monocyte Isolation beads) according to the manufacturer's protocol.
T cell culture and CAR-T gene editing: t cells were subsequently plated at 1x106The concentration of individual cells/mL was resuspended in Xcell medium supplemented with 50U/mL IL-2 and 10ng/mL IL-15 in the presence of anti-CD 3/CD28 beads (bead to cell ratio 3: 1). Twenty-four hours after the initial stimulation, T cells were transfected with a lentiviral vector encoding a CD19CAR construct in the presence of polybrene (final concentration 6. mu.g/ml). The stimulating beads were removed on day 2. CART19 cells at 4X106Individual T cells were suspended using a nuclear transfectator 4D, procedureEO-115, electroporated in 100. mu.l buffer P3 with 15. mu.g spCas9 mRNA (Trilink CA.) and 20. mu.g GM-CSF gRNA (Trilink). Control CAR 19T cells were electroporated in the absence of GM-CSF gRNA. T cells were subsequently assessed for CD34 (a bicistronic marker of CAR-T) and intracellular GM-CSF expression on day 6 using flow cytometry, followed by co-culture assays.
Production of cells of monocytic lineage: to generate iDCs, mononuclear cells (1X 10)6) Plates were plated in 6mL RPMI 1640 supplemented with 0.1mmol/L MEM non-essential amino acids, 2mmol/L L-glutamine, 100 units/mL penicillin, 100. mu.g/mL streptomycin (Life Technologies), and 10% fetal bovine serum (cR 10). Subsequently, cR10 was supplemented with 0.2. mu.g/mL human IL-4(Peptotec) and 0.2. mu.g/mL GM-CSF (Peptotec).
For macrophage and activated macrophage production, 10% human A/B serum was supplemented in cR10 in place of fetal bovine serum (hR 10). For activated macrophages, hR10 medium was supplemented with 30ng/ml LPS. On day 4, cytokines and LPS were supplemented. On day 6 post-isolation, macrophages, activated macrophages and iDCs (immature dendritic cells) were harvested using 2mmol/L EDTA. Twenty-four hours later, cells were harvested with 2mmol/L EDTA and stained with CD45, CD80, and CD86 to confirm differentiation of immature DCs and mature DCs.
Co-culture assay: CAR-T cells were pooled in 200ul/96 wells at the following ratio: 12.5K UCART-19 (with or without GM-CSF KO), target, 50K Ramos cells (CD19+) and monocyte derived cells, 1K iDC or 5K macrophages or 5K activated macrophages.
The co-cultures were then incubated at 37 ℃ and 100ul assay supernatant was collected at 24h and 48h for cytokine analysis.
Measurement of cytokine levels
Cytokine concentrations were determined from culture supernatants using IL-6ELISA plates (R & D systems). Prior to analysis, the supernatant was centrifuged at 300g for 10 minutes at 4 ℃ and then diluted 1:10 in assay calibration dilutions. Measurements were made using standard product protocols.
CART19 lacking GM-CSF induces significantly lower il-6 expression in different monocytic lineages. FIGS. 8 and 10
Example 18 in vitro CRS assay for testing the efficacy of CRS induction following GM-CSF deficiency in T cells
Isolation of normal donor monocytes and T cells: primary human T cells and monocytes were isolated from normal healthy human donors. T cells were isolated from PBMC using CD4+ CD8+ selection (Miltenyi Biotec) and monocytes were isolated using Miltenyi Biotec classical monocyte isolation beads according to the manufacturer's protocol.
T cell culture and gene editing: the T cells were then resuspended at a concentration of 106 cells/mL in Xcell medium supplemented with 50U/mL IL-2 and 10ng/mL IL-15 in the presence of anti-CD 3/CD28 beads (bead to cell ratio 3:1) (Life Technologies, Cat. No. 111.32D). Twenty-four hours after the initial stimulation. The stimulating beads were removed on day 2. Will be 4X106Individual T cells were electroporated using a nuclear transfectator 4D, program EO-115, in 100 μ l buffer P3 with 15 μ g spCas9 mRNA (Trilink CA.) and 20 μ g TRAC gRNA (Trilink). Control CAR 19T cells were electroporated in the absence of GM-CSF gRNA. GM-CSF expression of T cells prior to co-culture assays was subsequently assessed on day 6 using flow cytometry.
Production of cells of monocytic lineage: to generate iDCs, mononuclear cells (1X 10)6) Plates were plated in 6mL RPMI 1640 supplemented with 0.1mmol/L MEM non-essential amino acids, 2mmol/L L-glutamine, 100 units/mL penicillin, 100. mu.g/mL streptomycin (Life Technologies), and 10% fetal bovine serum (cR 10). Subsequently, cR10 was supplemented with 0.2. mu.g/mL human IL-4(Peptotec) and 0.2. mu.g/mL GM-CSF (Peptotec). On day 4, cytokines and LPS were supplemented. On day 6 post-isolation, iDCs (immature dendritic cells) were harvested using 2mmol/L EDTA.
Co-culture assay: t cells were pooled in 200ul/96 wells at the following ratio: 12.5K T cells (with or without GM-CSF KO), 50K anti-CD 3/CD28 beads and 1K iDC co-culture, followed by incubation at 37 ℃ and collection of 100ul assay supernatant at 24h and 48h for cytokine analysis.
Measurement of cytokine levels: cytokine concentrations were determined from culture supernatants using IL-6ELISA plates (R & D systems). Prior to analysis, the supernatant was centrifuged at 300xg for 10 minutes at 4 ℃ and then diluted 1:10 in the assay calibration dilution. Measurements were made using standard product protocols.
Deletion of GM-CSF reduced IL-6 production by > 3-fold at 24h (fig. 7 and 8) and by > 4-fold at 48h (fig. 9 and 10) relative to unedited T cells.
T cells lacking GM-CSF induce significantly lower IL-6 expression in different monocytic lineages.
Example 19-methods of making and testing genome-edited CAR-T cells incapable of inducing CRS by inserting a selectable marker into a gene-edited locus
Primary B-ALL (2X 10) was injected in NSG mice if in vivo CRS experiments were performed6). This should be done 3 weeks prior to CAR-T infusion into mice.
The following steps can be taken to provide a genome edited CRS-resistant CAR-T cell. This example describes the preparation of CD19CART Δ GMCSF Δ CD3 epsilon mutant IL-7R T cells in which deletion of GM-CSF mitigates the risk of CRS, deletion of CD3e prevents TCR signaling and GvHD and mutant IL-7R enhances proliferation of CAR-T sufficiently to induce CRS in this model. Sequences encoding mutated, constitutively active IL-7R sequences can be found in Table 19 or may be present in the art. As one skilled in the art will recognize, certain steps may or may not be performed in the order listed below, although different efficiencies may result.
Step 1: t cell activation (day 0)
T cells were purified from the leukapheresis chamber using the Miltenyi human pan T isolation kit. Resuspended in culture medium. The cells were counted. The number of human T cell activated CD3/CD28 beads required to obtain a bead to cell ratio of 3:1 was determined. Beads were washed 2x with T cell culture medium. Cells were diluted in hXcell medium at 1.256 cells/mL. Human T cell activated CD3/CD28 beads were added. 4 mL/well of 1.256 cells/mL solution was aliquoted into 6-well plates. Cells were incubated at 37 ℃.
Step 2: t cell transduction (day 1)
CAR-T cells can then be transduced with one or more CARs that target (i.e., recognize) one or more targets, e.g., with a lentivirus comprising a CAR construct. Any other suitable transduction method may be used.
And step 3: CRISPR (day 2)
In CRS-resistant CAR-T cells, cytokine/chemokine/transcription factor genes or transcription factors may be deleted to prevent secretion of factors that induce cytokine secretion by myeloid cells. Deletion can be achieved by electroporation using Cas9 mRNA and a gRNA directed to the target. However, other techniques may be used to inhibit expression of the target. These include other genome editing techniques such as TALENs, RNA interference, and priming for internal binding of antigens to prevent cell surface expression. Examples of grnas that can be used include those shown in tables 8-10, as well as other examples known in the art.
Cells are harvested, isolated and purified, for example, by magnetic selection using labeled antibody-coated magnetic beads (available, for example, from Miltenyi Biotec) that bind to cell-specific proteins. For T cells, anti-CD 3/CD28 beads can be used. Other purification techniques are known in the art and may be used.
Protocol-nuclear transfection using nuclear transfectator 4D:
for 15 μ g Cas9 mRNA per tube, a nuclear transfection protocol was performed as described above (example 6) using 20 μ g of each gRNA (GGM-CSF and gCD3 ∈).
And 4, step 4: evaluation of CRISPR Activity and Td efficiency (day 10)
Remove 5x10 from each sample5Individual cells, and analyzed by flow cytometry. Wash the sample with RB. Add 5. mu.l CD3 APC and 2. mu.l anti-FAB BV421 (CAR transduction was detected). And (6) washing. Flow cytometry was performed. Cells should be CD3 epsilon negative, CD34 positive and FAB + positive. T cells were harvested (day 11).
Purification of CAR-T cells. TCR-negative cells can be purified using TCRa/b negative selection to remove TCR-positive cells.
And 5: evaluation of CAR-T Activity in vivo
I.v. injection of 5x10 per mouse6And (c) CAR-T. Serum cytokine levels were assessed (days +1, +2, +3, +4, +5, +10, + 15). Serum cytokine levels were measured using Luminex multiplex cytokine profiling to examine the elevation of CRS-associated cytokines. A 4h chromium release assay for target cells (Raji) was performed to assess in vitro activity (day 11). The efficacy of tumor clearance was monitored using flow cytometry of blood to detect hCD45, CD19+ cells.
Provided below are improved gRNA protocols for T cell CRISPR and CAR-T transduction of UCART 19.
Day 0-T cell activation.
T cells were purified from the leukapheresis chamber using the Miltenyi human pan T isolation kit. Resuspended in culture medium. The cells were counted. The number of human T cell activated CD3/CD28 beads required to obtain a bead to cell ratio of 3:1 was determined. Beads were washed 2x with T cell culture medium. Cells were diluted in hXcell medium at 1.256 cells/mL. Human T cell activated CD3/CD28 beads were added.
T cells can then be transduced with one or more CARs that target (i.e., recognize) one or more targets, e.g., with a lentivirus comprising a CAR construct. Any other suitable transduction method may be used.
Day 2: 4X10 was used for each reaction6And (4) cells. The procedure sets the EO-115-100. mu.l transfection volume and adds all supplements to the NucleofectorTMSolution P3. By filling the appropriate number of wells with the desired volume of recommended medium (2 ml in a 6-well plate) and humidifying at 37 deg.C/5% CO2The plates were pre-incubated/equilibrated in an incubator to prepare cell culture plates. Beads were removed magnetically (twice to ensure complete removal) and cells were counted and cell density determined. The desired number of cells were centrifuged at 90Xg for 10 min at room temperature and the supernatant was completely removed. The cells were then resuspended in PBS (1ml) and transferred to a microfuge tube, and the desired number of cells were centrifuged at 90xg for 10 minutes at room temperature. The supernatant was completely removed and the cell pellet was carefully resuspended in 4D Nucleofector at complete room temperatureTM Solution P3, 4X10 per 100. mu.l6). 20 μ g of gRNA (gGM-CSF and gTRAC) was added to 15 μ g of Cas9 mRNA per tube. Then, 100 μ l cells were added to Cas9/gRNA per tube, gently mixed and all material was transferred to NucleocuvetteTMIn (1). The cuvette was tapped to remove air bubbles. Electroporation was performed using the procedure (Human T cell stim EO-115). After the operation is finished, the special tool is used for converting NucleocuvetteTMCarefully remove from the holder's container. Cells were resuspended in pre-warmed medium. The medium was then removed from the target well, added to the cuvette, and then pipetted gently up and down two to three times. And then transferred to a well. The process was repeated with medium from the same well and incubated at 37 ℃.
Day 5: CRISPR activity and Td efficiency were assessed. This was then done by taking 5x10 from each sample5Individual cells and analyzed by flow cytometry to assess the transduction efficiency of the cell sample. Samples were subjected to fixed permeabilization and analyzed by FACS for CD3, CD34 and intracellular GM-CSF.
Evaluation of gene deletion.
To assess gene deletion for GM-CSF and TRAC, 5X10 was harvested from each sample5And (4) carrying out cell separation, and extracting DNA of the cells. Gene editing efficiency was assessed by target sequencing of the target locus using either TIDE analysis or deep sequencing.
Day 11
Mice were bled and tumor burden was measured.
CD3 depleted T cells and injected into mice.
Mice were injected with 5x106Individual CAR + T cells/mouse.
Groups of mice are provided in table 20 below:
table 20.
Mice were then bled on days 0, 1, 2,3, 5, 7, 14 and 21 for FACS and plasma measurements, weighed and body temperature determined.
The panel (panel) for the detection of specific markers for CAR-T cells was as follows:
cytokine analysis and CRS evaluation were evaluated using Millipore luminex multiplex cytokine analysis.
Sequences for preparing vectors as described herein include, but are not limited to, the following:
SEQ ID NO 3048 left ITR of the vector for inserting CD34 into the GM-CSF locus
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
3049-left homology arm of vector for inserting CD34 into the GM-CSF locus
cctgagatggatgcagccacagccctggagccagcctgaagctcctggtgtcttctgggggctacatataggagtgtagtccgaacctcagaggggcaaacctgctctgcagagggaatcaaggttcacataaccagagaggggagtcactcaggaaggtggctccagagccaagagtcagactctgggtcccgacttgacccagccacaccccctctgaagcttgctgagagtggctgcagtctcgctgctggatgtgcacatggtggtcattccctctgctcacaggggcaggggtccccccttactggactgaggttgccccctgctccaggtcctgggtgggagcccatgtgaactgtcagtggggcaggtctgtgagagctcccctcacactcaagtctctcacagtggccagagaagaggaaggctggagtcagaatgaggcaccagggcgggcatagcctgcccaaaggcccctgggattacaggcaggatggggagccctatctaagtgtctcccacgccccaccccagccattccaggccaggaagtccaaactgtgcccctcagagggagggggcagcctcaggcccattcagactgcccagggagggctggagagccctcaggaaggcgggtgggtgggctgtcggttcttggaaaggttcattaatgaaaacccccaagcctgaccacctagggaaaaggctcaccgttcccatgtgtggctgataagggccaggagattccacagttcaggtagttcccccgcctccctggcattttgtggtcaccattaatcatttcctctgtgtatttaagagctcttttgccagtgagcccaGTACACAGAGAGAAAGGCTAAAGTTCTCTGGAGGATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAGCACGCAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCC
3050-EFS promoter of a vector for inserting CD34 into the GM-CSF locus
GGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGG
3051-trCD 34 for a vector for inserting CD34 into the GM-CSF locus
atgccgcggggctggaccgcgctttgcttgctgagtttgctgccttctgggttcatgagtcttgacaacaacggtactgctaccccagagttacctacccagggaacattttcaaatgtttctacaaatgtatcctaccaagaaactacaacacctagtacccttggaagtaccagcctgcaccctgtgtctcaacatggcaatgaggccacaacaaacatcacagaaacgacagtcaaattcacatctacctctgtgataacctcagtttatggaaacacaaactcttctgtccagtcacagacctctgtaatcagcacagtgttcaccaccccagccaacgtttcaactccagagacaaccttgaagcctagcctgtcacctggaaatgtttcagacctttcaaccactagcactagccttgcaacatctcccactaaaccctatacatcatcttctcctatcctaagtgacatcaaggcagaaatcaaatgttcaggcatcagagaagtgaaattgactcagggcatctgcctggagcaaaataagacctccagctgtgcggagtttaagaaggacaggggagagggcctggcccgagtgctgtgtggggaggagcaggctgatgctgatgctggggcccaggtatgctccctgctccttgcccagtctgaggtgaggcctcagtgtctactgctggtcttggccaacagaacagaaatttccagcaaactccaacttatgaaaaagcaccaatctgacctgaaaaagctggggatcctagatttcactgagcaagatgttgcaagccaccagagctattcccaaaagaccctgattgcactggtcacctcgggagccctgctggctgtcttgggcatcactggctatttcctgatgaatcgccgcagctggagccccatttaa
3052-hGMB Poly A vector for inserting CD34 into the GM-CSF locus
ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACGTGCGGACCGA
3053-RHA of a vector for inserting CD34 into the GM-CSF locus
CGTCTCCTGAACCTGAGTAGAGACACTGCTGCTGAGATGgtaagtgagagaatgtgggcctgtgcctaggccacccagctggcccctgactggccacgcctgtcagcttgataacatgacattttccttttctacagAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGgtaagatgcttctctctgacatagctttccagaagcccctgccctggggtggaggtggggactccattttagatggcaccacacagggttgtccactttctctccagtcagctggctgcaggaggagggggtagcaactgg
gtgctcaagaggctgctggccgtgcccctatggcagtcacatgagctcctttatcagctgagcggccatgggcagacctagcattcaatggccaggagtcaccaggggacaggtggtaaagtgggggtcacttcatgagacaggagctgtgggtttggggcgctcactgtgccccgagaccaagtcctgttgagacagtgctgactacagagaggcacagaggggtttcaggaacaacccttgcccacccagcaggtccaggtgaggccccacccccctctccctgaatgatggggtgagagtcacctccttccctaaggctgggctcctctccaggtgccgctgagggtggcctgggcggggcagtgagaagggcaggttcgtgcctgccatggacagggcagggtctatgactggacccagcctgtgcccctcccaagccctactcctgggggctgggggcagcagcaaaaaggagtggtggagagttcttgtaccactgtgggcacttggccactgctcaccgacgaacgacattttccacagGAGCCGACCTGCCTACAGACCCGCCTGGAGCTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAGCAGCACTGCCCTCCAACCCCGgtgagtgc
SEQ ID NO 51-Right ITR of the vector for inserting CD34 into the GM-CSF locus
AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
3054-complete sequence of the vector for inserting CD34 into the GM-CSF locus
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTcctgagatggatgcagccacagccctggagccagcctgaagctcctggtgtcttctgggggctacatataggagtgtagtccgaacctcagaggggcaaacctgctctgcagagggaatcaaggttcacataaccagagaggggagtcactcaggaaggtggctccagagccaagagtcagactctgggtcccgacttgacccagccacaccccctctgaagcttgctgagagtggctgcagtctcgctgctggatgtgcacatggtggtcattccctctgctcacaggggcaggggtccccccttactggactgaggttgccccctgctccaggtcctgggtgggagcccatgtgaactgtcagtggggcaggtctgtgagagctcccctcacactcaagtctctcacagtggccagagaagaggaaggctggagtcagaatgaggcaccagggcgggcatagcctgcccaaaggcccctgggattacaggcaggatggggagccctat
ctaagtgtctcccacgccccaccccagccattccaggccaggaagtccaaactgtgcccctcagagggagggggcagcctcaggcccattcagactgcccagggagggctggagagccctcaggaaggcgggtgggtgggctgtcggttcttggaaaggttcattaatgaaaacccccaagcctgaccacctagggaaaaggctcaccgttcccatgtgtggctgataagggccaggagattccacagttcaggtagttcccccgcctccctggcattttgtggtcaccattaatcatttcctctgtgtatttaagagctcttttgccagtgagcccaGTACACAGAGAGAAAGGCTAAAGTTCTCTGGAGGATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAGCACGCAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCCGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGatgccgcggggctggaccgcgctttgcttgctgagtttgctgccttctgggttcatgagtcttgacaacaacggtactgctaccccagagttacctacccagggaacattttcaaatgtttctacaaatgtatcctaccaagaaactacaacacctagtacccttggaagtaccagcctgcaccctgtgtctcaacatggcaatgaggccacaacaaacatcacagaaacgacagtcaaattcacatctacctctgtgataacctcagtttatggaaacacaaactcttctgtccagtcacagacctctgtaatcagcacagtgttcaccaccccagccaacgtttcaactccagagacaaccttgaagcctagcctgtcacctggaaatgtttcagacctttcaaccactagcactagccttgcaacatctcccactaaaccctatacatcatcttctcctatcctaagtgacatcaaggcagaaatcaaatgttcaggcatcagagaagtgaaattgactcagggcatctgcctggagcaaaataagacctccagctgtgcggagtttaagaaggacaggggagagggcctggcccgagtgctgtgtggggaggagcaggctgatgctgatgctggggcccaggtatgctccctgctccttgcccagtctgaggtgaggcctcagtgtctactgctggtcttggccaacagaacagaaatttccagcaaactccaacttatgaaaaagcaccaatctgacctgaaaaagctggggatcctagatttcactgagcaagatgttgcaagccaccagagctattcccaaaagaccctgattgcactggtcacctcgggagccctgctggctgtcttgggcatcactggctatttcctgatgaatcgccgcagctggagccccatttaaACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACGTGCGGACCGACGTCTCCTGAACCTGAGTAGAGACACTGCTGCTGAGATGgtaagtgagagaatgtgggcctgtgcctaggccacccagctggcccctgactggccacgcctgtcagcttgataacatgacattttccttttctacagAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGgtaagatgcttctctctgacatagctttccagaagcccctgccctggggtggaggtggggactccattttagatggcaccacacagggttgtccactttctctccagtcagctggctgcaggaggagggggtagcaactgggtgctcaagaggctgctggccgtgcccctatggcagtcacatgagctcctttatcagctgagcggccatgggcagacctagcattcaatggccaggagtcaccaggggacaggtggtaaagtgggggtcacttcatgagacaggagctgtgggtttggggcgctcactgtgccccgagaccaagtcctgttgagacagtgctgactacagagaggcacagaggggtttcaggaacaacccttgcccacccagcaggtccaggtgaggccccacccccctctccctgaatgatggggtgagagtcacctccttccctaaggctgggctcctctccaggtgccgctgagggtggcctgggcggggcagtgagaagggcaggttcgtgcctgccatggacagggcagggtctatgactggacccagcctgtgcccctcccaagccctactcctgggggctgggggcagcagcaaaaaggagtggtggagagttcttgtaccactgtgggcacttggccactgctcaccgacgaacgacattttccacagGAGCCGACCTGCCTACAGACCCGCCTGGAGCTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAGCAGCACTGCCCTCCAACCCCGgtgagtgcAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
SEQ ID NO 3048 left ITR of Donor construct for GFP insertion into the CD3 epsilon locus
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT
3055-cloning fragment of a Donor construct for inserting GFP into the locus CD3 ε (remnants)
GCGGCCGCATCGATTGaattc
3056-left homology arm of CD3 for Donor construct used to insert GFP into the CD3 epsilon locus
AGGTAAGTCCACGAATCAGTGATTCAGTGGTGTGGAGAGCTTTATTTCTGAGAAGGCCAGTAGCGCTCCCTTCTGACAAGCAAATCTAAGACCTGGATGACAGATGACTTCCTGCATTTGGTTGGTTCTTTTGTCATTCATATCTATCTGTAATACAGTTCTGGCTAATTTAAGAGGATAAGCTTGAAGACCTCTGGAATTTTTCGGCTTTAGGACTTTAAGGCTTTCTGAGCTTCAGTAGATCTAGATCTAGGAGCTCATGCTGGTATATTCTGAATCCGATGTATCTGAGTTACATCTATGAGCTACTTAATAAATATATCTATGAGCTAAATCTCATAGGCTAAGCATGAACCTCACCTCCAAGACTCGGGGTTCCTAAATGGATGAGACCCTCTTT
GGGAAGTCTTGTGGGCAGTGTCTAATTCCACTAGAAAAGTTTTACCTACAATTTAAACTTAAACCATGATATTTTCTTACTGCTGTTTCCTTTTTTCATTTTCAGGTGGTATTACACAGACACGTGAGTTTATTGGTCTTTTATTTATGCCCTGTCTGAGGATGCAGATTGGTGGGTAGATGAGAAGGAACTGATTGAGAGAGATTAACCCCAAGAACTGATATCTTCCCAGCATTGCATTCTCAACTCCATTTTAGAAAGGTTCCAAATAGGGACTTCTGTGGGTTTTTCTTTACATCCATCTTACCCTTCCCAAGTCCCCATGTCCCTGCGTAAACCCTAAAGCCACCTCTCAAAAGGTTCTCTAGTTCCCTTCAAGGTTCTCTAGTTCCCTTCATTCCACATATCTCCTCTTCCACACCCTCTAGCCAGTAGAGCTCCCTTCTGACAAGCAAGTCTAAGATCTAGATGACAGATGACTTCCTGCATTTGGGTGGTTCTTTTGTCACTAATTTGCCTTTTCTAAAATTGTCCTGGTTTCTTCTGCCAATTTCCCTTCTTTCTCCCCAGCATATAAAGTCTCCATCTCTGGAACCACA
3057-CAR 7 for Donor construct to insert GFP into the CD3 epsilon locus
atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccggatatccagatgacacagactacatcctccctgtctgcctctctgggagacagagtcaccatcagttgcagtgcaagtcagggcattagcaattatttaaactggtatcagcagaaaccagatggaactgttaaactcctgatctattacacatcaagtttacactcaggagtcccatcaaggttcagtggcagtgggtctgggacagattattctctcaccatcagcaacctggaacctgaagatattgccacttattattgtcagcagtatagcaagcttccgtacacgttcggaggggggaccaagctggaaataaaacgtggtggtggtggttctggtggtggtggttctggcggcggcggctccggtggtggtggatccgaggtgcaactggtggagtctgggggaggcttagtgaagcctggggggtccctgaaactctcctgtgcagcctctggactcactttcagtagctatgccatgtcttgggttcgccagactccagagaagaggctggagtgggtcgcatccattagtagtggtggtttcacctactatccagacagtgtgaagggccgattcaccatctccagagataatgccaggaacatcctgtatctgcaaatgagcagtctgaggtctgaggacacggccatgtattactgtgcaagagacgaggtacgggggtacctcgatgtctggggcgcagggaccacggtcaccgtttcccctaggGCTAGCaccacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatttttgggtgctggtggtggttggtggagtcctggcttgctatagcttgctagtaacagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccctatgccccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcccccgcgtacaagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgcCGGACCGATggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacctgtttctgaagccatgccgcggggctggaccgcgctttgcttgctgagtttgctgccttctgggttcatgagtcttgacaacaacggtactgctaccccagagttacctacccagggaacattttcaaatgtttctacaaatgtatcctaccaagaaactacaacacctagtacccttggaagtaccagcctgcaccctgtgtctcaacatggcaatgaggccacaacaaacatcacagaaacgacagtcaaattcacatctacctctgtgataacctcagtttatggaaacacaaactcttctgtccagtcacagacctctgtaatcagcacagtgttcaccaccccagccaacgtttcaactccagagacaaccttgaagcctagcctgtcacctggaaatgtttcagacctttcaaccactagcactagccttgcaacatctcccactaaaccctatacatcatcttctcctatcctaagtgacatcaaggcagaaatcaaatgttcaggcatcagagaagtgaaattgactcagggcatctgcctggagcaaaataagacctccagctgtgcggagtttaagaaggacaggggagagggcctggcccgagtgctgtgtggggaggagcaggctgatgctgatgctggggcccaggtatgctccctgctccttgcccagtctgaggtgaggcctcagtgtctactgctggtcttggccaacagaacagaaatttccagcaaactccaacttatgaaaaagcaccaatctgacctgaaaaagctggggatcctagatttcactgagcaagatgttgcaagccaccagagctattcccaaaagaccctgattgcactggtcacctcgggagccctgctggctgtcttgggcatcactggctatttcctgatgaatcgccgcagctggagccccatttaa
3058-GFP from the Donor construct for insertion into the locus CD3 epsilon
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA
3059-hGMB poly A of Donor construct for GFP insertion into CD3 epsilon locus
ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCAC
3060-right homology arm of CD3e of Donor construct for GFP insertion into the CD3 epsilon locus
aGTAtaatattgacatgccctcagtatcctggatctgaaatactatggcaacacaatgataaaaacataggcggtgatgaggatgataaaaacataggcagtgatgaggatcacctgtcactgaaggaattttcagaattggagcaaagtggttattatgtctgctaccccagaggaagcaaaccagaagatgcgaacttttatctctacctgagggcaagagtgtgtgagaactgcatggagatggatgtgatgtcggtggccacaattgtcatagtggacatctgcatcactgggggcttgctgctgctggtttactactggagcaagaatagaaaggccaaggccaagcctgtgacacgaggagcgggtgctggcggcaggcaaaggggacaaaacaaggagaggccaccacctgttcccaacccagactatgagcccatccggaaaggccagcgggacctgtattctggcctgaatcagagacgcatctgaccctctggagaacactgcctcccgctggcccaggtctcctctccagtccccctgcgactccctgtttcctgggctagtcttggaccccacgagagagaatcgttcctcagcctcatggtgaactcgcgccctccagcctgatcccccgctccctcctccctgccttctctgctggtacccagtcctaaaatattgctgcttcctcttcctttgaagcatcatcagtagtcacaccctcacagctggcctgccctcttgccaggatatttatttgtgctattcactcccttccctttggatgtaacttctccgttcagttccctccttttcttgcatgtaagttgtcccccatcccaaagtattccatctacttttctatcgccgtccccttttgcagccctctctggggatggactgggtaaatgttgacagaggccctgccccgttcacagatcctggccctgagccagccctgtgctcctccctcccccaacactccctaccaacc
3061-cloning remnant of a Donor construct for inserting GFP into the CD3 epsilon locus
GCGgacCGAGCGGCCGC
3062-Right ITR of Donor construct for inserting GFP into the CD3 epsilon Gene locus
AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
3063-cloning remnant of Donor construct for inserting GFP into the locus CD3 ε
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCATCGATTGaattcAGGTAAGTCCACGAATCAGTGATTCAGTGGTGTGGAGAGCTTTATTTCTGAGAAGGCCAGTAGCGCTCCCTTCTGACAAGCAAATCTAAGACCTGGATGACAGATGACTTCCTGCATTTGGTTGGTTCTTTTGTCATTCATATCTATCTGTAATACAGTTCTGGCTAATTTAAGAGGATAAGCTTGAAGACCTCTGGAATTTTTCGGCTTTAGGACTTTAAGGCTTTCTGAGCTTCAGTAGATCTAGAT
CTAGGAGCTCATGCTGGTATATTCTGAATCCGATGTATCTGAGTTACATCTATGAGCTACTTAATAAATATATCTATGAGCTAAATCTCATAGGCTAAGCATGAACCTCACCTCCAAGACTCGGGGTTCCTAAATGGATGAGACCCTCTTTGGGAAGTCTTGTGGGCAGTGTCTAATTCCACTAGAAAAGTTTTACCTACAATTTAAACTTAAACCATGATATTTTCTTACTGCTGTTTCCTTTTTTCATTTTCAGGTGGTATTACACAGACACGTGAGTTTATTGGTCTTTTATTTATGCCCTGTCTGAGGATGCAGATTGGTGGGTAGATGAGAAGGAACTGATTGAGAGAGATTAACCCCAAGAACTGATATCTTCCCAGCATTGCATTCTCAACTC
CATTTTAGAAAGGTTCCAAATAGGGACTTCTGTGGGTTTTTCTTTACATCCATCTTACCCTTCCCAAGTCCCCATGTCCCTGCGTAAACCCTAAAGCCACCTCTCAAAAGGTTCTCTAGTTCCCTTCAAGGTTCTCTAGTTCCCTTCATTCCACATATCTCCTCTTCCACACCCTCTAGCCAGTAGAGCTCCCTTCTGACAAGCAAGTCTAAGATCTAGATGACAGATGACTTCCTGCATTTGGGTGGTTCTTTTGTCACTAATTTGCCTTTTCTAAAATTGTCCTGGTTTCTTCTGCCAATTTCCCTTCTTTCTCCCCAGCATATAAAGTCTCCATCTCTGGAACCACAATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACaGTAtaatattgacatgccctcagtatcctggatctgaaatactatggcaacacaatgataaaaacataggcggtgatgaggatgataaaaacataggcagtgatgaggatcacctgtcactgaaggaattttcagaattggagcaaagtggttattatgtctgctaccccagaggaagcaaaccagaagatgcgaacttttatctctacctgagggcaagagtgtgtgagaactgcatggagatggatgtgatgtcggtggccacaattgtcatagtggacatctgcatcactgggggcttgctgctgctggtttactactggagcaagaatagaaaggccaaggccaagcctgtgacacgaggagcgggtgctggcggcaggcaaaggggacaaaacaaggagaggccaccacctgttcccaacccagactatgagcccatccggaaaggccagcgggacctgtattctggcctgaatcagagacgcatctgaccctctggagaacactgcctcccgctggcccaggtctcctctccagtccccctgcgactccctgtttcctgggctagtcttggaccccacgagagagaatcgttcctcagcctcatggtgaactcgcgccctccagcctgatcccccgctccctcctccctgccttctctgctggtacccagtcctaaaatattgctgcttcctcttcctttgaagcatcatcagtagtcacaccctcacagctggcctgccctcttgccaggatatttatttgtgctattcactcccttccctttggatgtaacttctccgttcagttccctccttttcttgcatgtaagttgtcccccatcccaaagtattccatctacttttctatcgccgtccccttttgcagccctctctggggatggactgggtaaatgttgacagaggccctgccccgttcacagatcctggccctgagccagccctgtgctcctccctcccccaacactccctaccaaccGCGgacCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
3064-complete sequence of the vector for inserting GFP into the CD3e Gene locus
CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCATCGATTGaattcAGGTAAGTCCACGAATCAGTGATTCAGTGGTGTGGAGAGCTTTATTTCTGAGAAGGCCAGTAGCGCTCCCTTCTGACAAGCAAATCTAAGACCTGGATGACAGATGACTTCCTGCATTTGGTTGGTTCTTTTGTCATTCATATCTATCTGTAATACAGTTCTGGCTAATTTAAGAGGATAAGCTTGAAGACCTCTGGAATTTTTCGGCTTTAGGACTTTAAGGCTTTCTGAGCTTCAGTAGATCTAGAT
CTAGGAGCTCATGCTGGTATATTCTGAATCCGATGTATCTGAGTTACATCTATGAGCTACTTAATAAATATATCTATGAGCTAAATCTCATAGGCTAAGCATGAACCTCACCTCCAAGACTCGGGGTTCCTAAATGGATGAGACCCTCTTTGGGAAGTCTTGTGGGCAGTGTCTAATTCCACTAGAAAAGTTTTACCTACAATTTAAACTTAAACCATGATATTTTCTTACTGCTGTTTCCTTTTTTCATTTTCAGGTGGTATTACACAGACACGTGAGTTTATTGGTCTTTTATTTATGCCCTGTCTGAGGATGCAGATTGGTGGGTAGATGAGAAGGAACTGATTGAGAGAGATTAACCCCAAGAACTGATATCTTCCCAGCATTGCATTCTCAACTC
CATTTTAGAAAGGTTCCAAATAGGGACTTCTGTGGGTTTTTCTTTACATCCATCTTACCCTTCCCAAGTCCCCATGTCCCTGCGTAAACCCTAAAGCCACCTCTCAAAAGGTTCTCTAGTTCCCTTCAAGGTTCTCTAGTTCCCTTCATTCCACATATCTCCTCTTCCACACCCTCTAGCCAGTAGAGCTCCCTTCTGACAAGCAAGTCTAAGATCTAGATGACAGATGACTTCCTGCATTTGGGTGGTTCTTTTGTCACTAATTTGCCTTTTCTAAAATTGTCCTGGTTTCTTCTGCCAATTTCCCTTCTTTCTCCCCAGCATATAAAGTCTCCATCTCTGGAACCACAatggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccggatatccagatgacacagactacatcctccctgtctgcctctctgggagacagagtcaccatcagttgcagtgcaagtcagggcattagcaattatttaaactggtatcagcagaaaccagatggaactgttaaactcctgatctattacacatcaagtttacactcaggagtcccatcaaggttcagtggcagtgggtctgggacagattattctctcaccatcagcaacctggaacctgaagatattgccacttattattgtcagcagtatagcaagcttccgtacacgttcggaggggggaccaagctggaaataaaacgtggtggtggtggttctggtggtggtggttctggcggcggcggctccggtggtggtggatccgaggtgcaactggtggagtctgggggaggcttagtgaagcctggggggtccctgaaactctcctgtgcagcctctggactcactttcagtagctatgccatgtcttgggttcgccagactccagagaagaggctggagtgggtcgcatccattagtagtggtggtttcacctactatccagacagtgtgaagggccgattcaccatctccagagataatgccaggaacatcctgtatctgcaaatgagcagtctgaggtctgaggacacggccatgtattactgtgcaagagacgaggtacgggggtacctcgatgtctggggcgcagggaccacggtcaccgtttcccctaggGCTAGCaccacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatttttgggtgctggtggtggttggtggagtcctggcttgctatagcttgctagtaacagtggcctttattattttctgggtgaggagtaagaggagcaggctcctgcacagtgactacatgaacatgactccccgccgccccgggcccacccgcaagcattaccagccctatgccccaccacgcgacttcgcagcctatcgctccagagtgaagttcagcaggagcgcagacgcccccgcgtacaagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgcCGGACCGATggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacctgtttctgaagccatgccgcggggctggaccgcgctttgcttgctgagtttgctgccttctgggttcatgagtcttgacaacaacggtactgctaccccagagttacctacccagggaacattttcaaatgtttctacaaatgtatcctaccaagaaactacaacacctagtacccttggaagtaccagcctgcaccctgtgtctcaacatggcaatgaggccacaacaaacatcacagaaacgacagtcaaattcacatctacctctgtgataacctcagtttatggaaacacaaactcttctgtccagtcacagacctctgtaatcagcacagtgttcaccaccccagccaacgtttcaactccagagacaaccttgaagcctagcctgtcacctggaaatgtttcagacctttcaaccactagcactagccttgcaacatctcccactaaaccctatacatcatcttctcctatcctaagtgacatcaaggcagaaatcaaatgttcaggcatcagagaagtgaaattgactcagggcatctgcctggagcaaaataagacctccagctgtgcggagtttaagaaggacaggggagagggcctggcccgagtgctgtgtggggaggagcaggctgatgctgatgctggggcccaggtatgctccctgctccttgcccagtctgaggtgaggcctcagtgtctactgctggtcttggccaacagaacagaaatttccagcaaactccaacttatgaaaaagcaccaatctgacctgaaaaagctggggatcctagatttcactgagcaagatgttgcaagccaccagagctattcccaaaagaccctgattgcactggtcacctcgggagccctgctggctgtcttgggcat
cactggctatttcctgatgaatcgccgcagctggagccccatttaaACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTAACCACaGTAtaatattgacatgccctcagtatcctggatctgaaatactatggcaacacaatgataaaaacataggcggtgatgaggatgataaaaacataggcagtgatgaggatcacctgtcactgaaggaattttcagaattggagcaaagtggttattatgtctgctaccccagaggaagcaaaccagaagatgcgaacttttatctctacctgagggcaagagtgtgtgagaactgcatggagatggatgtgatgtcggtggccacaattgtcatagtggacatctgcatcactgggggcttgctgctgctggtttactactggagcaagaatagaaaggccaaggccaagcctgtgacacgaggagcgggtgctggcggcaggcaaaggggacaaaacaaggagaggccaccacctgttcccaacccagactatgagcccatccggaaaggccagcgggacctgtattctggcctgaatcagagacgcatctgaccctctggagaacactgcctcccgctggcccaggtctcctctccagtccccctgcgactccctgtttcctgggctagtcttggaccccacgagagagaatcgttcctcagcctcatggtgaactcgcgccctccagcctgatcccccgctccctcctccctgccttctctgctggtacccagtcctaaaatattgctgcttcctcttcctttgaagcatcatcagtagtcacaccctcacagctggcctgccctcttgccaggatatttatttgtgctattcactcccttccctttggatgtaacttctccgttcagttccctccttttcttgcatgtaagttgtcccccatcccaaagtattccatctacttttctatcgccgtccccttttgcagccctctctggggatggactgggtaaatgttgacagaggccctgccccgttcacagatcctggccctgagccagccctgtgctcctccctcccccaacactccctaccaaccGCGgacCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG
All references, patents, or applications (U.S. or other than the U.S.) cited in this application are hereby incorporated by reference as if fully set forth herein. In the event of any inconsistency, the literal disclosure herein controls.
From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.