Method for co-expressing four structural proteins of African swine fever virus in insect cells and application of method
阅读说明：本技术 一种在昆虫细胞中共表达非洲猪瘟病毒四种结构蛋白的方法及其应用 (Method for co-expressing four structural proteins of African swine fever virus in insect cells and application of method ) 是由 黄超华 花群义 史卫军 吴江 林彦星 曹琛福 曾少灵 刘建利 阮周曦 杨俊兴 于 2020-05-12 设计创作，主要内容包括：本申请涉及一种在昆虫细胞中共表达非洲猪瘟病毒四种结构蛋白的方法及其应用。本发明将非洲猪瘟病毒四种结构蛋白pp62、p54、p30和p72基因插入经改造pFastBac-Dual后获得的穿梭载体,制备重组穿梭质粒pF4-pp62-p54-p30-p72,并获得重组杆状病毒rBac-pp62-p54-p30-p72,实现昆虫细胞中的高效共表达。基于共表达的混合重组蛋白建立用于检测非洲猪瘟抗体的间接ELISA方法,具有敏感性高、特异性高和重复性好等优点。(The application relates to a method for co-expressing four structural proteins of African swine fever virus in insect cells and application thereof. The invention inserts four structural proteins pp62, p54, p30 and p72 genes of African swine fever virus into a shuttle vector obtained after the improvement of pFastBac-Dual, prepares a recombinant shuttle plasmid pF4-pp62-p54-p30-p72, obtains a recombinant baculovirus rBac-pp62-p54-p30-p72, and realizes the high-efficiency co-expression in insect cells. The indirect ELISA method for detecting the African swine fever antibody is established based on the co-expressed mixed recombinant protein, and has the advantages of high sensitivity, high specificity, good repeatability and the like.)
1. A recombinant shuttle plasmid pF4 containing four multiple cloning sites, wherein the plasmid pF4 is a vector pFastBac-Dual with the sequence between the 3510 th base and the 3985 th base replaced by an F4 sequence, and the F4 gene sequence is shown as SEQ ID No. 1; preferably, the recombinant shuttle plasmid pF4 gene sequence is shown in SEQ ID NO. 6.
2. A recombinant shuttle plasmid pF4-pp62-p54-p30-p72, characterized in that the four structural proteins pp62, p54, p30 and p72 of african swine fever virus are inserted into the recombinant shuttle plasmid pF4 of claim 1; preferably, the pp62 gene is inserted between the enzyme cutting sites Sph I and Xho I of pF4 multiple cloning site MCS 3; the p54 gene is inserted between the enzyme cutting site Sbf I and Nhe I of the expression vector pF4 multiple cloning site MCS 1; the p30 gene is inserted between the restriction enzyme site Aat II and Eco81I of the expression vector pF4 multiple cloning site MCS 2; the p72 gene is inserted between the enzyme cutting site BamH I and EcoR I of the expression vector pF4 multiple cloning site MCS 4.
3. The recombinant shuttle plasmid pF4-pp62-p54-p30-p72 of claim 2, wherein the pp62, p54, p30 and p72 gene sequences are shown in SEQ ID nos. 2-5, respectively.
4. A recombinant virus comprising the recombinant shuttle plasmid pF4-pp62-p54-p30-p72 of any one of claims 2 to 3; preferably, the recombinant virus is recombinant baculovirus rBac-pp62-p54-p30-p 72.
5. A method of constructing a recombinant shuttle plasmid according to any one of claims 2 to 3: characterized in that the method comprises the following steps:
1) carrying out double enzyme digestion on plasmid pUC-F4 and vector pFastBac-Dual by restriction endonucleases Bsp 1407I and SnaB I, and obtaining linear F4 and pFastBac-Dual by gel cutting, recycling and purifying; obtaining a recombinant shuttle plasmid pF4 by connecting, transforming, PCR and double enzyme digestion technologies;
2) carrying out double enzyme digestion on plasmid pUC-pp62 and recombinant shuttle plasmid pF4 by using restriction enzymes Sbf I and Nhe I, and carrying out gel recovery and purification on the enzyme digestion product to obtain linear pp62 and pF 4; obtaining a recombinant shuttle plasmid pF4-pp62 by connecting, transforming, PCR and double enzyme digestion technologies;
3) carrying out double enzyme digestion on plasmid pUC-p54 and recombinant shuttle plasmid pF4-pp62 by using restriction enzymes Sph I and Xho I, and carrying out gel recovery and purification on an enzyme digestion product to obtain linear p54 and pF4-pp 62; obtaining a recombinant shuttle plasmid pF4-pp62-p54 by connecting, transforming, PCR and double enzyme digestion technologies;
4) carrying out double enzyme digestion on a plasmid pUC-p30 and a recombinant shuttle plasmid pF4-pp62-p54 by using restriction enzymes Aat II and Eco81I, and carrying out gel recovery and purification to obtain linear p30 and pF4-pp62-p 54; obtaining a recombinant shuttle plasmid pF4-pp62-p54-p30 by connecting, transforming, PCR and double enzyme digestion;
5) carrying out double enzyme digestion on plasmid pUC-p72 and recombinant shuttle plasmid pF4-pp62-p54-p30 by using restriction endonucleases BamH I and EcoR I, and cutting gel to obtain linear p72 and pF4-pp62-p54-p 30; obtaining a recombinant shuttle plasmid pF4-pp62-p54-p30-72 by connecting, transforming, PCR and double enzyme digestion;
the pp62, p54, p30 and p72 gene sequences are respectively shown in SEQ ID NO. 2-5; the gene sequence of the recombinant shuttle plasmid pF4 is shown in SEQ ID NO. 6.
6. The method for producing a recombinant virus according to claim 4, wherein the method comprises the method according to claim 5, and further comprises the steps of:
6) carrying out heat shock transformation on the recombinant shuttle plasmid pF4-pp62-p54-p30-72 into a competent cell DH10Bac, and screening out a recombinant bacmid successfully transposed by colony PCR; the recombinant baculovirus rBac-pp62-p54-p30-72 was obtained by transfecting insect cells Sf9 with liposome.
7. A method for simultaneously expressing four African swine fever virus structural proteins pp62, p54, p30 and p72 recombinant proteins in insect cells, wherein the method co-expresses four recombinant proteins of African swine fever virus pp62, p54, p30 and p72 after infecting insect cells Sf9 with the recombinant virus of claim 4 or the recombinant virus prepared by the method of claim 6; preferably, it further comprises a protein purification step; more preferably, the specific steps include:
1) inoculating the recombinant virus of claim 4, or the recombinant virus prepared by the method of claim 6, to Sf9 cells, and culturing at 28 ℃ for 72 h;
2) when 80% of Sf9 cells have cytopathic effect, RIPA lysate is added to lyse the cells;
3) centrifuging at 4 ℃ and 10000r/min for 10min, purifying the target egg in the supernatant by using a Ni affinity chromatography column after centrifugation to obtain purified recombinant proteins of African swine fever viruses pp62, p30, p54 and p 72.
8. Use of the recombinant shuttle plasmid of claims 2-3 or the recombinant virus of claim 4 for co-expressing African Swine fever Virus pp62, p30, p54 and p 72.
9. Use of the recombinant shuttle plasmid according to any one of claims 2 to 3 or the recombinant virus according to claim 4 for establishing an indirect ELISA method for detecting antibodies against African swine fever virus, wherein the recombinant shuttle plasmid according to any one of claims 2 to 3 or the recombinant virus according to claim 4 is used for co-expressing African swine fever virus pp62, p54, p30 and p72 proteins, and the mixed recombinant proteins are purified to prepare an ELISA kit by using the mixed recombinant proteins as envelope antigens.
10. An indirect ELISA detection method, characterized in that the mixed recombinant protein of African swine fever virus pp62, p30, p54 and p72 obtained in claim 7 is used as a coating antigen for detecting antibody of African swine fever virus; preferably, the addition amount of the mixed recombinant protein is 0.25 mu g/hole; more preferably, the method comprises the steps of:
1) coating: diluting the mixed recombinant protein obtained in claim 7 with 0.05mol/L of carbonate buffer solution with pH 9.6, adding to an ELISA plate at a concentration of 0.25. mu.g per well of protein, and coating overnight;
2) and (3) sealing: after PBST was washed 3 times, 200. mu.L/well Protein-Free T20(PBS) Blocking Buffer was added and blocked at room temperature for 1 h;
3) incubation of serum samples: PBST is washed for 3 times, 100 mu L/hole of a serum sample to be detected after PBST dilution is added, and incubation is carried out for 30min at 37 ℃;
4) HRP-labeled rabbit anti-porcine IgG incubation: after PBST is washed for 3 times, HRP-labeled rabbit anti-pig IgG diluted by 20,000 times and added into the mixture at a concentration of 100 mu L/hole, and the mixture is incubated at room temperature for 45 min;
5) color development and termination: PBST is washed for 3 times, TMB substrate solution is added, 100 mu L/hole is added, and the color development is carried out for 10min in a dark place at room temperature; adding 50 mu L/hole of stop solution to stop color development;
6) and (4) judging a result: enzyme-linked immunosorbent assay (OD) reading450(ii) a Sample OD450The value is more than or equal to 0.226, the result is positive, OD450The value is less than or equal to 0.213, the serum is African swine fever negative serum, OD is more than 0.226450If < 0.213, the product is judged to be suspicious.
Technical Field
The application relates to the field of molecular biology and biotechnology, in particular to an insect baculovirus expression system for simultaneously expressing four structural proteins pp62, p30, p54 and p72 of African swine fever virus and application thereof.
Background
African Swine Fever (ASF) is a virulent, highly contagious disease of pigs caused by African Swine FeverVirus (ASFV) infection. Its acute symptoms are characterized by high fever, bleeding of the reticuloendothelial system and high mortality. All breeds and all age groups of domestic pigs and wild pigs are susceptible to diseases. Ticks, in particular o.moubata and o.erratics, are storage and transmission vehicles for african swine fever viruses. The disease has previously been limited to africa until the middle of the last century, where it passed to europe, south america and the caribbean, and in 2007, it passed to eastern europe and gradually spread to russian siberian. In 2018, 8 and 3 months, the first African swine fever epidemic situation is diagnosed in China, and then the disease outbreaks in a large scale in China and brings huge damage to the pig industry in China.
The African swine fever virus belongs to DNA virus, and virus particles are in a regular icosahedral structure. The genome DNA comprises 151-167 open reading frames, and about 68 structural proteins and more than 100 non-structural proteins are coded. Among them, the four proteins pp62, p54, p30 and p72 are important structural proteins of the African swine fever virus, have extremely important functions in the assembly and infection of host cells of the African swine fever virus, and are also main target proteins of the pathogenic mechanism, vaccine development and detection method of the African swine fever virus at present.
At present, although the prior art has the effect of carrying out separate expression or partial co-expression on the four proteins individually, no method or system for simultaneously co-expressing the four proteins of African swine fever virus pp62, p54, p30 and p72 in insect cells is seen. However, since the African swine fever virus belongs to a highly pathogenic virulent swine fever virus, the infectious disease virus of the national legal class has to be operated in other laboratories except the laboratories approved by the Ministry of rural agriculture to involve experiments such as separation of the African swine fever virus according to the requirements of biological safety management. Therefore, the search for the one-time co-expression of various structural proteins as a virus substitute can provide a new research approach and a method for preparing the efficient antigen of the African swine fever virus under the condition that the operation of the African swine fever virus cannot be carried out, and has extremely important significance.
In view of this, the present invention is proposed.
Disclosure of Invention
One of the purposes of the application is to provide a construction method of a recombinant baculovirus containing pF4-pp62-p54-p30-p72, and the recombinant baculovirus can simultaneously express four structural proteins of African swine fever virus pp62, p30, p54 and p72 after infecting insect cells Sf 9;
the other purpose of the application is to provide an application, which utilizes the simultaneous expression of recombinant baculovirus to prepare four recombinant proteins of pp62, p30, p54 and p 72;
the third purpose of the application is to provide an indirect ELISA method, which takes four co-expressed mixed recombinant proteins of pp62, p30, p54 and p72 as coating antigens to establish the indirect ELISA method for detecting the African swine fever antibody;
to achieve the above object, the present invention provides a recombinant shuttle plasmid pF4 having 4 multiple cloning sites;
in some embodiments, the sequence between base 3510 and base 3985 of the plasmid pF4, vector pFastBac-Dual, is replaced by F4 sequence, having 4 multiple cloning sites MCS1, MCS2, MCS3, MCS4 containing independent promoters.
In some preferred embodiments, the gene sequence of F4 is shown in SEQ ID No. 1; preferably, the gene sequence of the recombinant shuttle plasmid pF4 is shown in SEQ ID NO. 6.
The application also provides pF4-pp62-p54-p30-p72 of the recombinant shuttle plasmid inserted with the genes of the four structural proteins pp62, p30, p54 and p72 of the African swine fever virus, wherein the genes of the four structural proteins pp62, p54, p30 and p72 of the African swine fever virus are inserted into the recombinant shuttle plasmid pF 4.
In some embodiments, the african swine fever virus pp62 gene is inserted between the cleavage sites Sph I and Xho I of the pF4 multiple cloning site MCS 3; the p54 gene is inserted between the enzyme cutting site Sbf I and NheI of the expression vector pF4 multiple cloning site MCS 1; the p30 gene is inserted between the restriction enzyme site Aat II and Eco81I of the expression vector pF4 multiple cloning site MCS 2; the p72 gene is inserted between the enzyme cutting site BamH I and EcoR I of the expression vector pF4 multiple cloning site MCS 4.
In some embodiments, the pp62, p54, p30 and p72 gene sequences are shown in SEQ ID nos. 2-5, respectively.
The invention also provides a recombinant virus, which is characterized by comprising the recombinant shuttle plasmid or being transferred or transposed by the recombinant shuttle plasmid;
in some preferred embodiments, the recombinant virus is a recombinant baculovirus rBac-pp62-p54-p30-p 72.
The application also provides a construction method of the recombinant expression plasmid or virus, which comprises the following steps:
1) carrying out double enzyme digestion on plasmid pUC-F4 and vector pFastBac-Dual by restriction endonucleases Bsp 1407I and SnaB I, and obtaining linear F4 and pFastBac-Dual by gel cutting, recycling and purifying; obtaining a recombinant shuttle plasmid pF4 by technologies such as connection, transformation, PCR and double enzyme digestion;
2) carrying out double enzyme digestion on plasmid pUC-pp62 and recombinant shuttle plasmid pF4 by using restriction enzymes Sbf I and Nhe I, and carrying out gel recovery and purification on the enzyme digestion product to obtain linear pp62 and pF 4; obtaining a recombinant shuttle plasmid pF4-pp62 by technologies of connection, transformation, PCR, double enzyme digestion and the like;
3) carrying out double enzyme digestion on plasmid pUC-p54 and recombinant shuttle plasmid pF4-pp62 by using restriction enzymes Sph I and Xho I, and carrying out gel recovery and purification on an enzyme digestion product to obtain linear p54 and pF4-pp 62; obtaining a recombinant shuttle plasmid pF4-pp62-p54 by technologies such as connection, transformation, PCR, double enzyme digestion and the like;
4) carrying out double enzyme digestion on a plasmid pUC-p30 and a recombinant shuttle plasmid pF4-pp62-p54 by using restriction enzymes Aat II and Eco81I, and carrying out gel recovery and purification to obtain linear p30 and pF4-pp62-p 54; obtaining a recombinant shuttle plasmid pF4-pp62-p54-p30 by technologies of connection, transformation, PCR, double enzyme digestion and the like;
5) carrying out double enzyme digestion on plasmid pUC-p72 and recombinant shuttle plasmid pF4-pp62-p54-p30 by using restriction endonucleases BamH I and EcoR I, and cutting gel to obtain linear p72 and pF4-pp62-p54-p 30; obtaining recombinant shuttle plasmid pF4-pp62-p54-p30-72 by technologies of connection, transformation, PCR, double enzyme digestion and the like;
6) the recombinant shuttle plasmid pF4-pp62-p54-p30-72 is transformed into a competent cell DH10Bac in a heat shock mode, and recombinant bacmid successfully transposed is screened out through colony PCR. The insect cell Sf9 is transfected by liposome, so that the recombinant baculovirus rBac-pp62-p54-p30-72 is obtained.
The application also provides a method for co-expressing African swine fever virus pp62, p54, p30 and p72 proteins after the recombinant baculovirus is used for infecting insect cells Sf9, which comprises the following steps:
1) inoculating the recombinant baculovirus to Sf9 cells, and culturing at 27 ℃ for 72 h;
2) when 80% of Sf9 cells have cytopathic effect, RIPA lysate is added to lyse the cells;
3) centrifuging at 4 deg.C and 10000r/min for 10min, and purifying the desired egg in the supernatant with Ni affinity chromatography column to obtain protein mixture of purified African swine fever viruses pp62, p30, p54 and p 72.
The application also provides a method for preparing an indirect ELISA kit for detecting the African swine fever antibody, which comprises the steps of co-expressing African swine fever virus pp62, p54, p30 and p72 proteins by using the recombinant plasmid, purifying to obtain mixed recombinant protein, and preparing the ELISA kit by using the mixed recombinant protein as a coating antigen; preferably, the amount of the mixed recombinant protein added is 0.25. mu.g/well.
The application also provides an indirect ELISA method for detecting the African swine fever antibody, which is established by taking four mixed recombinant proteins of co-expressed and purified pp62, p30, p54 and p72 as coating antigens, wherein the addition amount of the mixed recombinant proteins is preferably 0.25 mu g/hole.
In some embodiments, the above method specifically comprises the steps of:
(1) coating the purified mixed recombinant protein diluted by a carbonate buffer solution (0.05mol/L, pH 9.6) coating solution, adding the diluted mixed recombinant protein into an ELISA plate, wherein each hole of the mixed recombinant protein is 0.25 mu g of protein, and coating the mixed recombinant protein overnight;
(2) after PBST is blocked and washed for 3 times, 200 mu L/hole Protein-Free T20(PBS) Blocking Buffer is added for Blocking at room temperature for 1 h;
(3) after PBST is incubated and washed for 3 times by the serum sample, 100 mu L/hole of the serum sample to be detected (the optimal dilution multiple is 1/20) after PBST is diluted is added, and incubation is carried out for 30min at 37 ℃;
(4) after PBST (PBST) is washed for 3 times by incubating rabbit anti-pig IgG marked by HRP, rabbit anti-pig IgG marked by HRP and diluted by 20,000 times is added, and the mixture is incubated for 45min at room temperature in 100 mu L/hole;
(5) after 3 times of color development and PBST termination washing, TMB substrate solution is added, 100 mu L/hole, and color development is carried out for 10min at room temperature in a dark place. Adding 50 mu L/hole of stop solution to stop color development;
(6) reading and result judging microplate reader reading OD 450. The sample OD450 value is more than or equal to 0.226, and the sample is judged to be positive, namely the African swine fever positive serum; and the OD450 value is less than or equal to 0.213, and the serum is African swine fever negative serum. The value of OD450 is more than 0.226 and less than 0.213, the value is judged to be suspicious and needs to be judged through another experiment.
The invention also provides application of the recombinant shuttle plasmid or the recombinant virus in co-expression of African swine fever virus pp62, p30, p54 and p72 proteins.
The invention also provides application of the recombinant shuttle plasmid or the recombinant virus in establishing an indirect ELISA method for detecting the African swine fever virus antibody, which is characterized in that the recombinant shuttle plasmid or the recombinant virus is used for co-expressing African swine fever virus pp62, p54, p30 and p72 proteins, mixed recombinant proteins are obtained through purification, and the mixed recombinant proteins are used as coating antigens to prepare an ELISA kit.
The invention has the following advantages:
(1) the invention obtains a brand-new recombinant plasmid pF4 with four multiple cloning sites, and provides an effective and reliable way for co-expressing a plurality of proteins. The recombinant plasmid pF4-pp62-p54-p30-p72 constructed based on the recombinant plasmid can co-express pp62, p30, p54 and p72 in insect cells in a soluble way, has high expression level and is suitable for downstream application.
(2) In view of the fact that the African swine fever virus belongs to a highly pathogenic fulminating pig infectious disease virus, the infectious disease virus of the national legal class can not be operated by other laboratories except for the laboratory approved by the Ministry of rural agriculture to relate to experiments such as separation of the African swine fever virus and the like according to the requirements of biological safety management. Therefore, the technology of the invention can co-express four structural proteins of the African swine fever virus pp62, p30, p54 and p72 in insect cells at one time with high efficiency, and provides a new research approach and a method for preparing high-efficiency antigens of the African swine fever virus under the condition that the operation of the African swine fever virus cannot be carried out, thereby having significant meaning in the aspect.
(3) The invention directly uses four mixed recombinant proteins of the expressed and purified African swine fever virus as envelope antigens to establish the indirect ELISA method for detecting the African swine fever virus antibody, thereby not only being simple and convenient and saving the cost, but also obviously improving the detection rate of the African swine fever virus antibody by the mixed protein envelope.
(4) The indirect ELISA method for detecting the African swine fever virus antibody, which is established by the invention, has good specificity, high sensitivity and repeatability, and provides a new detection technology for detecting the African swine fever virus antibody.
Drawings
Fig. 1 is a flow chart of the experimental technique of the present application.
FIG. 2 is a structural diagram of the synthetic sequence F4.
FIG. 3 is a diagram showing the structure of the vector pF4 obtained by transformation.
FIG. 4 is a structural diagram of a recombinant vector pF4-pp62-p54-p30-p72 obtained by engineering, wherein,
f1 origin, bases 102-557
Ampicillin resistance gene, base 689-1549
pUC origin, bases 1694-2367
Tn7R bases 2611-2835
Gentamicin resistance gene, base 2902-
HSV tkpolyadenylation signal:
(1) Bases 3992-
(2) Base 4913-
Multiple cloning site:
(1) base 4275-4322 (comprising SbfI (SdaI), NcoI, NheI, EheI)
(1) Base 5196-
p10 promoter (Pp10):
(1) base 4323-
(2) Base 5259-
Polyhedrin Promoter (PPH):
(1) base 4463-
(1) Base 5399-5527
Multiple cloning site:
(1) base 4592-4652 (comprising: AatII, Eco81I)
(2) Base 5528-
SV40 polyadenylation signal:
(1) Base 4653-4893
(2) Base 5643-
Tn7L bases 5913-6077.
FIG. 5 shows the construction and identification results of recombinant plasmid pF4-pp62-p54-p30-p72,
a is the result of pF4-pp62 construction,
b is the result of pF4-pp62-p54 construction,
c is the construction result of pF4-pp62-p54-p30,
d is pF4-pp62-p54-p30-p72 construction result
Fig. 6 is a result of cytopathy, wherein,
a is normal Sf9 cell;
b is lesion Sf9 cells 72h after transfection.
FIG. 7 shows the results of indirect immunofluorescence, wherein
A is wild baculovirus infected Sf9 cells;
b is Sf9 cell infected by recombinant baculovirus rBac-PP62-P54-P30-P72
FIG. 8 shows the result of SDS-PAGE of the purified product, wherein
1 is a purified product;
2 is Sf9 cell whole protein infected by recombinant baculovirus rBac-PP 62-P54-P30-P72;
3 is Sf9 cell holoprotein infected by wild baculovirus;
and 4 is a protein Marker.
FIG. 9 shows Western blot results of the purified product, wherein,
m is a protein Marker;
1 is Sf9 cell holoprotein infected by wild baculovirus;
2 is a purified product.
FIG. 10 shows the results of the indirect ELISA method specific assay.
FIG. 11 shows the results of sensitivity tests of indirect ELISA method.
Detailed Description
Embodiments of the present application will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present application and should not be construed as limiting the scope of the present application. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by manufacturers, and are all conventional products available on the market.
Definition of partial terms
Unless defined otherwise below, all technical and scientific terms used in the detailed description of the present invention are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present invention.
As used herein, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of …" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.
Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun.
The terms "about" and "substantially" in the present invention denote an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.
Specific examples are as follows:
example 1 design and preparation of pF4 vector
In order to simultaneously express the African swine fever virus structural proteins pp62, p30, p54 and p72, the vector pFastBac-Dual is modified to have four cloning sites, and each cloning site has a separate promoter. The invention analyzes the whole sequence of the vector pFastBac-Dual, finds that the 3510 th base of the vector is Bsp 1407I restriction site and is unique, the 3985 th base is SnaB I restriction site and is unique, and simultaneously, no element exists between the 3510 th base and the 3985 th base, so that the vector can be modified as a modification region.
Because the original vector has two cloning sites, and respective promoters are Polyhedrin and P10, the sequence between the 3510 th base and the 3985 th base is cut by Bsp 1407I and SnaB I double enzyme digestion vector pFastBac-Dual, and then a synthetic sequence F4 (the sequence comprises the sequence between the 3510 th base and the 3985 th base and two cloning sites, and the two cloning sites have respective independent promoters, specifically the series is shown in SEQ ID NO.1) is inserted, as shown in FIG. 2, thereby completing the transformation of the vector, the transformed vector is named as pF4, and the whole vector map is shown in FIG. 3.
Example 2 construction of recombinant vector pF4-pp62-p54-p30-p72
Pp62, p30, p54 and p72 gene sequences (for the convenience of protein expression and purification, a His tag sequence is added to the 5 ' end of each gene sequence) are synthesized by shanghai bio-corporation by using Shenyang strain of African swine fever as a reference sequence (GenBank: MH766894.1), respectively, and the gene sequences are respectively referred to SEQ ID nos. 2-5, to obtain recombinant plasmids pUC-pp62 (the 5 ' and 3 ' ends of pp62 sequences have cleavage sites Sph I and Xho I, respectively), pUC-p30 (the 5 ' and 3 ' ends of p30 sequences have cleavage sites Aat II and Eco81I, respectively), pUC-p54 (the 5 ' and 3 ' ends of p54 sequences have cleavage sites Sbf I and Nhe I, respectively), and pUC-p72 (the 5 ' and 3 ' ends of p72 sequences have cleavage sites BamH I and Eco R I, respectively).
According to the conventional molecular cloning technology, pp62, p54, p30 and p72 gene sequence genes are sequentially inserted into four cloning sites of an improved vector pF4, and an improved recombinant plasmid pF4 with four multi-cloning sites is prepared, wherein the sequence of the improved recombinant plasmid is shown as SEQ ID NO. 6. The specific construction comprises the following steps:
1) carrying out double enzyme digestion on plasmid pUC-F4 and vector pFastBac-Dual by restriction endonucleases Bsp 1407I and SnaB I, and obtaining linear F4 and pFastBac-Dual by gel cutting, recycling and purifying; obtaining a recombinant shuttle plasmid pF4 by technologies such as connection, transformation, PCR and double enzyme digestion;
2) carrying out double enzyme digestion on plasmid pUC-pp62 and recombinant shuttle plasmid pF4 by using restriction enzymes Sbf I and Nhe I, and carrying out gel recovery and purification on the enzyme digestion product to obtain linear pp62 and pF 4; obtaining a recombinant shuttle plasmid pF4-pp62 by technologies of connection, transformation, PCR, double enzyme digestion and the like;
3) carrying out double enzyme digestion on plasmid pUC-p54 and recombinant shuttle plasmid pF4-pp62 by using restriction enzymes Sph I and Xho I, and carrying out gel recovery and purification on an enzyme digestion product to obtain linear p54 and pF4-pp 62; obtaining a recombinant shuttle plasmid pF4-pp62-p54 by technologies such as connection, transformation, PCR, double enzyme digestion and the like;
4) carrying out double enzyme digestion on plasmid pUC-p30 and recombinant shuttle plasmid pF4-pp62-p54 by using restriction enzymes Aat II and Eco81I, and carrying out gel recovery and purification to obtain linear p30 and pF4-pp62-p 54; obtaining a recombinant shuttle plasmid pF4-pp62-p54-p30 by technologies of connection, transformation, PCR, double enzyme digestion and the like;
5) carrying out double enzyme digestion on plasmid pUC-p72 and recombinant shuttle plasmid pF4-pp62-p54-p30 by using restriction endonucleases BamH I and EcoR I, and cutting gel to obtain linear p72 and pF4-pp62-p54-p 30; the recombinant shuttle plasmid pF4-pp62-p54-p30-72 is obtained by the technologies of connection, transformation, PCR, double enzyme digestion and the like.
6) And identifying the construction result.
As a result, 4 genes are correctly inserted through sequencing, so that a recombinant plasmid pF4-pp62-p54-p30-p72 is constructed, the structure of the recombinant plasmid is shown in figure 4, and the identification result of the whole construction process is shown in figure 5.
EXAMPLE 3 extraction of recombinant Bacmid-pp62-p54-p30-p72
The recombinant plasmid pF4-pp62-p54-p30-p72 is transformed into a competent cell DH10Bac by means of thermal transformation, and after 48h, a single white colony is picked and streaked and cultured for another 48 h. A single white colony is picked and subjected to colony PCR identification to determine whether the pp62-p54-p30-p72 is successfully transposed. Positive results were identified, grown overnight in large numbers and used with PureLinkTMAnd (3) massively extracting and purifying the recombinant Bacmid-pp62-p54-p30-p72 by using a HiPure plasmid purification kit.
EXAMPLE 4 acquisition of recombinant baculovirus rBac-pp62-p54-p30-p72
Using transfection kitsII Reagent recombinant Bacmid-pp62-p54-p30-p72 transfected Sf9 cells, setting blank control, and continuously observing cytopathic condition. When the cytopathic effect is obvious, collecting cell culture supernatant, namely P1 generation recombinant baculovirus rBac-pp62-P54-P30-P72, and continuously carrying out passageTo increase the titer of the recombinant baculovirus. Significant cytopathic effects were observed 48 to 72h after transfection: compared with normal Sf9 cells, the number of cells was significantly reduced, the cell volume was increased, the cells were rounded, and tympanites occurred, they became easy to fall off, and a small amount of cells were broken, as shown in FIG. 6. More than 72h after transfection, Sf9 cells showed massive disruption.
EXAMPLE 5 Indirect immunofluorescence assay for Co-expression of PP62, P30, P54 and P72
Sf9 cells are inoculated into a 24-hole culture plate, after adherence for 1h, recombinant baculovirus rBac-pp62-p54-p30-p72 is inoculated, and the culture is carried out for 72h at 28 ℃. The culture medium was discarded and gently washed 3 times with PBST (pH 7.4); adding pre-cooled 4% paraformaldehyde, and fixing at room temperature for 1 h; after PBST is washed, 1% Triton x-100 is added, and the mixture is transparent for 1 hour at room temperature; after washing, adding a protein-free closed liquid chamber for warm sealing for 2 hours; removing the blocking solution, adding African swine fever standard positive serum (purchased from Spanish national veterinary institute), and incubating overnight at 4 ℃; after washing, adding a Goat Anti-Pig IgG-FITC fluorescent antibody (diluted 1: 200), and incubating for 30min at 37 ℃ in the dark; after washing, observation was carried out under an inverted fluorescence microscope. The expression conditions of pp62, p30, p54 and p72 proteins after Sf9 cells are infected by recombinant baculovirus rBac-pp62-p54-p30-p72 are detected by indirect immunofluorescence.
As a result, as shown in FIG. 7, the Sf9 cells infected with the wild baculovirus (without the target gene inserted) did not observe any specific green fluorescence, while the Sf9 cells infected with the recombinant baculovirus rBac-pp62-p54-p30-p72 showed strong green fluorescence. The result shows that the recombinant baculovirus rBac-pp62-p54-p30-p72 infected Sf9 cell can express a large amount of four structural proteins of African swine fever virus, pp62, p30, p54 and p72 proteins.
Example 6 expression and purification of PP62, P30, P54 and P72
2mL of recombinant baculovirus rBac-pp62-p54-p30-p72 was seeded to adherent Sf9 cells. Culturing for 72h in a constant temperature incubator at 28 ℃. When 80% of Sf9 cells have cytopathic effect (cells stop growing, cells swell and become larger) and no cell breakage occurs, abandoning the cell culture solution, adding 1mL of RIPA lysate to make the lysate spread on the cell surface, and standing for 10 min. Subsequently, Sf9 cells were blown or scraped with a cell scraper and collected into centrifuge tubes. To lyse the cells sufficiently, the collected cells may be repeatedly frozen and thawed 3 times or more. After enough cell lysate is collected, centrifuging the cell lysate for 10min at the centrifugation condition of 4 ℃ and 10000r/min, reserving supernatant and discarding precipitate. And purifying the target proteins pp62, p30, p54 and p72 in the supernatant by using a Ni affinity chromatography column to obtain four mixed recombinant proteins of African swine fever virus pp62, p30, p54 and p 72.
Example 7 SDS-PAGE results of purified products
5 XLoading buffer was added at a ratio of 4:1, and after boiling, 5. mu.L of the protein sample was subjected to SDS-PAGE. Direct Coomassie blue staining was performed for 0.5h, followed by destaining, and the results are shown in FIG. 8. SDS-PAGE showed 4 distinct protein bands in the purified product (lane 1), with sizes of 76kD, 63kD, 26kD and 19kD, respectively, consistent with the expected sizes of p72, pp62, p30 and p54 proteins.
Example 8 Western blot results of purified products
SDS-PAGE electrophoresis was performed according to example 7, the membrane was transferred to an NC membrane, blocking was performed according to the conventional Western blot method, primary antibody (primary antibody against swine African swine fever standard positive serum diluted 1:1000 times), enzyme-labeled secondary antibody (HRP-labeled rabbit anti-swine polyclonal antibody 1:5000), and finally color development was performed to evaluate the immunogenicity of the purified proteins (pp62, p30, p54 and p 72). The Western blot results are shown in FIG. 9, and show that the purified product (lane 2) has 4 distinct blotting bands with sizes of 76kD, 63kD, 26kD and 19kD, respectively, which are consistent with the expected sizes of p72, pp62, p30 and p54 proteins and with the SDS-PAGE electrophoresis results.
SDS-PAGE and Western blot results show that the invention can simultaneously express a large amount of four structural proteins of African swine fever virus p72, pp62, p30 and p54 in insect cells, and a mixed product of the four structural proteins obtained by affinity chromatography purification has good immunogenicity and reactogenicity.
EXAMPLE 9 preparation of Indirect ELISA method for detection of ASFV antibody
An indirect ELISA method for detecting ASFV antibody is established by taking co-expressed and purified ASFV PP62, P30, P54 and P72 recombinant protein as envelope antigen. The method comprises the following specific steps:
(1) coating quilt
The purified recombinant protein was diluted with a carbonate buffer (0.05mol/L, pH 9.6) coating and added to an ELISA plate at 0.25. mu.g per well of protein, overnight coating.
(2) Sealing of
After 3 PBST washes, 200. mu.L/well Protein-Free T20(PBS) Blocking Buffer (from Thermo) was added and blocked at room temperature for 1 h.
(3) Serum sample incubation
After PBST was washed 3 times, 100. mu.L/well of a serum sample to be tested diluted with PBST (the optimal dilution factor was 1/20) was added, and incubation was carried out at 37 ℃ for 30 min.
(4) HRP-labeled rabbit anti-porcine IgG incubation
After PBST washing 3 times, 20000 times diluted HRP-labeled rabbit anti-pig IgG 100. mu.L/well was added and incubated at room temperature for 45 min.
(5) Color development and termination
PBST was washed 3 times, then TMB substrate solution was added at 100. mu.L/well, and color development was carried out for 10min at room temperature in the dark. 2mol/LH is added2SO4The color development was stopped at 50. mu.L/well.
(6) Reading number
Enzyme-linked immunosorbent assay (OD) reading450
(7) Determination of results
218 known african swine fever negative sera were tested by the established indirect ELISA method, and the mean value X of the test results was calculated to be 0.193 and the standard deviation SD was calculated to be 0.011, and the positive threshold PC was further calculated to be 0.226 and the negative threshold NC was calculated to be 0.213. The decision criteria for determining the detection method are thus: sample OD450The value is more than or equal to 0.226, and the serum is determined to be positive, namely the African swine fever positive serum; OD450The value is less than or equal to 0.213, the African swine fever negative serum is obtained. OD of 0.226450If the number is less than 0.213, the result is suspicious and needs to be determined through another experiment.
TABLE 1 Indirect ELISA reaction conditions
Example 10 specificity test
The established indirect ELISA method is used for respectively detecting the positive serum of the swine infectious disease with the similar or common clinical symptoms of foot-and-mouth disease (FMDV), Vesicular Stomatitis (VSV), Porcine Reproductive and Respiratory Syndrome (PRRSV), porcine Pseudorabies (PRV), Porcine Circovirus (PCV) and Classical Swine Fever Virus (CSFV), judging whether cross reaction exists or not, and checking the specificity of the cross reaction.
The positive serum is detected by the established indirect ELISA method, and the result shows that the OD of the 6 virus positive serum450nmValues were all < 0.209 and all were negative (FIG. 10), indicating that the method had good specificity.
EXAMPLE 11 detection Limit test
The African swine fever standard positive serum is diluted by a multiple ratio from 160 times, detection is carried out by an established indirect ELISA method, and the dilution times capable of detecting positive is determined as the detection limit. And compared with a commercial detection kit on the market. The results show that OD was measured when the positive serum was diluted 5120-fold450nmThe value is still larger than the critical value of 0.226, which indicates that the established indirect ELISA method has very high sensitivity, the detection limit can reach 5120 times, which is far higher than that of the commercial detection kit, and the result is shown in FIG. 11.
EXAMPLE 12 repeatability test
3 enzyme labeling plates coated at the same time are taken out, and 4 plates are randomly drawn out. Selecting 6 negative serum samples and 2 positive serum samples, respectively adding the samples into a plate, operating according to optimized ELISA conditions, and respectively calculating the average OD of each sample450nmAnd calculating the coefficient of variation of each sample according to the formula coefficient of variation which is the standard deviation/average value, and finally calculating the average coefficient of variation of all samples to be used as the intra-batch coefficient of variation. In the same way, 3 enzyme label plates coated at different times are taken, and 4 plates are randomly extracted from each plate. The batch-to-batch coefficient of variation was calculated using 6 negative serum samples and 2 positive serum samples, operating according to the above description.
TABLE 2 ELISA repeatability test results
The results in Table 2 show that the intra-batch coefficient of variation is 2.36-8.56% and the inter-batch coefficient of variation is 3.34-9.76%. The established indirect ELISA detection method is stable and repeatable, and can be applied to actual detection.
The above description of the specific embodiments of the present application is not intended to limit the present application, and those skilled in the art may make various changes and modifications according to the present application without departing from the spirit of the present application, which is intended to fall within the scope of the appended claims.
SEQUENCE LISTING
<110> Shenzhen customs animal and plant inspection and quarantine technical center
<120> method for co-expressing four structural proteins of African swine fever virus in insect cells and application thereof
<130>2020
<160>6
<170>PatentIn version 3.5
<210>1
<211>1397
<212>DNA
<213> Artificial sequence
<400>1
tgtacaaaaa aacagtcata acaagccatg aaaaccgcca ctgcgccgtt accaccgctg 60
cgttcggtca aggttctgga ccagttgcgt gagcgcatac gctacttgca ttacagttta 120
cgaaccgaac aggcttatgt caactgggtt cgtgccttca tccgtttcca cggtgtgcgt 180
cacccggcaa ccttgggcag cagcgaagtc gaggcatttc tgtcctggct ggcgaacgag 240
cgcaaggttt cggtctccac gcatcgtcag gcattggcgg ccttgctgtt cttctacggc 300
aaggtgctgt gcacggatct gccctggctt caggagatcg gtagacctcg gccgtcgcgg 360
cgcttgccgg tggtgctgac cccggatgaa gtggttcgca tcctcggttt tctggaaggc 420
gagcatcgtt tgttcgccca ggactctagc tatagttcta gtggttggcc tacttacccg 480
tagtggctat ggcagggctt gccgccccga cgttggctgc gagccctggg ccttcacccg 540
aacttggggg ttggggtggg gaaaaggaag aaacgcgggc gtattggtcc caatggggtc 600
tcggtggggt atcgacagag tgccagccct gggaccgaac cccgcgttta tgaacaaacg 660
acccaacacc cgtgcgtttt attctgtctt tttattgccg tcatagcgcg ggttccttcc 720
ggtattgtct ccttccgtgt ttcagttagc ctcccccatc tcccgggcgc cgctgctagc 780
accatggagg cccctgcagg tgatcaagtc ttcgtcgagt gattgtaaat aaaatgtaat 840
ttacagtata gtattttaat taatatacaa atgatttgat aataattctt atttaactat 900
aatatattgt gttgggttga attaaaggtc cgtatactcc ggaatattaa tagatcatgg 960
agataattaa aatgataacc atctcgcaaa taaataagta ttttactgtt ttcgtaacag 1020
ttttgtaata aaaaaaccta taaatattcc ggattattca taccgtccca ccatcgggcg 1080
cggatcgacg tccgaactac ctaaggtaga gcgtctcgac aggcttgtcg agaagtacta 1140
gaggatcata atcagccata ccacatttgt agaggtttta cttgctttaa aaaacctccc 1200
acacctcccc ctgaacctga aacataaaat gaatgcaatt gttgttgtta acttgtttat 1260
tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa ataaagcatt 1320
tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt atcatgtctg 1380
gatctgatca ttacgta 1397
<210>2
<211>1677
<212>DNA
<213> African swine fever virus (African swine fever virus)
<400>2
ctcgagatgt cgtactacca tcaccatcac catcacgatt acgatatccc aacgaccgaa 60
aacctgtatt ttcagggaat gccctctaat atgaaacagt tttgcaagat ttctgtatgg 120
ctacagcagc acgatccaga tttattagaa attatcaaca acttatgtat gcttggcaat 180
ttatccgcgg caaagtacaa acacggagtt accttcattt accccaaaca ggcaaagatc 240
cgcgatgaaa taaaaaaaca tgcctactcc aatgaccctt cacaagccat aaagacctta 300
gaatcactca tccttccatt ttacattccc actccagcgg agttcaccgg ggaaatcggc 360
tcctacaccg gagtgaaatt agaggttgaa aaaacggagg cgaataaagt tattttaaaa 420
aatggagaag cggtcctagt accggcggcc gattttaagc cctttcctga tcgccgacta 480
gcggtctgga tcatggagtc aggctctatg cccctggagg gtccccccta taagcggaaa 540
aaggagggtg gggggaatga cccgccggtt cctaagcata tctcgccgta tactccgcgc 600
acgcgtattg ccattgaggt ggaaaaggcc tttgatgact gtatgcgtca aaactggtgt 660
agtgtcaata atccctatct tgccaagtcg gtctccttgc tgtctttctt gtcgctcaac 720
catcccaccg agtttattaa ggtactgccg cttatagact ttgacccctt ggtgaccttt 780
tatctacttc ttgagcccta taaaacgcat ggggatgact ttttaattcc ggaaaccatt 840
ttattcggcc ctaccggatg gaatggtaca gatctgtatc aaagtgccat gctggagttt 900
aaaaagtttt ttacccagat tactcgccaa acctttatgg acatagccga ttcggctact 960
aaggaggtag atgttcccat atgttactct gatcccgaaa ccgtacattc ctatgccaat 1020
cacgtgcgta ctgaaatttt gcatcacaat gccgtcaata aggttacaac acctaacctc 1080
gtcgtgcagg cctataatga gcttgagcaa accaatacca tacgacatta cggccctatt 1140
ttcccggaaa gtaccatcaa cgcactgcgt ttttggaaaa agctgtggca ggatgaacag 1200
cgatttgtta tccacggcct gcaccgcacg ttgatggatc aacccaccta tgaaacctct 1260
gagtttgcag agatcgttag aaatttacgg ttttcgcgtc ccggcaataa ctatataaac 1320
gagcttaata ttacaagtcc cgctatgtac ggcgacaagc ataccaccgg agatattgcg 1380
cccaatgata gatttgccat gttggtggcc tttatcaaca gtactgactt tttatacacc 1440
gcgattcccg aggaaaaggt aggggggaat gaaacccaaa ccagtagcct tacagaccta 1500
gttccaacac ggctacactc ttttttaaat cataatctaa gcaaacttaa aatcttaaac 1560
cgcgcgcagc aaacggttag aaatattctt tcaaatgatt gtcttaatca actgaaacat 1620
tatgttaaac acacgggaaa aaatgaaata ctaaagttac ttcaagaata agcatgc 1677
<210>3
<211>551
<212>DNA
<213> African swine fever virus (African swine fever virus)
<400>3
cctgcaggat gtcgtactac catcaccatc accatcacga ttacgatatc ccaacgaccg 60
aaaacctgta ttttcagggc atgtatacta ttctcattgc tatcgtggtc ttagtcatca 120
ttatcatcgt tctaatctat ctattctctt caagaaagaa aaaagctgct gctattgagg 180
aggaagatat acagtttata aatccttatc aagatcagca gtgggtagaa gtcactccac 240
aaccaggtac ctctaaacca gctggagcga ctacagcaag tgtaggcaag ccagtcacgg 300
gcagaccggc aacaaacaga ccagcaacaa acaaaccagt tacggacaac ccagttacgg 360
acagactagt catggcaact ggcgggccgg cggccgcacc tgcggccgcg agtgctcctg 420
ctcatccggc tgagccttac acgacagtca ctactcagaa cactgcttca caaacaatgt 480
cggctattga aaatttacga caaagaaaca cctatacgca taaagaccta gaaaactcct 540
tgtaagctag c 551
<210>4
<211>691
<212>DNA
<213> African swine fever virus (African swine fever virus)
<400>4
gacgtcatgt cgtactacca tcaccatcac catcacgatt acgatatccc aacgaccgaa 60
aacctgtatt ttcagggcat ggattttatt ttaaatatat ccatgaaaat ggaggtcatc 120
ttcaaaacgg atttaagatc atcttcacaa gttgtgtttc atgcgggtag cctgtataat 180
tggttttctg ttgagattat caatagcggt agaattgtta cgaccgctat aaaaacattg 240
cttagtactg ttaagtatga tattgtgaaa tctgctcgta tatatgcagg gcaagggtat 300
actgaacatc aggctcaaga agaatggaat atgattctgc atgtgctgtt tgaagaggag 360
acggaatcct cagcatcttc ggagaacatt catgaaaaaa atgataatga aaccaatgaa 420
tgcacatcct cctttgaaac gttgtttgag caagagccct catcggaggt acctaaagac 480
tccaagctgt atatgcttgc acaaaagact gtgcaacata ttgaacaata tggaaaggca 540
cctgatttta acaaggttat tagagcacat aattttattc aaaccattta tggaacccct 600
ctaaaggaag aagaaaaaga ggtggtaaga ctcatggtta ttaaactttt aaaaaaaata 660
agcttttttc tcacctacat ttaacctaag g 691
<210>5
<211>2025
<212>DNA
<213> African swine fever virus (African swine fever virus)
<400>5
ggatccatgt cgtactacca tcaccatcac catcacgatt acgatatccc aacgaccgaa 60
aacctgtatt ttcagggcat ggcatcagga ggagcttttt gtcttattgc taacgatggg 120
aaggccgaca agattatatt ggcccaagac ttgctgaata gcaggatctc taacattaaa 180
aatgtgaaca aaagttatgg gaaacccgat cccgaaccca ctttgagtca aatcgaagaa 240
acacatttgg tgcattttaa tgcgcatttt aagccttatg ttccagtagg gtttgaatac 300
aataaagtac gcccgcatac gggtaccccc accttgggaa acaagcttac ctttggtatt 360
ccccagtacg gagacttttt ccatgatatg gtgggccatc atatattggg tgcatgtcat 420
tcatcctggcaggatgctcc gattcagggc acgtcccaga tgggggccca tgggcagctt 480
caaacgtttc ctcgcaacgg atatgactgg gacaaccaaa cacccttaga gggcgccgtt 540
tacacgcttg tagatccttt tggaagaccc attgtacccg gcacaaagaa tgcgtaccga 600
aacttggttt actactgcga ataccccgga gaacgacttt atgaaaacgt aagattcgat 660
gtaaatggaa attccctaga cgaatatagt tcggatgtca caacgcttgt gcgcaaattt 720
tgcatcccag gggataaaat gactggatat aagcacttgg ttggccagga ggtatcggtg 780
gagggaacca gtggccctct cctatgcaac attcatgatt tgcacaagcc gcaccaaagc 840
aaacctattc ttaccgatga aaatgatacg cagcgaacgt gtagccatac caacccgaaa 900
tttctttcac agcattttcc cgagaactct cacaatatcc aaacagcagg taaacaagat 960
attactccta tcacggacgc aacgtatctg gacataagac gtaatgttca ttacagctgt 1020
aatggacctc aaacccctaa atactatcag ccccctcttg cgctctggat taagttgcgc 1080
ttttggttta atgagaacgt gaaccttgct attccctcag tatccattcc cttcggcgag 1140
cgctttatca ccataaagct tgcatcgcaa aaggatttgg tgaatgaatt tcctggactt 1200
tttgtacgcc agtcacgttt tatagctgga cgccccagta gacgcaatat acgctttaaa 1260
ccatggttta tcccaggagt cattaatgaa atctcgctca cgaataatga actttacatc 1320
aataacctgt ttgtaacccc tgaaatacac aacctttttg taaaacgcgt tcgcttttcg 1380
ctgatacgtg tccataaaac gcaggtgacc cacaccaaca ataaccacca cgatgaaaaa 1440
ctaatgtctg ctcttaaatg gcccattgaa tatatgttta taggattaaa acctacctgg 1500
aacatctccg atcaaaatcc tcatcaacaccgagattggc acaagttcgg acatgttgtt 1560
aacgccatta tgcagcccac tcaccacgca gagataagct ttcaggatag agatacagct 1620
cttccagacg catgttcatc tatatctgat attagccccg ttacgtatcc gatcacatta 1680
cctattatta aaaacatttc cgtaactgct catggtatca atcttatcga taaatttcca 1740
tcaaagttct gcagctctta catacccttc cactacggag gcaatgcgat taaaaccccc 1800
gatgatccgg gtgcgatgat gattaccttt gctttgaagc cacgggagga ataccaaccc 1860
agtggtcata ttaacgtatc cagagcaaga gaattttata ttagttggga cacggattac 1920
gtggggtcta tcactacggc tgatcttgtg gtatcggcat ctgctattaa ctttcttctt 1980
cttcagaacg gttcagctgt gctgcgttac agtacctaag aattc 2025
<210>6
<211>6159
<212>DNA
<213> Artificial sequence
<400>6
ttctctgtca cagaatgaaa atttttctgt catctcttcg ttattaatgt ttgtaattga 60
ctgaatatca acgcttattt gcagcctgaa tggcgaatgg gacgcgccct gtagcggcgc 120
attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct 180
agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg 240
tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga 300
ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt 360
ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg 420
aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc 480
ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat 540
attaacgttt acaatttcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg 600
tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat 660
gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat 720
tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt 780
aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag 840
cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa 900
agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc aactcggtcg 960
ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct 1020
tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac 1080
tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca 1140
caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat 1200
accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt tgcgcaaact 1260
attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc 1320
ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga 1380
taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg 1440
taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg 1500
aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca 1560
agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta 1620
ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca 1680
ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg 1740
cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga 1800
tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa 1860
tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc 1920
tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg 1980
tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac 2040
ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct 2100
acagcgtgag cattgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc 2160
ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg 2220
gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg 2280
ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct 2340
ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga 2400
taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 2460
cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca 2520
tctgtgcggt atttcacacc gcagaccagc cgcgtaacct ggcaaaatcg gttacggttg 2580
agtaataaat ggatgccctg cgtaagcggg tgtgggcgga caataaagtc ttaaactgaa 2640
caaaatagat ctaaactatg acaataaagt cttaaactag acagaatagt tgtaaactga 2700
aatcagtcca gttatgctgt gaaaaagcat actggacttt tgttatggct aaagcaaact 2760
cttcattttc tgaagtgcaa attgcccgtc gtattaaaga ggggcgtggc caagggcatg 2820
gtaaagacta tattcgcggc gttgtgacaa tttaccgaac aactccgcgg ccgggaagcc 2880
gatctcggct tgaacgaatt gttaggtggc ggtacttggg tcgatatcaa agtgcatcac 2940
ttcttcccgt atgcccaact ttgtatagag agccactgcg ggatcgtcac cgtaatctgc 3000
ttgcacgtag atcacataag caccaagcgc gttggcctca tgcttgagga gattgatgag 3060
cgcggtggca atgccctgcc tccggtgctc gccggagact gcgagatcat agatatagat 3120
ctcactacgc ggctgctcaa acctgggcag aacgtaagcc gcgagagcgc caacaaccgc 3180
ttcttggtcg aaggcagcaa gcgcgatgaa tgtcttacta cggagcaagt tcccgaggta 3240
atcggagtcc ggctgatgtt gggagtaggt ggctacgtct ccgaactcac gaccgaaaag 3300
atcaagagca gcccgcatgg atttgacttg gtcagggccg agcctacatg tgcgaatgat 3360
gcccatactt gagccaccta actttgtttt agggcgactg ccctgctgcg taacatcgtt 3420
gctgctgcgt aacatcgttg ctgctccata acatcaaaca tcgacccacg gcgtaacgcg 3480
cttgctgctt ggatgcccga ggcatagact gtacaaaaaa acagtcataa caagccatga 3540
aaaccgccac tgcgccgtta ccaccgctgc gttcggtcaa ggttctggac cagttgcgtg 3600
agcgcatacg ctacttgcat tacagtttac gaaccgaaca ggcttatgtc aactgggttc 3660
gtgccttcat ccgtttccac ggtgtgcgtc acccggcaac cttgggcagc agcgaagtcg 3720
aggcatttct gtcctggctg gcgaacgagc gcaaggtttc ggtctccacg catcgtcagg 3780
cattggcggc cttgctgttc ttctacggca aggtgctgtg cacggatctg ccctggcttc 3840
aggagatcgg tagacctcgg ccgtcgcggc gcttgccggt ggtgctgacc ccggatgaag 3900
tggttcgcat cctcggtttt ctggaaggcg agcatcgttt gttcgcccag gactctagct 3960
atagttctag tggttggcct acttacccgt agtggctatg gcagggcttg ccgccccgac 4020
gttggctgcg agccctgggc cttcacccga acttgggggt tggggtgggg aaaaggaaga 4080
aacgcgggcg tattggtccc aatggggtct cggtggggta tcgacagagt gccagccctg 4140
ggaccgaacc ccgcgtttat gaacaaacga cccaacaccc gtgcgtttta ttctgtcttt 4200
ttattgccgt catagcgcgg gttccttccg gtattgtctc cttccgtgtt tcagttagcc 4260
tcccccatct cccgggcgcc gctgctagca ccatggaggc ccctgcaggt gatcaagtct 4320
tcgtcgagtg attgtaaata aaatgtaatt tacagtatag tattttaatt aatatacaaa 4380
tgatttgata ataattctta tttaactata atatattgtg ttgggttgaa ttaaaggtcc 4440
gtatactccg gaatattaat agatcatgga gataattaaa atgataacca tctcgcaaat 4500
aaataagtat tttactgttt tcgtaacagt tttgtaataa aaaaacctat aaatattccg 4560
gattattcat accgtcccac catcgggcgc ggatcgacgt ccgaactacc taaggtagag 4620
cgtctcgaca ggcttgtcga gaagtactag aggatcataa tcagccatac cacatttgta 4680
gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa acataaaatg 4740
aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat4800
agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc 4860
aaactcatca atgtatctta tcatgtctgg atctgatcat tacgtacccg tagtggctat 4920
ggcagggctt gccgccccga cgttggctgc gagccctggg ccttcacccg aacttggggg 4980
ttggggtggg gaaaaggaag aaacgcgggc gtattggtcc caatggggtc tcggtggggt 5040
atcgacagag tgccagccct gggaccgaac cccgcgttta tgaacaaacg acccaacacc 5100
cgtgcgtttt attctgtctt tttattgccg tcatagcgcg ggttccttcc ggtattgtct 5160
ccttccgtgt ttcagttagc ctcccccatc tcccggtacc gcatgctatg catcagctgc 5220
tagcaccatg gctcgagatc ccgggtgatc aagtcttcgt cgagtgattg taaataaaat 5280
gtaatttaca gtatagtatt ttaattaata tacaaatgat ttgataataa ttcttattta 5340
actataatat attgtgttgg gttgaattaa aggtccgtat actccggaat attaatagat 5400
catggagata attaaaatga taaccatctc gcaaataaat aagtatttta ctgttttcgt 5460
aacagttttg taataaaaaa acctataaat attccggatt attcataccg tcccaccatc 5520
gggcgcggat cccggtccga agcgcgcgga attcaaaggc ctacgtcgac gagctcacta 5580
gtcgcggccg ctttcgaatc tagagcctgc agtctcgaca agcttgtcga gaagtactag 5640
aggatcataa tcagccatac cacatttgta gaggttttac ttgctttaaa aaacctccca 5700
cacctccccc tgaacctgaa acataaaatg aatgcaattg ttgttgttaa cttgtttatt 5760
gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt 5820
ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctgg 5880
atctgatcac tgcttgagcc taggagatcc gaaccagata agtgaaatct agttccaaac 5940
tattttgtca tttttaattt tcgtattagc ttacgacgct acacccagtt cccatctatt 6000
ttgtcactct tccctaaata atccttaaaa actccatttc cacccctccc agttcccaac 6060
tattttgtcc gcccacagcg gggcattttt cttcctgtta tgtttttaat caaacatcct 6120
gccaactcca tgtgacaaac cgtcatcttc ggctacttt 6159