阅读说明：本技术 磁性探针材料、磁性探针及其制备方法和应用以及分子标记物 (Magnetic probe material, magnetic probe, preparation method and application of magnetic probe and molecular marker ) 是由 李培峰 丁晗 王胤 朱素洁 亓洪昭 于 2020-09-17 设计创作，主要内容包括：本发明提供了一种磁性探针材料、磁性探针及其制备方法和应用以及分子标记物,涉及生物材料技术领域,磁性探针材料包括顺次连接的磁性材料、氨基、羰基、PEG以及N-羟基硫代琥珀酰。利用含有该磁性探针材料的产品诊断心脏疾病的效率高、速度快或者准确度高。(The invention provides a magnetic probe material, a magnetic probe, a preparation method and an application thereof, and a molecular marker, and relates to the technical field of biological materials. The product containing the magnetic probe material has high efficiency, high speed or high accuracy in diagnosing heart diseases.)

1. A magnetic probe material, comprising: magnetic material, amino, carbonyl, PEG and N-hydroxy thiosuccinyl connected in sequence;

the shape of the magnetic material comprises spherical particles and rod-shaped particles, the particle size of the spherical particle magnetic material is 60nm, and the particle size of the rod-shaped particle magnetic material is 50nm +/-1 nm in length and 7nm +/-1 nm in width.

2. The magnetic probe material according to claim 1, further comprising a silicon-based material, wherein the silicon-based material encapsulates the magnetic material, and the silicon-based material is sequentially linked to an amino group, a carbonyl group, PEG, and N-hydroxythiosuccinyl group;

preferably, the silicon-based material comprises silicon dioxide;

preferably, the magnetic material contains iron;

preferably, the magnetic material comprises ferroferric oxide;

preferably, the content of the magnetic material is 67.7 wt% based on the total mass of the magnetic probe material.

3. A method for preparing a magnetic probe material according to claim 1 or 2, comprising the steps of:

performing amination treatment and carbonylation treatment on the magnetic material in sequence to obtain a carbonylation magnetic material;

sequentially introducing PEG and N-hydroxy sulphosuccinyl into the carbonylation magnetic material to obtain the magnetic probe material;

preferably, the magnetic material is subjected to pretreatment, and the pretreatment comprises coating a silicon-based material on the surface of the magnetic material.

4. The method of claim 3, wherein the amination comprises: carrying out a first reaction on a magnetic material and a 3-aminopropyltriethoxysilane solution;

preferably, the volume concentration of the 3-aminopropyltriethoxysilane solution is 4-6%;

preferably, the time of the first reaction is 1 to 3 hours;

preferably, the product obtained from the first reaction is dried at a temperature of 100-120 ℃;

preferably, the drying time is 10-14 hours;

preferably, the drying treatment is carried out after the product obtained by the first reaction is washed by ethanol;

preferably, the carbonylation comprises: carrying out a second reaction on the aminated magnetic material and a glutaraldehyde solution;

preferably, the volume concentration of the glutaraldehyde solution is 3-5%;

preferably, the time of the second reaction is 1 to 3 hours;

preferably, the glutaraldehyde solution contains sodium cyanoborohydride with the concentration of 450-550 mM;

preferably, the product of the second reaction is centrifuged;

preferably, the centrifuged product of the second reaction is washed with PBS.

5. The method of claim 3 or 4, wherein introducing PEG comprises: performing a third reaction on the carbonylated magnetic material and a carboxyl-PEG-amine solution;

preferably, the carboxyl-PEG-amine solution contains 450-550mM sodium cyanoborohydride;

preferably, the time of the third reaction is 10 to 14 hours;

preferably, the product of the third reaction is centrifuged;

preferably, washing the product of the centrifuged third reaction with PBS and pure water in this order;

preferably, introducing N-hydroxy-thiosuccinyl comprises: performing a fourth reaction on the PEG-introduced magnetic material and the N-hydroxy thiosuccinimide solution;

preferably, the concentration of the N-hydroxy thiosuccinimide solution is 8-12 mM;

preferably, the N-hydroxy thiosuccinimide solution contains N-ethyl-N' - (3-dimethylaminopropyl) carbodiimide with a concentration of 4-6 mM;

preferably, the time of the fourth reaction is 10 to 14 hours;

preferably, the product of the fourth reaction is centrifuged;

preferably, washing the product of the fourth reaction after centrifugation with a nuclease-free solution;

preferably, the product of the fourth reaction is washed with water, ethanol, 1 × PBS buffer, and nuclease-free water in sequence to obtain the magnetic probe material.

6. A magnetic probe comprising the magnetic probe material of claim 1 or 2;

preferably, the magnetic probe further comprises an aptamer modified on the surface of the magnetic probe material;

preferably, the sequence of the aptamer comprises at least one of the following (a) - (d):

(a)HPN CP-124-3-dabcyl：

5’-CTAATCGTGATAGGGGTATTGGCATTCACCGCGTGCCTTATACCCCTATCACGATTAGCATTAA-3’(SEQ ID NO.1)；

(b)HPN CP-124-5-dabcyl：

5’-CTAATCGTGATAGGGGTAATCAAGGTCCGCTGTGAACACGTACCCCTATCACGATTAGCATTAA-3’(SEQ ID NO.2)；

(c)HPN CP-23a-3-dabcyl：

5’-CTAATCGTGATAGGGGTAAAATCCCATCCCCAGGAACCCCTACCCCTATCACGATTAGCATTAA-3’(SEQ ID NO.3)；

(d)HPN CP-23a-5-dabcyl：5’-

CTAATCGTGATAGGGGTACAACTCAGCTTGTCAAATACACGTACCCCTATCACGATTAGCATTAA-3’(SEQID NO.4)；

wherein, the 5 'end of the sequence of the aptamer is sequentially provided with a quenching group and an Amino C6 nucleic acid label, and the 3' end is provided with a fluorescent group;

preferably, the quencher group is Dabcyl;

preferably, the fluorophore comprises FAM or Cy 5;

preferably, the Amino C6 nucleic acid marker has the sequence: 5'-CCC ACC AAC CAT-3' (SEQ ID NO. 5).

7. A method for preparing the magnetic probe according to claim 6, comprising: mixing the aminated magnetic probe material with an aptamer for reaction to obtain a magnetic probe;

preferably, the time of the mixing reaction is 12 to 14 hours;

preferably, the amination of the magnetic probe material comprises: carrying out a crosslinking reaction on the magnetic probe material and a crosslinking solution containing EDC and N-hydroxy thiosuccinimide to obtain an aminated magnetic probe material;

preferably, the time of the crosslinking reaction is 5 to 7 hours;

preferably, the concentration of EDC is 4-6 mM;

preferably, the concentration of N-hydroxythiosuccinimide is 8-12 mM;

preferably, the solvent of the crosslinking solution comprises MES;

preferably, the pH of the crosslinking solution is 4-6, preferably 4.5.

8. Use of the magnetic probe material of claim 1 or 2 or the magnetic probe of claim 6 for the preparation of a product for the diagnosis and/or the post-cure assessment of a cardiac disorder;

preferably, the heart disease comprises myocardial infarction;

preferably, the product is a reagent or kit;

preferably, the test sample of the product comprises serum, plasma or urine.

9. A reagent or kit comprising the magnetic probe material of claim 1 or 2 or the magnetic probe of claim 6.

10. A molecular marker detected by the magnetic probe of claim 6;

preferably, the molecular marker comprises at least one of Hsa-miR-19a-3, Hsa-miR-145-5, Ha-miR-197-5, Hsa-miR-124-5p, Hsa-miR-124-3p, Hsa-miR-223-5p, Hsa-miR-23a-5p and Hsa-miR-23a-3 p.

Technical Field

The invention relates to the technical field of biological materials, in particular to a magnetic probe material, a magnetic probe, a preparation method and application of the magnetic probe and a molecular marker, and more particularly relates to a magnetic probe material, a magnetic probe, a preparation method and application of the magnetic probe, a reagent or a kit and a molecular marker.

Background

At present, cardiovascular diseases such as myocardial infarction are the first killers of human death, and how to effectively diagnose and prevent myocardial damage and myocardial infarction is a problem to be solved urgently in medical and biological research at present.

Micro RNA (microRNA, miRNA) is a non-protein coding small RNA which is widely existed in eukaryote and has the length of 21-25nt, can regulate gene expression in a sequence specificity mode, and plays an important role in development, apoptosis, metabolism and human diseases. Recent studies have shown that cardiovascular diseases cause significant changes in the expression level of specific micrornas in vivo, and therefore, detection of changes in specific micrornas in body fluids can be used to diagnose and prevent cardiovascular diseases. The currently more common means for counting microRNA changes is by means of real-time quantitative PCR techniques. Although real-time quantitative PCR has many advantages, such as small amount of sample analysis, high automation, and avoidance of contamination, there are disadvantages, such as susceptibility to interference agents in the sample, artificial loss of a certain amount during RNA extraction, and long detection time. Therefore, it is important to develop a rapid, efficient and accurate detection technique.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a magnetic probe material, which has high efficiency, high speed or high accuracy in diagnosing heart diseases by using a product containing the magnetic probe material.

The invention provides a magnetic probe material, comprising: magnetic material, amino, carbonyl, PEG and N-hydroxy thiosuccinyl connected in sequence;

the shape of the magnetic material comprises spherical particles and rod-shaped particles, the particle size of the spherical particle magnetic material is about 60nm, and the particle size of the rod-shaped particle magnetic material is 50nm +/-1 nm in length and 7nm +/-1 nm in width.

Further, the magnetic material also comprises a silicon-based material, wherein the silicon-based material coats the magnetic material and is sequentially connected with amino, carbonyl, PEG and N-hydroxy thiosuccinyl;

preferably, the silicon-based material comprises silicon dioxide;

preferably, the magnetic material comprises a magnetic material comprising iron;

preferably, the magnetic material comprises ferroferric oxide;

preferably, the content of the magnetic material is 67.7 wt% based on the total mass of the magnetic probe material.

A method for preparing the magnetic probe material comprises the following steps:

performing amination treatment and carbonylation treatment on the magnetic material in sequence to obtain a carbonylation magnetic material;

sequentially introducing PEG and N-hydroxy sulphosuccinyl into the carbonylation magnetic material to obtain the magnetic probe material;

preferably, the magnetic material is subjected to pretreatment, and the pretreatment comprises coating the surface of the magnetic material with a silicon-based material.

Further, the amination comprises: carrying out a first reaction on a magnetic material and a 3-aminopropyltriethoxysilane solution;

preferably, the volume concentration of the 3-aminopropyltriethoxysilane solution is 4-6%;

preferably, the time of the first reaction is 1 to 3 hours;

preferably, the product obtained from the first reaction is dried at a temperature of 100-120 ℃;

preferably, the drying time is 10-14 hours;

preferably, the drying treatment is carried out after the product obtained by the first reaction is washed by ethanol;

preferably, the carbonylation comprises: carrying out a second reaction on the aminated magnetic material and a glutaraldehyde solution;

preferably, the volume concentration of the glutaraldehyde solution is 3-5%;

preferably, the time of the second reaction is 1 to 3 hours;

preferably, the glutaraldehyde solution contains sodium cyanoborohydride with the concentration of 450-550 mM;

preferably, the product of the second reaction is centrifuged;

preferably, the centrifuged product of the second reaction is washed with PBS.

Further, introducing PEG includes: performing a third reaction on the carbonylated magnetic material and a carboxyl-PEG-amine solution;

preferably, the carboxyl-PEG-amine solution contains 450-550mM sodium cyanoborohydride;

preferably, the time of the third reaction is 10 to 14 hours;

preferably, the product of the third reaction is centrifuged;

preferably, washing the product of the centrifuged third reaction with PBS and pure water in this order;

preferably, introducing N-hydroxy-thiosuccinyl comprises: performing a fourth reaction on the PEG-introduced magnetic material and the N-hydroxy thiosuccinimide solution;

preferably, the concentration of the N-hydroxy thiosuccinimide solution is 8-12 mM;

preferably, the N-hydroxy thiosuccinimide solution contains N-ethyl-N' - (3-dimethylaminopropyl) carbodiimide with a concentration of 4-6 mM;

preferably, the time of the fourth reaction is 10 to 14 hours;

preferably, the product of the fourth reaction is centrifuged;

preferably, washing the product of the fourth reaction after centrifugation with a nuclease-free solution;

preferably, the product of the fourth reaction is washed with water, ethanol, 1 × PBS buffer, and nuclease-free water in sequence to obtain the magnetic probe material.

A magnetic probe comprising the magnetic probe material described above;

preferably, the magnetic probe further comprises an aptamer modified on the surface of the magnetic probe material;

preferably, the sequence of the aptamer comprises at least one of the following (a) - (d):

(a)HPN CP-124-3-dabcyl： 5’-CTAATCGTGATAGGGGTATTGGCATTCACCGCGTGCCTTATACCCCT ATCACGATTAGCATTAA-3’(SEQ ID NO.1)；

(b)HPN CP-124-5-dabcyl： 5’-CTAATCGTGATAGGGGTAATCAAGGTCCGCTGTGAACACGTACCCC TATCACGATTAGCATTAA-3’(SEQ ID NO.2)；

(c)HPN CP-23a-3-dabcyl： 5’-CTAATCGTGATAGGGGTAAAATCCCATCCCCAGGAACCCCTACCCCT ATCACGATTAGCATTAA-3’(SEQ ID NO.3)；

(d)HPN CP-23a-5-dabcyl：5’- CTAATCGTGATAGGGGTACAACTCAGCTTGTCAAATACACGTACCCCT ATCACGATTAGCATTAA-3’(SEQ ID NO.4)；

wherein, the 5 'end of the sequence of the aptamer is sequentially provided with a quenching group and an Amino C6 nucleic acid label, and the 3' end is provided with a fluorescent group;

preferably, the quencher group is Dabcyl;

preferably, the fluorophore comprises FAM or Cy 5;

preferably, the Amino C6 nucleic acid marker has the sequence: 5'-CCC ACC AAC CAT-3' (SEQ ID NO. 5).

A method for preparing the magnetic probe, comprising: mixing the aminated magnetic probe material with an aptamer for reaction to obtain a magnetic probe;

preferably, the time of the mixing reaction is 12 to 14 hours;

preferably, the amination of the magnetic probe material comprises: carrying out a crosslinking reaction on the magnetic probe material and a crosslinking solution containing EDC and N-hydroxy thiosuccinimide to obtain an aminated magnetic probe material;

preferably, the time of the crosslinking reaction is 5 to 7 hours;

preferably, the concentration of EDC is 4-6 mM;

preferably, the concentration of N-hydroxythiosuccinimide is 8-12 mM;

preferably, the solvent of the crosslinking solution comprises MES;

preferably, the pH of the crosslinking solution is 4-6, preferably 4.5.

Use of a magnetic probe material as hereinbefore described or a magnetic probe as hereinbefore described in the manufacture of a product for the diagnosis and/or prognosis of a cardiac disorder;

preferably, the heart disease comprises myocardial infarction;

preferably, the product is a reagent or kit;

preferably, the test sample of the product comprises serum, plasma or urine.

A reagent or kit comprising a magnetic probe material as hereinbefore described or a magnetic probe as hereinbefore described.

A molecular marker which is detected by the magnetic probe as described above;

preferably, the molecular marker comprises at least one of Hsa-miR-19a-3, Hsa-miR-145-5, Ha-miR-197-5, Hsa-miR-124-5p, Hsa-miR-124-3p, Hsa-miR-223-5p, Hsa-miR-23a-5p and Hsa-miR-23a-3 p.

Compared with the prior art, the invention can at least obtain the following beneficial effects:

the magnetic probe material provided by the invention is a biomolecule, the magnetic probe prepared by the magnetic probe material has stable luminescence and low toxicity, the magnetic probe material can detect (even can detect in situ) micro RNA related to heart diseases (such as myocardial infarction) after being combined with fluorescence labeled nucleic acid aptamer designed according to the specificity of a micro RNA sequence to be detected, the magnetic probe material can rapidly diagnose the myocardial infarction and evaluate the effect after healing, the magnetic probe can generate obvious optical property change after being contacted with the micro RNA related to the heart diseases, and the efficiency and the accuracy for diagnosing the heart diseases are higher.

The magnetic probe of the invention adopts biomolecules as raw materials, avoids pollution caused by reaction or toxicity of products, and has the advantages of good biocompatibility, small toxicity and simple and quick detection, namely, the magnetic probe is directly mixed with a body fluid sample to be detected, and the required data result can be obtained within minutes. Meanwhile, the magnetic probe for detecting the micro RNA also has the advantages of low cost, convenient operation, small damage to the RNA, little restriction by external conditions and the like. Because the magnetic probe has the characteristic of magnetism, the 96-hole magnetic plate can be used for quickly separating, extracting and detecting within 30 seconds, time-consuming and labor-consuming operations such as centrifugation can be omitted, the whole operation process can be directly finished in a detection instrument, time, labor and space are saved, a detection result can be obtained more quickly, and more precious time is strived for diagnosing and treating diseases of patients.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a comparison graph of a magnetic probe material coated with a silicon-based material according to example 2 of the present invention, wherein a in FIG. 1 is a spherical magnetic material without the silicon-based material coating, and the size is 50 nm. + -. 5 nm; in FIG. 1, b is a spherical magnetic material coated with silicon dioxide, the size is 55nm +/-5 nm long and 7nm +/-1 nm wide; in FIG. 1, c is a bar-shaped magnetic material without silicon-based material coating, the size is 80nm + -1 nm long and 4nm + -1 nm wide; in FIG. 1, d is a rod-shaped magnetic material wrapped with silicon dioxide, and the rod-shaped magnetic material has a length of 84nm +/-1 nm and a width of 7nm +/-1 nm;

fig. 2 is an infrared spectrum of the magnetic probe provided in example 3 of the present invention, wherein a in fig. 2 is an infrared spectrum of a spherical magnetic material with hydroxyl groups on the surface and polyethylene glycol; in FIG. 2, b is an infrared spectrum of the bar-shaped magnetic material with hydroxyl on the surface and polyethylene glycol;

fig. 3 is a hysteresis (M-H) diagram of a magnetic probe provided in embodiment 3 of the present invention, wherein a in fig. 3 is a hysteresis curve of a spherical magnetic material; in fig. 3 b is a hysteresis curve of the rod-shaped magnetic material;

FIG. 4 is a graph of a standard test provided in test example 1 of the present invention for the detection of a specific non-coding nucleic acid, wherein: in FIG. 4, a is a standard curve for miR-124-3P detection by quantitative PCR; in FIG. 4, b is a standard curve for miR-124-5P detection by quantitative PCR; in FIG. 4, c is a standard curve for detecting miR-124-3P by using a probe material; in FIG. 4, d is a standard curve for detecting miR-124-3P by using a probe material;

FIG. 5 is a graph showing the comparison results of the probe materials provided in test example 1 of the present invention on different small RNA detections, in which: in FIG. 5, a is the comparison result of the miR-124-3P probe, and in FIG. 5, b is the comparison result of the miR-124-5P probe.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments, and it should be understood that the described embodiments are some, but not all, embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In one aspect of the invention, the invention provides two magnetic probe materials comprising: magnetic material, amino, carbonyl, PEG and N-hydroxy thiosuccinyl connected in sequence; the shape of the magnetic material comprises spherical particles and rod-shaped particles, the particle size of the spherical particle magnetic material is about 60nm, and the particle size of the rod-shaped particle magnetic material is 50nm +/-1 nm in length and 7nm +/-1 nm in width.

The magnetic probe material provided by the invention is a biomolecule, the magnetic probe prepared by the magnetic probe material has stable luminescence and low toxicity, after the magnetic probe material is combined with the fluorescence-labeled nucleic acid aptamer designed according to the specificity of the micro RNA sequence to be detected, the micro RNA related to heart diseases (such as myocardial infarction) can be detected and even detected in situ, the rapid diagnosis and the evaluation after healing of the myocardial infarction can be realized, the magnetic probe and the micro RNA related to the heart diseases can generate obvious optical property change after contact, and the efficiency and the accuracy for diagnosing the heart diseases are higher.

It should be noted that, the magnetic material, the amino group, the carbonyl group, PEG (polyethylene glycol), and N-hydroxysulfosuccinic group, which are connected in this order, are understood as being a magnetic material connected to the amino group, the amino group connected to the carbonyl group, the carbonyl group connected to PEG, and PEG connected to the N-hydroxysulfosuccinic group; the manner in which the magnetic material is connected to the amino group can be broadly understood, for example, the magnetic material can be directly connected to the amino group, or can be connected to the amino group through other possible molecules or atoms; the manner in which an amino group is attached to a carbonyl group is to be understood broadly, e.g., an amino group can be directly attached to a carbonyl group, or can be attached to a carbonyl group through other possible molecules or atoms; the manner in which the carbonyl group is attached to the PEG is to be understood broadly, e.g., the carbonyl group may be attached directly to the PEG, or may be attached to the PEG through other possible molecules or atoms; the manner in which PEG is linked to N-hydroxythiosuccinyl is to be understood in a broad sense, e.g., PEG may be linked directly to N-hydroxythiosuccinyl, or may be linked to N-hydroxythiosuccinyl via other possible molecules or atoms.

The shape of the magnetic material comprises spherical particles and rod-shaped particles, the particle size of the spherical particle magnetic material is about 60nm, and the particle size of the rod-shaped particle magnetic material is 50nm +/-1 nm in length and 7nm +/-1 nm in width. When the particle diameter of the magnetic material is too large or too small relative to the above particle diameter range, the amount of the modified probe nucleic acid aptamer per unit area is reduced, thereby affecting the detection efficiency.

In some embodiments of the present invention, the magnetic probe material further comprises a silicon-based material, the silicon-based material covers the magnetic material, and the silicon-based material is sequentially connected with amino, carbonyl, PEG, and N-hydroxythiosuccinyl. Therefore, the amino and the silicon-based material are combined together more easily, and the obtained magnetic probe material has higher stability.

It should be noted that, when the magnetic material is coated with the silicon-based material, the magnetic material is connected to the amino group through the silicon-based material.

In some embodiments of the invention, the silicon-based material comprises silicon dioxide.

In some embodiments of the invention, the magnetic material comprises a composition comprising iron; preferably, the magnetic material comprises ferroferric oxide. Thus, the magnetic material has better magnetism.

In some embodiments of the present invention, the content of the magnetic material is 67.7 wt% based on the total mass of the magnetic probe material. With respect to the above content, when the content of the magnetic material is too low, the magnetic screening rate after coating the silicon-based material is reduced; when the content of the magnetic material is too high, the material obtained after coating the silicon-based material is easily agglomerated.

In another aspect of the present invention, the present invention provides a method for preparing the magnetic probe material, comprising the following steps: performing amination treatment and carbonylation treatment on the magnetic material in sequence to obtain a carbonylation magnetic material; and sequentially introducing PEG and N-hydroxy sulphosuccinyl into the carbonylation magnetic material to obtain the magnetic probe material.

In some embodiments of the present invention, the magnetic material is prepared by:

step (a): mixing ferric chloride, sodium acetate and sodium dodecyl benzene sulfonate according to a molar ratio of 40:226:1 is added into 80 ml of glycol solution for ultrasonic treatment for 30 minutes to obtain a raw material mixture;

step (b): after ultrasonic treatment for 30 minutes, adding 1.5 g of polyethylene glycol, and uniformly stirring for 1 hour;

step (c): the mixed solution is reacted for 10 hours at the temperature of 200 ℃ to obtain the magnetic material.

In some embodiments of the present invention, the magnetic material is subjected to a pretreatment comprising coating a surface of the magnetic material with a silicon-based material.

In some embodiments of the present invention, coating the surface of the magnetic material with a silicon-based material comprises:

adding 100 mg of magnetic material into 195 ml of 80% ethanol solution, carrying out ultrasonic treatment for 50 minutes, adding 2 ml of ammonia water solution, and stirring for 30 minutes; and (3) dropwise adding 2 ml of tetraethyl orthosilicate into the mixed solution, and continuously stirring for 6 hours to obtain the magnetic material wrapped by the silicon-based material. In some embodiments of the present invention, the magnetic material coated with the silicon-based material is dialyzed, and the resulting product is washed with double distilled water, ethanol, PBS, and the like and dried using vacuum.

In some embodiments of the invention, the amination comprises: a magnetic material (note that, the form of the magnetic material here includes a magnetic material or a magnetic material coated with a silicon-based material) and a 3-aminopropyltriethoxysilane solution are subjected to a first reaction for 1 to 3 hours (for example, 1 hour, 2 hours, or 3 hours, etc.). Thus, the amination effect is good.

In some embodiments of the invention, the 3-Aminopropyltriethoxysilane (APTES) solution has a concentration of 4-6% by volume (e.g., 4%, 5%, 6%, etc.) and the solvent for the APTES solution is ethanol.

In some embodiments of the present invention, the product obtained from the first reaction is dried at a temperature of 100 ℃ to 120 ℃ (for example, 100 ℃, 110 ℃, or 120 ℃, etc.). In the drying process at 100-120 ℃, hydroxyl in APTES is further reacted to generate ether bonds, the reaction is not favorably carried out when the temperature is too low, and carbonization is easily caused when the temperature is too high.

In some embodiments of the invention, the drying time is 10-14 hours (e.g., 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, etc.). Therefore, the drying effect is better.

In some embodiments of the present invention, the drying treatment (e.g., vacuum drying, etc.) is performed after washing the product obtained from the first reaction with ethanol. This makes it possible to purify the aminated magnetic material.

In some embodiments of the invention, the carbonylation comprises: and (2) carrying out a second reaction on the aminated magnetic material (the form of the magnetic material herein includes a magnetic material or a magnetic material coated by a silicon-based material) and the glutaraldehyde solution, wherein the second reaction time is 1-3 hours (for example, 1 hour, 2 hours or 3 hours can be allowed).

In some embodiments of the invention, the glutaraldehyde solution has a volume concentration of 3-5% (e.g., can be 3%, 4%, or 5%, etc.), and the solvent for the glutaraldehyde solution is 1x PBS (phosphate buffered saline solution at a concentration of 0.1M); the glutaraldehyde solution contains sodium cyanoborohydride at a concentration of 450-550mM (e.g., 450mM, 500mM, or 550 mM). Thus, sodium cyanoborohydride is a mild reducing agent, mainly reducing aldehyde groups with aminated magnetic materials to form C-N.

In some embodiments of the invention, the product of the second reaction is centrifuged; preferably, the products of the centrifuged second reaction are washed with PBS. Thus, the purpose of purifying the carbonylated magnetic material can be achieved.

In some embodiments of the invention, introducing PEG comprises: and (3) performing a third reaction on the carbonylated magnetic material (note that the form of the magnetic material herein includes a magnetic material or a magnetic material coated with a silicon-based material) and a carboxyl-PEG-amine solution (which can be used interchangeably with the aminopolyethylene glycol carboxyl solution), wherein the time of the third reaction is 10 to 14 hours (for example, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours and the like).

In some embodiments of the invention, the solvent of the carboxy-PEG-amine solution is 1XPBS, and the carboxy-PEG-amine solution contains 450-550mM (e.g., 450mM, 500mM, 550mM, etc.) sodium cyanoborohydride. Thus, sodium cyanoborohydride is a mild reducing agent, primarily reducing the aldehyde group with the carbonylated magnetic material to form C-N.

In some embodiments of the invention, the product of the third reaction is centrifuged; the product of the centrifuged third reaction was washed with PBS and pure water in this order. Thus, the magnetic material into which PEG has been introduced can be purified.

In some embodiments of the invention, introducing N-hydroxy thiosuccinyl comprises: the PEG-incorporated magnetic material (note that the form of the magnetic material here includes a magnetic material or a magnetic material coated with a silicon-based material) and the N-hydroxythiosuccinimide solution are subjected to a fourth reaction for 10 to 14 hours (for example, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, or the like may be possible).

In some embodiments of the invention, the concentration of the N-hydroxythiosuccinimide solution is 8-12mM (e.g., may be 8mM, 9mM, 10mM, 11mM, or 12mM, etc.), and the solvent of the N-hydroxythiosuccinimide solution is MES (2- (N-morpholine) ethanesulfonic acid monohydrate) solution; the N-hydroxythiosuccinimide solution contains N-ethyl-N' - (3-dimethylaminopropyl) carbodiimide at a concentration of 4 to 6mM (for example, 4mM, 5mM, or 6 mM). Therefore, the amidation reaction of carboxyl amino, EDC and NHS are mainly used for activating carboxyl, and are convenient for the next reaction with amino modified aptamer.

In some embodiments of the invention, the product of the fourth reaction is centrifuged; washing the product of the fourth reaction after centrifugation with a nuclease-free solution. Thus, the magnetic material after N-hydroxythiosuccinimide can be purified.

In some embodiments of the present invention, the magnetic probe material is obtained by washing the product of the fourth reaction with water, ethanol, 1 × PBS buffer, and nuclease-free water in this order.

It is understood that when the product of the fourth reaction is washed with water, ethanol, 1XPBS buffer and nuclease-free water, the product may be dried under vacuum after the previous washing, and then the dried product may be washed in the next washing.

In some embodiments of the present invention, the magnetic probe material is prepared by the following method:

(1) immersing the magnetic material or the magnetic material coated by the silicon-based material into a 5% (v/v) APTES (ethanol solvent) solution, slowly shaking for 2 hours at room temperature, then washing with ethanol, and drying for 12 hours at 110 ℃ to obtain an aminated magnetic material;

(2) immersing the aminated magnetic material into 4% glutaraldehyde solution (1 x PBS solution containing 50mM sodium cyanoborohydride) for reaction for 2 hours at room temperature under shaking, centrifuging and washing with PBS to obtain a carbonylated magnetic material;

(3) immersing the carbonylated magnetic material in a 500mM carboxyl-PEG-amine solution (solvent is 1xPBS solution, and the solution contains 50mM sodium cyanoborohydride) at room temperature overnight, gently shaking, centrifuging, washing with PBS, washing with ultrapure water, and drying to obtain a PEG-introduced magnetic material;

(4) the PEG-introduced magnetic material was immersed in 10mM N-hydroxythiosuccinimide (solvent is MES solution containing 5mM N-ethyl-N' - (3-dimethylaminopropyl) carbodiimide) at room temperature overnight, gently shaken, centrifuged, and washed with nuclease-free water to obtain a magnetic probe material.

In another aspect of the present invention, the present invention provides a magnetic probe, which comprises the magnetic probe material described above, and preferably, the magnetic probe further comprises an aptamer modified on the surface of the magnetic probe material.

In some embodiments of the invention, the sequence of the aptamer comprises at least one of the following (a) - (d):

(a)HPN CP-124-3-dabcyl：

5’-CTAATCGTGATAGGGGTATTGGCATTCACCGCGTGCCTTATACCCCT ATCACGATTAGCATTAA-3’(SEQ ID NO.1)；

(b)HPN CP-124-5-dabcyl：

5’-CTAATCGTGATAGGGGTAATCAAGGTCCGCTGTGAACACGTACCCC TATCACGATTAGCATTAA-3’(SEQ ID NO.2)；

(c)HPN CP-23a-3-dabcyl：

5’-CTAATCGTGATAGGGGTAAAATCCCATCCCCAGGAACCCCTACCCCT ATCACGATTAGCATTAA-3’(SEQ ID NO.3)；

(d)HPN CP-23a-5-dabcyl：5’-

CTAATCGTGATAGGGGTACAACTCAGCTTGTCAAATACACGTACCCCT ATCACGATTAGCATTAA-3’(SEQ ID NO.4)；

wherein, the 5 'end of the sequence of the aptamer is sequentially provided with a quenching group and an Amino C6 nucleic acid label, and the 3' end is provided with a fluorescent group.

It should be noted that, if the aptamers are a mixture, the fluorophores of different sequences are different from each other two by two.

In some embodiments of the invention, the quencher is Dabcyl, the fluorophore comprises FAM or Cy5, and the amino c6 nucleic acid tag has the sequence: 5'-CCC ACC AAC CAT-3' (SEQ ID NO. 5).

In some embodiments of the invention, the sequence of the aptamer comprises at least one of the following (a) - (d):

(a)HPN CP-124-3-dabcyl：Amino

C6-CCCACCAACCAT-Dabcyl--CTAATCGTGATAGGGGTATTGGCATTCAC CGCGTGCCTTATACCCCTATCACGATTAGCATTAA-FAM；

(b)HPN CP-124-5-dabcyl：Amino

C6-CCCACCAACCAT-Dabcyl-CTAATCGTGATAGGGGTAATCAAGGTCCG CTGTGAACACGTACCCCTATCACGATTAGCATTAA-FAM；

(c)HPN CP-23a-3-dabcyl：Amino

C6-CCCACCAACCAT-Dabcyl-CTAATCGTGATAGGGGTAAAATCCCATCC CCAGGAACCCCTACCCCTATCACGATTAGCATTAA-Cy5；

(d)HPN CP-23a-5-dabcyl：Amino C6-CCCACCAACCAT-Dabcyl-CTA ATCGTGATAGGGGTACAACTCAGCTTGTCAAATACACGTACCCCTATC ACGATTAGCATTAA-Cy5。

in another aspect of the present invention, the present invention provides a method for preparing the magnetic probe, comprising: and mixing the aminated magnetic probe material with the aptamer for reaction to obtain the magnetic probe. Therefore, complementary base groups capable of being combined with the micro RNA to be detected are connected to the magnetic probe material and modified on the magnetic probe material, so that the detection specificity is ensured.

In some embodiments of the present invention, the mixing reaction time is 12-14 hours (e.g., 12 hours, 13 hours, 14 hours, etc.).

In some embodiments of the invention, the amination of the magnetic probe material comprises: and carrying out crosslinking reaction on the magnetic probe material and a crosslinking solution containing EDC (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride) and N-hydroxy thiosuccinimide to obtain the aminated magnetic probe material. Thereby, the magnetic probe material is more easily bound to the aptamer.

In some embodiments of the invention, the time for the crosslinking reaction is 5 to 7 hours (e.g., can be 5 hours, 6 hours, 7 hours, etc.). Therefore, the crosslinking effect is better.

In some embodiments of the invention, the EDC concentration is 4-6mM (e.g., can be 4mM, 5mM, or 6mM, etc.), the N-hydroxythiosuccinimide (Sulfo-NHS) concentration is 8-12mM (e.g., can be 8mM, 10mM, or 12mM, etc.), and the crosslinking solution solvent comprises MES.

In some embodiments of the invention, the pH of the crosslinking solution is 4-6, (e.g., can be 4, 4.5, 5, 5.5, or 6, etc.), preferably 4.5.

The magnetic probe provided by the invention can be used for rapidly diagnosing and evaluating myocardial infarction after healing by detecting the effect of micro RNA related to heart diseases, has stable luminescence and low toxicity, can be used for in-situ detection, and can generate obvious optical property change after being contacted with specific micro RNA. The biological molecules are used as raw materials, so that pollution caused by reaction or product toxicity is avoided, and the method has the advantages of good biocompatibility, small toxicity and simple and quick detection, namely, the magnetic probe is directly mixed with a body fluid sample to be detected, and a required data result can be obtained within minutes. Meanwhile, the magnetic probe for detecting the micro RNA also has the advantages of low cost, convenient operation, small damage to the RNA, little restriction by external conditions and the like.

In another aspect of the present invention, the present invention provides a use of the magnetic probe material or the magnetic probe as described above for the preparation of a product for diagnosis and/or prognosis evaluation of heart diseases.

In some embodiments of the invention, the cardiac disorder comprises myocardial infarction.

In some embodiments of the invention, the product is a reagent or kit; the test sample of the product comprises serum, plasma or urine.

In another aspect of the present invention, there is provided a reagent or a kit comprising the magnetic probe material as described above or the magnetic probe as described above.

In another aspect of the invention, the invention provides a molecular marker which is detected by a magnetic probe as hereinbefore described. The molecular marker is used as a new biological target, can play a role in early diagnosis and/or evaluation after healing of heart diseases, and can even diagnose myocardial infarction in vitro and judge the pathogenic process of the myocardial infarction.

In some embodiments of the invention, the molecular marker comprises at least one of Hsa-miR-19a-3, Hsa-miR-145-5, Has-miR-197-5, Hsa-miR-124-5p, Hsa-miR-124-3p, Hsa-miR-223-5p, Hsa-miR-23a-5p, and Hsa-miR-23a-3 p.

In some embodiments of the invention, the molecular marker comprises at least one of:

Hsa-miR-19a-3：5’-UGUGCAAAUCUAUGCAAAACUGA-3’(SEQ ID No.6)；

Hsa-miR-145-5：5’-GUCCAGUUUUCCCAGGAAUCCCU-3’(SEQ ID No.7)；

Has-miR-197-5：5’-CGGGUAGAGAGGGCAGUGGGAGG-3’(SEQ ID No.8)；

Hsa-miR-124-5p：5’-CGUGUUCACAGCGGACCUUGAU-3’(SEQ ID No.9)；

Hsa-miR-124-3p：5’-UAAGGCACGCGGUGAAUGCCAA-3’(SEQ ID No.10)；

Hsa-miR-223-5p：5’-CGUGUAUUUGACAAGCUGAGUUG-3’(SEQ ID No.11)；

Hsa-miR-23a-5p：5’-GGGGUUCCUGGGGAUGGGAUUU-3’(SEQ ID No.12)；

and, Hsa-miR-23a-3 p: 5'-AUCACAUUGCCAGGGAUUUUCC-3' (SEQ ID No. 13).

The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

It should be noted that, when the magnetic material in the following examples and comparative examples is ferroferric oxide, the preparation method of the magnetic material is as follows:

(1) adding ferric chloride, sodium acetate and sodium dodecyl benzene sulfonate into 80 ml of glycol solution according to the molar ratio of 40:226:1, and carrying out ultrasonic treatment for 30 minutes;

(2) adding 1.5 g of polyethylene glycol into the mixed solution after ultrasonic treatment, and uniformly stirring for 1 hour;

(3) and (3) reacting the mixed solution obtained in the step (2) at the temperature of 200 ℃ for 10 hours to obtain the magnetic material.

When the magnetic material in the following examples and comparative examples is ferroferric oxide, the preparation method of the silicon-based material formed by coating silicon dioxide on the surface thereof is as follows:

adding 100 mg of magnetic material into 195 ml of 80% ethanol solution, carrying out ultrasonic treatment for 50 minutes, adding 2 ml of ammonia water solution, and stirring for 30 minutes; and (3) dropwise adding 2 ml of tetraethyl orthosilicate into the mixed solution, and continuously stirring for 6 hours to obtain the magnetic material wrapped by the silicon-based material.