Genetically encoded phage-displayed cyclic peptide libraries and methods of making the same

文档序号：327504 发布日期：2021-11-30 浏览：30次中文

阅读说明：本技术 遗传编码的噬菌体展示的环状肽文库及其制备方法 (Genetically encoded phage-displayed cyclic peptide libraries and methods of making the same ) 是由 W·刘于 2019-05-20 设计创作，主要内容包括：本公开的实施方式涉及选择与靶标结合的环状肽的方法,所述方法通过将带有多种核酸的噬菌体展示文库转化进细菌宿主细胞中来进行,其中所述核酸包括具有编码至少一个半胱氨酸和至少一个非经典氨基酸的组合区域的噬菌体衣壳蛋白基因。转化导致产生具有噬菌体衣壳蛋白的噬菌体颗粒,其中半胱氨酸和非经典氨基酸相互偶联以形成环状肽文库。然后针对所需的靶标筛选噬菌体颗粒以选择结合的环状肽。然后鉴定所选择的环状肽的氨基酸序列。其他实施方式涉及构建编码所述环状肽的噬菌体展示文库的方法。本公开的进一步实施方式涉及所生产的环状肽、噬菌体展示文库和噬菌体颗粒。(Embodiments of the present disclosure relate to methods of selecting cyclic peptides that bind to a target by transforming a phage display library with a plurality of nucleic acids into a bacterial host cell, wherein the nucleic acids comprise a phage capsid protein gene having a combined region encoding at least one cysteine and at least one non-canonical amino acid. Transformation results in the production of phage particles with phage coat proteins in which cysteine and non-classical amino acids are coupled to each other to form a cyclic peptide library. The phage particles are then screened against the desired target to select for bound cyclic peptides. The amino acid sequence of the selected cyclic peptide is then identified. Other embodiments relate to methods of constructing phage display libraries encoding the cyclic peptides. Further embodiments of the disclosure relate to the cyclic peptides, phage display libraries, and phage particles produced.)

1.A method of selecting a cyclic peptide that binds to a desired target, the method comprising:

(a) transforming a phage display library containing a plurality of nucleic acids into a bacterial host cell,

wherein the nucleic acid comprises a bacteriophage capsid protein gene comprising a combined region,

wherein the combined region encodes at least one cysteine and at least one non-canonical amino acid,

wherein the bacterial host cell produces phage particles from the nucleic acid,

wherein the bacteriophage particle comprises a bacteriophage capsid protein having at least one cysteine and at least one non-canonical amino acid within a combined region, and

wherein the at least one cysteine and the at least one non-canonical amino acid are coupled to each other to form a cyclic peptide;

(b) screening said bacteriophage particle for said desired target,

wherein the screening results in the selection of phage particles having a cyclic peptide bound to the desired target; and

2. The method of claim 1, wherein screening is by affinity selection for the desired target.

3. The method of claim 1, wherein performing the screening is performed by:

(a) incubating said phage particle with said desired target,

wherein the desired target is immobilized on a surface;

(b) separating unbound phage particles from phage particles bound to the desired target; and

4. The method of claim 1, wherein the screening further comprises:

(a) transforming said selected phage particles into said bacterial host cell to allow for the production of other phage particles; and

(b) according to claim 1 step (b), screening the phage particles.

5. The method of claim 4, wherein the further screening is repeated a plurality of times.

6. The method of claim 1, wherein the identifying is performed by sequencing a combinatorial region of the selected phage particle.

7. The method of claim 1, wherein the identifying comprises:

(a) purifying the selected phage particles;

(b) separating the nucleic acid from the selected phage particle; and

8. The method of claim 1, wherein the desired target is selected from the group consisting of: peptides, proteins, enzymes, small molecules, cellular receptors, antigens, ligand binding sites of a desired target, active sites of a protein, allosteric sites of a protein, DNA, RNA, and combinations thereof.

9. The method of claim 1, wherein the desired target is an enzyme.

10. The method of claim 9, wherein the cyclic peptide inhibits the activity of the enzyme.

11. The method of claim 10, wherein the enzyme is selected from the group consisting of: proteases, histone deacetylases, TEV proteases, HDAC8, and combinations thereof.

12. The method of claim 1, wherein the nucleic acid is in the form of a phagemid.

13. The method of claim 1, wherein the nucleic acid is encapsulated in a phage.

14. The method of claim 1, wherein the bacterial host cell is capable of translating the combined regions of the phage coat protein genes such that the at least one cysteine and the at least one non-canonical amino acid are translated.

15. The method of claim 1, wherein the bacterial host cell is co-infected with a knockout helper phage that does not express the phage capsid protein gene.

16. The method of claim 1, wherein the at least one non-canonical amino acid is encoded by a codon selected from the group consisting of: in-frame amber codons, in-frame ochre codons, in-frame opal codons, rare codons, and four base codons.

17. The method of claim 1, wherein the at least one non-canonical amino acid is encoded by an in-frame amber codon, and wherein the bacterial host cell is an amber-suppressing bacterial host strain.

18. The method of claim 17, wherein the bacterial host cell comprises an amber suppressor tRNA that has been aminoacylated by at least one non-canonical amino acid by a homologous aminoacyl-tRNA synthetase.

19. The method of claim 1, wherein the phage capsid protein gene is a PIII gene.

20. The method of claim 1, wherein the phage capsid protein gene is located near an IPTG-inducible promoter, wherein the phage capsid protein is expressed by exposing the bacterial host cell to IPTG.

21. The method of claim 1, wherein the at least one non-canonical amino acid includes an electrophilic moiety capable of reacting with the thio group of the at least one cysteine.

22. The method of claim 1, wherein the at least one non-canonical amino acid is selected from the group consisting of: phenylalanine-derived non-classical amino acids, lysine-derived non-classical amino acids, and combinations thereof.

23. The method of claim 1, wherein the at least one non-canonical amino acid is selected from the group consisting of: an alkene-containing non-classical amino acid, an alkyne-containing non-classical amino acid, a haloalkane-containing non-classical amino acid, and combinations thereof.

24. The method of claim 1, wherein the at least one non-canonical amino acid is N⁶Acrylyl lysine (AcrK).

25. The method of claim 1, wherein the at least one non-canonical amino acid is located at one end of the combined region and the at least one cysteine is located at the other end of the combined region.

26. The method of claim 1, wherein the at least one non-canonical amino acid and the at least one cysteine are separated by at least 4 amino acids.

27. The method of claim 1, wherein the at least one cysteine and the at least one non-classical amino acid are coupled to each other by a michael addition reaction or a nucleophilic substitution reaction between the electrophilic regions of the at least one cysteine and the at least one non-classical amino acid.

28. The method of claim 1, wherein the at least one cysteine and the at least one non-canonical amino acid are coupled to each other by a bond that excludes disulfide bonds.

29. A method of constructing a phage display library encoding a cyclic peptide, the method comprising:

(a) providing an original phage display library, providing a library of phage displays,

wherein the original phage display library comprises a plurality of nucleic acids,

wherein the plurality of nucleic acids comprises nucleic acids having a bacteriophage capsid protein gene,

wherein the phage capsid protein gene comprises a combinatorial region; and

(b) introducing at least one of the first codon and the second codon into the combining region,

wherein the first codon expresses a cysteine,

wherein the second codon expresses a non-canonical amino acid, and

wherein the cysteine and the non-canonical amino acid are coupled to each other to form a cyclic peptide.

30. The method of claim 29, wherein said introducing is performed by site-directed mutagenesis.

31. The method of claim 29, wherein said introducing comprises introducing said first codon and said second codon into said combining region.

32. The method of claim 29, further comprising the step of producing a phage particle encoding the cyclic peptide, wherein the method comprises transforming the phage display library into a bacterial host cell, wherein the bacterial host cell produces a phage particle comprising a phage coat protein having cysteine and non-canonical amino acids within a combinatorial region, and wherein the cysteine and non-canonical amino acids are coupled to each other to form the cyclic peptide.

33. The method of claim 32, wherein the non-canonical amino acid is encoded by a codon selected from the group consisting of: in-frame amber codons, in-frame ochre codons, in-frame opal codons, rare codons, and four base codons.

34. The method of claim 32, wherein the bacterial host cell is an amber-suppressing bacterial host strain.

35. The method of claim 34, wherein the bacterial host cell comprises an amber suppressor tRNA that has been aminoacylated by a non-classical amino acid by a homologous aminoacyl-tRNA synthetase.

36. The method of claim 29, wherein the phage capsid protein gene is a PIII gene.

37. The method of claim 29, wherein the non-classical amino acid comprises an electrophilic moiety capable of reacting with a thio group of the cysteine.

38. The method of claim 29, wherein the non-canonical amino acid is selected from the group consisting of: phenylalanine-derived non-classical amino acids, lysine-derived non-classical amino acids, and combinations thereof.

39. The method of claim 29, wherein the non-canonical amino acid is selected from the group consisting of: an alkene-containing non-classical amino acid, an alkyne-containing non-classical amino acid, a haloalkane-containing non-classical amino acid, and combinations thereof.

40. The method of claim 29, wherein the non-canonical amino acid is N⁶Acrylyl lysine (AcrK).

41. A phage display library, wherein the phage display library encodes a cyclic peptide,

wherein the phage display library comprises a plurality of nucleic acids,

wherein the plurality of nucleic acids comprises nucleic acids having a bacteriophage capsid protein gene comprising a combined region,

wherein the combined region comprises codons expressing at least one cysteine and at least one non-canonical amino acid, and

wherein at least one cysteine and at least one non-canonical amino acid in the combined region are coupled to each other to form a cyclic peptide.

42. The phage display library of claim 41, wherein said phage coat protein gene comprises the PIII gene.

43. The phage display library of claim 41, wherein said at least one non-canonical amino acid comprises an electrophilic moiety capable of reacting with a thio group of said at least one cysteine.

44. The phage display library of claim 41, wherein said at least one non-canonical amino acid is selected from the group consisting of: phenylalanine-derived non-classical amino acids, lysine-derived non-classical amino acids, and combinations thereof.

45. The phage display library of claim 41, wherein said at least one non-canonical amino acid is selected from the group consisting of: an alkene-containing non-classical amino acid, an alkyne-containing non-classical amino acid, a haloalkane-containing non-classical amino acid, and combinations thereof.

46. The phage display library of claim 41, wherein said at least one non-canonical amino acid is N⁶Acrylyl lysine (AcrK).

47. The phage display library of claim 41, wherein said at least one non-canonical amino acid is located at one end of said combinatorial region and said at least one cysteine is located at the other end of said combinatorial region.

48. The phage display library of claim 41, wherein said at least one non-canonical amino acid and said at least one cysteine are separated by at least 4 amino acids.

49. A cyclic peptide comprising at least one cysteine and at least one non-canonical amino acid, wherein the at least one cysteine and the at least one non-canonical amino acid are coupled to each other to form the cyclic peptide.

50. The cyclic peptide of claim 49, wherein the cyclic peptide is an inhibitor of TEV protease.

51. The cyclic peptide of claim 50,

wherein the cyclic peptide is selected from the group consisting of: CWDDYLIX (CycTev1) (SEQ ID NO:1), CQWFSHRX (CycTev2) (SEQ ID NO:2), or a combination thereof; and is

Wherein X is the at least one non-canonical amino acid.

52. The cyclic peptide of claim 49, wherein the cyclic peptide is an inhibitor of HDAC 8.

53. The cyclic peptide of claim 52,

wherein the cyclic peptide is CQSLWMNX (CycH8a) (SEQ ID NO: 3); and is

Wherein X is the at least one non-canonical amino acid.

54. The cyclic peptide of claim 49, wherein the at least one non-canonical amino acid includes an electrophilic moiety capable of reacting with the thio of the at least one cysteine.

55. The cyclic peptide of claim 49, wherein the at least one non-canonical amino acid is selected from the group consisting of: phenylalanine-derived non-classical amino acids, lysine-derived non-classical amino acids, and combinations thereof.

56. The cyclic peptide of claim 49, wherein the at least one non-canonical amino acid is selected from the group consisting of: an alkene-containing non-classical amino acid, an alkyne-containing non-classical amino acid, a haloalkane-containing non-classical amino acid, and combinations thereof.

57. The cyclic peptide of claim 49, wherein the at least one non-canonical amino acid is N⁶Acrylyl lysine (AcrK).

58. The cyclic peptide of claim 49, wherein the at least one non-canonical amino acid is located at one end of the combined region and the at least one cysteine is located at the other end of the combined region.

59. The cyclic peptide of claim 49, wherein the at least one non-canonical amino acid and the at least one cysteine are separated by at least 4 amino acids.

60. The cyclic peptide of claim 49, wherein the at least one cysteine and the at least one non-canonical amino acid are coupled to each other by a bond that excludes disulfide bonds.

61. A bacteriophage particle comprising a cyclic peptide,

wherein the bacteriophage particle comprises a bacteriophage capsid protein comprising a combined region,

wherein the combined region comprises at least one cysteine and at least one non-canonical amino acid coupled to each other to form a cyclic peptide.

62. The bacteriophage particle of claim 61, wherein said bacteriophage capsid protein comprises PIII.

63. The bacteriophage particle of claim 61, wherein said at least one non-classical amino acid comprises an electrophilic moiety capable of reacting with a thio group of said at least one cysteine.

64. The phage particle of claim 61, wherein said at least one non-canonical amino acid is selected from the group consisting of: phenylalanine-derived non-classical amino acids, lysine-derived non-classical amino acids, and combinations thereof.

65. The phage particle of claim 61, wherein said at least one non-canonical amino acid is selected from the group consisting of: an alkene-containing non-classical amino acid, an alkyne-containing non-classical amino acid, a haloalkane-containing non-classical amino acid, and combinations thereof.

66. The phage particle of claim 61, wherein said at least one non-canonical amino acid is N⁶Acrylyl lysine (AcrK).

67. The phage particle of claim 61, wherein said at least one non-canonical amino acid is located at one end of said combined region and said at least one cysteine is located at the other end of said combined region.

68. The phage particle of claim 61, wherein said at least one non-canonical amino acid and said at least one cysteine are separated by at least 4 amino acids.

Background

Cyclic peptides are considered to have potential use as therapeutic agents due to their improved properties over their linear counterparts. To identify cyclic peptide ligands as therapeutic targets, selection from phage display peptide libraries, in which cysteines are covalently coupled via disulfide bonds or organic linkers, has been widely adopted and with great success. However, this approach has a number of technical drawbacks, such as limited in vivo use, and limited phage viability. Various embodiments of the present disclosure address the above limitations.

The development of the invention was partially subsidized by the Welch Foundation under the accession number A-1715.

Disclosure of Invention

In some embodiments, the present disclosure relates to methods of selecting a cyclic peptide that binds to a desired target. In some embodiments, the methods of the present disclosure comprise transforming a phage display library with a plurality of nucleic acids into a bacterial host cell, wherein the nucleic acids comprise a phage capsid protein gene with a combined region encoding at least one cysteine and at least one non-canonical amino acid. Transformation results in the production of phage particles containing phage capsid proteins with cysteine and non-classical amino acids coupled to each other to form a cyclic peptide.

The phage particles are then screened for the desired target, thereby selecting phage particles having a cyclic peptide that binds to the desired target. The amino acid sequence of the cyclic peptide of the selected phage particle is then identified.

Other embodiments of the invention relate to methods of constructing phage display libraries encoding cyclic peptides. In some embodiments, such methods comprise providing an original phage display library having nucleic acids comprising phage coat protein genes of a combinatorial region, and introducing codons expressing at least one cysteine and at least one non-canonical amino acid into the combinatorial region. The resulting nucleic acids can then be transformed into bacterial host cells to produce phage particles containing phage coat proteins with cysteine and non-canonical amino acids coupled in combined regions.

Other embodiments of the present disclosure relate to phage display libraries encoding a cyclic peptide in a combinatorial region of phage capsid proteins, wherein the cyclic peptide comprises at least one cysteine and at least one non-canonical amino acid in the combinatorial region, coupled to each other to form the cyclic peptide.

Other embodiments of the present disclosure relate to phage particles comprising a cyclic peptide. The phage particle includes a phage coat protein having a combined region containing at least one cysteine and at least one non-canonical amino acid coupled to each other to form a cyclic peptide.

Other embodiments of the present disclosure relate to cyclic peptides comprising at least one cysteine and at least one non-canonical amino acid coupled to each other. In some embodiments, a cyclic peptide inhibitory enzyme of the present disclosure, e.g., TEV protease or HDAC 8.

Drawings

Figure 1 illustrates a representative, existing and proposed cyclization strategy for phage-displayed peptides. Figure 1A shows cyclization by disulfide bonding between cysteines. FIG. 1B shows cyclization by covalent coupling of cysteine to an organic linker. Figure 1C shows representative organic linkers for cysteine coupling to produce mono-cyclic peptides and bi-cyclic peptides. Figure 1D shows the proposed proximity-driven cyclization between cysteine and electrophilic non-classical amino acids (ncAA). Figure 1E shows a pathway based on amber-suppressing ligation of phenotype ncAA with genotype TAG mutation. Phage having a TAG mutation in the coding region of their displayed peptide are produced in e.coli cells with an evolved aminoacyl-tRNA synthetase and amber suppressor tRNA for specifying gene inclusion of ncAA.

FIG. 2 provides a scheme for the method of selecting cyclic peptides that bind to a desired target (FIG. 2A) and constructing a phage display library encoding cyclic peptides (FIG. 2B).

Fig. 2C and 2D provide structures of various non-canonical amino acids that can be incorporated into cyclic peptides.

FIG. 3 shows N introduced by cysteine and by genetic means^ε-Michael (Michael) addition between acryloyl-lysine (AcrK) cyclized phage display peptides. Figure 3A shows a schematic illustrating proximity driven peptide cyclization between cysteine and electron deficient ncAA. Fig. 3B shows the structure of AcrK and HZC1, the cleavage product in water being a nitrilimine (nitrilimine) that selectively reacts with acrylamide to show strong blue fluorescence. FIG. 3C shows two superfolder green fluorescent protein (sfGFP) derivatives, one with an N-terminal CA₅X peptide, the other having an N-terminal A₆X peptides, and their fluorescent labels (using HZC 1). X represents AcrK. The proteins were first denatured and then analyzed by SDS-PAGE. The fluorescence in the gel was recorded in the blue region excited at 365 nm. FIG. 3D shows two phage derivatives, one with an N-terminal CA₅X peptide, the other having an N-terminal A₆X peptides, and their fluorescent labels (using HZC 1). The phage were precipitated and then fluorescence imaged under UV light.

FIG. 4 shows selected TEV protease-binding cyclic peptides and their Ks_dAnd (6) measuring. FIG. 4A shows a schematic of the phagemid structure used to produce phage-displayed 6-polycyclopeptide libraries. FIG. 4B shows the structure of 5FAM-CycTev 1. CycTev1 was selected from phage display. FIG. 4C shows fluorescence polarization analysis of 5FAM-CycTev1 binding to TEV protease. Data using the linear counterpart of 5 FAM-cycttev 1 without a linker are also included. FIG. 4D shows the structure of FITC-CycTev 2. FIG. 4E shows fluorescence polarization analysis of 5FAM-CycTev2 binding to TEV protease. Data for the linear counterpart of 5FAM-CycTev2 without linker are also included。

FIG. 5 shows the sequences of 20 isolated clones from a phage display library.

Figure 6 shows phage eluted after each round of selection against TEV protease.

FIG. 7 shows the DNA sequencing results of HDAC 8-bound clones and their pooled peptide sequences.

FIG. 8 shows additional DNA sequencing results of HDAC 8-bound clones and their pooled peptide sequences.

Figure 9 shows selected cyclic peptide ligands CycH8a and their binding and inhibition to HDAC 8. FIG. 9A shows the structure of 5FAM-CycH8 a. The sequence of CycH8a was selected from phage display. FIG. 9B shows fluorescence polarization analysis of 5FAM-CycH8a binding to HDAC 8. Data for the linear counterpart of 5FAM-CycH8a are also included. Figure 9C shows a schematic of an assay protocol showing fluorescent HDAC8 activity. FIG. 9D shows the IC of the assay shown in C for the inhibition of HDAC8 by 5FAM-CycH8a₅₀。

Figure 10 shows the molecular docking results of CycH8a binding to HDAC8 dimer. The upper panel shows the conformation (conforms) of the different CycH8a bound at the two grooves of the HDAC8 dimer interface. The bottom panel shows the most favorable conformation of CycH8a bound at each groove.

FIG. 11 shows A₆X-sfGFP and CA₅Expression of X-sfGFP.

FIG. 12 shows confirmation of pIII knock-out in M13KO7-g3 TAA. Supernatants of E.coli cultures expressing M13KO7-g3TAA or wild type M13KO7 and CM13 were spotted on Top agar overlays containing E.coli Top 10F'. The presence of plaques in wild-type M13KO7 and CM13 dots indicates the presence of viable phage. The absence of plaques in the M13KO7-g3TAA spot demonstrated the absence of pIII required for host infection.

FIG. 13 shows the M13KO7-g3TAA phagemid complementation assay. Coli Top 10F' was infected with supernatant from cultures expressing wild type pIII (left) or pIII with an in-frame amber mutation (right). Growth of cells infected with wild type pIII supernatant demonstrated the ability of M13KO7-g3TAA to complement phagemids carrying viable pIII.

Figure 14 shows the expression of TEV protease.

FIG. 15 shows SDS-PAGE analysis of purified HAC 8.

FIG. 16 shows the general procedure for solid phase peptide synthesis.

FIG. 17 shows MALDI-TOF spectrum (calculated molecular weight: 1634.7Da) of CWDDYLIX-K-5 FAM (SEQ ID NO: 1).

FIG. 18 shows MALDI-TOF spectrum (calculated molecular weight: 1580.7Da) of CWDDYLIK-K-5 FAM (SEQ ID NO: 4).

FIG. 19 shows MALDI-TOF spectrum (calculated molecular weight: 1629.7Da) of CWDDYLIX-K-5 FAM (SEQ ID NO: 1).

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are explanatory and explanatory only and are not restrictive of the subject matter claimed. In this application, the use of the singular includes the plural, and the words "a" or "an" mean "at least one" or "the use of the word" and/or "unless specifically stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "including," is not limiting. Meanwhile, unless specifically stated otherwise, terms such as "element" or "component" include an element or component of one unit and an element or component including more than one unit.

The section headings used herein are for organizational purposes and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treaties, are hereby incorporated by reference in their entirety for any purpose. The definition of a term in one or more of the incorporated documents and similar materials is to be contrasted with the definition of that term in the present application, which controls the present application.

Traditionally, therapeutic drugs consist of small molecules that precisely bind their receptors. However, due to their small size, small molecules have been less successful in targeting proteins that involve large, relatively flat surfaces that interact with other molecules. With the development of recombinant protein expression technology, a new class of protein drugs, called biologicals, has emerged. Due to their large size, biological agents exhibit far superior target affinity and selectivity compared to small molecule drugs. However, their increased size and protein-based composition result in poor tissue permeability and metabolic stability.

Peptides are intermediate in size between small molecules and biologies, providing a promising alternative to both classes of mature drugs. Peptides, being larger than small molecule drugs, offer greater potency and target selectivity while retaining the potential for cell permeability and are less expensive to manufacture than biologies. Peptides are also very easy to screen. Using peptide display technology, such as phage display, which links the displayed peptide phenotype to genotype, a researcher may screen for over 10 in a few days¹⁰A library of species-unique peptides. Despite these advantages, peptide-based inhibitors have long been avoided for two reasons.

First, peptides are generally unstructured in solution, which results in an entropic penalty (entropic penalty) for binding to the target. Second, peptides are highly susceptible to proteolysis when used in vivo. It is well known that macrocyclization (macrocyclization) can help overcome some of the disadvantages of peptides.

Macrocyclization imparts a degree of conformational rigidity to the unstructured peptide, which generally increases the binding affinity of the peptide for its target. Cyclic peptides are significantly more resistant to proteolysis. In some cases, this also results in peptides so stable that they have been successfully used for oral delivery.

Although peptide cyclization generally results in better pharmacological properties, cyclization of linear peptides identified by screening may have an unknown effect on the ability of the peptide to bind to a target protein. Currently, there are few options for direct screening of cyclic peptide libraries.

Two methods have been reported for cyclization of phage display peptide libraries. One is the formation of a disulfide bond between two cysteine residues (FIG. 1A). There are many examples of using this strategy to produce cyclized disulfide peptides that have a higher affinity for the target protein than their linear counterparts. Although beneficial for some in vitro applications, peptides cyclized in this manner cannot be used in vivo because they cannot withstand the reducing cellular environment.

Another strategy is to covalently link two cysteines by virtue of the reactivity of the nucleophilic thiol to a small molecule organic linker (fig. 1B). This strategy has been successfully used to form single and bi-cyclic phage-displayed peptide libraries and to select ligands with inhibition constants as low as 2nM (FIG. 1C). While effective in forming cyclized peptide libraries, this approach modifies the original phage cysteines, resulting in low phage activity.

Attempts have been made to construct phage strains without surface cysteines. However, these phages are less active, limiting the production of phages. Due to the non-selective nature of coupling cysteines, all organic linkers are now symmetrical and achiral to avoid heterogeneity in phage-displayed cyclic peptides, which presents a significant challenge for subsequent synthesis and characterization of the selected cyclic peptides. The symmetric, achiral organic linker used to cyclize the asymmetric, chiral peptide also results in structural limitations, which may be undesirable in some cases.

Therefore, there is a need for more efficient methods to produce cyclic peptides and screen them against the desired target. Various embodiments of the present disclosure address this need.

In some embodiments, the present disclosure relates to methods of selecting a cyclic peptide that binds to a desired target. In some embodiments illustrated in fig. 2A, the methods of the present disclosure comprise transforming a phage display library into a bacterial host cell with a plurality of nucleic acids, wherein the nucleic acids comprise a phage coat protein gene having a combined region encoding at least one cysteine and at least one non-canonical amino acid (step 10). The transformation results in the production of phage particles containing phage coat proteins with cysteines and non-classical amino acids coupled to each other to form a cyclic peptide (step 12).

The phage particles are then screened for the desired target (step 14), thereby selecting phage particles having a cyclic peptide that binds to the desired target (step 16). The amino acid sequence of the cyclic peptide of the selected phage particle is then identified (step 18).

In some embodiments, the screening includes a rescreening step in which selected phage particles are transformed into bacterial host cells (step 19) to allow production (step 12) and screening for other phage particles (steps 14, 16 and 18). In some embodiments, the further screening is repeated a plurality of times.

Other embodiments of the present disclosure relate to methods of constructing phage display libraries encoding cyclic peptides. In some embodiments illustrated in fig. 2B, such a method comprises: providing the originalA phage display library having nucleic acids comprising phage capsid protein genes of the combinatorial regions (step 20); and introducing at least one of a first codon expressing cysteine and a second codon expressing a non-canonical amino acid into the combined region (step 22). In other embodiments, the phage particles comprising the cyclic peptide are produced by transforming a phage display library into a bacterial host cell (step 24) to produce phage particles comprising a phage coat protein having the cyclic peptide (step 26).

Other embodiments of the disclosure relate to phage display libraries encoding cyclic peptides. The phage display library includes a plurality of nucleic acids having phage coat protein genes including combinatorial regions having codons expressing at least one cysteine and at least one non-canonical amino acid. The cysteines and non-canonical amino acids in the combined regions are coupled to each other to form a cyclic peptide.

Other embodiments of the present disclosure relate to phage particles comprising a cyclic peptide (such as the phage particles illustrated in fig. 1E). The phage particle includes a phage coat protein having a combined region containing at least one cysteine and at least one non-canonical amino acid coupled to each other to form a cyclic peptide.

As described in more detail herein, there are many embodiments of the methods, cyclic peptides, phage display libraries, and phage particles of the present disclosure. Specifically, cyclic peptides can be selected using a variety of methods. In addition, a variety of methods can be used to construct a variety of phage display libraries encoding a variety of cyclic peptides. In addition, phage display libraries, phage particles, and cyclic peptides can encode and contain multiple types of non-canonical amino acids.

Nucleic acids

The phage display libraries of the present disclosure can include multiple types of nucleic acids. For example, in some embodiments, the nucleic acid is in the form of a phagemid. In some embodiments, the nucleic acid is encapsulated in a phage.

Bacteriophage capsid protein gene

The cyclic peptides of the present disclosure may be encoded by a combinatorial region of a variety of phage capsid protein genes. For example, in some embodiments, the phage capsid protein gene is a PIII gene.

Cysteine and non-classical amino acids can be introduced into combinatorial regions of the phage coat protein gene using a variety of methods. For example, in some embodiments, the introduction is by site-directed mutagenesis.

In some embodiments, at least one of a first codon expressing cysteine and a second codon expressing a non-canonical amino acid is introduced into the combining region. In some embodiments (e.g., in embodiments where the combined region already contains codons for expressing non-canonical amino acids), only the first codon to express cysteine is introduced into the combined region. In some embodiments (e.g., in embodiments where the combining region already contains codons that express cysteine), only second codons that express non-canonical amino acids are introduced into the combining region. In some embodiments (e.g., in embodiments where the combination region does not contain codons expressing cysteine or non-canonical amino acids), a first codon expressing cysteine and a second codon expressing non-canonical amino acids are introduced into the combination region.

In some embodiments, the phage capsid protein gene is located adjacent to an IPTG-inducible promoter. Thus, in some embodiments, the phage capsid protein is expressed by exposing the bacterial host cell to IPTG.

Screening of phage particles for a desired target

The cyclic peptide selection methods of the present disclosure can utilize a variety of methods to screen phage particles for a desired target. For example, in some embodiments, screening is performed by affinity selection against a desired target. In some embodiments, screening is performed by: (a) incubating the phage particle with the desired target immobilized on the surface; (b) separating unbound phage particles from phage particles that bind to the desired target; and (c) isolating the bound phage particles. In some embodiments, the separation step may be performed by washing unbound phage particles from phage particles that bind to the desired target.

In some embodiments, the desired target can be biotinylated and immobilized on a streptavidin surface. In some such embodiments, screening can be performed by: (1) incubating phage particles with a desired target immobilized on a streptavidin surface; (2) separating unbound phage particles from phage particles bound to the desired target by a washing step; and (3) separating the bound phage particles by competitively eluting bound phage particles with biotin, or by adding an acidic buffer (e.g., pH 2) to release bound phage particles.

In some embodiments, the result of the screening is the selection of phage particles having a cyclic peptide that bind to the ligand binding site of the desired target. In some embodiments, the cyclic peptide acts as a ligand to direct the phage capsid assembly region to the ligand binding site of the desired target.

Identification of cyclic peptide amino acid sequencesColumn(s) of

The cyclic peptide selection methods of the present disclosure can also utilize a variety of methods to identify cyclic peptide amino acid sequences. For example, in some embodiments, identification is performed by sequencing a combinatorial region of a selected phage particle. In some embodiments, the identifying is performed by: (a) purifying the selected phage particles; (b) isolating nucleic acids from the selected phage particles; and (c) sequencing the combined regions of the nucleic acids.

Bacterial host cells

The methods of the present disclosure can utilize various types of bacterial host cells to produce phage particles. In some embodiments, the bacterial host cells of the present disclosure are capable of translating a combinatorial region of a phage capsid protein gene. In some embodiments, the bacterial host cell is co-infected with a knockout helper phage that does not express a phage capsid protein gene. In some embodiments, the helper phage is a CM13 helper phage. In some embodiments, the bacterial host cell comprises e.coli with F-fimbriae.

In some embodiments (e.g., in embodiments in which at least one non-canonical amino acid is encoded by at least one in-frame amber codon), the bacterial host cell comprises an amber-suppressing bacterial host strain. In some embodiments, the bacterial host cell comprises an amber suppressor tRNA that has been aminoacylated by the encoded non-canonical amino acid by a homologous aminoacyl-tRNA synthetase.

In a more specific embodiment, the bacterial host cell is a bacterium that has been transformed with three plasmids: (1) a plasmid encoding a phage capsid protein gene having at least one in-frame amber codon in the combined region; (2) a plasmid encoding an amber suppressor tRNA and a cognate aminoacyl-tRNA synthetase that can link a desired non-canonical amino acid to the suppressor tRNA; and (3) a helper phage that encodes all necessary phage proteins except the phage capsid protein containing the combinatorial region.

Cyclic peptides

The cyclic peptides of the present disclosure generally include at least one non-canonical amino acid coupled to at least one cysteine. The cyclic peptides of the present disclosure can include various types of non-canonical amino acids. For example, in some embodiments, the non-canonical amino acid includes an electrophilic moiety capable of reacting with the thio of a cysteine in the cyclic peptide.

In some embodiments, the non-classical amino acids include, but are not limited to, phenylalanine-derived non-classical amino acids, lysine-derived non-classical amino acids, and combinations thereof.

In some embodiments, the at least one non-classical amino acid includes, but is not limited to, alkene-containing non-classical amino acids, alkyne-containing non-classical amino acids, haloalkane-containing non-classical amino acids, and combinations thereof.

In some embodiments, the at least one non-canonical amino acid comprises an alkene-containing non-canonical amino acid. In some embodiments, the olefin comprises an electron deficient olefin.

In some embodiments, the at least one non-classical amino acid comprises an alkyne-containing non-classical amino acid. In some embodiments, the alkyne comprises an electron deficient alkyne.

In some embodiments, the at least one non-canonical amino acid comprises a haloalkane-containing non-canonical amino acid. In some embodiments, the haloalkane-containing non-canonical amino acid includes, but is not limited to, chloride, bromide, iodide, and combinations thereof.

Exemplary structures of non-canonical amino acids are shown in FIGS. 2C-D. In some embodiments, non-canonical amino acids include, but are not limited to, N⁶-acryloyl-L-lysine, N⁶crotonyl-L-lysine, N⁶-vinylsulfonyl-L-lysine, p-acrylamido-L-phenylalanine, p-vinylsulfonylamino-L-phenylalanine, m-acrylamido-L-phenylalanine, m-vinylsulfonylamino-L-phenylalanine, N⁶- (2-fluoroacetyl) -L-lysine, p-chloromethyl-phenylalanine, m-chloromethyl-L-phenylalanine, p-bromomethyl-L-phenylalanine, m-bromomethyl-L-phenylalanine, N⁶- (2-chloropropionyl)Radical) -L-lysine, N⁶- (2-chloro-2-methylpropionyl) -L-lysine, N⁶- (2-bromopropionyl) -L-lysine, N⁶- (2-bromo-2-methylpropionyl) -L-lysine, N⁶(2-chloroacetyl) -L-lysine, N⁶- (3-chloropropionyl) -L-lysine, N⁶- (4-chlorobutyryl) -L-lysine, N⁶- (5-Chloropentanyl) -L-lysine, N⁶- (6-chlorohexanoyl) -L-lysine, N⁶- (7-chloroheptanoyl) -L-lysine, N⁶- (8-chlorooctanoyl) -L-lysine, N⁶- (9-chlorononanoyl) -L-lysine, N⁶- (2-bromoacetyl) -L-lysine, N⁶- (3-bromopropionyl) -L-lysine, N⁶- (4-bromobutyryl) -L-lysine, N⁶- (5-bromovaleryl) -L-lysine, N⁶- (6-bromohexanoyl) -L-lysine, N⁶- (7-bromoheptanoyl) -L-lysine, N⁶- (8-bromooctanoyl) -L-lysine, N⁶- (9-bromononanoyl) -L-lysine, N⁶- (2-iodoacetyl) -L-lysine, N⁶- (3-iodopropionyl) -L-lysine, N⁶- (4-iodobutyryl) -L-lysine, N⁶- (5-iodovaleryl) -L-lysine, N⁶- (6-iodohexanoyl) -L-lysine, N⁶- (7-iodoheptanoyl) -L-lysine, N⁶- (8-iodooctanoyl) -L-lysine, N⁶- (9-iodononanoyl) -L-lysine, p- (2-chloroacetylamino) -L-phenylalanine, p- (3-chloropropylamino) -L-phenylalanine, p- (4-chlorobutyrylamino) -L-phenylalanine, p- (5-chloropentanoylamino) -L-phenylalanine, p- (6-chlorohexanoylamino) -L-phenylalanine, p- (7-chloroheptanoylamino) -L-phenylalanine, p- (8-chlorooctanoylamino) -L-phenylalanine, p- (9-chlorononanoylamino) -L-phenylalanine, p- (2-bromoacetylamino) -L-phenylalanine, L-tyrosine, L-phenylalanine, L-tyrosine, L-phenylalanine, L-lysine, L-phenylalanine, L-tyrosine, L-phenylalanine, and its salt, P- (3-Bromopropionylamino) -L-phenylalanine, p- (4-bromobutylamino) -L-phenylalanine, p- (5-bromopentanamido) -L-phenylalanine, p- (6-bromohexanoylamino) -L-phenylalanine, p- (7-bromoheptanoylamino) -L-phenylalanine, p- (8-bromooctanoylamino) -L-phenylalanine, p- (9-bromononanoylamino) -L-phenylalanine, p- (2-iodoacetamido) -L-phenylalanine, p- (3-iodopropionylamino) -L-phenylalanine, p- (4-iodobutyrylamino) -L-phenylalanine, L-tyrosine, L-phenylalanine, L-tyrosine, L-lysine, arginine, and the like, P- (5-iodopentanoylamino) -L-benzeneAlanine, p- (6-iodohexanoylamino) -L-phenylalanine, p- (7-iodoheptanoylamino) -L-phenylalanine, p- (8-iodooctanoylamino) -L-phenylalanine, p- (9-iodononanoylamino) -L-phenylalanine, m- (2-chloroacetylamino) -L-phenylalanine, m- (3-chloropropylamino) -L-phenylalanine, m- (4-chlorobutyrylamino) -L-phenylalanine, m- (5-chloropentanoylamino) -L-phenylalanine, m- (6-chlorohexanoylamino) -L-phenylalanine, m- (7-chloroheptanoylamino) -L-phenylalanine, L-tyrosine, L-phenylalanine, L-tyrosine, L-lysine, arginine, and the like, M- (8-chlorooctanoylamino) -L-phenylalanine, m- (9-chlorononanoylamino) -L-phenylalanine, m- (2-bromoacetylamino) -L-phenylalanine, m- (3-bromopropionylamino) -L-phenylalanine, m- (4-bromobutyrylamino) -L-phenylalanine, m- (5-bromopentanoylamino) -L-phenylalanine, m- (6-bromohexanoylamino) -L-phenylalanine, m- (7-bromoheptanoylamino) -L-phenylalanine, m- (8-bromooctanoylamino) -L-phenylalanine, m- (9-bromononanoylamino) -L-phenylalanine, L-tyrosine, L-phenylalanine, L-tyrosine, L-phenylalanine, L-tyrosine, and its salt, M- (2-iodoacetamido) -L-phenylalanine, m- (3-iodopropionylamino) -L-phenylalanine, m- (4-iodobutyrylamino) -L-phenylalanine, m- (5-iodovalerylamino) -L-phenylalanine, m- (6-iodohexanoylamino) -L-phenylalanine, m- (7-iodoheptylamino) -L-phenylalanine, m- (8-iodooctanoylamino) -L-phenylalanine, m- (9-iodononanoylamino) -L-phenylalanine, p- ((chloromethyl) sulfonamido) -L-phenylalanine, p- ((2-chloroethyl) sulfonamido) -L-phenylalanine, L-tyrosine, L-methionine, L-phenylalanine, L-tyrosine, L-methionine, L-phenylalanine, L-methionine, L-tyrosine, beta-tyrosine, and its derivative, beta-tyrosine, beta-, P- ((3-chloropropyl) sulfonamido) -L-phenylalanine, p- ((4-chlorobutyl) sulfonamido) -L-phenylalanine, p- ((5-chloropentyl) sulfonamido) -L-phenylalanine, p- ((6-chlorohexyl) sulfonamido) -L-phenylalanine, p- ((7-chloroheptyl) sulfonamido) -L-phenylalanine, p- ((8-chlorooctyl) sulfonamido) -L-phenylalanine, m- ((chloromethyl) sulfonamido) -L-phenylalanine, m- ((2-chloroethyl) sulfonamido) -L-phenylalanine, m- ((3-chloropropyl) sulfonamido) -L-phenylalanine, beta-cyanomethyl ester, beta-hydroxy-methyl ester, beta-, M- ((4-chlorobutyl) sulfonamido) -L-phenylalanine, m- ((5-chloropentyl) sulfonamido) -L-phenylalanine, m- ((6-chlorohexyl) sulfonamido) -L-phenylalanine, m- ((7-chloroheptyl) sulfonamido) -L-phenylalanine, m- ((8-chlorooctyl) sulfonamido) -L-phenylalanine, p- ((bromomethyl) sulfonamido) -L-phenylalanine, p- ((2-bromomethyl) sulfonamido) -L-phenylalanineEthyl) sulfonamido) -L-phenylalanine, p- ((3-bromopropyl) sulfonamido) -L-phenylalanine, p- ((4-bromobutyl) sulfonamido) -L-phenylalanine, p- ((5-bromopentyl) sulfonamido) -L-phenylalanine, p- ((6-bromohexyl) sulfonamido) -L-phenylalanine, p- ((7-bromoheptyl) sulfonamido) -L-phenylalanine, p- ((8-bromooctyl) sulfonamido) -L-phenylalanine, p- ((iodomethyl) sulfonamido) -L-phenylalanine, p- ((2-iodoethyl) sulfonamido) -L-phenylalanine, beta-cysteine, beta-tyrosine, and beta-tyrosine P- ((3-iodopropyl) sulfonamido) -L-phenylalanine, p- ((4-iodobutyl) sulfonamido) -L-phenylalanine, p- ((5-iodopentyl) sulfonamido) -L-phenylalanine, p- ((6-iodohexyl) sulfonamido) -L-phenylalanine, p- ((7-iodoheptyl) sulfonamido) -L-phenylalanine, p- ((8-iodooctyl) sulfonamido) -L-phenylalanine, m- ((bromomethyl) sulfonamido) -L-phenylalanine, m- ((2-bromoethyl) sulfonamido) -L-phenylalanine, m- ((3-bromopropyl) sulfonamido) -L-phenylalanine, beta-cysteine, beta-cyclodextrin, and beta-cyclodextrin, M- ((4-bromobutyl) sulfonamido) -L-phenylalanine, m- ((5-bromopentyl) sulfonamido) -L-phenylalanine, m- ((6-bromohexyl) sulfonamido) -L-phenylalanine, m- ((7-bromoheptyl) sulfonamido) -L-phenylalanine, m- ((8-bromooctyl) sulfonamido) -L-phenylalanine, m- ((iodomethyl) sulfonamido) -L-phenylalanine, m- ((2-iodoethyl) sulfonamido) -L-phenylalanine, m- ((3-iodopropyl) sulfonamido) -L-phenylalanine, m- ((4-iodobutyl) sulfonamido) -L-phenylalanine, m- ((5-iodopentyl) sulfonamido) -L-phenylalanine, m- ((6-iodohexyl) sulfonamido) -L-phenylalanine, m- ((7-iodoheptyl) sulfonamido) -L-phenylalanine, m- ((8-iodooctyl) sulfonamido) -L-phenylalanine, and combinations thereof.

In some embodiments, the non-canonical amino acid is N⁶Acrylyl lysine (AcrK). Other non-classical amino acids are also envisaged.

The non-canonical amino acids of the disclosure can be encoded by a variety of codons. For example, in some embodiments, the non-canonical amino acid is encoded by including, but not limited to, in-frame amber codons, in-frame ochre codons, in-frame opal codons, rare codons, and four base codons.

In some embodiments, the non-canonical amino acid is encoded by an in-frame amber codon. In some embodiments, the non-canonical amino acid is encoded by a rare codon. In some embodiments, the rare codon is AGA. In some embodiments, the rare codon is AGG.

In some embodiments, the non-canonical amino acid is encoded by a four base codon. In some embodiments, the four base codon is AGGA.

In some embodiments, the non-canonical amino acid is encoded by a stop codon. In some embodiments, the stop codon comprises an in-frame amber codon. In some embodiments, the stop codon comprises an in-frame ochre codon. In some embodiments, the stop codon comprises an in-frame opal codon.

The non-canonical amino acids and cysteines of the present disclosure can be located at various positions in the cyclic peptide or phage capsid protein assembly region. For example, in some embodiments, the non-canonical amino acid is at one end of the combined region or cyclic peptide and the cysteine is at the other end of the combined region or cyclic peptide.

The non-canonical amino acid and cysteine can be separated from each other in a variety of ways. For example, in some embodiments, the non-canonical amino acid and cysteine are separated by at least 4 amino acids. In some embodiments, the non-canonical amino acid and cysteine are separated by about 4-10 amino acids. In some embodiments, the non-canonical amino acid and cysteine are separated by about 4-6 amino acids. In some embodiments, the non-canonical amino acid and the cysteine are separated by about 10 amino acids.

The non-canonical amino acids and cysteines of the present disclosure can be coupled to each other in a variety of ways to form cyclic peptides. For example, in some embodiments, a cysteine and a non-canonical amino acid are coupled to each other via a michael addition reaction between the electrophilic regions of the cysteine and the non-canonical amino acid (e.g., the coupling reaction shown in fig. 1D). In some embodiments, the cysteine and the non-canonical amino acid are coupled to each other by a nucleophilic substitution reaction between the electrophilic regions of the cysteine and the non-canonical amino acid. In some embodiments, the cysteine and the non-canonical amino acid are coupled to each other by a covalent bond. In some embodiments, the cysteine and the non-canonical amino acid are coupled to each other by a bond that excludes disulfide bonds.

Cyclic peptide targets

The cyclic peptides of the present disclosure can bind to and be selected against a variety of desired targets. For example, in some embodiments, the desired target includes, but is not limited to, a peptide, a protein, an enzyme, a small molecule, a cellular receptor, an antigen, a ligand binding site of the desired target, an active site of a protein, an allosteric site of a protein, DNA, RNA, and combinations thereof.

In some embodiments, the desired target is an enzyme. In some embodiments, the cyclic peptides of the present disclosure inhibit the activity of an enzyme. In some embodiments, the enzyme includes, but is not limited to, proteases, histone deacetylases, and combinations thereof. In some embodiments, the enzyme is TEV protease. In some embodiments, the enzyme is HDAC 8.

In some embodiments, the cyclic peptide is an inhibitor of TEV protease. In some embodiments, cyclic peptide inhibitors of TEV protease include, but are not limited to, CWDDYLIX (CycTev1) (SEQ ID NO:1), CQWFSHRX (CycTev2) (SEQ ID NO:2), or a combination thereof, wherein X is a non-canonical amino acid coupled to a cysteine.

In some embodiments, the cyclic peptide is an inhibitor of HDAC 8. In some embodiments, the inhibitor cyclic peptide of HDAC8 is CQSLWMNX (CycH8a) (SEQ ID NO:3), wherein X is a non-classical amino acid coupled to a cysteine.

In some embodiments, the cyclic peptides of the present disclosure bind to a desired target with high affinity. For example, in some embodiments, the cyclic peptides of the present disclosure bind to a desired target with significantly higher affinity than their linear counterparts. In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dValue of K to its linear counterpart_dThe value is at least two times lower. In some embodiments, the cyclic peptide of the present disclosure binds to a peptide of interestK of the desired target_dValue of K to its linear counterpart_dThe value is at least 5 times lower. In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dValue of K to its linear counterpart_dThe value is at least 6 times lower. In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dValue of K to its linear counterpart_dThe value is at least 10 times lower.

In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dThe value is 10 μm or less. In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dThe value is 5 μm or less. In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dThe value is 1 μm or less. In some embodiments, the cyclic peptides of the present disclosure bind K of a desired target_dThe value is 500nm or less.

Applications and advantages

In some embodiments, the cyclic peptides formed by the methods of the present disclosure have increased affinity for a desired target. For example, in some embodiments, the cyclic peptides of the present disclosure bind to their protein targets with six-fold greater affinity than their linear counterparts.

Furthermore, applicants envision that the methods of the present disclosure will find broad application in many areas, such as drug discovery. For example, in some embodiments, the methods of the present disclosure can be used to select effective ligands for a number of therapeutic targets (e.g., surface receptors and enzymes).

In addition, the method of the present disclosure provides an automated process that avoids the chemical treatments used in conventional methods. Furthermore, in some embodiments, the phage particles of the present disclosure have higher activity compared to traditional methods.

Reference will now be made to more specific embodiments of the disclosure and experimental data that provide support for such embodiments. Applicants note, however, that the following disclosure is for illustrative purposes only and is not intended to limit the scope of the claimed subject matter in any way.

Example 1 genetically encoded, phage displayCyclic peptide libraries

In this example, the applicant describes a novel phage display technique in which the peptide it displays is the N encoded by the codons cysteine and amber^ε-cyclizing by a proximity-driven michael addition reaction between acryloyl-lysine (AcrK). Using a random 6-mer library in which the peptides are cyclized at both ends by cysteine-AcrK linkers, applicants demonstrated successful selection of a potent ligand for TEV protease and HDAC 8. All selected cyclic peptide ligands had 6-fold greater affinity for their protein targets than their linear counterparts.

More specifically, applicants envisioned that electrophilic non-classical amino acids (ncAA) and cysteines could be genetically loaded in a proximal relationship within phage display peptides for peptide cyclization (fig. 1D). Inclusion of ncAA into phage can be achieved by suppressing the amber mutation of the phage-displayed peptide coding region in E.coli cells containing an aminoacyl-tRNA synthetase-amber suppressor tRNA pair specific for ncAA and grown in the presence of ncAA (FIG. 1E). Phage display libraries constructed using this novel approach will provide genetically encoded phage displayed cyclic peptide libraries whose spontaneous peptide cyclization requires neither the use of phage strains without surface cysteines nor organic linkers for cyclization.

Pyrrolysine (Pyl) is the naturally occurring amino acid of the 22 nd protein, genetically encoded by the amber codon. Its incorporation is mediated by pyrrolysinyl-tRNA synthetase (PylRS) and tRNAcyl CUA. Over the past decade, many research teams have evolved PylRS as a protein for the genetic incorporation of more than 100 ncaas (including lysine and phenylalanine derivatives) into e. One of these ncAA is N^ε-acryloyl-lysine (AcrK), michael acceptor.

Applicants previously demonstrated that AcrK reacts slowly with thiols under physiological conditions (second order rate constant of 0.004M)^- ¹s^-1) However, evolved PylRS mutants (PrKRS) andstably incorporated into proteins in E.coli. The slow reaction between AcrK and cysteine is desirable because it avoids non-specific reactions with conventional protein cysteines, but allows for rapid coupling when AcrK and cysteine are positioned in close proximity in the peptide.

The peptide was predicted to cyclize automatically by mounting cysteines and acrks at both ends of the phage display peptide (fig. 3A). There are also advantages to the action of AcrK. Its acrylamide moiety selectively undergoes a Huisgen 1, 3-cycloaddition reaction with a non-fluorescent diphenylnitrilimine moiety to form a strongly blue fluorescent end product. Using HZC1 (figure 3B) that undergoes rapid dehydrochlorination in water to release diphenylnitriles, proteins or phages with intact acrks can be easily labeled and visualized.

However, a proximity-driven michael addition reaction between AcrK and cysteine in the peptide will annihilate the acrylamide moiety, resulting in a cyclic peptide that cannot be labeled by HZC 1. To demonstrate proximity-driven cyclization between genetically incorporated AcrK and adjacent cysteines in proteins, applicants expressed N-terminal CA₅Superfolder green fluorescent protein (sfGFP) of peptide X (X represents AcrK and is encoded by the amber codon). For the expression of this protein, the applicant transformed E.coli BL21(DE3) cells with two plasmids. One is previously described as containing PrKRS andpEVOL-PrKRS plasmid of a gene, the other comprising a plasmid encoding CA₅pETduet plasmid for the gene for the X-sfGFP protein. Growing transformed cells in the presence of AcrK provides CA₅X-sfGFP. Labeling of the protein with HZC1 resulted in the absence of a blue fluorescent product.

However, the Applicant has expressed similarities to CA₅Having an N-terminal A of X-sfGFP₆Control sfGFP protein of peptide X and reaction with HZC1 provided a strong blue fluorescent protein band in SDS-PAGE gels (fig. 3C). In parallel, applicants generated two phages, one with CA₅X peptide, anotherThe capsid protein pIII has an A at the N-terminal end₆And (3) an X peptide. To construct CA₅Phage X, applicants inserted the coding CA sequence between the PelB leader coding region in the pADLg3 phagemid vector and the phage pIII (gIII) coding gene₅X, vectors purchased by the Applicant from Antibody Design laboratories (Antibody Design Labs).

Applicants used the phagemid pADLg3-CA provided₅X transformation of Escherichia coli Top10 cells, the cells also carrying plasmid pEVOL-PrKRS-ClODF and mutant helper phage plasmid M13K07-g3 TAA. pEVOL-PrKRS-ClODF is derived from pEVOL-PrKRS by converting the origin of replication from p15a to ClODF for use with a helper phage plasmid whose origin of replication is typically p15 a. Applicants constructed M13K07-g3TAA by introducing a deleterious ochre mutation at the Q350 coding site in the gIII gene of M13K07 helper phage. Since M13K07-g3TAA has a non-functional gIII gene, it is homologous to PADLg3-CA₅The co-use of X drives the synthesis of phages containing pIII expressed only from the latter plasmid. Growing transformed cells in the presence of AcrK provides CA₅And (4) X phage.

Applicants produced control A using a similar method₆And (4) X phage. After their separation, the applicant marked both phages with HZC 1. Under UV light, A₆X phage display ratio CA₅Much higher fluorescence of X phage, indicated at CA₅Cyclization between cysteine and AcrK in phage X (fig. 3D). CA₅The relatively high background of X phage is due to diffraction of phage from solid pellets.

These results indicate that the use of AcrK and adjacent cysteines can efficiently generate cyclic peptides on protein and phage surfaces. With the encouragement of in vitro labeling results, applicants have advanced the construction of phage-displayed 6-poly cyclic peptide libraries. To provide a phagemid library for the production of phage displaying cyclic peptides, applicants inserted a 24 base pair DNA fragment encoding 6 randomized amino acids flanking an N-terminal cysteine and a C-terminal AcrK between the PelB leader coding region of the pADLg3 phagemid and the gIII gene (FIG. 4A). 20 clones from this library were sequenced to confirm library diversity (FIG. 5).

Applicants used this phagemid library to transform E.coli Top10 cells that also contained pEVOL-PrKRS-CloDF and M13K07-g3TAA to provide approximately 10⁹Individual transformants, and the transformed cells are then cultured in the presence of AcrK to produce phage. To demonstrate the feasibility of using this library to select cyclic peptide ligands for protein targets, applicants first tested on model proteins, and applicants coupled TEV protease with biotin for loading onto streptavidin magnetic beads for selection.

Applicants performed three rounds of affinity-based selection. The eluted phages were clearly enriched after each round (fig. 6). After the third round, the applicants sequenced 25 phage clones that only pooled to three peptide sequences, CycTev1, CycTev2, and CycTev3 (fig. 7). Using solid phase peptide synthesis, applicants synthesized 5-FAM-conjugated cycttev 1, cycttev 2, and their linear counterparts, and then measured their binding affinity to TEV protease using fluorescence polarization analysis. Applicants' results are shown in fig. 4B-E and table 1, indicating that CycTev1 and CycTev2 both bind to TEV protease with a dissociation constant of single digit μ M, and that both cyclic peptides bind to TEV protease significantly better (> 6-fold) than their linear counterparts.

[a] X represents AcrK.

TABLE 1 determination of K binding of selected cyclic peptides and their linear counterparts to their protein targets_dAnd IC₅₀The value is obtained.

These results establish the feasibility of using applicants' genetically encoded phage-displayed cyclic peptide libraries to identify potent ligands for protein targets and demonstrate that cyclization facilitates binding.

HDAC8 is Zn²⁺Dependent histone deacetylases have been identified as therapeutic targets for a variety of diseases, including cancer, X-linked intellectual impairment and parasitic infections. To identify the effectivenessMany efforts have been made to inhibit HDAC 8. To identify novel cyclic peptide ligands for HDAC8, applicants performed a similar selection as the TEV protease from their genetically encoded phage-displayed 6-polycyclic peptide library. Among the selected clones subsequently sequenced by the applicant, most of them were pooled in a single sequence, CycH8a (table 1 and fig. 8).

To determine the affinity of CycH8a for HDAC8, applicants synthesized 5-FAM-conjugated CycH8a (fig. 9A) and then characterized its binding to HDAC8 using fluorescence polarization analysis. The results showed a dissociation constant of 7.1. mu.M (FIG. 9B).

Applicants also synthesized 5-FAM-conjugated LinH8a (a linear counterpart of CycH8a) and tested its binding to HDAC 8. However, LinH8a bound very weakly to HDAC 8. Since HDAC8 aggregated at concentrations above 100 μ M, applicants were unable to collect sufficient data to accurately determine the K of LinH8a_dAlthough it is estimated to be higher than 50 μ M. Thus, cyclization is expected to provide high potency for CycH8a binding to HDAC 8.

For a ligand to be selected from a library by direct binding to a protein target, it is not necessarily capable of binding to the active site of the protein for direct inhibition. To test whether CycH8a directly inhibited the deacetylation activity of HDAC8, applicants employed HDAC8 activity assay as shown in fig. 9C and synthesized the substrate Boc-AcK-AMC. In this experiment, HDAC8 catalyzed the deacetylation of Boc-AcK-AMC to give Boc-K-AMC, which reacted with the coupling enzyme trypsin released fluorescent AMC, a compound that applicants could easily follow in a fluorescent plate reader. As shown in FIG. 9D, provision of CycH8a to the assay inhibited deacetylation of Boc-AcK-AMC by HDAC 8. IC determined under 5 μ M HDAC8 and 50 μ M Boc-AcK-AMC conditions₅₀The value was 9.7. mu.M, close to the measured K_dThe value is obtained. In view of the IC₅₀Is not a direct indicator of binding affinity and is influenced by the co-ordination of the substrates used, which is slightly higher than K_dThe value of (a) is expected.

In summary, the results in fig. 9 demonstrate the successful application of using applicants' genetically encoded phage-displayed cyclic peptide libraries for identifying potent cyclic peptide inhibitors for therapeutic protein targets.

To further understand how CycH8a interacts with HDAC8, applicants virtually docked CysH8a with HDAC 8.HDAC8 occurs naturally as a dimer. Thus, the applicants have investigated monomeric and dimeric HDAC8 as a receptor for docking. Docking results indicated that CycH8a bound weakly to monomeric HDAC8, but matched well in both grooves at the dimeric interface of HDAC8 and adjacent to both active sites (fig. 10). Some published crystal structures of HDAC 8-substrate complexes show that the two dimeric interfacial grooves are also part of the pathway for binding peptide substrates.

Binding of CycH8a at the two channels would prevent the peptide substrate from entering the two active sites, providing an explanation for CycH8a to inhibit HDAC 8. Whereas docking suggests that CycH8a binds near the active site channel of HDAC8, whereas many potent small molecule HDAC8 inhibitors, including some hydroxamic acid (hydroxamate) derivatives, bind directly within the active site channel, one possibility for developing more potent HDAC8 inhibitors is to couple the active site targeted inhibitor to CycH8a, forming a tightly bound bidentate ligand (bidentate ligand).

In summary, applicants have developed novel phage display technologies that allow the construction of genetically encoded phage display cyclic peptide libraries. Cyclization of the phage-displayed peptide is achieved by a proximity-driven michael addition reaction between cysteine and AcrK flanked by randomized 6-polypeptide sequences. AcrK is encoded by the amber codon, its inclusion in phage is evolved by E.coliIs mediated. Application of the developed library to selection against TEV protease and HDAC8, the resulting cyclic peptide ligands bind to their protein targets, K_dThe values are single digit μ M, significantly better than their linear counterparts.

As a proof of concept, this example relates to a smaller peptide, only 6 residues randomized. It is expected that libraries with more randomized peptides will provide for the selection of more potent ligands. Whereas many electrophilic ncaas have been incorporated into proteins using amber suppression mutagenesis methods, they are all likely to be used to construct genetically encoded phage display cyclic peptide libraries. Since these ncaas are structurally diverse, their use will confer different structural constraints on phage-displayed cyclic peptides, which will provide different structural diversity for selection. As a novel complement to phage display technology, applicants expect that the developed technology will find wide application in identifying potent ligands and enzymes for many surface receptors and potent inhibitors of protein-protein/DNA/RNA binding interactions.

Example 1.1 Synthesis of AcrK

The synthesis of AcrK is shown in scheme 1.

Scheme 1. synthetic route to AcrK.

To a solution of N-hydroxysuccinimide (1.3g,11.3mmol) in anhydrous dichloromethane (25mL), applicants added N, N-diisopropylethylamine (1.5mL,8.9mmol) followed by acryloyl chloride (0.8mL,9.3mmol) in an ice bath. The mixture was stirred at room temperature for 10 hours. The applicant extracted the mixture with ethyl acetate and saturated NH₄Cl solution and brine, and anhydrous MgSO₄And (5) drying. Applicants filtered the solution and evaporated under vacuum to give 2(1.5g) as a yellow oil. Applicants used 2 directly in the next synthesis without further purification.

To an aqueous solution (50mL) of copper (II) sulfate pentahydrate (1.0g,4.0mmol), applicants added lysine hydrochloride (1.5g,8.0mmol) and sodium bicarbonate (1.9g,22.4 mmol). The applicants stirred the mixture at room temperature for 20 minutes. To this mixture, applicants added compound 2 in acetone (20 mL). The Applicant stirred the reaction mixture obtained for a further 8 hours. The applicant filtered the blue mixture, washed the blue filter cake with water and acetone, dissolved in water and chloroform (v/v ═ 1:1,100mL), and the resulting solution was stirred at room temperature for 5 minutes.

Then, the applicants added 8-hydroxyquinoline (1.6g,11.0mmol) to the suspension, which was then allowed to stir at room temperature for 30 minutes. The applicants filtered the green suspension and washed the filtrate with chloroform, concentrated under reduced pressure, then further purified by ion exchange chromatography to give AcrK (1.2g, two steps 60%) as a white powder.

1H NMR(D₂O,300MHz)δ6.2-5.43(m,2H),5.59(dd,1H,J＝11.4,1.8Hz),3.58(t,1H,J＝6Hz,),3.13(t,2H,J＝6.9Hz),1.71(m,2H),1.46(m,2H),1.24(m,2H).13C NMR(75MHz,D2O)δ175.4,169.1,130.6,127.7,55.3,39.6,30.7,28.6,22.4.

₅ ₆Example 1.2 CAX-sfGFP and AX-sfGFP expression and their labelling with HCZ1

CA₅The DNA sequence of X-sfGFP is as follows:

atgtgtgctgcagcggctgcatagaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtccgtggagagggtgaaggtgatgctacaaacggaaaactcacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtcactactctgacctatggtgttcaatgcttttcccgttatccggatcacatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggacctacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaagggtattgattttaaagaagatggaaacattcttggacacaaactcgagtacaactttaactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacgttgaagatggttccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgtcctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaaggatcccatcaccatcaccatcactaa (SEQ ID NO: 7.) underlined nucleotides encode CA₅X。

A₆The DNA sequence of X-sfGFP is as follows:

atggctgctgcagcggctgcatagaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtccgtggagagggtgaaggtgatgctacaaacggaaaactcacccttaaatttatttgcactactggaaaactacctgttccgtggccaacacttgtcactactctgacctatggtgttcaatgcttttcccgttatccggatcacatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggacctacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaagggtattgattttaaagaagatggaaacattcttggacacaaactcgagtacaactttaactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacgttgaagatggttccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgtcctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaaggatcccatcaccatcaccatcactaa (SEQ ID NO: 8.) underlined nucleotide code A₆X。

₅ ₆Example 1.3 construction of pETduet-CAX-sfGFP and pETduet-AX-sfGFP

The applicant used the previously constructed plasmid pETtrio-PylRS-sfGFP-TAA (Ala)₅TAG-PylT as template. Applicants used PCR with two primers to amplify a CA with an N-terminus₅sfGFP for peptide X: (1) CA₅X-F:5’-GAGATATACC ATGTGTGCTG CAGCGGCTGC-3' (SEQ ID NO: 9); and (2) CA₅X-R:5’-GCAGCCGCTG CAGCACACAT GGTATATCTC-3' (SEQ ID NO: 10). Next, the applicant digested the PCR product with AflIII and KpnI restriction enzymes. Applicants cloned the digested product into AflIII and KpnI sites in the empty petDuet-1 vector to yield pETduet-CA₅X-sfGFP. Applicant follows the same protocol for the construction of pETduet-A₆X-sfGFP, using two primers: (1) CA₅5'-GAGATATACC ATGGCTGCTG CAGCGGCTGC-3' (SEQ ID NO: 11); and (2) CA₅X-R:5’-GCAGCCGCTG CAGCAGCCAT GGTATATCTC-3’(SEQ ID NO:12)。

Example 1.4 protein expression and purification

To express CA₅X-sfGFP, applicants used previously reported plasmids pEVOL-PrKRS and pETduet-CA₅X-sfGFP transformed BL21(DE3) cells and the transformed cells were plated on LB-agar plates containing ampicillin (100. mu.g/mL) and chloramphenicol (34. mu.g/mL). Applicants picked a single clone and inoculated into 5mL LB medium supplemented with 100. mu.g/mL ampicillin and 34. mu.g/mL chloramphenicol. Applicants inoculated 100mL LB medium with this overnight culture and incubated the shaker (250 rp) at 37 deg.Cm) allowing it to grow. When OD is reached₆₀₀When 0.8 is reached, applicants add 1mM AcrK, 1mM IPTG and 0.2% arabinose to induce protein expression. After 8 hours of induction, applicants collected cells by centrifuging the cell culture medium at 4000g for 15 minutes, and then resuspended the cells in lysis buffer (50mM NaH)₂PO₄250mM NaCl,10mM imidazole, pH 8.0), which applicants sonicated 6 times in an ice bath (2 minutes per pulse, 5 minute intervals for cooling). Applicants clarified the cell lysate by centrifugation at 1000g for 60 minutes (4 ℃), collected the supernatant, and incubated with 1mL of Ni-NTA resin (Qiagen) (1.5h,4 ℃). Applicants used a composition containing 50mM NaH₂PO₄250mM NaCl and 10mM imidazole in 50mL of wash buffer (pH 8.0) and then with 50mM NaH₂PO₄Elution buffer of 250mM NaCl and 250mM imidazole (pH 8.0) elute CA₅X-sfGFP. Applicants concentrated the purified protein and dialyzed it against a buffer containing 10mM ammonium bicarbonate.

The final purified protein was analyzed by 15% SDS-PAGE and stored at-80 deg.C (FIG. 11). Except that the Applicant introduced the plasmid pETduet-CA₅The X-sfGFP was replaced by the plasmid pETduet-A₆Outside of X-sfGFP, A₆Expression and purification of X-sfGFP followed exactly the same protocol.

₅ ₆Example 1.5 labeling of CAX-sfGFP and AX-sfGFP with HCZ1

Applicants have synthesized HCZ1 from previous disclosures. To mark CA₅X-sfGFP and A₆X-sfGFP, applicants added HZC1(5mM, 15. mu.L) to CA₅X-sfGFP and A₆X-sfGFP (5. mu.M, 500. mu.L) in two different solutions in 1:1 acetonitrile-50 mM phosphate buffer (pH 10 chloride-free), the mixture was incubated for 10 minutes and the reaction was then quenched by the addition of 500mM acrylamide. Applicants purified the labeled protein using Ni-NTA resin (5. mu.L), spun down the protein-bound resin (10 min, 13.4K), and then washed it 4 times with water. The protein was boiled in 6 Xprotein loading buffer (375mM Tris-HCl, 10% SDS, 30% glycerol, 0.03% bromophenol blue, 600mM DTT)After resin, filtration to remove precipitates, applicants eluted the bound proteins and performed 15% SDS-PAGE analysis of them. Applicants performed fluorescence detection in gels using a berle (BioRad) ChemiDoc XRS + imaging system, and then applied to stain gels with coomassie blue.

₅ ₆Example 1.6 expression of pADLg3-CAX and pADLg3-AX phages and their labeling with HCZ1

The applicants derived the M13K07-g3TAA helper phage plasmid from M13K07 by performing Quik-Change mutagenesis. Applicants used two primers: (1) M13K07g3TAA-F: 5'-gttgaaagtt gtttagcaTa accccataca gaaaattc-3' (SEQ ID NO: 13); and (2) M13K07TAA-R: 5'-gaattttctg tatggggttA tgctaaacaa ctttcaac-3' (SEQ ID NO: 14).

The Applicant followed the Pfu-catalyzed standard Quik-Change protocol to introduce a single TAA mutation into the K10 coding site of the gIII gene.

Applicants performed two experiments to verify M13KO7-g3TAA as a helper phage for multivalent display. To confirm the phenotypic knockout of pIII, the applicants expressed helper phage in E.coli Top 10F' containing 25. mu.g.mL^-1Kanamycin in 2XYT at 37 ℃ overnight. The next day, cells were pelleted and the supernatant was incubated at 65 ℃ for 15 minutes to kill the remaining bacteria. The supernatant (10. mu.L) of the heat-killed (heat-killed) was then spotted in a medium containing 10. mu.g.mL^-1On Top agar of tetracycline on Top agar on the Escherichia coli Top 10F' covering, and at 37 degrees C were incubated overnight. As positive controls, applicants expressed and spotted wild-type M13KO7 and CM13 phage (antibody design laboratory). After overnight incubation, the inoculated spots corresponding to wild-type M13KO7 and CM13 exhibited zones of delayed cell growth, indicating the presence of viable phage. In contrast, no delayed growth was observed in the inoculated spots corresponding to M13KO7-g3TAA, confirming the loss of pIII functionality required for host infection (FIG. 12).

Next, the applicants demonstrated the ability of M13KO7-g3TAA to complement pIII-loaded phagemids and produce active phage. For this purpose, the Applicant used M13KO7 (pIII)^–) And two kinds of phageOne of the bacterium grains: coli Top 10F' was co-transformed with pADL-10b (antibody design laboratories) or pADL-g3 TAG. pADL-10b contains the gene encoding wild type pIII, while pADL-G3TAG contains the wild type pIII with an in-frame amber mutation at the coding site of G1 following the pelB coding sequence. The transformed cells contained 100. mu.g/mL^-1Ampicillin and 25. mu.g.mL^-1Kanamycin 2XYT Medium growth to OD₆₀₀At 0.8, IPTG was added at this point to induce pIII expression. After overnight incubation, the supernatants were collected and heat killed (as described above) and 10 μ Ι _ of the heat killed supernatant was used to infect 90 μ Ι _ of log phase e.coli Top 10F' for 45 minutes. Infected cultures were plated in a medium containing 100. mu.g.mL^-1Ampicillin was selected on agar plates and grown overnight at 37 ℃. Cells infected with the supernatant from pADL-g3TAG did not grow because both the phagemid and the helper phage contained pIII nonsense mutations. However, cells infected with the supernatant from pADL-10b showed dense cell growth, confirming the ability of M13KO7-g3TAA to replenish pIII-loaded phagemids and produce functional phagemid particles (FIG. 13).

To substitute Cys-Ala₅AcrK sequence was introduced into phage, the previously constructed plasmid pADL-NcoI-g3-AAKAA (modified from pADL-10 b) was amplified by Phusion Hi-Fi DNA polymerase PCR, using the 5' -end primer, pADL-NcoI-Cys-Ala₅TAG-g 3-F5'-GCTTCCATGG CCTGCGCAGC AGCAGCAGCA TAGGCGGCGA AAGCGG-3' (SEQ ID NO:15) and 3' -end primer, pADL-NcoI-Cys-Ala₅-TAG-R: 5'-GCTTCCATGG CCGGCTGGGC CGC-3' (SEQ ID NO: 16). The PCR product was digested with DpnI and NcoI, then ligated with T4 DNA ligase, and then used to transform E.coli Top 10. pADLg3-A was constructed similarly as described above₆X, with 5' -end primer, pADL-NcoI-Ala₆TAG-g 3-F5'-GCTTCCATGG CCGCAGCAGC AGCAGCAGCA TAGGCGGCGA AAGCGG-3' (SEQ ID NO:17) and the 3' -end primer, pADL-NcoI-Ala₆-TAG-R:5’-GCTTCCATGG CCGGCTGGGC CGC-3’(SEQ ID NO:18)。

Applicants derived plasmid pEVOL-PrKRS-CloDF from pEVOL-PrKRS. The original from pEVOL-PrKRS, which had a p15a origin of replication, was incompatible with the use of pADLg3 in the same cellular host. To is coming toThe p15a replication origin was exchanged for the CloDF replication origin and the Applicant used two primers, ColDF-F: 5'-ttggcgcgcc caaatagcta gctcactcgg tc-3' (SEQ ID NO:19), and ColDF-R: 5'-tgttcctagg gataaattgc actgaaatct ag-3' (SEQ ID NO:20), to amplify pCDFDuet from Novagen^TMThe CloDF gene of plasmid 1, two additional primers pEVOL-F: 5'-tgttcctagg tcttcaaatg tagcacctga ag-3' (SEQ ID NO:21), and pEVOL-R: 5'-ttggcgcgcc ccttttttct cctgccacat g-3' (SEQ ID NO:22) to amplify the pEVOL-PrKRS backbone structure without the p15a region.

The applicant digested the two PCR products with restriction enzymes AscI and AvrII, purified the digests, and then ligated together using T4 DNA ligase. The applicant transformed E.coli Top10 cells with the ligation product and then confirmed the resulting plasmid by sequencing the entire plasmid.

pADLg3-CA₅X and pADLg3-A₆X was electroporated into E.coli Top10 competent cells, containing M13KO7-g3TAA and pEVOL-PrKRS-ColDF. The cells were then inoculated into 100mL of 2YT medium containing ampicillin, chloramphenicol and kanamycin, and at OD₆₀₀When 0.5 was reached, pIII expression was induced by the addition of 0.2% arabinose, 1mM IPTG and 5mM AcrK. After 12 hours of induction, the culture was collected, clarified by centrifugation, and the supernatant was collected. Then, a frozen polyethylene glycol solution was added to the supernatant to precipitate phages. The mixture was then centrifuged (30 min, 10,000g,4 ℃), and the phage pellet resuspended in PBS buffer and centrifuged again. The supernatant was then collected and heated to 65 ℃ for 15 minutes to kill all remaining cells.

To label pADLg3-CA with HCZ1₅X and pADLg3-A₆X phage, 90uL of CA₅X and A₆The X phage solution was added to 90uL of acetonitrile, regardless of the presence or absence of 20uM HZC 1. The mixture was incubated for 2 hours, then a polyethylene glycol solution was added and centrifuged (30 minutes, 10,000g,4 ℃) to obtain a phage pellet. These precipitates were recorded by the ChemiDOC imaging system using the default EtBr protocol.

Example 1.7 expression of TEV protease

The applicants transformed BL21(DE3) cells with pTEV plasmid containing the gene encoding the N-terminally His-tagged TEV protease. The applicant picked single clones and cultured them in 5mL of LB medium at 37 ℃. The applicant inoculated 500mL of 2XYT medium supplemented with ampicillin (100. mu.g/mL) with this overnight culture and cultured the cells in an incubation shaker (250rpm) at 37 ℃. When OD is reached₆₀₀When 0.4-0.6 was reached, applicants added 0.8mM IPTG to induce expression of TEV protease. After 4 hours of induction, applicants harvested the cells by centrifugation at 4000g for 15 minutes and resuspended the pelleted cells in lysis buffer (50mM NaH)₂PO₄250mM NaCl,10mM imidazole, pH 8.0). Applicants sonicated the resuspended cells 6 times in an ice bath (2 minutes per pulse, 5 minute intervals for cooling) and clarified the cell lysate by centrifugation at 1000g for 60 minutes (4 ℃). Applicants collected the supernatant and incubated with 1mL of Ni-NTA resin (1.5h,4 ℃). Applicants used a composition containing 50mM NaH₂PO₄250mM NaCl and 10mM imidazole in 50mL of wash buffer (pH 8.0) and then with 50mM NaH₂PO₄Elution buffer (pH 8.0) with 250mM NaCl and 250mM imidazole. Applicants concentrated the eluted protein and dialyzed it against a buffer containing 10mM ammonium bicarbonate. Applicants analyzed proteins by 15% SDS-PAGE (FIG. 14) and stored at-80 ℃.

Example 1.8 expression of HDAC8

Applicants transformed BL21(DE3) CodonPlus cells with pHD4-HDAC8-TEV-His6 and picked single clones and grown overnight in 5mL 2XYT medium supplemented with ampicillin (Amp) (100. mu.g/mL). Applicants inoculated this overnight culture into 500mL of auto-induced TB medium (24g/L yeast extract, 12g/L tryptone, 8g/L tris, 4g/L lactose, 1g/L glycerol, pH7.5) supplemented with 100. mu.g/mL ampicillin and 200. mu.M ZnSO₄. Applicants cultured cells in an incubation shaker (250rpm) at 37 ℃. After 20 hours of induction, applicants harvested the cells by centrifugation at 4000g for 15 minutes and resuspended the collected cells in lysis buffer (50mM NaH)₂PO₄250mM NaCl,10mM imidazolepH 8.0). Applicants sonicated the resuspended cells 6 times in an ice bath (3 minutes per pulse, 6 minute intervals for cooling) and clarified the cell lysate by centrifugation at 1000g for 60 minutes (4 ℃). Applicants collected the supernatant by decantation and incubated with 1mL of Ni-NTA resin (1.5h,4 ℃). Applicants used a composition containing 50mM NaH₂PO₄250mM NaCl and 10mM imidazole in 50mL of wash buffer (pH 8.0) and then with 50mM NaH₂PO₄The protein was eluted with an elution buffer (pH 8.0) of 250mM NaCl and 250mM imidazole. Applicants combined the eluted fractions, concentrated, and then allowed it to further purify by Q Sepharose FPLC chromatography (GE Healthcare). Applicants aimed at dialysis buffer (25mM Tris-HCl,300mM NaCl, 200. mu.M ZnSO)₄5 μ M KCl, pH7.5), analyzed by 15% SDS-PAGE (FIG. 15), and the protein was stored as a5 μ M aliquot at-80 ℃.

Example 1.9 construction of phagemid libraries with randomized 6 coding sites and their use as phage articles Expression of the library

pADLg3-TGC-(NNK)₆The DNA sequence of the TAG phagemid library is as follows:

gcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcgcttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgacccgacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggacatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcggtacccgataaaagcggcttcctgacaggaggccgttttgttttgcagcccacctcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgaatttctagataacgagggcaaatcatgaaatacctattgcctacggcggccgctggattgttattactcgcggcccagccggccatggcctgcnnkn nknnknnknnknnktagggcccgggaggccaaggcggtggttctgagggtggtggctccctcgagggcgcgccagccgaaactgttgaaagttgtttagcaaaacctcatacagaaaattcatttactaacgtctggaaagacgacaaaactttagatcgttacgctaactatgagggctgtctgtggaatgctacaggcgttgtggtttgtactggtgacgaaactcagtgttacggtacatgggttcctattgggcttgctatccctgaaaatgagggtggtggctctgagggtggcggttctgagggtggcggttctgagggtggcggtactaaacctcctgagtacggtgatacacctattccgggctatacttatatcaaccctctcgacggcacttatccgcctggtactgagcaaaaccccgctaatcctaatccttctcttgaggagtctcagcctcttaatactttcatgtttcagaataataggttccgaaataggcagggtgcattaactgtttatacgggcactgttactcaaggcactgaccccgttaaaacttattaccagtacactcctgtatcatcaaaagccatgtatgacgcttactggaacggtaaattcagagactgcgctttccattctggctttaatgaggatccattcgtttgtgaatatcaaggccaatcgtctgacctgcctcaacctcctgtcaatgctggcggcggctctggtggtggttctggtggcggctctgagggtggcggctctgagggtggcggttctgagggtggcggctctgagggtggcggttccggtggcggctccggttccggtgattttgattatgaaaaaatggcaaacgctaataagggggctatgaccgaaaatgccgatgaaaacgcgctacagtctgacgctaaaggcaaacttgattctgtcgctactgattacggtgctgctatcgatggtttcattggtgacgtttccggccttgctaatggtaatggtgctactggtgattttgctggctctaattcccaaatggctcaagtcggtgacggtgataattcacctttaatgaataatttccgtcaatatttaccttctttgcctcagtcggttgaatgtcgcccttatgtctttggcgctggtaaaccatatgaattttctattgattgtgacaaaataaacttattccgtggtgtctttgcgtttcttttatatgttgccacctttatgtatgtattttcgacgtttgctaacatactgcgtaataaggagtcttaatcaagctttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcaggtg(SEQ ID NO:23)。

the sites of the mutations are underlined in bold. n represents any one of a, g, c and t, and k represents g or t.

Applicants constructed phagemid libraries by performing PCR to directly amplify the pADL-10b plasmid using two primers, pADL-F:5'-GGTCCGTCCA TGGCCTGCNN KNNKNNKNNK NNKNNKTAGG GCCCGGG-3' (SEQ ID NO:24), and pADL-R:5'-CCACGGCCAT GGCCGGCTG GGCCGCG-3' (SEQ ID NO: 25). The applicant digested the PCR product with NcoI restriction enzyme and ligated the digested product with T4 DNA ligase. DpnI was also used to remove template phagemids. Then, the applicant electroporated the ligated plasmid into competent E.coli Top10 cells, incubated the transformant in 1mL of LB medium, and then inoculated it into 50mL of LB medium containing 100. mu.g/mL of ampicillin. At OD₆₀₀After reaching 1.0, applicants collected 0.5mL of cell culture, mixed with 50% glycerol, and stored at-80 ℃. Several aliquots were made to achieve overall coverage of over 10¹¹cfu. To collect phagemids, applicants normalized the cell stock to ensure equal amounts of phagemids in each aliquot. Applicants isolated 20 clones from the library and sequenced their DNA. The sequencing data are shown in FIG. 5. Of these 20 clones, 16 contained the designed sequence, 2 were the original pADL-10b phagemid, and 2 were deleterious clone products that could be caused by synthetic errors of the DNA primers. In all 16 designed clones, all sites were randomized and not enriched for certain codons.

Example 1.10 expression of phages

Applicants electroporate the phagemid library constructed from the previous step into E.coli Top10 competent cells containing M13KO7-g3TAA and pEVOL-PrKRS-ColDF. Applicants inoculated transformed cells into 100mL 2YT medium, and in OD₆₀₀pIII expression in the phagemid was induced by addition of 0.2% arabinose, 0.5mM IPTG and 2mM AcrK up to 0.5. After 12 hours of induction, applicants spun down the cells by centrifugation and harvestAnd collecting the supernatant. Applicants then precipitated the phage-containing supernatant by adding frozen polyethylene glycol and then centrifuged the solution (15 min, 10,000g,4 ℃). The applicants collected phage particles and dissolved them in PBS buffer.

Applicants calculated the total amount of phage by: applicants incubated 10uL phage solution in a water bath at 65 ℃ for 15 minutes to kill all of the E.coli Top10 cells therein, and infected 90uL Top 10F' (OD)₆₀₀1.0), infected cells were serially diluted, and the diluted cells were plated on an agar plate containing 100 μ g/mL ampicillin to select infected cells. The total yield per 100mL LB medium was about 10¹⁰cfu, sufficient to cover library diversity (theoretical diversity of 20 for 6-mer libraries)⁶＝6.4x10⁶)。

Example 1.11 phage selection against TEV protease and HDAC8

Applicants used streptavidin magnetic beads for selection. To produce biotinylated proteins in aqueous solution, applicants used the biotin sulfosuccinimidyl ester kit (thermo fisher scientific) to couple TEV protease and HDAC 8. Applicants incubated 15. mu.M of purified target protein with 30. mu.M biotin sulfosuccinimidyl ester in 50mM phosphate buffer for 2 hours at room temperature. Applicants quenched the reaction with the addition of 10mM lysine and treated the solution with a protein purification kit from BioRAD. Applicants incubated the purified biotinylated protein with streptavidin magnetic beads (Pierce) in PBS buffer for 1 hour and washed unreacted protein.

In selection, to remove individuals capable of non-specific binding, applicants incubated the phage library with only streptavidin magnetic beads in each round of selection, collected unbound phage, and then allowed to bind to protein-bound streptavidin magnetic beads for 10 minutes. Applicant used Tween-20-containing PBS buffer (8mM Na)₂HPO₄,150mM NaCl,3mM KCl,2mM KH₂PO₄0.05% Tween-20, pH 7.4) and buffered with Glycine-HCl 10 timesBound phage were eluted in solution (pH 2.2) and the eluate was neutralized with Tris buffer (pH 9.1). The applicant infected Top 10F' cells with the eluted phage to calculate the amount of phage particles. To amplify the selected phage library, the applicant infected Top 10F' cells with the eluate and propagated the infected cells to amplify their loaded phagemids.

Applicants repeated cell transformation, phage expression and phage selection for three consecutive rounds. For better comparison, applicants also added phage bound to streptavidin magnetic bead background as a control in each round of selection. Applicants also characterized the number of phage clones eluted. As shown in FIG. 6, the number of eluted phages increased dramatically after each round, indicating enrichment of the preferred tightly bound clones.

For TEV protease and HDAC8, applicants isolated 25 clones selected to bind to them for DNA sequencing, the results of which are shown in FIGS. 7-8.

Example 1.12 Synthesis of selected peptides

Applicants synthesized all peptides from C-terminus to N-terminus using solid phase peptide synthesis as in FIG. 16. The resin is used to couple the amino acids one by one. Applicants used Fmoc protected nucleotides in the synthesis. Coupling of each amino acid of the N-deprotected resin-coupled peptide with an Fmoc-protected amino acid using an activated coupling reagent typically takes from about a few minutes to several hours. Applicants washed unreacted reagents and byproducts with DMF and dichloromethane. The final synthesized peptides were cleaved from the resin with 95% TFA, precipitated with cold ether, and further characterized by the applicant. To monitor the coupling process, the applicants used the Kaiser test.

To couple the first lysine to the resin, applicants added 200mg Rink amide MBHA resin (Novabiochem) in DMF and expanded in a polymer vessel (poly vessel) for 1 hour. Applicants then deprotected the Fmoc group of the resin by providing 20% (v/v) piperidine in DMF for 30 minutes, followed by washing the resin with DMF, Dichloromethane (DCM) and methanol. Applicants dissolved Fmoc-Lys (mtt) -OH (4 equiv.), tetramethyluronium hexafluorophosphate (HBTU, 4 equiv.), and diisopropylethylamine (DIEA, 10 equiv.) in DMF and added this solution to the reaction vessel under nitrogen and mixed with the resin. When the Kaiser-ninhydrin test becomes negative, the applicants believe that the coupling is complete.

To couple 5-carboxyfluorescein (5-FAM) to the first lysine, applicants removed the mtt protecting group of the first lysine by repeatedly washing the resin with 1% TFA and 5% Triisopropylsilane (TIS) in DCM (v/v). After deprotection, applicants added 5-FAM (2 equiv.) and DIEA (5 equiv.) to the resin in DMF and performed the coupling reaction until the Kaiser test became negative.

To couple the second lysine and the remaining amino acids to the resin, applicants deprotected the Fmoc group in the resin-coupled peptide by adding 20% piperidine in DMF for 30 minutes, followed by washing the resin with DMF, Dichloromethane (DCM) and methanol. Applicants dissolved the Fmoc-protected amino acid (4 equivalents), tetramethyluronium hexafluorophosphate (HBTU, 4 equivalents), and diisopropylethylamine (DIEA, 10 equivalents) in DMF (10mL), added this solution to the reaction vessel under nitrogen, and mixed with the resin. The applicants continued the reaction until the Kaiser-ninhydrin test became negative. For the last amino acid, applicants used Boc-Cys (trt) -OH. After the final coupling, there is no additional deprotection step.

To synthesize N-succinimide-acrylate, applicants added N, N-diisopropylethylamine (1.5mL,8.9mmol) to a solution of N-hydroxysuccinimide (1.3g,11.3mmol) in anhydrous dichloromethane (25 mL). Acryloyl chloride (0.8mL,9.3mmol) was then added dropwise in an ice bath. The Applicant stirred the mixture at room temperature for 10 hours. The applicant then extracted the mixture with ethyl acetate and saturated NH₄Cl solution and brine, and anhydrous MgSO₄And (5) drying. Applicants filtered the solution and evaporated under vacuum to give N-succinimide-acrylate as a yellow oil (1.5 g). The product was used in the next step without further purification.

To couple the N-succinimide-acrylate with the second lysine, applicants removed the mtt group after the cysteine coupling using 1% TFA and 5% Triisopropylsilane (TIS) in dichloromethane (v/v). The applicants then added N-succinimidyl acrylate (2 equiv.) and DIEA (5 equiv.) to the resin in DMF and coupled until the Kaiser test became negative.

To cleave the peptide from the resin, applicants incubated 200mg of the resin with 4mL of cleavage solution containing 92.5% TFA, 2.5% TIS, 2.5% water, and 2.5% 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) for 2-3 hours. The peptide product was then precipitated with 10 volumes of cold ether. Applicants collected the cleaved peptide by centrifugation, washed with cold ether, and purified by HPLC. The purified product was lyophilized and subjected to MALDI-TOF analysis (FIGS. 17-19).

To prepare the cyclic peptide, applicants dissolved the purified peptide in PBS buffer and incubated it for 4 hours at room temperature before subjecting it to HPLC chromatography. Applicants collected the eluted peptides and lyophilized them to give a white powder. NMR analysis indicated no peak of alkenyl hydrogens, confirming successful cyclization of the cysteine side chains in these peptides with the acryloyl moiety of AcrK.

Example 1.13 fluorescence polarization measurement

Applicants incubated 25nM 5-FAM conjugated cyclic peptide and different concentrations of target protein (160nM to 160. mu.M) in black 96-well plates in a total volume of 200. mu.L, the volume being adjusted by the addition of PBS buffer. Fluorescence polarization was measured in a microplate reader at Ex/Em ═ 490nm/520 nm.

₅₀Example 1.14 IC value measurement

For the synthesis of Boc-Kac-AMC, applicants dissolved Boc-Kac-OH (2.0mmol, 576.7mg) and 7-amino-4-methylcoumarin (2.0mmol,350.4mg) in ice-cold anhydrous THF (50mL), then pyridine (20.0mmol,1.6mL) was added dropwise to the solution, followed by phosphorus oxychloride (8.4mmol,0.8 mL). Applicants stirred the mixture in an ice-water bath for 3 hours and quenched the reaction by the addition of saturated sodium bicarbonate solution (50 mL). Applicants concentrated the mixture to 50mL under reduced pressure, extracted three times with 25mL of dichloromethane, then washed with 25mL of saturated NaCl solution and 0.5M HCl solution (4X50 mL). Applicants will merge twoMethyl chloride extract over anhydrous MgSO₄Dried, concentrated under reduced pressure, and dissolved in HCl/MeOH (1:4 v/v). Applicants stirred the solution at room temperature for 24 hours and concentrated under reduced pressure to give the desired product as a yellow powder (489.1mg, 55% over two steps).

Scheme 2 illustrates the above synthesis.

Scheme 2 Synthesis of Boc-Kac-AMC.

₅₀Example 1.15 IC measurement

Applicants added different concentrations (1 nM-1000. mu.M) of 5FAM-cycH8a and 5nM HDAC8 to a black 96-well plate (Piercs) and additionally provided PBS buffer to adjust the final volume of each well to 200. mu.L. The plates were incubated at 30 ℃ for 10 minutes. Next, applicants added 50. mu.M Boc-Kac-AMC to each well. After incubation for 1 hour at 30 degrees celsius, applicants provided trichostatin a (TSA,1 μ M) to stop HDAC catalyzed deacetylation, and then added trypsin (0.5mg/mL) to the reaction solution. After a further 1 hour incubation at 30 ℃, the applicants measured the fluorescence of coumarin in a microplate reader at Ex/Em ═ 360nm/460 nm. All measurements were repeated 3 times.

Example 1.16 molecular docking

The crystal structures of monomeric and dimeric forms of HDAC8 receptor (PDB code 5FCW) were made using Autodock tools. The ligand CycH8a was also prepared using the same procedure. The docking search box was chosen to encompass the entire protein structure. Docking was performed using Autodock vina and pose (position) was visualized using UCSF kernel for analysis.

Without further elaboration, it is believed that one skilled in the art can, using the description herein, utilize the present disclosure to its fullest extent. The embodiments described herein are to be understood as illustrative and not limiting the remainder of the disclosure in any way. Although embodiments have been shown and described, many variations and modifications may be made by one skilled in the art without departing from the spirit and teachings of the invention. Accordingly, the scope of protection is not limited by the description set out above, but is only limited by the claims, which include all equivalents of the subject matter of the claims. The disclosures of all patents, patent applications, and publications cited herein are hereby incorporated by reference, to the extent that they provide procedural or other details consistent with and supplement the teachings herein.

Sequence listing

<110> Texas A & M University System (The Texas A & M University System)

Liu, Wenshe

<120> genetically encoded phage-displayed cyclic peptide library and method for preparing the same

<130> 13260-P190WO

<160> 57

<170> PatentIn version 3.5

<210> 1

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> CycTev1

<220>

<221> MISC _ feature

<222> (8)..(8)

<223> X is a non-classical amino acid

<400> 1

Cys Trp Arg Asp Tyr Leu Ile Xaa

1 5

<210> 2

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> CycTev2

<220>

<221> MISC _ feature

<222> (8)..(8)

<223> X is a non-classical amino acid

<400> 2

Cys Gln Trp Phe Ser His Arg Xaa

1 5

<210> 3

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> CycH8a

<220>

<221> MISC _ feature

<222> (8)..(8)

<223> X is a non-classical amino group

<400> 3

Cys Gln Ser Leu Trp Met Asn Xaa

1 5

<210> 4

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> LinTev1

<400> 4

Cys Trp Arg Asp Tyr Leu Ile Lys

1 5

<210> 5

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> LinTev2

<400> 5

Cys Gln Trp Phe Ser His Arg Lys

1 5

<210> 6

<211> 8

<212> PRT

<213> Artificial sequence

<220>

<223> LinH8a

<400> 6

Cys Gln Ser Leu Trp Met Asn Lys

1 5

<210> 7

<211> 759

<212> DNA

<213> Artificial sequence

<220>

<223> CA5X-sfGFP

<400> 7

atgtgtgctg cagcggctgc atagaaagga gaagaacttt tcactggagt tgtcccaatt 60

cttgttgaat tagatggtga tgttaatggg cacaaatttt ctgtccgtgg agagggtgaa 120

ggtgatgcta caaacggaaa actcaccctt aaatttattt gcactactgg aaaactacct 180

gttccgtggc caacacttgt cactactctg acctatggtg ttcaatgctt ttcccgttat 240

ccggatcaca tgaaacggca tgactttttc aagagtgcca tgcccgaagg ttatgtacag 300

gaacgcacta tatctttcaa agatgacggg acctacaaga cgcgtgctga agtcaagttt 360

gaaggtgata cccttgttaa tcgtatcgag ttaaagggta ttgattttaa agaagatgga 420

aacattcttg gacacaaact cgagtacaac tttaactcac acaatgtata catcacggca 480

gacaaacaaa agaatggaat caaagctaac ttcaaaattc gccacaacgt tgaagatggt 540

tccgttcaac tagcagacca ttatcaacaa aatactccaa ttggcgatgg ccctgtcctt 600

ttaccagaca accattacct gtcgacacaa tctgtccttt cgaaagatcc caacgaaaag 660

cgtgaccaca tggtccttct tgagtttgta actgctgctg ggattacaca tggcatggat 720

gagctctaca aaggatccca tcaccatcac catcactaa 759

<210> 8

<211> 759

<212> DNA

<213> Artificial sequence

<220>

<223> A6X-sfGFP

<400> 8

atggctgctg cagcggctgc atagaaagga gaagaacttt tcactggagt tgtcccaatt 60