Anti-helicobacter pylori recombinant antibody, preparation method and application

文档序号：80650 发布日期：2021-10-08 浏览：31次中文

阅读说明：本技术 一种抗幽门螺旋杆菌重组抗体、制备方法及用途 (Anti-helicobacter pylori recombinant antibody, preparation method and application ) 是由雷天柱张生银马建忠于 2021-07-16 设计创作，主要内容包括：本发明公开了一种抗幽门螺旋杆菌重组抗体、制备方法及用途,属于生物医药技术领域,具体涉及抗体工程技术领域,所述抗体为rFab,包括V-H和V-L,V-H和V-L由一端全人源C-H1-C-L片段融合构成,V-H的氨基酸序列如SEQ ID NO：1所示,V-L的氨基酸序列如SEQ ID NO：2所示,C-H1-C-L的氨基酸序列如SEQ ID NO：3所示,通过基因重组技术将Fab抗体中轻链和重链通过一段全人源C-H1-C-L片段连接构成rFab,同时解决了Fab抗体制备工序繁琐和稳定性低的缺点。(The invention discloses a helicobacter pylori resistant recombinant antibody, a preparation method and application thereof, belonging to the technical field of biological medicineRelates to the technical field of antibody engineering, wherein the antibody is rFab comprising V H And V L ，V H And V L From one end to the whole human source C H 1‑C L Fragment fusion construct, V H The amino acid sequence of (a) is as shown in SEQ ID NO: 1 is shown as V L The amino acid sequence of (a) is as shown in SEQ ID NO: 2 is shown as C H 1‑C L The amino acid sequence of (a) is as shown in SEQ ID NO: 3, passing the light chain and the heavy chain in the Fab antibody through a section of fully human C by a gene recombination technology H 1‑C L The fragments are connected to form rFab, and the defects of complicated preparation process and low stability of the Fab antibody are overcome.)

1. A recombinant antibody against helicobacter pylori, characterized in that: the antibody is rFab comprising V_HAnd V_L，V_HAnd V_LFrom a segment of a whole human source C_H1-C_LFragment fusion construct, V_HThe amino acid sequence of (a) is as shown in SEQ ID NO: 1 is shown as V_LThe amino acid sequence of (a) is as shown in SEQ ID NO: 2 is shown as C_H1-C_LThe amino acid sequence of (a) is as shown in SEQ ID NO: 3, respectively.

2. The recombinant antibody against helicobacter pylori according to claim 1, wherein: c_H1-C_LIs composed of (Gly)₄Ser)3, and the amino acid sequence of the rbab is as set forth in SEQ ID NO: 4, respectively.

3. An intermediate expression vector of a helicobacter pylori-resistant recombinant antibody, which is characterized in that: the intermediate expression vector is the fully human C of claim 2_H1-C_LThe gene sequence is inserted into a vector pGAPZ alpha A, and the obtained intermediate expression vector is C_H1-C_LpGAPZ alpha A, code C_H1-C_LThe nucleic acid sequence of SEQ ID NO: 5, the intermediate expression vector is C_H1-C_LThe nucleotide sequence of pGAPZ alpha A is shown as SEQ ID NO: and 6.

4. A eukaryotic expression vector for expressing a recombinant anti-helicobacter pylori antibody is characterized in that: eukaryotic expression vector V of anti-helicobacter pylori recombinant antibody_HAnd V_LThe sequence is inserted into the intermediate expression vector C of claim 3_H1-C_LThe eukaryotic expression vector is rFab/pGAPZ alpha A and encodes V_HThe nucleic acid sequence of (a) is as shown in SEQ ID NO: 7, code V_LThe nucleic acid sequence of (a) is as shown in SEQ ID NO: 8, and the nucleic acid sequence of the coded anti-helicobacter pylori recombinant antibody is shown as SEQ ID NO: 9, the eukaryotic expression vector is rFab/pGAPZ alpha A, and the sequence is shown as SEQ ID NO: shown at 10.

5. An eukaryotic expression strain of a recombinant antibody against helicobacter pylori, which is characterized in that: after linearization, the eukaryotic expression vector rFab/pGAPZ alpha A of claim 4 is transferred into a eukaryotic expression strain Pichia pastoris GS115 strain by electric shock, and the recombinant gene engineering strain for expressing rFab is obtained by screening.

6. A method for preparing a helicobacter pylori resistant recombinant antibody is characterized in that: the recombinant gene engineering strain expressing rFab of claim 5 is fermented and then subjected to Ni-NTA nickel ion exchange chromatography to obtain the recombinant antibody rFab against helicobacter pylori.

7. Use of the recombinant anti-helicobacter pylori antibody according to claim 1 or 2 in the preparation of a kit for detecting helicobacter pylori infection.

8. Use of the recombinant anti-helicobacter pylori antibody according to claim 1 or 2 for the preparation of an antibody preparation for the prophylaxis and/or treatment of a disease caused by helicobacter pylori infection.

Technical Field

The invention discloses a helicobacter pylori resistant recombinant antibody, a preparation method and application, belongs to the technical field of biological medicines, and particularly relates to the technical field of antibody engineering.

Background

Helicobacter pylori (Hp), a gram-negative microaerophilic bacterium, is found in the stomach and duodenum, is associated with gastric diseases such as chronic gastritis, peptic gastric ulcer, gastric cancer and gastric mucosa-associated tissue lymphoma (MALT), and is classified as a class I carcinogenic factor by world health organization. The helicobacter pylori infection rate in China is up to 58.07%, and the helicobacter pylori infection rate belongs to the region with higher infection rate in the world. The triple drug therapy developed based on the combination of antibiotics, proton pump inhibitors and bismuth agents, although being an effective method for eradicating Hp infection at present, has a plurality of disadvantages: (1) the price of the medicine is high, the treatment period is long, and the compliance of patients is poor. (2) The long-term drug treatment causes the increase of drug-resistant bacteria and the imbalance of intestinal flora. (3) The situation of repeated treatment and repeated infection is difficult to avoid in the drug treatment. Therefore, research and development of novel medicaments with preventive, therapeutic and non-toxic side effects are practical and effective methods for controlling helicobacter pylori infection, and become hot spots for studying strategies for preventing and treating helicobacter pylori infection by scholars at home and abroad.

The development of biological medicine and the rapidity of antibody technology provide a new therapeutic strategy for the treatment of those traditional diseases. The monoclonal antibody is a full-length antibody, and although the monoclonal antibody has the advantages of high purity, high titer, strong specificity, uniform structure, less serum cross reaction, low preparation cost and the like, the molecular weight of the monoclonal antibody is between 150 and 196 kDa. In practical application, such large molecular weight often suffers from problems of poor tissue permeability, easy degradation, etc., and therefore, the genetically engineered antibody with high affinity, high specificity and small molecular weight is the trend of the current recombinant antibody technology development.

Although single chain antibodies (scFv antibodies) have better cell penetration than intact antibodies. However, the rapid clearance effect of single-chain antibodies is limited due to their small size and low affinity for antigen. Fab fragments are held together by an intact light and heavy nitrogen-terminal half of the chains (VH and CH1) via an inter-disulfide bond, and have greater molecular mass and higher affinity for antigen than scFv antibodies. However, the conventional Fab antibody requires papain to hydrolyze the natural antibody, and then the Fab antibody is obtained after separation and purification, which is complicated in preparation process.

Disclosure of Invention

The invention aims to: provides a helicobacter pylori resistant recombinant antibody, a preparation method and application thereof, aiming at solving the defects of complicated preparation process and low stability of the existing Fab antibody.

The technical scheme adopted by the invention is as follows:

a recombinant anti-helicobacter pylori antibody is rFab comprising V_HAnd V_L，V_HAnd V_LFrom one end to the whole human source C_H1-C_LFragment fusion construct, V_HThe amino acid sequence of (a) is as shown in SEQ ID NO: 1 is shown as V_LThe amino acid sequence of (a) is as shown in SEQ ID NO: 2 is shown as C_H1-C_LThe amino acid sequence of (a) is as shown in SEQ ID NO: 3, respectively.

In the technical scheme of the application, the light chain and the heavy chain in the Fab antibody pass through a section of fully human C by the gene recombination technology_H1-C_LThe fragments are connected to form rFab, and the defects of complicated preparation process and low stability of the Fab antibody are overcome; the prepared anti-helicobacter pylori fully-humanized single-chain antibody has strong penetrability and small molecular weight, simultaneously reserves the main biological activity and specificity of a natural antibody, and is simple and convenient to operate.

Preferably, C_H1-C_LIs composed of (Gly)₄Ser)3, and the amino acid sequence of the rbab is as set forth in SEQ ID NO: 4, respectively.

An intermediate expression vector of a recombinant antibody against helicobacter pylori, the intermediate expression vector being the fully human C of claim 2_H1-C_LThe gene sequence is inserted into a vector pGAPZ alpha A, and the obtained intermediate expression vector is C_H1-C_LpGAPZ alpha A, code C_H1-C_LThe nucleic acid sequence of SEQ ID NO: 5, the intermediate expression vector is C_H1-C_LThe nucleotide sequence of pGAPZ alpha A is shown as SEQ ID NO: and 6.

An eucaryon expression carrier for expressing the recombinant antibody against pylorus helicobacterium is composed of the recombinant antibody against pylorus bacterium_HAnd V_LSequence insertion into said intermediate expression vector C_H1-C_LThe eukaryotic expression vector is rFab/pGAPZ alpha A and encodes V_HThe nucleic acid sequence of (a) is as shown in SEQ ID NO: 7, code V_LThe nucleic acid sequence of (a) is as shown in SEQ ID NO: 8, and the nucleic acid sequence of the coded anti-helicobacter pylori recombinant antibody is shown as SEQ ID NO: 9, the eukaryotic expression vector is rFab/pGAPZ alpha A, and the sequence is shown as SEQ ID NO: shown at 10.

A eukaryotic expression strain of anti-helicobacter pylori recombinant antibody is characterized in that the eukaryotic expression vector rFab/pGAPZ alpha A is linearized, then is electrically shocked and transferred into a eukaryotic expression strain Pichia pastoris GS115 strain, and the recombinant gene engineering strain for expressing the rFab is obtained through screening.

The recombinant gene engineering strain expressing rFab is fermented and then treated through Ni-NTA nickel ion exchange chromatography to obtain the recombinant antibody rFab resisting helicobacter pylori.

The anti-helicobacter pylori recombinant antibody is used for preparing a kit for detecting helicobacter pylori infection.

The application of the anti-helicobacter pylori recombinant antibody in preparing an antibody preparation for preventing and/or treating diseases caused by helicobacter pylori infection.

In the technical scheme of the application, V_HIs a heavy chain variable region; v_LIs a light chain variable region.

In summary, due to the adoption of the technical scheme, the invention has the beneficial effects that:

1. in the invention, the light chain and the heavy chain in the Fab antibody pass through a section of fully human C by a gene recombination technology_H1-C_LThe fragments are connected to form rFab, and the defects of complicated preparation process and low stability of the Fab antibody are overcome;

2. the prepared anti-helicobacter pylori fully-humanized single-chain antibody has strong penetrability and small molecular weight, simultaneously reserves the main biological activity and specificity of a natural antibody, and is simple and convenient to operate;

3. in the present invention, by containing C_H1-C_LIntermediate expression vector for fragment, in C_H1 upstream and C_LThe downstream of the chip is provided with a multiple cloning site, and different V can be cloned_HAnd V_LIs inserted into C_H1-C_LpGAPZ alpha A vector, thereby providing intermediate materials for developing other specific recombinant rFab.

Drawings

FIG. 1 shows ELISA screening positive single-chain antibody after random small expression of partial clones selected from natural fully human scFv antibody library;

FIG. 2 shows ELISA detection of cross-reactivity of 6 screened positive clones with ten common bacteria.

In FIG. 3, A is C_H1-C_LAs a result of amplification, B is C_H1-C_LStructural schematic diagram of/pGAPZ alpha A;

FIG. 4A is V against the scFv gene of helicobacter pylori_HAnd V_LAmplification results of the fragments; b is recombinant fragment V_H-C_H1-C_L-V_LThe PCR identification result of (1); c is a structural schematic diagram of a recombinant vector rFab/pGAPZ alpha A;

FIG. 5 shows the expression of recombinant protein rFab in the yeast of the transformant detected by Western blot;

FIG. 6A is SDS-PAGE to identify purified recombinant antibody rFab; b is a recombinant antibody rFab detected and purified by Western blot;

in FIG. 7, A is Western blot to verify the binding activity of recombinant antibody rFab with helicobacter pylori and ten common bacteria whole protein extracts; and B is the binding activity of ELISA detected and purified rFab with helicobacter pylori thallus and ten kinds of common thallus.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Example 1

Culture of anti-helicobacter pylori

A. Helicobacter pylori culture medium: weighing Columbia agar 39g, adding into 1L double distilled water, sterilizing at 121 deg.C for 20min, cooling to 50 deg.C, and adding the cultured defibrinated sheep blood and helicobacter pylori selective additive to final concentrations of 7% and 4%, respectively.

B. Placing frozen helicobacter pylori in 37 deg.C water bath for 30s, spreading 100 μ L onto Columbia selective culture medium, and placing in CO₂Incubator, 37 ℃ (O)₂ 5％、CO₂ 10％、N₂85%) for 24 h. After two times of activation, the cells are transferred to a columbia selective medium with new configuration and cultured for 12 hours.

Example 2

Screening anti-helicobacter pylori single-chain antibody by using phage display antibody library technology

Natural fully human scFv antibody library has been constructed in the early stage of the laboratory, and the library capacity reaches 2.5 multiplied by 10⁸And the diversity is good. Helicobacter pylori is used as an antigen, an immunomagnetic bead method is adopted to carry out phage display enrichment on a natural fully human scFv antibody library, clones are randomly selected from the enriched scFv antibody library to carry out amplification expression on monoclonal antibody, and phage ELISA detection is carried out on the expressed scFv by using an anti-M13-HRP monoclonal antibody. The specific experiment in this example is as follows:

(1) after blocking overnight by adding 1.5mL of 5% MPBS to the EP tube, the MPBS was discarded and washed 3 times with PBS.

(2) Taking 100 μ L of 1.72 × 10¹³The CFU phage single-chain antibody library and 200. mu.L of 5% MPBS were added to a closed EP tube and mixed well, followed by ice-cooling for 1 h.

(3)3300g for 10min, the supernatant was added to 200. mu.L of cell concentration about 10⁶Mixing the bacteria/mL of mixed bacteria solution (comprising salmonella, saccharomyces cerevisiae, bacillus subtilis, lactobacillus acidophilus, lactobacillus helveticus, lactobacillus plantarum, streptococcus lactis, bifidobacterium, lactobacillus rhamnosus and inactivated escherichia coli in equal proportion) in water bath at 37 ℃ for 30 min.

(4)3300g for 10min, the supernatant was transferred to 200. mu.L of cells at a concentration of about 10⁶Mixing the cells in each mL helicobacter pylori cell suspension, and carrying out water bath at 37 ℃ for 30 min.

(5)3300g for 10min, discard the supernatant, 1% Tween20 in PBS 5 times, and PBS 5 times, to remove non-specific binding of phage.

(6) The H.pylori was resuspended in 1mL TBS-trypsin (10. mu.g/mL) and eluted at 37 ℃ for 30 min.

(7) 50 μ L of eluted phage was used to infect 950 μ L of E.coli TG1 (OD)₆₀₀0.4), water bath at 37 ℃ for 30 min.

(8) mu.L of phage-infected TG1 was plated on TYE plates containing 100. mu.g/mL ampicillin and 1% glucose and incubated overnight at 37 ℃.

(9) The colonies on the plate were scraped off, added to 200mL of 2 XTY medium (containing 100. mu.g/mL ampicillin and 1% glucose), cultured at 37 ℃ for 12 hours, and the selected phages were amplified. Then 12. mu.L of a solution with a concentration of 6.3X 10 was added¹³PFU of KM13, rescued to release phage containing scFV fragments for the next round of screening.

(10) The single-chain antibody library was subjected to 5 rounds of repeated screening in accordance with the procedures (1) to (9) above.

(11) 50 μ L of phage obtained after the last round of screening was infected with 950 μ L of E.coli TG1 (OD)₆₀₀0.4), water bath at 37 ℃ for 30 min.

(12) The cells were diluted to 10-6 in 10-fold gradient with PBS, 100. mu.L of each dilution gradient was spread on TYE plates containing 100. mu.g/mL ampicillin and 1% glucose, and cultured overnight at 37 ℃.

(13) Each individual colony was randomly picked 96 times, inoculated into a cell culture plate containing 100. mu.L of 2 XTY (containing 100. mu.g/mL ampicillin and 1% glucose), and cultured overnight at 37 ℃.

(14) mu.L of each well was transferred to another 2 XTY (containing 100. mu.g/mL ampicillin and 1% glucose) cell culture plate containing 200. mu.L of each well, incubated at 37 ℃ for 2 hours, and 1. mu.L of a 6.3X 10 concentration solution was added to each well¹³PFU KM13, further incubation at 37 ℃ for 1 h.

(15) The culture 1800g was centrifuged for 10min, the supernatant discarded, 200. mu.L of fresh 2 XTY (containing 100. mu.g/mL ampicillin and 1% glucose) resuspended cells were added to each well and cultured overnight at 37 ℃ to release phage containing the scFV fragment by rescue.

Example 3

ELISA detection of screening results

(1) Step B (example 2) the cultured H.pylori was scraped into a 1.5ml LP tube containing 1ml PBS buffer, mixed well and washed 3 times repeatedly.

(2) mu.L of 0.25% glutaraldehyde was added to each well, and the cells were fixed by culturing at 37 ℃ for 2 hours.

(3) Washing with 200. mu.L PBS per well, removing unfixed pyloric spiral rod and excess glutaraldehyde, and repeating the washing 5 times.

(4) Adding 300 mu L of 2% skimmed milk into each hole to seal the enzyme label plate, and culturing at 37 ℃ for 2 h; excess skim milk was washed off with 200 μ L PBS and washed 5 times repeatedly.

(5) 200 μ L of skim milk was added to each well, and 10 μ L of KM13 rescued phage with scFv monoclonal was added to each well, mixed well by shaking, and incubated at 37 ℃ for 1 h.

(6) Non-specifically bound phage were removed by repeated 5 washes per well with 200 μ L of 0.1% Tween20 in PBS.

(7) 200 μ L of HRP-anti-M13 diluted 5000 times with skimmed milk was added to each well, and incubated at 37 ℃ for 1 h.

(8) The washing was repeated 5 times with 200. mu.L of PBS containing 0.2% Tween20 to remove the residual liquid.

(9) Add 100. mu.L of TMB per well (100. mu.g/mL of TMB in 0.1moL/L sodium acetate solution)Liquid, pH6.0, added with 30% H₂O₂In a ratio of 1: 5000) color development was performed at 37 ℃ for 5 min.

(10) 50 μ L of 1moL/LH per well₂SO₄The reaction was terminated and the absorbance at 450 was measured.

FIG. 1ELISA results show that 6 positive clones out of 96 randomly picked clones FIG. 1 is a partial clone selected by ELISA and 21 st, 45 th, 49 th, 54 th, 64 th and 79 th positive clones with absorbance greater than 1.5 at 450nm were designated as scFv1-scFv6, respectively.

Determination of Positive clone Cross-reactivity

Common bacteria such as 10 of salmonella, saccharomyces cerevisiae, bacillus subtilis, lactobacillus acidophilus, lactobacillus helveticus, lactobacillus plantarum, streptococcus lactis, bifidobacterium, lactobacillus rhamnosus, inactivated escherichia coli and the like and helicobacter pylori were respectively immobilized in an enzyme-labeled plate by glutaraldehyde according to the method shown in example 2, and the binding effect of the screened positive clones and each bacterium was measured by an ELISA method.

The results showed that none of the scFv1, scFv2, scFv4, and scFv6 showed cross-reactivity with each bacterium in 6 positive clones selected, and fig. 2 shows that the clones were all positive clones.

Example 4

Construction of the general vector CH1-CL/pGAPZ alpha A

The gene sequences of the CH1 and CL region of human IgG were retrieved from NCBI database, the CH1 and CL gene were ligated with GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCT sequence, and finally submitted to Jinwei corporation, the fragment was artificially synthesized into pET-28a vector, with upstream amplification primer 5'-GCGGTACCATGCCATCTGTTTTCCCATTG-3' and downstream amplification primer 5'-GCGTCGACAGCTCTGTTGAAAGACTTAACG-3',

the CH1-CL fragment was amplified as follows

The obtained CH1-CL fragment with restriction sites KpnI and SalI is subjected to double digestion with KpnI and SalI and then is connected with T4 DNA Ligase to construct a universal vector CH1-CL/pGAPZ alpha A, the amplification result of CH1-CL is shown in figure 3A, the structural schematic diagram of CH1-CL/pGAPZ alpha A is shown in figure 3B, pGAP in figure 3B represents a GAP promoter, and the alpha-factor secretion signal represents an a secretion factor signal; CH1-CL represents the heavy chain constant region 1-light chain constant region; 6 XHis represents 6 His tag, AOX terminator represents AOX terminator, BleoR represents bleomycin gene, CYC1terminator represents CYC1terminator, ori represents replication initiation site.

Example 5

Anti-helicobacter pylori single-chain antibody V_HAnd V_LAmplification of fragments

The highest OD was selected in example 3₄₅₀The absorbance and the mass expression of the positive clone scFv6 without cross reaction were followed by extraction of the phage plasmid using a plasmid miniprep kit and sent to the Kingwei company for sequencing. Upstream sequencing primer: 5'-CAGGAAACAGCTATGAC-3', downstream sequencing primer: 5'-CTATGCGGCCCCATTCA-3' are provided.

Respectively designing amplification V according to sequencing results_HFragment and V_LPrimers for the fragments. V_HFragment upstream primer: 5'-GTCtCGGATCGGTACCATGAAGTACTTGTTGCCAAC-3', downstream primer: 5'-GAAAACAGATGGCATAGTACCAGAACCACCAGAAGAAACAGTAAC-3', respectively; VL fragment upstream primer: 5'-TTTCAACAGAGCTGTTGACGGTGGTTCTACTGACATCCAAATGACTC-3', downstream primer: 5'-GATGATGATGATGATGGTCGACAGCAGCAGCACCGTTAGAC-3', respectively;

the heavy and light chain variable regions were expanded according to the following composition,

the amplification reaction conditions are 98 ℃ for 10s, 52 ℃ for 5s and 72 ℃ for 1min, and 30 cycles are carried out; 72 ℃ for 10min, 4 ℃ infinity.

Amplified V_HAnd V_LAnd (5) purifying and recovering the fragments according to a Shanghai crude rubber recovery and purification kit.

General carrier C_H1-C_LpGAPZ alpha A in KpnAfter I and SalI are completely digested in two enzymes, the mixture is purified by a phenol chloroform extraction ethanol precipitation method.

Purifying V_HAnd V_LFragment and digested and purified C_H1-C_LpGAPZ alpha A is connected by a Clonexpress II One step kit provided by Novozan, a DH5 alpha competent cell is transformed by a connecting product, a plasmid is extracted and sent to Jinwei for sequencing, and sequencing primers are as follows: GCACAAATTTCCGGCTGAAGCT, and GAGGAACAGTCATGTCTAAGG. VH and VL amplification results FIG. 4A, identification of VH-CH1-CL-VL after homologous recombination FIG. 4B, rFab-pGAPZ alpha A structure schematic, FIG. 4C, in FIG. 4C, pGAP represents GAP promoter, alpha-factor secretion signal represents a secretion factor signal; VH represents the heavy chain variable region, CH1-CL represents the heavy chain constant region 1-light chain constant region; VL represents the light chain variable region, 6 XHis represents the 6X histidine tag, AOX terminator represents the AOX terminator, BleoR represents the bleomycin gene, CYC1terminator represents the CYC1terminator, ori represents the replication initiation site.

The recombinant plasmid rFab-pGAPZ alpha A was linearized with the restriction endonuclease AvrII and introduced into Pichia pastoris GS115 by the electroporation method.

Western blot verification of recombinant protein expression

Inoculating the transformant yeast to YPD medium, culturing at 30 deg.C for 18 hr, centrifuging at 5000g for 5min, and collecting the culture medium and thallus respectively. Concentrating and crudely extracting secreted protein in the culture medium by using a saturated ammonium sulfate precipitation method; the bacterial cells were disrupted by ultrasonication, and after disruption, the cells were centrifuged at 12000rpm at 4 ℃ for 20min to collect the supernatant.

Crude protein from the culture medium and the disrupted supernatant were used for Western blot detection: directly dibbling the crude protein and the crushed cell supernatant in a boiling water bath for 10min to a nitrocellulose film, airing, sealing with 5% skimmed milk for 1h, taking a mouse anti-6 XHis tag antibody as a primary antibody, and carrying out floating culture at 4 ℃ overnight; and (3) detecting the expression condition of the recombinant protein rFab by taking a rabbit anti-mouse IgG-HRP antibody as a secondary antibody.

FIG. 5 shows that both the medium and the yeast cells contain recombinant protein expression.

Purification of recombinant antibody rFab

The procedure was followed in accordance with the instructions for nickel ion affinity chromatography columns (Shanghai Productivity).

SDS-PAGE (FIG. 6A) and Western blot (FIG. 6B) verify that the antibody protein is purified by a nickel ion affinity chromatography column, and the result proves that the antibody protein is successfully purified.

Example 5 validation of recombinant antibody rFab function

Binding activity of recombinant antibody rFab and helicobacter pylori protein

The cultured helicobacter pylori of example 1 and ten kinds of common bacteria were disrupted by ultrasonication, and the supernatant was disrupted to SDS-PAGE and transferred to a nitrocellulose membrane.

After the membrane is sealed, floating and breeding the rFab with the purified recombinant antibody for 1h at room temperature, washing the rFab with PBS for three times, floating and breeding the rFab with anti-6 XHis IgG-HRP for 1h at room temperature, and exposing and detecting the rFab in a chemiluminescence imaging instrument after washing.

FIG. 7A shows that the binding activity of the recombinant antibody rFab and the helicobacter pylori protein is verified by Western blot, and the result shows that the recombinant antibody rFab is specifically bound with the helicobacter pylori protein only.

Second, the combination of recombinant antibody rFab and helicobacter pylori thallus

Helicobacter pylori and ten kinds of common bacteria were fixed in an ELISA plate by the method in example 3, 300. mu.L of 2% skim milk was added to each well to seal the ELISA plate, and cultured at 37 ℃ for 2 hours; excess skim milk was washed off with 200 μ L PBS and washed 5 times repeatedly.

Add 200. mu.L skim milk to each well, add 10. mu.L purified rFab to each well, mix well by shaking, incubate 1h at 37 ℃.

Each well was washed 5 times repeatedly with 200 μ L of 0.1% Tween20 in PBS to remove non-specifically bound rbabs.

200 μ L of HRP-anti-6 XHis diluted 5000 times with skim milk was added to each well, and incubated at 37 ℃ for 1 h.

The washing was repeated 5 times with 200. mu.L of PBS containing 0.2% Tween20 to remove the residual liquid.

mu.L of TMB (100. mu.g/mL of TMB in 0.1moL/L sodium acetate solution, pH 6.0) was added to each well, and 30% H was added₂O₂In a ratio of 1: 5000) color development at 37 ℃5min。

50 μ L of 1moL/LH per well₂SO₄The reaction was stopped and the absorbance at 450 and 650nm was measured.

FIG. 7B shows that the specific binding activity of the recombinant antibody rFab to the helicobacter pylori thallus is verified by ELISA, and the result shows that the recombinant antibody rFab can be specifically bound to only the helicobacter pylori.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

<110> institute of ecological environmental resources in northwest China science

<120> helicobacter pylori-resisting recombinant antibody, preparation method and application

<160>8

<210>1

<211>137

<212>PRT

<213> Artificial sequence

<223> heavy chain variable region amino acid sequence

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala

1 5 10 15 20

Met Ala Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu

21 25 30 35 40

Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg

41 45 50 55 60

Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Phe Ile Leu Trp Leu Asp Thr Thr

61 65 70 75 80

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu

81 85 90 95 100

Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Ala

101 105 110 115 120

Asp Ala Ser Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

121 125 130 135

<210>2

<211>111

<212>PRT

<213> Artificial sequence

<223> light chain variable region amino acid sequence

Thr Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val

1 5 10 15 20

Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys

21 25 30 35 40

Pro Gly Lys Ala Pro Lys Leu Leu Ile Cys Ser Ala Ser Ala Leu Gln Ser Gly Val Pro

41 45 50 55 60

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln

61 65 70 75 80

Pro Glu Ile Leu His Leu Leu Leu Ser Gln Ala Asp Ile Leu Leu Leu Arg Ser Ala Lys

81 85 90 95 100

Gly Pro Arg Trp Lys Ser Asn Gly Ala Ala Ala

101 105 110

<210>3

<211>211

<212>PRT

<213> Artificial sequence

<223> CH1-CL amino acid sequence

Met Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala

1 5 10 15 20

Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly

21 25 30 35 40

Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

41 45 50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn

61 65 70 75 80

Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Gly Gly Gly Gly Ser

81 85 90 95 100

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Pro Thr Val Ser Ile Phe Pro Pro Ser

101 105 110 115 120

Ser Glu Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr Pro

121 125 130 135 140

Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val Leu Asn

141 145 150 155 160

Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu

161 165 170 175 180

Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser

181 185 190 195 200

Thr Ser Pro Ile Val Lys Ser Phe Asn Arg Ala

201 205 210

<210>4

<211>477

<212>PRT

<213> Artificial sequence

<223> rFab amino acid sequence

Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala

1 5 10 15 20

Met Ala Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu

21 25 30 35 40

Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg

41 45 50 55 60

Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Phe Ile Leu Trp Leu Asp Thr Thr

61 65 70 75 80

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu

81 85 90 95 100

Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Ala

101 105 110 115 120

Asp Ala Ser Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Ser

121 125 130 135 140

Gly Thr Met Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr

141 145 150 155 160

Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn

161 165 170 175 180

Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu

181 185 190 195 200

Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile

201 205 210 215 220

Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Gly Gly Gly

221 225 230 235 240

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Pro Thr Val Ser Ile Phe Pro

241 245 250 255 260

Pro Ser Ser Glu Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

261 265 270 275 280

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln Asn Gly Val

281 285 290 295 300

Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr Tyr Ser Met Ser Ser Thr Leu

301 305 310 315 320

Thr Leu Thr Lys Asp Glu Tyr Glu Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys

321 325 330 335 340

Thr Ser Thr Ser Pro Ile Val Lys Ser Phe Asn Arg Ala Val Asp Gly Gly Ser Thr Asp

341 345 350 355 360

Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile

361 365 370 375 380

Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly

381 385 390 395 400

Lys Ala Pro Lys Leu Leu Ile Cys Ser Ala Ser Ala Leu Gln Ser Gly Val Pro Ser Arg

401 405 410 415 420

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu

421 425 430 435 440

Ile Leu His Leu Leu Leu Ser Gln Ala Asp Ile Leu Leu Leu Arg Ser Ala Lys Gly Pro

441 445 450 455 460

Arg Trp Lys Ser Asn Gly Ala Ala Ala Val Asp His His His His His His

461 465 470 475

<210>5

<211>633

<212>DNA

<213> Artificial sequence

<223> nucleic acid sequence of CH1-CL

atgccatctg ttttcccatt ggctccatct tctaagtcta cttctggtgg tactgctgct 60

ttgggttgtt tggttaagga ctacttccca gaaccagtta ctgtttcttg gaactctggt 120

gctttgactt ctggtgttca cactttccca gctgttttgc aatcttctgg tttgtactct 180

ttgtcttctg ttgttactgt tccatcttct tctttgggta ctcaaactta catctgtaac 240

gttaaccaca agccatctaa cactaaggtt gacaagaagg ttgaaggtgg tggtggttct 300

ggtggtggtg gttctggtgg tggtggttct gctccaactg tttctatctt cccaccatct 360

tctgaacaat tgacttctgg tggtgcttct gttgtttgtt tcttgaacaa cttctaccca 420

aaggacatca acgttaagtg gaagatcgac ggttctgaaa gacaaaacgg tgttttgaac 480

tcttggactg accaagactc taaggactct acttactcta tgtcttctac tttgactttg 540

actaaggacg aatacgaaag acacaactct tacacttgtg aagctactca caagacttct 600

acttctccaa tcgttaagtc tttcaacaga gct

<210>6

<211>3713

<212>DNA

<213> Artificial sequence

<223> CH1-CL/pGAPZ alpha A nucleic acid sequences

agatcttttt tgtagaaatg tcttggtgtc ctcgtccaat caggtagcca tctctgaaat 60

atctggctcc gttgcaactc cgaacgacct gctggcaacg taaaattctc cggggtaaaa 120

cttaaatgtg gagtaatgga accagaaacg tctcttccct tctctctcct tccaccgccc 180

gttaccgtcc ctaggaaatt ttactctgct ggagagcttc ttctacggcc cccttgcagc 240

aatgctcttc ccagcattac gttgcgggta aaacggaggt cgtgtacccg acctagcagc 300

ccagggatgg aaaagtcccg gccgtcgctg gcaataatag cgggcggacg catgtcatga 360

gattattgga aaccaccaga atcgaatata aaaggcgaac acctttccca attttggttt 420

ctcctgaccc aaagacttta aatttaattt atttgtccct atttcaatca attgaacaac 480

tatttcgaaa cgatgagatt tccttcaatt tttactgctg ttttattcgc agcatcctcc 540

gcattagctg ctccagtcaa cactacaaca gaagatgaaa cggcacaaat tccggctgaa 600

gctgtcatcg gttactcaga tttagaaggg gatttcgatg ttgctgtttt gccattttcc 660

aacagcacaa ataacgggtt attgtttata aatactacta ttgccagcat tgctgctaaa 720

gaagaagggg tatctctcga gaaaagagag gctgaagctg aattcacgtg gcccagccgg 780

ccgtctcgga tcggtaccat gccatctgtt ttcccattgg ctccatcttc taagtctact 840

tctggtggta ctgctgcttt gggttgtttg gttaaggact acttcccaga accagttact 900

gtttcttgga actctggtgc tttgacttct ggtgttcaca ctttcccagc tgttttgcaa 960

tcttctggtt tgtactcttt gtcttctgtt gttactgttc catcttcttc tttgggtact 1020

caaacttaca tctgtaacgt taaccacaag ccatctaaca ctaaggttga caagaaggtt 1080

gaaggtggtg gtggttctgg tggtggtggt tctggtggtg gtggttctgc tccaactgtt 1140

tctatcttcc caccatcttc tgaacaattg acttctggtg gtgcttctgt tgtttgtttc 1200

ttgaacaact tctacccaaa ggacatcaac gttaagtgga agatcgacgg ttctgaaaga 1260

caaaacggtg ttttgaactc ttggactgac caagactcta aggactctac ttactctatg 1320

tcttctactt tgactttgac taaggacgaa tacgaaagac acaactctta cacttgtgaa 1380

gctactcaca agacttctac ttctccaatc gttaagtctt tcaacagagc tgtcgaccat 1440

catcatcatc atcattgagt tttagcctta gacatgactg ttcctcagtt caagttgggc 1500

acttacgaga agaccggtct tgctagattc taatcaagag gatgtcagaa tgccatttgc 1560

ctgagagatg caggcttcat ttttgatact tttttatttg taacctatat agtataggat 1620

tttttttgtc attttgtttc ttctcgtacg agcttgctcc tgatcagcct atctcgcagc 1680

tgatgaatat cttgtggtag gggtttggga aaatcattcg agtttgatgt ttttcttggt 1740

atttcccact cctcttcaga gtacagaaga ttaagtgaga ccttcgtttg tgcggatccc 1800

ccacacacca tagcttcaaa atgtttctac tcctttttta ctcttccaga ttttctcgga 1860

ctccgcgcat cgccgtacca cttcaaaaca cccaagcaca gcatactaaa ttttccctct 1920

ttcttcctct agggtgtcgt taattacccg tactaaaggt ttggaaaaga aaaaagagac 1980

cgcctcgttt ctttttcttc gtcgaaaaag gcaataaaaa tttttatcac gtttcttttt 2040

cttgaaattt ttttttttag tttttttctc tttcagtgac ctccattgat atttaagtta 2100

ataaacggtc ttcaatttct caagtttcag tttcattttt cttgttctat tacaactttt 2160

tttacttctt gttcattaga aagaaagcat agcaatctaa tctaagggcg gtgttgacaa 2220

ttaatcatcg gcatagtata tcggcatagt ataatacgac aaggtgagga actaaaccat 2280

ggccaagttg accagtgccg ttccggtgct caccgcgcgc gacgtcgccg gagcggtcga 2340

gttctggacc gaccggctcg ggttctcccg ggacttcgtg gaggacgact tcgccggtgt 2400

ggtccgggac gacgtgaccc tgttcatcag cgcggtccag gaccaggtgg tgccggacaa 2460

caccctggcc tgggtgtggg tgcgcggcct ggacgagctg tacgccgagt ggtcggaggt 2520

cgtgtccacg aacttccggg acgcctccgg gccggccatg accgagatcg gcgagcagcc 2580

gtgggggcgg gagttcgccc tgcgcgaccc ggccggcaac tgcgtgcact tcgtggccga 2640

ggagcaggac tgacacgtcc gacggcggcc cacgggtccc aggcctcgga gatccgtccc 2700

ccttttcctt tgtcgatatc atgtaattag ttatgtcacg cttacattca cgccctcccc 2760

ccacatccgc tctaaccgaa aaggaaggag ttagacaacc tgaagtctag gtccctattt 2820

atttttttat agttatgtta gtattaagaa cgttatttat atttcaaatt tttctttttt 2880

ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa aaccttgctt gagaaggttt 2940

tgggacgctc gaaggcttta atttgcaagc tggagaccaa catgtgagca aaaggccagc 3000

aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc 3060

ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat 3120

aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc 3180

cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcaatgct 3240

cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg 3300

aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 3360

cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga 3420

ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa 3480

ggacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta 3540

gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc 3600

agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg 3660

acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgcatgag atc 3713

<210>7

<211>411

<212>DNA

<213> Artificial sequence

<223> heavy chain variable region nucleic acid sequence

atgaagtact tgttgccaac tgctgctgct ggtttgttgt tgttggctgc tcaaccagct 60

atggctgaag ttcaattgtt ggaatctggt ggtggtttgg ttcaaccagg tggttctttg 120

agattgtctt gtgctgcttc tggtttcact ttctcttctt acgctatgtc ttgggttaga 180

caagctccag gtaagggttt ggaatgggtt tcttctttca tcttgtggtt ggacactact 240

tacgctgact ctgttaaggg tagattcact atctctagag acaactctaa gaacactttg 300

tacttgcaaa tgaactcttt gagagctgaa gacactgctg tttactactg tgctaaggct 360

gacgcttctt tcgactactg gggtcaaggt actttggtta ctgtttcttc t 411

<210>8

<211>333

<212>DNA

<213> Artificial sequence

<223> light chain variable region nucleic acid sequence

actgacatcc aaatgactca atctccatct tctttgtctg cttctgttgg tgacagagtt 60

actatcactt gtagagcttc tcaatctatc tcttcttact tgaactggta ccaacaaaag 120

ccaggtaagg ctccaaagtt gttgatctgt tctgcttctg ctttgcaatc tggtgttcca 180

tctagattct ctggttctgg ttctggtact gacttcactt tgactatctc ttctttgcaa 240

ccagaaatct tgcacttgtt gttgtctcaa gctgacatct tgttgttgag atctgctaag 300

ggtccaagat ggaagtctaa cggtgctgct gct 333

<210>9

<211>1431

<212>DNA

<213> Artificial sequence

<223> rFab nucleic acid sequences

atgaagtact tgttgccaac tgctgctgct ggtttgttgt tgttggctgc tcaaccagct 60

atggctgaag ttcaattgtt ggaatctggt ggtggtttgg ttcaaccagg tggttctttg 120

agattgtctt gtgctgcttc tggtttcact ttctcttctt acgctatgtc ttgggttaga 180

caagctccag gtaagggttt ggaatgggtt tcttctttca tcttgtggtt ggacactact 240

tacgctgact ctgttaaggg tagattcact atctctagag acaactctaa gaacactttg 300

tacttgcaaa tgaactcttt gagagctgaa gacactgctg tttactactg tgctaaggct 360

gacgcttctt tcgactactg gggtcaaggt actttggtta ctgtttcttc tggtggttct 420

ggtactatgc catctgtttt cccattggct ccatcttcta agtctacttc tggtggtact 480

gctgctttgg gttgtttggt taaggactac ttcccagaac cagttactgt ttcttggaac 540

tctggtgctt tgacttctgg tgttcacact ttcccagctg ttttgcaatc ttctggtttg 600

tactctttgt cttctgttgt tactgttcca tcttcttctt tgggtactca aacttacatc 660

tgtaacgtta accacaagcc atctaacact aaggttgaca agaaggttga aggtggtggt 720

ggttctggtg gtggtggttc tggtggtggt ggttctgctc caactgtttc tatcttccca 780

ccatcttctg aacaattgac ttctggtggt gcttctgttg tttgtttctt gaacaacttc 840

tacccaaagg acatcaacgt taagtggaag atcgacggtt ctgaaagaca aaacggtgtt 900

ttgaactctt ggactgacca agactctaag gactctactt actctatgtc ttctactttg 960

actttgacta aggacgaata cgaaagacac aactcttaca cttgtgaagc tactcacaag 1020

acttctactt ctccaatcgt taagtctttc aacagagctg ttgacggtgg ttctactgac 1080

atccaaatga ctcaatctcc atcttctttg tctgcttctg ttggtgacag agttactatc 1140

acttgtagag cttctcaatc tatctcttct tacttgaact ggtaccaaca aaagccaggt 1200

aaggctccaa agttgttgat ctgttctgct tctgctttgc aatctggtgt tccatctaga 1260

ttctctggtt ctggttctgg tactgacttc actttgacta tctcttcttt gcaaccagaa 1320

atcttgcact tgttgttgtc tcaagctgac atcttgttgt tgagatctgc taagggtcca 1380

agatggaagt ctaacggtgc tgctgctgtc gaccatcatc atcatcatca t 1431

<210>10

<211>4487

<212>DNA

<213> Artificial sequence

<223> rFab/pGAPZ alpha A nucleic acid sequences