阅读说明：本技术 一组检测核酸的HCR-DNAzyme探针及其应用 (HCR-DNAzyme probes for detecting nucleic acid and application thereof ) 是由 陈俊 杨子中 刘碧蓉 陈金香 谢宝平 段文军 田元新 于 2021-07-05 设计创作，主要内容包括：本发明属于分子生物学技术领域,公开了一组检测核酸的HCR-DNAzyme探针及其应用。该探针,包含探针H1、探针H2和底物链H3。该HCR-DNAzyme探针可以特异性识别目标核酸,实现基于DNAzyme辅助的杂交链反应(HCR)的指数级信号放大,反应动力学提高,检测限降低,仅为3.28fM,相比传统的HCR探针检测限降低了5个数量级(传统的HCR探针的检测限为0.78nM),同时,检测灵敏度比传统的DNAzyme探针提高了5个数量级,即本发明提供的HCR-DNAzyme探针灵敏度高、检测限低、特异性强；并且具有更优的反应动力学。(The invention belongs to the technical field of molecular biology, and discloses a group of HCR-DNAzyme probes for detecting nucleic acid and application thereof. The probe comprises a probe H1, a probe H2 and a substrate chain H3. The HCR-DNAzyme probe can specifically recognize target nucleic acid, realizes exponential signal amplification based on DNAzyme assisted Hybrid Chain Reaction (HCR), improves reaction kinetics, reduces detection limit which is only 3.28fM, reduces 5 orders of magnitude compared with the detection limit of the traditional HCR probe (the detection limit of the traditional HCR probe is 0.78nM), and simultaneously improves detection sensitivity by 5 orders of magnitude compared with the traditional DNAzyme probe, namely, the HCR-DNAzyme probe provided by the invention has high sensitivity, low detection limit and strong specificity; and has better reaction kinetics.)

1. A group of HCR-DNAzyme probes for detecting nucleic acid, which comprises a probe H1, a probe H2 and a substrate chain H3;

the probe H1 comprises the following components in sequence from 5 'to 3': a sequence, B sequence and C sequence;

the C sequence is complementary to the target nucleic acid;

the B sequence is a sequence consisting of any 4-6 bases;

the A sequence is complementary to the 5' end of the C sequence;

the probe H2 comprises the following components in sequence from 5 'to 3': d sequence, E sequence, F sequence, G sequence, H sequence and I sequence;

the D sequence is AAACCGAGGCTAGC (SEQ ID NO. 8);

the E sequence and the H sequence are one base, and the E sequence and the H sequence are complementary;

the sequence F is complementary to the sequence formed by connecting the sequence A and the sequence B;

the G sequence is complementary to the C sequence;

the sequence I is TACAACGACGCCTGC (SEQ ID NO. 9);

the substrate chain H3 comprises, in order from 5 'to 3': g sequence, J sequence and K sequence;

the J sequence is CG/rA// rU/CGGTTT (SEQ ID NO.10), wherein rA is adenine nucleotide, and rU is uracil nucleotide;

the K sequence is complementary to the 5' end of the G sequence.

2. The HCR-DNAzyme probe of claim 1, wherein:

the probe H1 is modified with a first fluorophore, the probe H2 is modified with a second fluorophore, and fluorescence resonance energy transfer can occur between the first fluorophore and the second fluorophore.

3. The HCR-DNAzyme probe of claim 2, wherein:

the first fluorophore is Cy3, and the second fluorophore is Cy 5; or

The first fluorophore is Cy5, and the second fluorophore is Cy 7; or

The first fluorophore is Cy3, and the second fluorophore is Alexa 488; or

The first fluorophore is Rhodamine, and the second fluorophore is FITC.

4. The HCR-DNAzyme probe of claim 3, wherein:

when the nucleic acid is miR-1246,

the sequence of the probe H1 is as follows: 5'-ATTTTTGGAGCAGGCACACCCTGCTCCAAAAATCCATT-3' (SEQ ID NO. 1);

the sequence of the probe H2 is as follows: 5'-AAACCGAGGCTAGCCGTGTGCCTGCTCCAAAAATAATGGATTTTTGGAGCAGGGTACAACGACGCCTGC-3' (SEQ ID NO. 2);

the sequence of the substrate chain H3 is as follows: 5 '-AATGGATTTTTGGAGCAGGCG/rA// rU/CGGTTTTCCAAATATCCATT-3' (SEQ ID NO. 3).

5. A nanoplatelet for detecting a nucleic acid comprising: the HCR-DNAzyme probe and MnO of any one of claims 1 to 4₂Nanosheets.

6. Nanoplatelets of detection nucleic acid according to claim 5 wherein:

the MnO₂The preparation method of the nano sheet comprises the following steps: mixing tetramethylammonium hydroxide and H₂O₂Mixing the mixed solution with soluble manganese salt, stirring, and carrying out solid-liquid separation to obtain precipitate, namely MnO₂Nanosheets.

7. A method for preparing a nanosheet for detecting a nucleic acid according to any one of claims 5 to 6, wherein the HCR-DNAzyme probe and MnO of any one of claims 1 to 4 are used₂And mixing the nano sheets, adding a buffer solution, and mixing to obtain the nano sheets.

8. A kit, comprising: a nanosheet of the HCR-DNAzyme probe of any one of claims 1 to 4 and/or the detection nucleic acid of any one of claims 5 to 6.

Use of any of the products of (1) to (3) in nucleic acid testing for non-disease diagnostic use;

(1) the HCR-DNAzyme probe of any one of claims 1-4;

(2) nanoplatelets of the detection nucleic acid of any of claims 5 to 6;

(3) the kit of claim 8.

10. A nucleic acid detection method for non-disease diagnostic use, said nucleic acid detection method being S1 or S2,

S1：

mixing the HCR-DNAzyme probe of any one of claims 1-4, buffer solution, manganese ions, magnesium ions and nucleic acid to be detected, incubating at 35-50 ℃ for 2-6 h, and measuring fluorescence signal intensity;

S2：

mixing nanosheets for detecting nucleic acid as defined in any one of claims 5 to 6 with cells comprising nucleic acid to be detected, incubating at 35 to 50 ℃ for 2 to 6 hours, and observing fluorescence intensity.

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a group of HCR-DNAzyme probes for detecting nucleic acid and application thereof.

Background

MicroRNA (miRNA) is a short non-coding RNA (with the length of 18-23 bases) and is one of the core factors of many biological processes in the cell development process. mirnas play a key role in many essential cellular processes, including cell proliferation, migration and apoptosis; the abnormal expression level is related to the occurrence, metastasis and progression of malignant tumors. A large number of researches show that microRNA is a stable tumor marker, and detection of microRNA is helpful for understanding the development condition of tumors or for disease diagnosis. The microRNA has the characteristics of high sequence similarity and low abundance, and the development of a microRNA detection method with high selectivity and high sensitivity is a great challenge. RT-qPCR is the gold standard for miRNA detection at present, and has high sensitivity. However, the high dependence of RT-qPCR on thermocycling temperature control, the high requirements on the instrument and the complex sample preparation have greatly limited its clinical application. Meanwhile, the method can only detect the average content of the microRNA in the RNA extract of the sample such as tissues or cells, and cannot obtain the spatial information of the microRNA. In-situ imaging detection of microRNA in living cells can obtain the expression level and spatial information of the microRNA in the living cells, and is a hotspot and difficulty of research.

Recently, isothermal nucleic acid amplification technology is considered to be an effective method for detecting nucleic acid in living cells with high sensitivity because of its mild reaction conditions and high amplification efficiency under isothermal conditions. Isothermal nucleic acid amplification technologies are mainly classified into isothermal amplification technologies based on biological enzymes and isothermal nucleic acid amplification technologies without participation of biological enzymes. Biological enzymes are difficult to transfect into living cells, however, nucleic acid probes can be effectively transported into the living cells under the action of some nano-carriers such as gold nanoparticles, graphene, manganese dioxide and the like, and amplification reactions without participation of the biological enzymes are gradually used for imaging analysis of miRNA in the living cells. The constant temperature amplification technology without participation of biological enzyme mainly comprises a catalytic hairpin self-assembly reaction (CHA), a Hybrid Chain Reaction (HCR) or a signal amplification method based on functional nuclease DNAzyme. CHA is an enzyme-independent chain-displacement catalytic cascade in which the target sequence acts as a trigger and catalyst, continuously inducing assembly between probes, and achieving signal enhancement. Hybridization chain reaction (hybridization ch)ain interaction (HCR)) is an isothermal signal amplification technique based on DNA strand displacement reactions established by Dirks and Pierce et al. In an HCR system, a target molecule triggers stem-loop alternate ring opening of two DNA hairpin structures, self-assembly is carried out to form a linear double-stranded DNA nano-structure containing a large number of repeating units, and the amplification efficiency reaches 10⁴～10⁶And (4) doubling. DNAzymes are DNA molecules with RNA cracking activity obtained by screening in vitro molecular evolution technology in recent years, have multiple catalytic functions such as nuclease activity and peroxidase activity, high efficiency and high specificity, and metal-assisted deoxyribozyme catalysts (DNAzymes) are DNA-based catalysts for cracking specific substrates in the presence of metal ions and are widely used for constructing a one-to-many signal amplification strategy. Although the above methods are widely used for analysis of miRNA in living cells, these methods are all linear amplification, have limited amplification efficiency, and can detect only miRNA in an amount as low as pM level in cells. However, the content of intracellular partial mirnas is as low as aM level, so it remains a challenge to develop a signal amplification strategy with higher amplification efficiency to achieve highly sensitive analysis of intracellular mirnas.

Disclosure of Invention

In a first aspect, the invention provides a set of HCR-DNAzyme probes for detecting nucleic acids.

The object of the second aspect of the present invention is to provide a nanosheet for detection of a nucleic acid.

The third aspect of the invention aims at providing a preparation method of a nano-sheet for detecting nucleic acid.

The fourth aspect of the present invention is directed to a kit for detecting a nucleic acid.

The object of the fifth aspect of the invention is to provide the use of the HCR-DNAzyme probe of the first aspect of the invention, the nanoplatelets of the second aspect of the invention, or the kit of the fourth aspect of the invention, in the detection of nucleic acids for non-disease diagnostic use.

The sixth aspect of the present invention is to provide a nucleic acid detection method for non-disease diagnostic use.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the invention, there is provided a set of HCR-DNAzyme probes for detecting nucleic acids comprising probe H1, probe H2 and substrate strand H3;

the probe H1 comprises the following components in sequence from 5 'to 3': a sequence, B sequence and C sequence;

the C sequence is complementary to the target nucleic acid;

the B sequence is a sequence consisting of any 4-6 bases; preferably, the B sequence is a sequence consisting of any 4-6 deoxynucleotides; further preferably, the B sequence is CACAC;

the A sequence is complementary to the 5' end of the C sequence; preferably, the A sequence is complementary with the 1 st to 14 th bases at the 5' end of the C sequence;

the probe H2 comprises the following components in sequence from 5 'to 3': d sequence, E sequence, F sequence, G sequence, H sequence and I sequence;

the D sequence is AAACCGAGGCTAGC (SEQ ID NO. 8);

the E sequence and the H sequence are one base, and the E sequence and the H sequence are complementary; preferably, said E sequence and said H sequence are one deoxynucleotide;

the sequence F is complementary to the sequence formed by connecting the sequence A and the sequence B;

the G sequence is complementary to the C sequence;

the sequence I is TACAACGACGCCTGC (SEQ ID NO. 9);

the substrate chain H3 comprises, in order from 5 'to 3': g sequence, J sequence and K sequence;

the J sequence is CG/rA// rU/CGGTTT (SEQ ID NO.10), wherein rA is adenine nucleotide, and rU is uracil nucleotide;

the K sequence is complementary to the 5' end of the G sequence; preferably, the K sequence is complementary to the 1 st to 14 th bases at the 5' end of the G sequence;

preferably, the K sequence has one base mismatch in the 2 nd to 13 th bases; more preferably, the K sequence has one base mismatch in the 5 th to 10 th bases; thereby reducing the stability of the double strand formed by the K sequence and the G sequence.

Preferably, the probe H1 is modified with a first fluorophore, the probe H2 is modified with a second fluorophore, and fluorescence resonance energy transfer can occur between the first fluorophore and the second fluorophore.

Fluorescence Resonance Energy Transfer (FRET) refers to two different fluorescent chromophores, wherein the emission spectrum of one fluorescent chromophore (donor) overlaps with the absorption spectrum of the other fluorescent chromophore (acceptor), when the donor molecule is excited, the acceptor is at a suitable distance from the donor, and when the Energy difference between the vibrational Energy levels of the ground and first excited electronic states of the donor and acceptor are suitable for each other, the excited donor transfers some or all of the Energy to the acceptor by dipole mediation, so that the acceptor is excited, and the emission and reabsorption of photons are not involved in the entire Energy Transfer process. According to the invention, the probe H1 and the probe H2 are respectively modified with the first fluorescent group and the second fluorescent group, and after the two probes are subjected to hybridization chain reaction, the two fluorescent groups are close to each other, so that fluorescence resonance energy transfer is caused, and the detection of target nucleic acid is realized.

Preferably, the first fluorophore is Cy3, and the second fluorophore is Cy 5; or

The first fluorophore is Cy5, and the second fluorophore is Cy 7; or

The first fluorophore is Cy3, and the second fluorophore is Alexa 488; or

The first fluorophore is Rhodamine, and the second fluorophore is FITC.

Preferably, the nucleic acid is miRNA.

Preferably, when the nucleic acid is miR-1246,

the sequence of the probe H1 is as follows: 5'-ATTTTTGGAGCAGGCACACCCTGCTCCAAAAATCCATT-3' (SEQ ID NO. 1);

the sequence of the probe H2 is as follows: 5'-AAACCGAGGCTAGCCGTGTGCCTGCTCCAAAAATAATGGATTTTTGGAGCAGGGTACAACGACGCCTGC-3' (SEQ ID NO. 2);

the sequence of the substrate chain H3 is as follows: 5 '-AATGGATTTTTGGAGCAGGCG/rA// rU/CGGTTTTCCAAATATCCATT-3' (SEQ ID NO. 3); wherein rA is adenine nucleotide, and rU is uracil nucleotide;

the sequence of the miR-1246 is as follows: 5'-AAUGGAUUUUUGGAGCAGG-3' (SEQ ID NO. 4).

In a second aspect of the invention, there is provided a nanoplatelet for detecting a nucleic acid, comprising: HCR-DNAzyme probes and MnO of the first aspect of the invention₂Nanosheets.

Preferably, the HCR-DNAzyme probe is supported on MnO₂And (4) nano-chips.

Preferably, the MnO₂The preparation method of the nano sheet comprises the following steps: mixing tetramethylammonium hydroxide and H₂O₂Mixing the mixed solution with soluble manganese salt, stirring, and carrying out solid-liquid separation to obtain precipitate, namely MnO₂Nanosheets.

Preferably, the preparation method further comprises the following steps: washing the precipitate, drying, dispersing in water, and ultrasonic treating.

Preferably, the stirring time is 10-16 h.

Preferably, the solid-liquid separation condition is 1500-4500 rpm centrifugation for 15-25 min.

Preferably, the nucleic acid is miRNA.

In a third aspect of the invention, a method for preparing a nanosheet for detecting nucleic acid is provided, wherein the HCR-DNAzyme probe of the first aspect of the invention and MnO are taken₂And mixing the nano sheets for the first time, adding a buffer solution, and mixing for the second time to obtain the nano sheets for detecting nucleic acid.

Preferably, the MnO₂The preparation method of the nano sheet comprises the following steps: mixing tetramethylammonium hydroxide and H₂O₂Mixing the mixed solution with soluble manganese salt, stirring, and carrying out solid-liquid separation to obtain precipitate, namely MnO₂Nanosheets.

Preferably, the preparation method further comprises the following steps: washing the precipitate, drying, dispersing in water, and ultrasonic treating.

Preferably, the stirring time is 10-16 h.

Preferably, the solid-liquid separation condition is 1500-4500 rpm centrifugation for 15-25 min.

Preferably, the time for the first mixing is 8-20 min.

Preferably, the buffer is HEPES buffer.

Preferably, the second mixing is carried out under the condition of stirring for 10-30 min at the temperature of 25-35 ℃.

Preferably, the nucleic acid is miRNA.

In a fourth aspect of the invention, there is provided a kit for detecting a nucleic acid comprising an HCR-DNAzyme probe of the first aspect of the invention and/or a nanoplatelet of the second aspect of the invention.

Preferably, the nucleic acid is miRNA.

In a fifth aspect of the invention there is provided the use of an HCR-DNAzyme probe of the first aspect of the invention, a nanoplate of the second aspect of the invention, or a kit of the fourth aspect of the invention, in the detection of nucleic acid for non-disease diagnostic use.

Preferably, the nucleic acid is miRNA.

In a sixth aspect of the present invention, there is provided a nucleic acid detecting method for non-disease diagnostic use, which is S1 or S2,

S1：

1) designing an HCR-DNAzyme probe according to the target nucleic acid;

2) mixing the HCR-DNAzyme probe, a buffer solution, manganese ions, magnesium ions and nucleic acid to be detected, incubating at 35-50 ℃ for 1-4 h, and determining the intensity of a fluorescence signal;

S2：

1) designing an HCR-DNAzyme probe according to target nucleic acid, and preparing a nano-sheet containing the HCR-DNAzyme probe and a manganese dioxide nano-sheet;

2) mixing the nanosheets and cells containing nucleic acid to be detected, incubating for 2-6 h at 35-50 ℃, and observing fluorescence intensity.

Preferably, the nucleic acid comprises miRNA.

Preferably, the HCR-DNAzyme probes described in S1 and S2, comprise probe H1, probe H2 and substrate strand H3;

the probe H1 comprises the following components in sequence from 5 'to 3': a sequence, B sequence and C sequence;

the C sequence is complementary to the target nucleic acid;

the B sequence is a sequence consisting of any 4-6 bases; preferably, the B sequence is a sequence consisting of any 4-6 deoxynucleotides; further preferably, the B sequence is CACAC;

the A sequence is complementary to the 5' end of the C sequence; preferably, the A sequence is complementary with the 1 st to 14 th bases at the 5' end of the C sequence;

the probe H2 comprises the following components in sequence from 5 'to 3': d sequence, E sequence, F sequence, G sequence, H sequence and I sequence;

the D sequence is AAACCGAGGCTAGC (SEQ ID NO. 8);

the E sequence and the H sequence are one base, and the E sequence and the H sequence are complementary; preferably, said E sequence and said H sequence are one deoxynucleotide;

the sequence F is complementary to the sequence formed by connecting the sequence A and the sequence B;

the G sequence is complementary to the C sequence;

the sequence I is TACAACGACGCCTGC (SEQ ID NO. 9);

the substrate chain H3 comprises, in order from 5 'to 3': g sequence, J sequence and K sequence;

the J sequence is CG/rA// rU/CGGTTT (SEQ ID NO.10), wherein rA is adenine nucleotide, and rU is uracil nucleotide;

the K sequence is complementary to the 5' end of the G sequence; preferably, the K sequence is complementary to the 1 st to 14 th bases at the 5' end of the G sequence;

preferably, the K sequence has one base mismatch in the 2 nd to 13 th bases; more preferably, the K sequence has one base mismatch in the 5 th to 10 th bases; thereby reducing the stability of the double strand formed by the K sequence and the G sequence.

Preferably, the probe H1 is modified with a first fluorophore, the probe H2 is modified with a second fluorophore, and fluorescence resonance energy transfer can occur between the first fluorophore and the second fluorophore.

Fluorescence Resonance Energy Transfer (FRET) refers to two different fluorescent chromophores, wherein the emission spectrum of one fluorescent chromophore (donor) overlaps with the absorption spectrum of the other fluorescent chromophore (acceptor), when the donor molecule is excited, the acceptor is at a suitable distance from the donor, and when the Energy difference between the vibrational Energy levels of the ground and first excited electronic states of the donor and acceptor are suitable for each other, the excited donor transfers some or all of the Energy to the acceptor by dipole mediation, so that the acceptor is excited, and the emission and reabsorption of photons are not involved in the entire Energy Transfer process. According to the invention, the probe H1 and the probe H2 are respectively modified with the first fluorescent group and the second fluorescent group, and after the two probes are subjected to hybridization chain reaction, the two fluorescent groups are close to each other, so that fluorescence resonance energy transfer is caused, and the detection of target nucleic acid is realized.

Preferably, the first fluorophore is Cy3, and the second fluorophore is Cy 5; or

The first fluorophore is Cy5, and the second fluorophore is Cy 7; or

The first fluorophore is Cy3, and the second fluorophore is Alexa 488; or

The first fluorophore is Rhodamine, and the second fluorophore is FITC.

The invention has the beneficial effects that:

the invention provides a group of HCR-DNAzyme probes, which can specifically identify target nucleic acid, realize exponential signal amplification of DNAzyme-assisted Hybridization Chain Reaction (HCR), improve reaction kinetics, reduce detection limit, which is only 3.28fM, reduce 5 orders of magnitude (the detection limit of the traditional HCR probe is 0.78nM) compared with the detection limit of the traditional HCR probe, and improve 5 orders of magnitude of detection sensitivity compared with the traditional DNAzyme probe, namely, the HCR-DNAzyme probe provided by the invention has high sensitivity, low detection limit and strong specificity; and has better reaction kinetics.

The invention provides a nanosheet, which comprises an HCR-DNAzyme probe and MnO₂Nanosheets, optionally MnO₂The nano-sheet protects the HCR-DNAzyme probe, improves the stability of the HCR-DNAzyme probe, supplements metal ions (auxiliary factors) which are relied on by intracellular enzyme chain cutting substrate reaction, realizes the application of the HCR-DNAzyme probe in living cells, and finally realizes the real-time in-situ imaging detection of intracellular nucleic acid with high sensitivity and high efficiency based on the exponential signal amplification of DNAzyme assisted Hybrid Chain Reaction (HCR).

The kit provided by the invention comprises an HCR-DNAzyme probe and/or a nano-sheet, can detect nucleic acid through the HCR-DNAzyme probe, and realizes real-time in-situ imaging detection of nucleic acid in cells through the nano-sheet.

The nucleic acid detection method provided by the invention is simple and rapid, has high sensitivity, low detection limit, high specificity and low cost, and has a good application prospect.

Drawings

FIG. 1 is MnO₂Schematic diagram of miRNA detection by nanosheets-HCR-DNAzyme.

Fig. 2 is a Scanning Electron Microscope (SEM) and Transmission Electron Microscope (TEM) image of manganese dioxide nanoplates: wherein A is a Scanning Electron Microscope (SEM) picture of manganese dioxide nanosheets; and B is a Transmission Electron Microscope (TEM) image of the manganese dioxide nanosheet.

FIG. 3 shows manganese dioxide nanosheets and MnO₂Ultraviolet-visible absorption spectrum of the nanosheet-HCR-DNAzyme.

FIG. 4 shows manganese dioxide nanosheets and MnO₂Particle size comparison of nanosheet-HCR-DNAzyme.

FIG. 5 shows manganese dioxide nanosheets and MnO₂Potential contrast plot of nanosheet-HCR-DNAzyme.

FIG. 6 is a graph of fluorescence emission spectra results of feasibility verification of HCR-DNAzymet probes.

FIG. 7 is a graph of the results of native gel electrophoresis for feasibility verification of HCR-DNAzymet probes: wherein 1 represents a lane of H1, 2 represents a lane of H2, 3 represents a lane of H3, 4 represents a lane of H1+ H2, 5 represents a lane of H1+ H2+ H3, 6 represents a lane of H1+ H2+ miR-1246, and 7 represents a lane of H1+ H2+ H3+ miR-1246.

FIG. 8 is a diagram of HCR probe and HCR-DNAzymetGraph of the detection result of the sensitivity of the probe: wherein A is a fluorescence spectrum diagram of HCR-DNAzymet probe for detecting miR-1246 with different concentrations; b is the concentration of miR-1246 and F when HCR-DNAzymet probe is used_A/F_DThe correlation diagram of (2); c is a fluorescence spectrogram of the HCR probe for detecting miR-1246 with different concentrations; d is the concentration of miR-1246 and F when HCR probe is used_A/F_DThe correlation diagram of (2).

FIG. 9 is a kinetic plot of HCR probe and HCR-DNAzymet probe.

FIG. 10 is a graph showing the results of specific detection of HCR-DNAzymet probes: wherein A is a fluorescence spectrum diagram of different targets detected by the HCR-DNAzymet probe; b is F of HCR-DNAzymet probe for detecting different targets_A/F_DThe statistical result chart of (1).

FIG. 11 shows nucleic acid loading rate vs. MnO₂Graph of concentration of nanoplates: wherein A is the nucleic acid loading rate in accordance with MnO₂A graph of the change in concentration of the nanoplatelets; b is a graph of the concentration of H1 as a function of fluorescence intensity.

FIG. 12 shows MnO₂Protection of nucleic acid by nanosheet results are shown: wherein A is a supported or an unsupported MnO₂A fluorescence intensity change diagram after the nano sheet is added into cell lysate; b is MnO under load or not₂And (3) a fluorescence intensity change diagram after the deoxyribonuclease is added into the nanosheet.

FIG. 13 shows MnO at different concentrations of glutathione₂And (3) a degradation effect graph of the nanosheets.

FIG. 14 shows MCF-7 manganese dioxide nanoplates (MnO) at different concentrations₂nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme system).

FIG. 15 shows MCF-7 cells with MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme system) was co-incubated and the concentration of manganese ions in the cells was plotted.

FIG. 16 is a confocal laser microscopy (CLSM) image of MCF-7 cells under different treatments.

FIG. 17 is a confocal laser microscopy (CLSM) image of MCF-7 cells following up-and-down-regulation of miR-1246.

FIG. 18 is MnO₂Detection of confocal laser microscopy (CLSM) images in different cells by the nanosheet-HCR-DNAzyme.

FIG. 19 is a graph of miR-1246 expression levels in different cells.

Detailed Description

The present invention will be described in further detail with reference to specific examples.

It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers. The materials, reagents and the like used in the present examples are commercially available reagents and materials unless otherwise specified.

The principle of the nanosheet provided by the invention is shown in fig. 1, and specifically comprises the following steps: the nanosheet comprises an HCR-DNAzyme probe and MnO₂Nanosheets, the HCR-DNAzyme probe comprising probe H1, probe H2, and substrate strand H3; wherein H1 and H2 are respectively modified with a fluorescence donor and an acceptor, a Toehold sequence is modified at the 3 'end of H1 and the 5' end of H2, a complete DNAzyme sequence is further cleaved into 2 segments which are modified at the 3 'end and the 5' end of the hairpin of H2, and a substrate chain H3 comprises a recognition sequence of the DNAzyme and a similar sequence of a target nucleic acid; loading H1, H2 and H3 to MnO₂Delivery to cells on nanosheets, MnO₂The nano-sheet is degraded by glutathione in cells to generate Mn²⁺And release H1, H2 and H3; in the presence of target nucleic acid, H1 and H2 generate HCR, fluorescence donors and fluorescence acceptors on H1 and H2 chains are close to each other to generate energy resonance transfer, and a plurality of DNAzymes are formed on double chains of HCR products, so that specific divalent metal ions Mn are generated²⁺Because the stem of H3 is unstable, H3 is split into two parts and is dissociated into a solution, DNAzyme continuously acts with a new hairpin H3 and is cut to split H3 into two ends, the two ends are continuously circulated, one split fragment of H3 contains a sequence similar to a target miRNA and can be used as a target primer to induce H1 and H2 to generate new HCR, DNAzyme on an HCR product can continuously act with H3 to generateThe new segment thus triggers a new HCR, which repeats continuously, with exponential amplification of the energy resonance transfer signal, enabling detection of miRNA.

Example 1A set of HCR-DNAzyme probes for miR-1246 detection

A group of HCR-DNAzyme probes for detecting miR-1246, which comprises a probe H1, a probe H2 and a substrate chain H3;

wherein, probe H1: 5 '-ATTTTTGGAGCAGGCACACCCTGCTCCAAAAATCCATT/iCy 5 d/-3' (SEQ ID No. 1);

probe H2: 5 '-AAACCGAGGCTAGCCGTGTGCCTGCTCCAAAAA/iCy 3 dT/AATGGATTTTTGGAGCAGGGTACAACGACGCCTGC-3' (SEQ ID NO. 2);

substrate chain H3: 5 '-AATGGATTTTTGGAGCAGGCG/rA// rU/CGGTTTTCCAAATATCCATT-3' (SEQ ID NO. 3); wherein rA is adenine nucleotide, and rU is uracil nucleotide;

the sequence of miR-1246 is: 5'-AAUGGAUUUUUGGAGCAGG-3' (SEQ ID NO. 4).

Example 2 MnO for detecting miR-1246₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-HCR-DNAzyme)

(1) MnO for detecting miR-1246₂nanosheet-HCR-DNAzyme (MnO)₂ nanosheets-HCR-DNAzyme)

Preparation of 20mL of tetramethylammonium hydroxide and H₂O₂The mixed solution of (tetramethylammonium hydroxide, concentration: 0.6M, H)₂O₂At a concentration of 3.0 wt%, specific process references: fan, Z.ZHao, G.Yan, X.Zhang, C.Yang, H.Meng, Z.C hen, H.Liu, W.Tan, A Smart DNAzyme-MnO 2 Nanosystem for efficiency Gene Silencing, Angew.chem., int.Ed.,2015,54, 4801-doped 4805), 10mL of MnCl was quickly added to 20s₂(0.3M); the solution immediately turned dark brown, and was stirred vigorously overnight; centrifuging at 3000rpm for 20min, collecting precipitate, washing with water and methanol for three times respectively, and vacuum drying for 5 hr; obtaining manganese dioxide nanosheet (MnO)₂nanosheets). And dispersing the obtained manganese dioxide nanosheets in water, and performing ultrasonic treatment at 60Hz for more than 10 hours to obtain the small-size manganese dioxide nanosheets. 41 μ L (1.1mg/mL) of small-sized manganese dioxide nanoplates were mixed with H1(10 μ L, 10 μ M), H2(10 μ L, 10 μ M) and H3(25 μ L,10. mu.M) for 10 minutes, followed by addition of 914. mu.L of HEPES buffer (10mM, pH 7.4) and stirring at room temperature for 20 minutes to obtain MnO₂nanosheet-HCR-DNAzyme.

(2) Manganese dioxide nanosheet (MnO)₂nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂Characterization of nanosheets-HCR-DNAzyme)

Respectively for manganese dioxide nanosheet and MnO₂The nano-sheet-HCR-DNAzyme is subjected to granularity, potential, ultraviolet and fluorescence and electron microscope characterization, and the results of a Scanning Electron Microscope (SEM) and a Transmission Electron Microscope (TEM) of the manganese dioxide nano-sheet are shown in FIG. 2: presenting a sheet-like structure; the ultraviolet-visible absorption results of the manganese dioxide nanosheets are shown in fig. 3: ultraviolet absorption is realized at 380nm, which indicates that the synthesis of the manganese dioxide nanosheet is successful; manganese dioxide nanosheet (MnO)₂nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme) the uv-vis absorption results are shown in fig. 3: the ultraviolet visible absorption spectrum has no obvious change, and manganese dioxide nanosheet (MnO)₂nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme) the results of particle size determination by Dynamic Light Scattering (DLS) are shown in fig. 4: the particle diameter of the manganese dioxide nano-sheet is changed from 136.6 +/-2.914 nm to 151.2 +/-5.154 nm (MnO)₂nanosheet-HCR-DNAzyme); manganese dioxide nanosheet (MnO)₂nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂Results of potential detection of nanosheets-DNAzyme) are shown in fig. 5: the potential of the manganese dioxide nano-sheet is changed from-20.6 +/-1.34 to-35.8 +/-0.4 (MnO)₂nanosheet-HCR-DNAzyme) shows that the manganese dioxide nanosheet can effectively adsorb a nucleic acid probe and the load of nucleic acid chains (H1-H3) does not change MnO₂The nature of the nanoplatelets.

Example 3 design and Synthesis feasibility verification and determination condition optimization of HCR-DNAzyme Probe for detecting miR-1246

(1) Verifying feasibility by electrophoresis experiment and fluorescence experiment

1) Fluorescence experiment

Fluorescence experiments were performed on probe H1, probe H2, and substrate strand H3 in the HCR-DNAzyme probe: the following treatments were respectively carried out: taking H1+ H2, miR-1246+ H1+ H2, H1+ H2+ H3,adding Mn into miR-1246+ H1+ H2+ H3 (the final concentration of H1 is 200 nM; the final concentration of H2 is 200 nM; the final concentration of H3 is 500 nM; and the final concentration of miR-1246 is 50nM), respectively²⁺(final concentration 50mM), Mg²⁺(final concentration: 30mM), Tris buffer (final concentration: 10mM), 100. mu.L of the reaction system, a reaction at 37 ℃ for 2 hours, and a measurement at 562nm (F) using a fluorescence spectrophotometer with an excitation wavelength of 540nm_D) And 666nm (F)_A) Fluorescence intensity value at (b), excitation/emission slit width of 4nm, results are shown in FIG. 6: when the target miR-1246 does not exist, the ordinary HCR (H1+ H2) and HCR-DNAzyme (H1+ H2+ H3) exponential amplification reactions only have very weak fluorescence, which indicates that the reactions hardly occur; when a target miR-1246 is added, fluorescence is generated by the reaction of a common HCR (miR-1246+ H1+ H2), and the fluorescence of the reaction of the HCR-DNAzyme (miR-1246+ H1+ H2+ H3) is obviously enhanced, which indicates that the exponential amplification reaction (HCR-DNAzyme) of the HCR reaction combined DNAzyme cutting reaction is feasible and has higher amplification efficiency than the common HCR.

2) Polyacrylamide gel electrophoresis experiment

Fluorescence experiments were performed on probe H1, probe H2, and substrate strand H3 in the HCR-DNAzyme probe: the following treatments were respectively carried out: respectively adding Mn into H1, H2, H3, H1+ H2, H1+ H2+ H3, miR-1246+ H1+ H2, miR-1246+ H1+ H2+ H3 (the final concentration of H1 is 100nM, the final concentration of H2 is 100nM, the final concentration of H3 is 250nM and the final concentration of miR-1246 is 50nM), and respectively adding Mn into the mixture²⁺(final concentration 50mM), Mg²⁺(final concentration: 30mM), Tris buffer (final concentration: 10mM), 100. mu.L of the reaction system, and reaction at 37 ℃ for 2 hours, and performing 12% polypropylene gel electrophoresis experiments, the results of which are shown in FIG. 7: when the target miR-1246 is added, a bright band is generated in a lane of the common HCR (miR-1246+ H1+ H2), and a diffuse band is generated, which indicates that a chain hybridization reaction occurs; and the lane of HCR-DNAzyme (miR-1246+ H1+ H2+ H3) is darker in color and better in dispersion degree, and the disappearance of the H3 band can be seen by comparing the lane of H3, which shows that cascade index amplification based on HCR and DNAzyme cleavage reaction can occur.

(2) Detection performance for detecting miR-1246

1) Sensitivity and detection limit of HCR-DNAzyme probe for detecting miR-1246

Adding Mn into H1 (final concentration of 100nM) and H2 (final concentration of 100nM)²⁺(final concentration 50mM), Mg²⁺(final concentration is 30mM) and Tris buffer solution (final concentration is 10mM), miR-1246 is respectively added to ensure that the final concentrations of miR-1246 are respectively 300nM, 200nM, 100nM, 50nM, 10nM, 1nM and 0(Blank), the reaction system is 100 mu L, the reaction is carried out for 2h under the constant temperature condition of 37 ℃, and then 562nM (F) is measured by a fluorescence spectrophotometer with 540nM as excitation wavelength_D) And 666nm (F)_A) Fluorescence intensity value at (b), excitation/emission slit width was 4 nm.

Adding Mn into H1 (final concentration of 100nM), H2 (final concentration of 100nM) and H3 (final concentration of 250nM)²⁺(final concentration 50mM), Mg²⁺(final concentration is 30mM) and Tris buffer solution (final concentration is 10mM), miR-1246 is respectively added to ensure that the final concentrations of miR-1246 are respectively 100nM, 10nM, 1nM, 100pM, 10pM, 1pM, 100fM and 0(Blank), the reaction system is 100 mu L, the reaction is carried out for 2h under the constant temperature condition of 37 ℃, and then 562nM (F) is measured by a fluorescence spectrophotometer with 540nM as excitation wavelength_D) And 666nm (F)_A) Fluorescence intensity value at (b), excitation/emission slit width was 4 nm.

The results are shown in FIG. 8: in A in FIG. 8, the fluorescence intensity gradually increases with the increase of the concentration of miR-1246; and, B in FIG. 8, F in the concentration range of 100fM to 100nM_A/F_DThe concentration of miR-1246 shows a good linear relation, and the linear equation is that Y is 0.081X +1.21 (R)²0.9928), detection limit of 3.28 fM; c, D in FIG. 8 is the normal HCR result: the fluorescence intensity gradually increases with the increase of the miR-1246 concentration; in the concentration range of 1nM to 300nM, F_A/F_DThe linear equation with the concentration of miR-1246 is that Y is 0.098X +0.089 (R)²0.9960), detection limit of 0.78 nM; compared with the detection sensitivity of the HCR probe, the HCR-DNAzyme probe provided by the embodiment is improved by 5 orders of magnitude, and has a better detection effect.

2) Reaction kinetics investigation of HCR-DNAzyme probes for miR-1246 detection

Taking H1+ H2(HCR blank), H1+ H2+ H3+ Mn²⁺(HCR-DNAzyme-Mn²⁺system blank)、miR-1246+H1+H2(HCR)，miR-1246+H1+H2+H3+Mn²⁺(HCR-DNAzyme-Mn²⁺system) (final concentration of H1 was 100 nM; the final concentration of H2 was 100 nM; the final concentration of H3 was 250 nM; the final concentration of miR-1246 is 100 nM; mn²⁺Final concentration 50mM), Mg was added separately²⁺(final concentration: 30mM), Tris buffer (final concentration: 10mM), 100. mu.L of the reaction system, a reaction at 37 ℃ for 2 hours, and scanning with a fluorescence spectrophotometer at an excitation wavelength of 540nm for 562nm (F)_D) And 666nm (F)_A) Fluorescence intensity values (time set at 2 hours, every 10 min) at 4nm excitation/emission slit width.

The results are shown in FIG. 9: when the target miR-1246 exists, the fluorescence of the HCR-DNAzyme probe (miR-1246+ H1+ H2+ H3) is obviously enhanced along with the prolonging of time, and the fluorescence is about 4 times stronger than that of the common HCR probe (miR-1246+ H1+ H2), which indicates that the HCR-DNAzyme probe has higher reaction kinetics than the common HCR probe; (ii) a When the target was absent, the fluorescence value was low, indicating that the background signal of the HCR-DNAzyme probe was low.

3) Specificity of HCR-DNAzyme Probe for detecting miR-1246

To investigate whether this HCR-DNAzyme probe responds specifically to the target, a series of Random sequences differing by 1 or 2 bases from the target were designed and synthesized (see table 1 for sequence). Adding Mn into H1 (final concentration of 100nM), H2 (final concentration of 100nM) and H3 (final concentration of 250nM)²⁺(final concentration 50mM), Mg²⁺(final concentration of 30mM), the target sequences (SEQ ID NO.4, 5, 6, 7, final concentration of 10nM, no Blank (Blank) added), Tris buffer (final concentration of 10mM) and 100. mu.L of the reaction system were added, the reaction was carried out at a constant temperature of 37 ℃ for 2 hours, and then 562nM (F) was measured using a fluorescence spectrophotometer at an excitation wavelength of 540nM_D) And 666nm (F)_A) Fluorescence intensity value at (b), excitation/emission slit width was 4 nm. The results are shown in FIG. 10: the strong fluorescence can be generated only in the presence of miR-1246, and the fluorescence generated by blank and mismatched chains is very weak, which indicates that the HCR-DNAzyme probe has high specificity.

TABLE 1 DNA/RNA sequences used to test the specificity of HCR-DNAzyme for miR-1246

Sequence name	Sequence (5'-3')
		mis-1	AATGGATTTTTGGACCAGG(SEQ ID NO.5)
mis-2	AATGGATTATTGGACCAGG(SEQ ID NO.6)
		mis-3	AATCGATTTTTGGACCAGG(SEQ ID NO.7)

Note: wherein "T" in DNA is equivalent to "U" in RNA.

Example 4 MnO₂Verification of the Effect of the Nanosheet

(1)MnO₂Nanosheet-loaded nucleic acid probe

The fluorescence intensity of H1 labeled with fluorophore cy5 was measured after being diluted to a concentration gradient (10, 25, 40, 55, 70, 85, 100nM), to obtain a standard curve of fluorescence intensity as a function of concentration. H1 with the final concentration of 100nM is loaded on manganese dioxide nanosheets with the final concentration of 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 and 130 mug/mL (the method is the same as the example 2), the fluorescence values of the manganese dioxide nanosheets with different concentrations are obtained after centrifugation at 12000rpm, and MnO with different concentrations is obtained through conversion of an H1 standard curve fitting equation₂Graph of change of loading rate and fluorescence intensity of nanosheet with H1 concentration and graph of H1 loading rate with MnO₂The concentration change curve of the nanosheet is shown in fig. 11: MnO₂The highest H1 load rate in the nanosheet can reach more than 80 percent, which indicates MnO₂The nano-sheet has good adsorption effect on the nucleic acid probe.

(2)MnO₂Protective action of nanosheet

Using the above MnO₂nanosheet-HCR-DNAzyme (MnO)₂The method for synthesizing nanosheets-HCR-DNAzymes) comprises the steps of loading DNA chains ((FAM) -GAAGTGCTTCGATTTTGGGGTGT/rA// rG/TATAGTGGCAAAATCGAAGCACTTC (SEQ ID NO.11) - (BHQ1) marked with FAM fluorescent groups on manganese dioxide nanosheets, detecting the change of FAM fluorescence by using a fluorescence PCR instrument under the condition that 6 mu L of cell lysate and oxyribonuclease are added to the loaded and unloaded DNA chains marked with FAM fluorescent groups respectively, and comparing the change of fluorescence intensity of the nanosheets under the condition that whether manganese dioxide exists or not.

The results are shown in FIG. 12: MnO in nucleic acid Probe Supported MnO₂Adding cell lysis solution (FAM + MnO) into the nano sheet₂nanosheets + Cell Lysates) or oxyribonuclease (FAM + MnO)₂nanosheets + DNase I) with no significant change in fluorescence value, no MnO₂Under the condition of the nanosheet, the probe labeled with the fluorophore is quickly cleaved by Cell lysate liquid (FAM + Cell Lysates) and oxyribonuclease (FAM + DNase I), so that the fluorophore FAM and the quencher BHQ1 are separated to generate strong fluorescence.

(3)MnO₂Degradation of the nanoplates

MnO of₂Diluting the nano-sheets to 126.1 mu g/mL, respectively adding Glutathione (GSH) with different concentrations (0, 10, 50, 100, 200, 300, 400, 600, 1000 mu M), incubating at 37 ℃ for 1h, centrifuging at 12000rmp, taking supernatant, and measuring Mn in the supernatant by ICP-MS²⁺To obtain Mn in the manganese dioxide nanosheet by calculation²⁺The release rate of (c). The results are shown in FIG. 13: mn as Glutathione (GSH) concentration increases²⁺The release rate of (a) also gradually increases: mn when the GSH concentration reaches 1mM²⁺The release rate of the drug reaches nearly 80 percent, and the GSH concentration in cancer cells reaches 6mM, which indicates MnO₂After the nano sheet enters cancer cells, intracellular GSH can effectively crack MnO₂Conversion of nanosheets to Mn²⁺。

(4) Manganese dioxide nanosheet (MnO)₂ nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme system) cytotoxicity

The MCF-7 cells were plated in 96-well plates at approximately 5000 cells per well, and manganese dioxide nanoplates (MnO) were added after overnight incubation₂nanosheets) and MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme systems) (final concentrations of 0, 5, 10, 20, 30, 45, 60, 80. mu.g/mL in DMEM), incubated at 37 ℃ for 24 hours, the culture was discarded, 100. mu.L of 10% MTT solution was added, after incubation at 37 ℃ for 24 hours, MTT was discarded, 100. mu.L of DMSO was added and shaken for 10min, and absorbance at 490nm was measured. The results are shown in FIG. 14: when the manganese dioxide nano-plate is within 80 mug/mL, the cell survival rate is over 85 percent, which shows that the manganese dioxide nano-plate has low cytotoxicity.

(5) Uptake of manganese dioxide nanosheets by cells

Taking MnO₂nanosheet-HCR-DNAzyme (MnO)₂nanosheets-DNAzyme systems) (diluted with DMEM to a final concentration of 45. mu.g/mL) were incubated with MCF-7 cells at 37 ℃ for 4h (equal amount of solvent was added to the control group), the supernatant was discarded, the cells were washed 3 times with PBS, counted after digestion, concentrated nitric acid was added, left overnight at 37 ℃, the supernatant was centrifuged after cell lysis, and Mn was measured by ICP-MS in the supernatant²⁺The results are shown in fig. 15: the MCF-7 cells can take up MnO₂nanosheet-HCR-DNAzyme (MnO)₂Mn in nanosheets-DNAzyme system)²⁺。

(6) Generation of resonance energy transfer in living cells

MCF-7 cells were plated in confocal dishes at approximately 5000 cells per well and incubated overnight before the following treatments: h1+ H2+ H3, MnO₂ nanosheets-H2+H3(H2+H3+MnO₂)、MnO₂ nanosheets-H1+H2(H1+H2+MnO₂)、MnO₂ nanosheets-H1+H2+H3(H1+H2+H3+MnO₂) (H1 (final concentration of 100nM), H2 (final concentration of 100nM), H3 (final concentration of 250nM), MnO₂Nanosheet (final concentration is 45 mu g/mL), and solvent is DMEM and MnO₂nanosheets-H2+H3、MnO₂ nanosheets-H1+H2、MnO₂nanosheets-H1+ H2+ H3The preparation method is the same as example 2), incubation is carried out for 4h at the constant temperature of 37 ℃, the fluorescence intensity of intracellular energy resonance transfer is observed by an inverted confocal laser microscope, and the result is shown in figure 16: only when MnO is present₂When the nanosheets-H1+ H2+ H3 system is complete, the fluorescence of stronger Fluorescence Resonance Energy Transfer (FRET) can be generated in cells, which shows that MnO is₂The nanosheets-HCR-DNAzyme has the capability of live cell imaging and has higher efficiency of energy resonance transfer.

Example 5 in situ imaging of microRNAs in living cells

(1) Accuracy of live cell microRNA in-situ imaging

MCF-7 cells were plated in a confocal dish at approximately 10000 cells per well and incubated overnight before being treated as follows: miRNA-1246 antisense sequence (diluted with DMEM to a final concentration of 500nM) is incubated for 2 hours (Anti-miR-1246pre-treated MCF-7), solvent incubated for 2 hours (untreated MCF-7), miRNA-1246 sequence (diluted with DMEM to a final concentration of 500nM) is incubated for 2 hours (miR-1246pre-treated MCF-7), and MnO-7 is added respectively₂nanosheet-HCR-DNAzyme (H1 (final concentration of 100nM), H2 (final concentration of 100nM), H3 (final concentration of 250nM), MnO₂Nanosheet (final concentration 45 mug/mL) and DMEM as solvent are incubated at constant temperature of 37 ℃ for 4h, and the fluorescence intensity of intracellular energy resonance transfer is observed by an inverted confocal laser microscope, and the result is shown in FIG. 17: MCF-7 cells and MnO after miR-1246 pretreatment₂The fluorescence of the nano-sheet-HCR-DNAzyme probe is obviously enhanced after reaction, and MCF-7 cells pretreated by antisense miR-1246 and MnO₂The fluorescence intensity of the nano-sheet-HCR-DNAzyme probe after reaction is weaker than that of the nano-sheet-HCR-DNAzyme probe after reaction, which is because the antisense miR-1246 is combined with the miR-1246 in the cell to cause the miR-1246 in the cell to be down-regulated so as to reduce the generation of HCR amplification reaction, and shows that MnO is not added₂The nanosheet-HCR-DNAzyme probe can successfully detect the change of the expression level of miR-1246 in the cell.

(2) In-situ imaging of microRNAs in different types of cells

Respectively selecting cancer cells MCF-7, Hela and normal cells MCF-10A and L02, spreading the cells in a confocal dish, wherein each hole has about 10000 cells, and after incubation overnight, respectively carrying out the following treatment: separately adding MnO₂nanosheet-HCR-DNAzyme (H1 (final concentration of 100nM), H2 (final concentration of 100nM), H3 (final concentration of 250nM), MnO₂Nanosheet (final concentration 45 mug/mL) and DMEM as solvent are incubated at constant temperature of 37 ℃ for 4h, and the fluorescence intensity of intracellular energy resonance transfer is observed through an inverted confocal microscope, and the result is shown in FIG. 18: human breast cancer cell MCF-7 and human cervical carcinoma cell Hela and MnO₂The nanosheets-HCR-DNAzyme generates stronger fluorescence, and the FRET channel of the human normal embryonic stem cell L02 and the human normal mammary epithelial cell has very weak fluorescence, which indicates that the miR-1246 in the cell is obviously up-regulated when cancer occurs, and the result is consistent with the RT-qPCR result (figure 19), and further verifies that MnO is not required₂The nanosheets-HCR-DNAzyme can be used as a diagnosis of microRNA related disease markers.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern medical university

<120> a group of HCR-DNAzyme probes for detecting nucleic acids and uses thereof

<130>

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 38

<212> DNA

<213> Artificial sequence

<400> 1

atttttggag caggcacacc ctgctccaaa aatccatt 38

<210> 2

<211> 69

<212> DNA

<213> Artificial sequence

<400> 2

aaaccgaggc tagccgtgtg cctgctccaa aaataatgga tttttggagc agggtacaac 60

gacgcctgc 69

<210> 3

<211> 43

<212> DNA

<213> Artificial sequence

<400> 3

aatggatttt tggagcaggc gaucggtttt ccaaatatcc att 43

<210> 4

<211> 19

<212> RNA

<213> Homo sapiens

<400> 4

aauggauuuu uggagcagg 19

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<400> 5

aatggatttt tggaccagg 19

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence

<400> 6

aatggattat tggaccagg 19

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence

<400> 7

aatcgatttt tggaccagg 19

<210> 8

<211> 14

<212> DNA

<213> Artificial sequence

<400> 8

aaaccgaggc tagc 14

<210> 9

<211> 15

<212> DNA

<213> Artificial sequence

<400> 9

tacaacgacg cctgc 15

<210> 10

<211> 10

<212> DNA

<213> Artificial sequence

<400> 10

cgaucggttt 10

<210> 11

<211> 50

<212> DNA

<213> Artificial sequence

<400> 11

gaagtgcttc gattttgggg tgtagtatag tggcaaaatc gaagcacttc 50