阅读说明：本技术 拮抗剂 (Antagonists ) 是由 沃克尔·哲马绍斯基 伊格尔·瑟利 若阿纳·德·阿布雷乌·卡瓦略 摩根·马里·勒库安特 乔纳森 于 2019-08-15 设计创作，主要内容包括：本发明涉及骨形态发生蛋白6(BMP6)拮抗剂,如抗体和片段,以及方法、用途和组合。(The present invention relates to bone morphogenic protein 6(BMP6) antagonists, such as antibodies and fragments, and methods, uses and combinations.)

1. an antibody or fragment comprising a binding site that specifically binds bone morphogenetic protein 6(BMP6), wherein said binding site comprises a VH domain, wherein said VH domain comprises a light chain variable region comprising SEQ ID NO: 114, or a CDRH3 sequence of the VH domain of 114.

2. The antibody of claim 1, wherein the CDRH3 comprises SEQ ID NO: 110 or 113.

3. The antibody of any preceding claim, wherein the VH domain is encoded by a recombined nucleotide sequence derived from a human VH gene segment, a DH gene segment, and a JH gene segment, wherein

(a) The VH gene segment is selected from IGHV3-11 and IGHV 1-3;

(b) the DH gene segment is a human gene segment selected from the group consisting of IGHD3-10, IGHD6-19, IGHD7-27, IGHD4-23, IGHD5-18, IGHD3-22 and IGHD 3-16; and/or

(c) The JH gene segment is a human gene segment selected from IGHJ3, IGHJ4, and IGHJ 5.

4. The antibody or fragment of any preceding claim, wherein the binding site comprises (i) a heavy chain variable region comprising SEQ ID NO: 110, which is identical to a VH domain comprising SEQ ID NO: 119 with a VL domain pairing; or (ii) comprises SEQ ID NO: 113, which hybridizes to a VH domain comprising SEQ ID NO: 122, in the VL domain pair.

5. The antibody or fragment of any preceding claim, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 114, which hybridizes to a VH domain comprising SEQ ID NO: 123 is paired with the VL domain.

6. The antibody or fragment of any preceding claim, wherein the VH domain comprises

(a) Comprises the amino acid sequence of SEQ ID NO: 110 CDRH 3; and a polypeptide comprising SEQ ID NO: 108 and/or a CDRH1 comprising SEQ ID NO: 109 CDRH 2; or

(b) Comprises the amino acid sequence of SEQ ID NO: 113 CDRH 3; and a polypeptide comprising SEQ ID NO: 111 and/or CDRH1 comprising SEQ ID NO: 112 CDRH 2.

7. An antibody or fragment (optionally according to any preceding claim) comprising a binding site that specifically binds BMP6, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 114 or a VH domain having at least 70% identity thereto.

8. The antibody or fragment of any preceding claim, comprising a first and second copy of the VH domain.

9. An antibody or fragment (optionally according to any preceding claim) comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VL domain, wherein the VL domain comprises a heavy chain variable region comprising SEQ ID NO: 123, the CDRL3 sequence of the VL domain.

10. The antibody of claim 9, wherein the CDRL3 comprises SEQ ID NO: 119 or 122.

11. The antibody of claim 9 or 10, wherein the VL domain is encoded by a nucleotide sequence derived from recombination of human VL gene segments and JL gene segments, wherein

(a) The VL gene segment is selected from IGKV3-20, IGKV1-5 and IGKV 3-15; and/or

(b) The JL gene segments are selected from IGKJ1 and IGKJ 3.

12. The antibody or fragment of any one of claims 9 to 11, wherein the VL domain comprises

(a) Comprises the amino acid sequence of SEQ ID NO: CDRL3 of 119; and a polypeptide comprising SEQ ID NO: 117 and/or a CDRL1 comprising SEQ ID NO: 118 CDRL 2; or

(b) Comprises the amino acid sequence of SEQ ID NO: 122 CDRL 3; and a polypeptide comprising SEQ ID NO: 120 and/or a CDRL1 comprising SEQ ID NO: CDRL2 of 121.

13. An antibody or fragment (optionally according to any preceding claim) comprising a binding site that specifically binds BMP6, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 123 or a VL domain of amino acids having at least 70% identity thereto.

14. The antibody or fragment of any one of claims 9 to 13, comprising a first copy and a second copy of the VL domain.

15. An antibody or fragment (optionally according to any preceding claim) which specifically binds bone morphogenetic protein 6(BMP6) and comprises (i) a heavy chain variable region comprising SEQ ID NO: 116 or an amino acid having at least 70% identity thereto; and/or (ii) comprises SEQ ID NO: 125 or an amino acid having at least 70% identity thereto.

16. An antibody or fragment (optionally according to any preceding claim) which (i) specifically binds to the same epitope of human BMP6 as the epitope bound by the antibody according to any preceding claim; and/or (ii) competes with an antibody according to any preceding claim for binding to human BMP 6.

17. The antibody or fragment of any preceding claim, which specifically binds to a polypeptide comprising SEQ ID NO: 562 human BMP 6; and/or comprises SEQ ID NO: 564 from cynomolgus monkey BMP 6; and/or comprises SEQ ID NO: 563 rat BMP 6.

18. The antibody or fragment of any preceding claim, wherein the antibody or fragment comprises a human constant region, optionally an IgG4 constant region or an IgG1 constant region.

19. The antibody or fragment of claim 18, wherein the constant region is an IgG4-PE constant region, optionally the constant region comprises SEQ ID NO: 454.

20. The antibody or fragment of any preceding claim, further comprising a binding specificity to another target antigen (optionally human hemojuvelin, transferrin receptor, or BMP receptor); or binds to BMP6 and another BMP (optionally BMP2, 4, 7 or 9).

21. The anti-BMP 6 antibody or fragment according to any preceding claim, for use in the treatment or prevention of a BMP6 mediated disease or condition (optionally anemia) in an individual.

22. The anti-BMP 6 antibody or fragment according to claim 21, wherein the disease or condition is selected from anemia, Pulmonary Arterial Hypertension (PAH) (optionally primary PAH or secondary PAH), Cerebral Cavernous Malformation (CCM) (optionally familial CCM or sporadic CCM), Restless Leg Syndrome (RLS), cancer metastasis, systemic sclerosis, sjogren's syndrome, endothelial cell-to-mesenchymal transition (EndoMT), cardiovascular disease, atherosclerosis, systemic sclerosis-associated pulmonary fibrosis, and cardiac fibrosis.

23. The antibody or fragment of claim 21 or 22, wherein the antibody or fragment is administered to the individual simultaneously or sequentially with an Erythropoietin Stimulating Agent (ESA).

24. A combination of an amount of an anti-BMP 6 antibody or fragment and an amount of an ESA (optionally comprising multiple doses of the antibody and/or ESA), wherein the antibody or fragment is according to any preceding claim.

25. The antibody, fragment or combination of any preceding claim, for use in a method of:

(a) Preventing the blood hemoglobin content of a subject from decreasing to less than 10g/dL, the method comprising administering to the subject the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA);

(b) raising blood hemoglobin to a level of at least 10g/dL in a subject suffering from anemia, the method comprising administering to the subject the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated;

(c) treating or preventing anemia in a subject suffering from an inflammatory disease or condition, the method comprising administering to the subject the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented;

(d) eliminating or reducing the need for administration of iron or blood transfusion to an individual suffering from anemia, the method comprising administering to the individual the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA), wherein the need is eliminated or reduced;

(e) treating or preventing anemia in a subject suffering from a microbial infection, the method comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA);

(f) reducing administration of an Erythropoiesis Stimulating Agent (ESA) to a subject suffering from anemia to treat anemia, the method comprising administering the antibody or fragment and the ESA, wherein anemia in the subject is treated; or

(g) Treating or reducing the risk of anemia in a subject suffering from or at risk of anemia, the method comprising administering to the subject the antibody or fragment and a low dose of an Erythropoiesis Stimulating Agent (ESA), wherein anemia is treated or the risk of anemia is reduced in the subject.

26. The combination according to claim 24 or 25, wherein the ESA is

a. Epoetin alpha and is administered at a weekly dose of less than 1000, 1500, 2500, 5000, 11000, 18000, 34000, or 90000 units, optionally wherein the subject has previously received < 1500, 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90000 units of weekly epoetin alpha treatment, respectively;

b. dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms, optionally wherein the individual has previously received 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms of dapoxetine alpha or per week, respectivelyTreatment; or

c. Dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 20, 40, 60, 100 or 200 micrograms, optionally wherein the subject has previously received 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90,000 units of weekly epoetin alpha treatment, respectively.

27. The antibody, fragment, or combination of any preceding claim, for use in maintaining or increasing blood hemoglobin content in the subject to at least 10g/dL at least 13 or 14 days after the subject has received the anti-BMP 6 antibody or fragment and ESA.

28. Use of an antibody, fragment or combination according to any preceding claim in the manufacture of a medicament for administration to a subject for the treatment or prevention of a BMP6 mediated disease or condition, optionally anemia.

29. A method of treating or preventing a BMP6 mediated disease or condition (optionally anemia) in a subject, the method comprising administering to the subject a therapeutically effective amount of an antibody, fragment, or combination of any one of claims 1-27, wherein the BMP6 mediated disease or condition is treated or prevented thereby.

30. The use according to claim 28 or the method according to claim 29 wherein the BMP6 mediated disease or condition is anemia.

31. The antibody, fragment, combination, use or method of any one of claims 21 to 30, further comprising administering to the individual another therapy, for example another therapeutic agent, optionally wherein the other therapeutic agent is selected from the group consisting of:

(a) Intravenous iron;

(b) ESA (optionally EPO);

(c) an ActRIIa inhibitor;

(d) an ActRIIb inhibitor;

(e) IL-6 or IL-6 receptor inhibitors (optionally anti IL-6 or IL-6 receptor antibodies);

(f) a TNF-alpha or TNF-alpha receptor inhibitor (optionally an anti-TNF-alpha or TNF-alpha receptor antibody);

(g) an HJV inhibitor (optionally an anti-HJV antibody);

(h) a BMP antagonist (optionally another anti-BMP antibody or fragment), optionally wherein the BMP is BMP2, 4, 5, 6, 7 or 9;

(i) a protein lyase-2 (MTP2) agonist (optionally a protein lyase-2 (MTP2) agonist antibody);

(j) HIF-PH inhibitors;

(k) transferrin receptor 2(TFR2) inhibitors;

(l) An HFE inhibitor;

(m) NRf2 inhibitors;

(n) a transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptor inhibitor;

(o) an activin receptor inhibitor (optionally an activin receptor Fc fusion);

(p) GDF11 inhibitors; and

(q) myostatin inhibitors.

32. A pharmaceutical composition comprising the antibody, fragment or combination of any one of claims 1 to 27 and 31, and a pharmaceutically acceptable excipient, diluent or carrier, and optionally in combination with another therapeutic agent selected from the agents of claim 44.

33. The pharmaceutical composition according to claim 32 for use in the treatment and/or prevention of a BMP6 mediated condition or disease, optionally anemia.

34. The pharmaceutical composition of claim 32 or 33, in combination with a label or instructions for use to treat and/or prevent the disease or condition in a human; optionally wherein the tag or instruction includes a marketing approval number (optionally an FDA or EMA approval number); optionally wherein the kit comprises an IV or injection device comprising the antibody or fragment.

35. A nucleic acid, which

(a) Encoding the antibody or fragment of any one of claims 1 to 20, a VH domain and/or a VL domain;

(b) encodes (i) a polypeptide comprising SEQ ID NO: 114 or a VH domain having an amino acid sequence at least 70% identical thereto; and/or (ii) comprises SEQ ID NO: 123 or a VL domain having an amino acid sequence at least 70% identical thereto;

(c) comprising (i) a sequence that is substantially identical to SEQ ID NO: 115 has a nucleotide sequence of at least 70% identity; and/or (ii) a sequence that is identical to SEQ ID NO: 124 having a nucleotide sequence of at least 70% identity;

(d) a heavy and/or light chain encoding the antibody or fragment of any one of claims 1-20; or

(e) (iii) encodes (ii) a polypeptide comprising an amino acid sequence substantially identical to that of SEQ ID NO: 116 a heavy chain having an amino acid sequence with at least 70% identity; and/or

(iii) Comprises a nucleotide sequence substantially identical to SEQ ID NO: 125 having an amino acid sequence of at least 70% identity.

36. A vector comprising the nucleic acid of claim 35; optionally wherein the vector is a CHO or HEK293 vector.

37. A host cell comprising the nucleic acid of claim 35 or the vector of claim 36.

38. An antibody, fragment, combination, vector, host cell, use or method as described herein.

Technical Field

The present invention relates to bone morphogenic protein 6(BMP6) antagonists, such as antibodies and fragments, and methods, uses and combinations.

Background

Bone morphogenic protein 6(BMP6) is a key regulator of hepcidin (hepcidin), a small peptide secreted by the liver, which is the major regulator of iron metabolism in mammals. anti-BMP 6 antagonists, such as antibodies, are being developed for use in methods of treating or preventing anemia (see, e.g., WO2016098079, US20160176956a 1). See also WO2017191437, which discloses anti-BMP 6 antagonists in combination with Erythropoietin Stimulating Agents (ESAs).

Anemia is a serious disease affecting 25% or more than 17 hundred million people worldwide, specifically pregnant women, newborns and children. Anemia in excess of 40% reflects dysfunction in the homeostatic control of iron intake, reserve and recirculation. The disorder is the result of a variety of chronic diseases including infection (e.g., HIV, hepatitis), inflammation (e.g., rheumatoid arthritis), cancer, and renal disease. A great influence of diseases leading to dysregulation of iron homeostasis is seen in the united states, of which 10% of adults > 65 years of age suffer from anemia and of which 1/3 is caused by chronic conditions.

The standard of care is focused on blood transfusion and use of ESAs such as EPO or(Amgen, Inc).

The hamp gene encodes hepcidin, a 25 amino acid peptide hormone produced by the liver. Hepcidin acts primarily by controlling cellular iron efflux by modulating the amount of the iron transporter ferroportin (ferroportin) present on the cell surface of cells involved in iron transport. Hepcidin interacts with ferroportin, expressed primarily on macrophages and duodenal cells, leading to internalization and degradation of ferroportin (Ganz and Nemeth, 2011; Ramey et al, 2010). BMP6 triggers hepcidin expression in mechanisms involving several receptors and cofactors. These receptors include the BMP class I and II receptors, which are necessary to trigger hamp expression, and members of the repulsive guidance molecule family RGM such as RGMc (hemojuvelin, HJV) and rgmb (dragon), proteolytic enzyme-2, neogenin (neogenin), HFE, and transferrin receptors 1 and 2. The SMAD pathway may be triggered by the initial interaction of BMP6 with a class I BMP receptor that may also be involved in HJV. This results in binding to autophosphorylated BMPR II and activation of phosphorylation of BMPRI, triggering the SMAD cascade. Phosphorylated SMADs 1, 5 and 8, and eventually SMAD4 translocate to the nucleus to interact with BMP responsive elements in the hamp gene control region to trigger hepcidin expression. Liver-specific disruption of SMAD4 signaling molecules or type I receptors Alk2 and ALk3 reduced hepcidin expression in mice, and, similar to BMP6 knockout, demonstrated that the factor is also part of the relevant pathway (Steinbicker et al, 2011; Wang et al, 2005).

Ganz, T., Nemeth, E., 2011. Hepcidin-Ferroportin System as a Therapeutic Target for anemia and Iron Overload Disorders [ Hematology (Hematology) 2011, 538-.

Ramey, g., Deschemin, j.c., Durel, b., cannone-Hergaux, f., Nicolas, g., vaultont, s., 2010. Hepcidin targets ferroportin for degradation in hepatocytes hematology (haematogica) 95, 501-.

Steinbecker, A.U., Bartnikas, T.B., Lohmeyer, L.K., Leyton, P., Mayeur, C., Kao, S.M., Pappas, A.E., Peterson, R.T., Blood, D.B., Yu, P.B., Fleming, M.D., Blood, K.D., 2011, BMP type I receptor loss interference induced mouse iron overload on hepcidin expression (permeability of hepcidin expression by BMP type I receptor interference in), Blood (Blood) 118, 4224-.

Wang, R. -, H., Li, C., Xu, X., Zheng, Y., Xiao, C., Zerfas, P., Cooperman, S., Eckhaus, M., Rouuault, T., Mishra, L., 2005.SMAD4 the role in iron metabolism by positively regulating the expression of hepcidin (A role of SMAD4 in iron metabolism) the cellular metabolism of 399-409.

Disclosure of Invention

The present invention provides the following:

an antibody or fragment comprising a binding site that specifically binds bone morphogenetic protein 6(BMP6), wherein said binding site comprises a VH domain, wherein said VH domain comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO: 114, or a CDRH3 sequence of the VH domain of 114.

An antibody or fragment comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VH domain comprising the amino acid sequence of SEQ ID NO: 114 or an amino acid having at least 70% identity thereto.

An antibody or fragment comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VL domain, wherein the VL domain comprises a heavy chain variable region comprising SEQ ID NO: 123, the CDRL3 sequence of the VL domain.

An antibody or fragment comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VL domain comprising the amino acid sequence of SEQ ID NO: 123 or an amino acid having at least 70% identity thereto.

An antibody or fragment that specifically binds bone morphogenetic protein 6(BMP6) and comprises (i) a heavy chain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 116 or an amino acid having at least 70% identity thereto; and/or (ii) a light chain sequence comprising SEQ ID NO: 125 or an amino acid having at least 70% identity thereto.

An antibody or fragment that (i) specifically binds to an epitope of human BMP6 that is identical to the epitope to which an antibody of the invention binds; and/or (ii) competes with an antibody of the invention for binding to human BMP 6.

The present invention also provides the following configurations.

In the first configuration of the first embodiment,the present invention provides:

an antibody or fragment comprising a binding site that specifically binds bone morphogenetic protein 6(BMP6), wherein the binding site comprises a VH domain encoded by a recombinant nucleotide sequence derived from a human VH gene segment, a DH gene segment, and a JH gene segment, wherein the VH gene segment is selected from IGHV3-11 and IGHV 1-3.

In the second configuration of the process, the first configuration,the present invention provides:

an antibody or fragment which specifically binds BMP6 and comprises the CDRH3 sequence of an anti-BMP 6 antibody according to the invention, or the CDRH3 sequence comprises 3, 2 or 1 amino acid substitutions.

In the third configuration, the first and second switches are,the present invention provides:

an antibody or fragment which specifically binds BMP6 and comprises a VH domain comprising a CDRH3 sequence of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or the sequence comprises 3, 2 or 1 amino acid substitutions.

In the fourth configuration, it is possible to,the present invention provides:

an antibody or fragment comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VH domain comprising the amino acid sequence of the VH domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70% identity thereto.

In the fifth configuration, it is possible to,the present invention provides:

an antibody or fragment comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VL domain encoded by a recombined nucleotide sequence derived from a human VL gene segment and a JL gene segment, wherein the VL gene segment is selected from IGKV3-20, IGKV1-5, and IGKV 3-15.

In the sixth configuration, it is possible to,the present invention provides:

an antibody or fragment which specifically binds BMP6 and comprises the CDRL3 sequence of an anti-BMP 6 antibody of the invention, said CDRL3 sequence comprising 3, 2 or 1 amino acid substitutions.

In the seventh configuration, it is possible to,the present invention provides:

An antibody or fragment which specifically binds BMP6 and comprises a VL domain comprising a CDRL3 (and optionally a CDRH3) sequence of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or the sequences each comprise 3, 2 or 1 amino acid substitutions.

In the eighth configuration, it is possible that,the present invention provides:

an antibody or fragment comprising a binding site that specifically binds BMP6, wherein the binding site comprises a VL domain comprising the amino acid sequence of the VL domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, and CL-58713; or an amino acid having at least 70% identity thereto.

In the ninth configuration, it is possible to,the present invention provides:

an antibody or fragment that specifically binds BMP6 and comprises the heavy chain amino acid sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, and CL-58713; or an amino acid having at least 70% identity thereto.

In the tenth configuration, it is possible to,the present invention provides:

an antibody or fragment that specifically binds BMP6 and comprises the light chain amino acid sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, and CL-58713; or an amino acid having at least 70% identity thereto.

In the eleventh configuration, the first and second switches are,the present invention provides:

an antibody or fragment that specifically binds to a human BMP6 epitope that is identical to an epitope bound by an antibody of the invention (e.g., CL-58838).

In the twelfth configuration, it is possible to,the present invention provides:

an antibody or fragment that competes with an antibody of the invention for binding to human BMP 6.

In the thirteenth configuration, in the fifth configuration,the present invention provides:

an anti-BMP 6 antibody or fragment of the invention for use in the treatment or prevention of a BMP6 mediated disease or condition (optionally anemia) in an individual.

In a fourteenth configuration, the first and second switches are,the present invention provides:

a combination of an amount of an anti-BMP 6 antibody or fragment and an amount of an ESA (optionally comprising multiple doses of the antibody and/or ESA), wherein the antibody or fragment is according to the invention.

In the fifteenth configuration, in the fifth configuration,the present invention provides:

use of an antibody, fragment or combination of the invention in the manufacture of a medicament for administration to a subject for treating or preventing a BMP6 mediated disease or condition, optionally anemia.

In a sixteenth configuration, the first and second switches,the present invention provides:

a method of treating or preventing a BMP6 mediated disease or condition (optionally anemia) in an individual, the method comprising administering to the individual a therapeutically effective amount of an antibody, fragment or combination of the invention, wherein the BMP6 mediated disease or condition is thereby treated or prevented.

In a seventeenth configuration, the first and second configurations,the present invention provides:

a pharmaceutical composition comprising an antibody, fragment or combination of the invention and a pharmaceutically acceptable excipient, diluent or carrier.

In an eighteenth configuration,the present invention provides:

a nucleic acid encoding a VH domain and/or a VL domain of an antibody or fragment of the invention.

In the nineteenth configuration,the present invention provides:

a nucleic acid encoding a VH domain comprising the amino acid sequence of the VH domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70% identity thereto.

In a twentieth configuration, the first configuration,the present invention provides:

a nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 115. 520 or 521 having a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 124. 522 or 523 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 115 has a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 124 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 520 has a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 522 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 521 has a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 523 has a nucleotide sequence of at least 70% identity.

In a twenty-first configuration, the first configuration,the present invention provides:

combinations of first and second nucleic acids (e.g., in host cells such as CHO or HEK293 or Cos cells), respectively, comprising

(a) And SEQ ID NO: 115. 520 or 521 having a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 124. 522 or 523 has a nucleotide sequence of at least 70% identity.

Combinations of first and second nucleic acids (e.g., in host cells such as CHO or HEK293 or Cos cells), respectively, comprising

(a) And SEQ ID NO: 115 has a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 124 has a nucleotide sequence of at least 70% identity.

Combinations of first and second nucleic acids (e.g., in host cells such as CHO or HEK293 or Cos cells), respectively, comprising

(a) And SEQ ID NO: 520 has a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 522 has a nucleotide sequence of at least 70% identity.

Combinations of first and second nucleic acids (e.g., in host cells such as CHO or HEK293 or Cos cells), respectively, comprising

(a) And SEQ ID NO: 521 has a nucleotide sequence of at least 70% identity; and/or

(b) And SEQ ID NO: 523 has a nucleotide sequence of at least 70% identity.

In a twenty-second configuration of the device,the present invention provides:

a nucleic acid encoding the heavy and/or light chain of an antibody or fragment of the invention.

In a twenty-third configuration of the system,the present invention provides:

a nucleic acid encoding a polypeptide comprising an amino acid sequence substantially identical to SEQ ID NO: 116 has an amino acid sequence of at least 70% identity.

In a twenty-fourth configuration of the method,the present invention provides:

a nucleic acid encoding a polypeptide comprising an amino acid sequence substantially identical to SEQ ID NO: 125 having an amino acid sequence of at least 70% identity.

In a twenty-fifth configuration,the present invention provides:

a nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) A nucleotide sequence at least 70% identical to a selected heavy chain sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; and/or

(b) A nucleotide sequence having at least 70% identity to a selected sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And a sequence selected from SEQ ID NO: 512. 514, 516, 518, and 519 having a nucleotide sequence of at least 70% identity; and/or

(b) And a sequence selected from SEQ ID NO: 513. 515 and 517 has a nucleotide sequence with at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 512 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 513 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 516 a nucleotide sequence having at least 70% identity; and/or

(b) And SEQ ID NO: 517 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 518 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 513 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 519 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 513 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 518 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 517 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 519 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 517 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 514 a nucleotide sequence having at least 70% identity; and/or

(b) And SEQ ID NO: 515 has a nucleotide sequence identity of at least 70%.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 516 a nucleotide sequence having at least 70% identity; and/or

(b) And SEQ ID NO: 517 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 518 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 513. 515 or 517 has a nucleotide sequence of at least 70% identity.

A nucleic acid (e.g., in a host cell such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 519 nucleotide sequences having at least 70% identity; and/or

(b) And SEQ ID NO: 513. 515 or 517 has a nucleotide sequence of at least 70% identity.

In a twenty-sixth configuration,the present invention provides:

a vector comprising the nucleic acid; optionally wherein the vector is a CHO or HEK293 vector.

In a twenty-seventh configuration,the present invention provides:

a host cell comprising said nucleic acid or said vector.

In a twenty-eighth configuration,the present invention provides:

an antibody, fragment, combination, vector, host cell, use or method as described herein.

In a twenty-ninth configuration, the first and second switches,the present invention provides:

an antibody or fragment that specifically binds to a Bone Morphogenetic Protein (BMP) for use in a method of treating or preventing a disease or condition caused by a Hemojuvelin (HJV) -deficient BMP-BMP receptor (BMPR) complex in a human or animal subject, wherein the method comprises administering the antibody or fragment to the subject to inhibit formation of the complex and/or inhibit triggering of intracellular signaling by the complex in the subject, thereby treating or preventing an HJV-independent BMP-BMPR mediated disease or condition.

An antibody or fragment that specifically binds to a Bone Morphogenetic Protein (BMP) for use in a method of treating or preventing HJV-independent anemia or osteoporosis in a human or animal subject, wherein the method comprises administering the antibody or fragment to the subject to inhibit the formation of a Hemojuvelin (HJV) -deficient BMP-BMP receptor (BMPR) complex and/or to inhibit triggering of intracellular signaling by the complex in the subject, thereby treating or preventing HJV-independent anemia or osteoporosis.

An antibody or fragment that specifically binds to a Bone Morphogenetic Protein (BMP) for use in a method of treating or preventing Hemojuvelin (HJV) -independent anemia or osteoporosis in a human or animal subject, wherein the method comprises administering the antibody to the subject, thereby treating or preventing HJV-independent anemia or osteoporosis.

The invention also provides such methods for treating a disease or condition, such as anemia or osteoporosis.

Drawings

FIG. 1:

the assay windows were established using a HepG2 hamp luciferase reporter cell line and various human BMP ligands as stimulators. The function of the firefly luciferase gene under the control of the human hepcidin promoter regulatory element in HepG2 cells was tested by stimulating the cells with increasing concentrations of various human BMP proteins (R & D Systems or Peprotech). The performance of the assay was tested in two different media settings, MEM (A) containing 1% FBS and hybridoma medium (B; see example 1 for details) containing 25% MEM.

FIG. 2:

the HepG2 hamp luciferase reporter cell assay window was evaluated using various human or mouse BMP6 ligands added in increasing concentrations as stimulators (R & D Systems or Peprotech). BMP6 was diluted in MEM containing 1% FBS. Using 25% HMM, the total assay volume was 60 μ l (see example 1 for more details and reagents used).

FIG. 3:

human BMP6(Peprotech) or mouse BMP6(R & D Systems) at a fixed concentration of 1nM and commercial mouse anti-BMP 6 monoclonal antibodies MAB507(a) and MAB2365(B) from R & D Systems diluted in Hybridoma Maintenance Medium (HMM) were used in MEM containing 1% FBS to evaluate HepG2 hamp luciferase reporter cell assay window; (see example 1 for further details and reagents).

FIG. 4:

using five bmp 6-/-kymetice through reverseAssay (Perkin Elmer) serum titer determination of the immunization protocol KM089 was performed with an assay (Perkin Elmer) in which added serum was captured via Fc domain with anti-mouse IgG (goat anti-mouse IgG; Southern Biotech1030-01) at various serial dilutionsThe IgG antibodies contained in (a) were then incubated with biotinylated BMP6 and detected using DELFIA Eu-N1 europium-labeled streptavidin (perkin elmer). The cutoff value (any signal below that value was judged negative) was defined as the negative control mean +3x standard deviation for all replicates. KMBM code in the legend refers to individual Kymouses ^TMbmp 6-/-animals.

FIG. 5:

human BMP6(Peprotech) was purified by SDS-PAGE separation 2 μ g/lane and stained with coomassie blue (a) under reducing (R) and non-reducing (NR) conditions, and western blots from the gels were blotted onto membranes, followed by detection using purified human anti-BMP 6 antibody as a label. Bound antibodies were detected by enhanced chemiluminescence with anti-human K light chain-horseradish peroxidase (HRP) and peroxidase (CL-58838 and antibody a) or anti-human Fc-Alkaline Phosphatase (AP) and phosphatase 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and Nitro Blue Tetrazolium (NBT) colorimetric substrate conversion (antibody B).

FIG. 6:

receptor dimerization assays based on U2OS cells transfected with BMPRIA (ALK3, CD292) and BMPRII (T-ALK; Panel A) or BMPRIA (ALK6) and BMPRII (T-ALK; Panel B). Ligand-driven dimerization with BMP6(Peprotech 120-06SEQ ID NO: 2) generates a chemiluminescent signal. Human anti-BMP 6 IgG4 antibody CL-58838 and anti-BMP 6 antibody A, B (A), human anti-BMP 6 IgG4 antibodies 1-8(B) and murine monoclonal antibody MAB507(R & D Systems; A and B) were added at increasing concentrations (11 point dilution). Representative data of two experiments in each case. Appropriate isotype control IgG was used in both experiments.

FIG. 7:

cross-reactivity profile of purified CL-58838IgG4(SEQ ID NO: 116 and SEQ ID NO: 125) with human BMP2(A), BMP4(B), BMP5(C), BMP7(D) and BMP9 (E; details described in example 7). The effect of the anti-BMP 6 antibody CL-58838 on BMP-driven hamp luciferase reporter activation in HepG2 cells was studied by adding increasing amounts of CL-58838. As a positive control, related BMP-specific antibodies (both from R & D Systems) were added to interfere with the related BMP activation.

FIG. 8:

plotted transferrin saturation% (TSAT) in normal rats, following a single intravenous injection of anti-BMP-6 or isotype IgG control antibody, according to table 12 (for figures 8A-D), table 13 (for figures 8E-G), and table 14 (for figures 8H and I).

FIG. 9:

results of transferrin saturation% (TSAT) in normal rats after a single intravenous injection of various doses of CL-58838(A) or 1mg/kg of CL-58838 and antibody A (B; Table 15).

FIG. 10:

results of transferrin saturation% (TSAT) in normal rats after a single subcutaneous injection of either CL-58838(A) or 1mg/kg of CL-58838 and antibodies A and B (B; Table 16).

FIG. 11:

pharmacokinetic (PK) profiles of human anti-BMP 6 IgG4 antibody CL-58838 after a single intravenous injection at different doses (a) or compared to antibody a at a 1mg/kg dose (B). PK profile after single subcutaneous (sc) injection of different doses of CL-58838(C) or 1mg/kg doses of antibodies a and b (d). Results are plotted as IgG [ ng/ml ] IgG as a function of time [ hours (h) ].

FIG. 12:

results from the rat PG-PS model of ACD. Transferrin saturation tsat (a), hemoglobin [ g/dL ] (B), MCH [ pg ] (C), and serum hepcidin levels [ ng/mL ] at weeks 0 (D), 1 (E) and 2 (F) after initiation of treatment (ρ < 0.05, × p < 0.01, × p < 0.001).

FIG. 13:

transferrin saturation% (TSAT) after a single intravenous administration of 3mg/kg of CL-58838 and antibodies A and B (A) and different doses of CL-58838(B) in cynomolgus monkeys, and plasma hepcidin content after a single intravenous administration of 3mg/kg of CL-58838 and antibodies A and B (C) and different doses of CL-58838(D) in cynomolgus monkeys.

FIG. 14:

PK profile of CL-58838 (A) and PK profile of 3mg/kg of CL-58838 compared to antibodies A and B after a single intravenous injection at different doses in cynomolgus monkeys (B).

FIG. 15:

amino acid sequence alignment of antibody Vh and Vk sequences highly related to CL-58838 (table 6) based on V-region usage and CDRH 3. The top line shows germline sequences for the IMGT V region genes IGHV3-11 and IGKV3-20 encoded in bmp6-/-Kymouse used in the present invention. Amino acid positions in the selected antibody sequences that differ from germline V-region sequences are boxed below. The antibodies selected for in vivo evaluation are shown in bold (table 6).

FIG. 16:

a homogeneous time-resolved fret (htrf) assay showed the ability of the V-region-based antibodies highly correlated with CL-58838 and CDRH antibodies identified by NGS sequences (table 6) to compete with labeled CL-58838(10nM) for binding to human BMP6 present at 32 nM. The competitor antibody was added in a series of concentrations starting at a final concentration of 3 μ M over the 11-point dilution range.

FIG. 17:

experimental setup and results obtained from example 17. Graphical illustration of the experimental time course (A), decision graphs for inclusion in rats and administration of EPO (B), hemoglobin [ g/dL ] (C), MCV [ fL ] (D), MCH [ pg ] (E) and the EPO dose [% ] (F) administered. ANCOVA analysis for change from baseline at week 4 using baseline as covariate (C-E) and Fishers exact test (F). Data are shown as mean ± SEM (. rho < 0.05,. rho < 0.01,. rho < 0.001).

FIG. 18:

experimental setup and results of example 18. Graphical representation of the experimental time course (A), hemoglobin [ g/dL ] (B), MCV [ fL ] (C), MCH [ pg ] (D), hepatic Hamp mRNA levels [ fold expression ], plasma iron levels [ μ g/dL ] (F) and TSAT values [% ]. Analysis of variance with multiple comparisons to EPO using Dunnett's correction. The results of the comparison of EPO with EPO + CL-58838 are shown. Data are shown as mean ± SEM (. rho < 0.05,. rho < 0.01,. rho < 0.001).

FIG. 19:

the results obtained from example 19. Hemoglobin values [ g/dL ] (A) were compared in the treatment groups after administration of 1. mu.g/kg EPO in combination with different CL-58838 concentrations, hemoglobin values [ g/dL ] (B) after administration of 10mg/kg CL-58838 in combination with different EPO doses, MCV values [ fL ] (C) and TSAT [% ] (D) in mice after administration of 1. mu.g/kg EPO in combination with different CL-58838 concentrations, MCV values [ fL ] (E) in mice after administration of 1mg/kg CL-58838 in combination with different EPO doses, hepatic Hamp mRNA content [ fold expression ] (F) in all treatment groups. Analysis of variance using multiple comparisons of Dunnett correction with group II. Data are shown as mean ± SEM (. rho < 0.05,. rho < 0.01,. rho < 0.001).

Detailed Description

Definition of

Unless defined otherwise herein, scientific and technical terms shall have the meanings that are commonly understood by those of ordinary skill. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular.

The singular terms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "for example" is derived from latin-exempli gratia and is used herein to denote non-limiting examples. Thus, the abbreviation "such as" is synonymous with the term "for example".

In the present specification and claims, the term "about" is used to modify, for example, the amounts, concentrations, volumes, process temperatures, process times, yields, flow rates, pressures, and the like of ingredients in a composition, as well as ranges thereof, for describing embodiments of the present disclosure. The term "about" refers to, for example, through typical measurement and processing procedures used to prepare compounds, compositions, concentrates, or use formulations; through inadvertent errors in these procedures; variations in quantity may occur through differences in the manufacture, source, or purity of the starting materials or ingredients used to carry out the method, and like considerations. The term "about" also encompasses amounts that differ due to aging of a formulation having a particular initial concentration or mixture, as well as amounts that differ due to mixing or processing of a formulation having a particular initial concentration or mixture. Where modified by the term "about," the appended claims include equivalents to the amounts.

As used herein, "administering" or "administering" refers to the act of injecting or otherwise physically delivering a substance (e.g., an anti-hBMP 6 antibody provided herein) present in vitro into the body of a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and/or any other physical delivery method described herein or known in the art. When treating a disease or symptoms thereof, the substance is generally administered after the onset of the disease or symptoms thereof. When preventing a disease or symptoms thereof, administration of the substance is usually performed before the onset of the disease or symptoms thereof.

The terms "antibody," "immunoglobulin," or "Ig" are used interchangeably herein and refer to an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combination of the foregoing, via at least one antigen recognition site within the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (e.g., Fab ', F (ab')₂And Fv fragments), single chain Fv (scfv) mutants, multispecific antibodies such as bispecific antibodies (including double-binding antibodies), chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigenic determinant portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site, so long as the antibody exhibits the desired biological activity. The term "antibody" may also refer to a Y-shaped glycoprotein with a molecular weight of about 150kDa, which consists of four polypeptide chains: two light (L) chains and two heavy (H) chains. There are five types of mammalian Ig heavy chain isotypes, represented by the greek letters α, δ, ε, γ, and μ. The type of heavy chain defines the class of antibody, i.e., IgA, IgD, IgE, IgG, and IgM, respectively. The γ and α classes are further divided into subclasses based on differences in constant domain sequence and function, such as IgG1, hIgG2, mIgG2A, mIgG2B, IgG3, IgG4, IgA1, and IgA 2. In mammals, there are two types of immunoglobulin light chains, λ and κ. The "variable region" or "variable domain" of an antibody refers to The amino-terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "V" respectively_H"and" V_L". The domain is usually the most variable part of an antibody (relative to other antibodies of the same class) and contains an antigen binding site. One example of an antibody is a heavy chain only (i.e., H2) antibody, which comprises a dimer of heavy chains (5 '-VH- (optional hinge) -CH2-CH 3-3') and no light chain.

The antibodies described herein can be oligoclonal antibodies, polyclonal antibodies, monoclonal antibodies (including full length monoclonal antibodies), camelized antibodies, chimeric antibodies, CDR-grafted antibodies, multispecific antibodies, bispecific antibodies (including dual binding antibodies), catalytic antibodies, chimeric antibodies, humanized antibodies, fully human antibodies, anti-idiotypic antibodies, including antibodies that can be labeled in soluble or bound form, as well as fragments, variants, or derivatives thereof, alone or in combination with other amino acid sequences provided by known techniques. The antibody may be from any species. The antibodies described herein can be naked antibodies or conjugated to other molecules such as toxins, radioisotopes, and the like.

The terms "antigen binding site," "antigen binding domain," "antigen binding region," "antigen binding fragment," and similar terms refer to the portion of an antibody that comprises amino acid residues that interact with an antigen and confer specificity and affinity of a binding agent to the antigen (e.g., a Complementarity Determining Region (CDR)). The antigen-binding region can be derived from any animal species, such as rodents (e.g., rabbits, rats, or hamsters) and humans. Preferably, the antigen binding region will be of human origin.

Antigen binding fragments as described herein may include single chain Fv (scFv), single chain antibodies, single domain antibodies, Fv fragments, Fab fragments, F (ab')₂Fragments, antibody fragments exhibiting a desired biological activity, disulfide stabilized variable regions (dsFvs), dimeric variable regions (diabodies), anti-idiotypic (anti-Id) antibodies (including anti-Id antibodies such as antibodies), intrabodies, linear antibodies, single chain antibody molecules and multispecific antibodies formed from any one of the above antibody fragments and epitope-binding fragments. In particular, it is possible to obtain,the antibodies and antibody fragments described herein may include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site. Digestion of an antibody with the enzyme papain produces two identical antigen-binding fragments, also known as "Fab" fragments, and an "Fc" fragment that has no antigen-binding activity but has the ability to crystallize. As used herein, "Fab" refers to an antibody fragment that includes one constant domain and one variable domain of each of the heavy and light chains. The term "Fc region" is used herein to define the C-terminal region of an immunoglobulin heavy chain, including native sequence Fc regions and variant Fc regions. "Fc fragment" refers to the carboxy-terminal portions of two H chains held together by disulfide bonds. The effector function of an antibody is determined by sequences in the Fc region, which are also recognized by Fc receptors (fcrs) found on certain types of cells. Digestion of antibodies with the enzyme pepsin to produce F (ab') ₂A fragment wherein the two arms of the antibody molecule remain linked and comprise two antigen binding sites. F (ab')₂Fragments have the ability to cross-link antigens.

The term "… … -derived recombination" in relation to gene segments will be apparent to those skilled in the art, which is to be understood as the recombination of their variable region gene segments by a B cell to produce the coding sequence of the variable domain. For example, "recombination derived from a human VH gene segment, DH gene segment, and JH gene segment" involves the recombination of one human VH gene segment with one DH gene segment and one JH gene segment to form a rearranged VDJ sequence encoding a heavy chain antibody variable domain. Ligation and somatic hypermutation can also be a feature of the process, whereby the resulting recombinant VDJ sequence includes one or more nucleotide additions, substitutions, or deletions (e.g., p-additions and/or n-additions) not included in germline V, D and J sequences. For kappa light chain variable domains, the equivalents are referred to as vk and jk gene segments, and for lambda light chain variable domains, as V λ and jλ. Meaning that any post-translational modification may additionally be encompassed in the variable domain.

As used herein, "Fv" refers to the smallest fragment of an antibody that retains the antigen recognition and antigen binding sites. Said area being formed by A dimer of one heavy and one light chain variable domain that are non-covalently or covalently bound. In the configuration, the three CDRs of each variable domain interact to define V_H-V_LAntigen binding sites on the surface of the dimer. A total of six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, but with a lower affinity than the entire binding site.

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations and/or post-translational modifications (e.g., isomerization, amidation) that may be present in minor amounts. Monoclonal antibodies are highly specific and are directed against a single antigenic determinant or epitope. In contrast, polyclonal antibody preparations typically include different antibodies directed against different antigenic determinants (or epitopes). The term "monoclonal antibody" as used herein encompasses intact and full-length monoclonal antibodies as well as antibody fragments (e.g., Fab ', F (ab')₂Fv), single chain (scFv) mutants, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site. Furthermore, "monoclonal antibodies" refer to these antibodies prepared in a variety of ways including, but not limited to, hybridoma, phage selection, recombinant expression, and transgenic animals. Monoclonal antibodies herein may include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, and the remainder of the chain is identical or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as such antibody fragments which exhibit the desired biological activity.

The term "humanized antibody" refers to a subset of chimeric antibodies in which a "hypervariable region" from a non-human immunoglobulin (donor antibody) replaces the residues of a hypervariable region in a human immunoglobulin (acceptor antibody). In general, a humanized antibody will comprise substantially all of at least one and typically two variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin sequence and all or substantially all of the framework regions are those of a human immunoglobulin sequence, although they may comprise one or more substitutions which improve the performance of the antibody, such as binding affinity, isomerisation, immunogenicity and the like.

The term "bispecific antibody" refers to an antibody comprising specificity for two target molecules, and includes, but is not limited to, forms such as: DVD-Ig (see DiGiammarinao et al, "design and Generation of DVD-Ig for bispecific targeting^TMMolecule (Design and generation of DVD-Ig)^TMmolecules for dual-specific targeting), "molecular biology methods (meth.mo.biol.), (2012, 889, 145-156), mAb²(see WO2008/003103, mAb²Description of forms is incorporated herein by reference), FIT-Ig (see WO2015/103072, description of FIT-Ig scaffold is incorporated herein by reference), mAb-dAb, dock and lock (dock and lock), Fab arm exchange, SEEDbody, Triomab, LUZ-Y, Fcab, kappa lambda body, orthogonal Fab, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv-Fc, scFv-Fab, intrabodies, BITE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH 3, bifunctional antibody-CH 3, trifunctional antibody, minibody, TriBi minibody, scFv-CH3 KIH, scFv-CH-CL-scFv, F (ab') 2-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knob-in-holes (knobs-in-holes), knob-in-holes with a common light chain and charge pair, charge pair with a common light chain, DT-IgG, DutaMab, IgG (H) -scFv, scFv- (H) IgG, IgG (L) -scFv, scFv- (L) IgG, IgG (L, H) -Fv, IgG (H) -V, V (H) -IgG, IgG (L) -V, V (L) -IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig and zybody. For a review of the bispecific format, see Spiess, c, et al, molecular immunology (2015). In another embodiment, the bispecific molecule comprises an antibody, e.g., a T cell, fused to another non-Ig form A receptor binding domain; an immunoglobulin superfamily domain; an amantadine-free variable lymphocyte receptor; fibronectin domains (e.g., Adnectin)^TM) (ii) a Antibody constant domains (e.g., CH)₃Domains, e.g. Fcab^TMCH (A) of₂And/or CH₃) Wherein the constant domain is not a functional CH₁A domain; scFv; (scFv)₂(ii) a A single chain bifunctional antibody; scFab; centyrin and a peptide derived from a compound selected from CTLA-4 (Evibody)^TM) The epitope binding domain of the scaffold of (a); a lipocalin domain; protein A, e.g.the Z domain of protein A (e.g.Affinibody)^TMOr SpA); a Domain (e.g., Avimer)^TMOr Maxibody^TM) (ii) a Heat shock proteins (e.g., epitope binding domains derived from GroEI and GroES); transferrin domains (e.g., transmembrane-antibodies); ankyrin repeat proteins (e.g. darpins)^TM) (ii) a A peptide aptamer; c-type lectin domains (e.g. Tetranectin)^TM) (ii) a Human gamma-crystallin or human ubiquitin (affilin); a PDZ domain; (ii) a scorpion toxin; and kunitz-type domain of human protease inhibitors.

In one embodiment, the bispecific antibody is a mAb²。mAb²Comprising VH and V from whole antibodies_LA domain fused to a modified constant region (referred to as "Fcab") that has been engineered to form an antigen binding site. Fcab/mAb is described in more detail in WO2008/003103 ²Techniques behind the forms, and mAbs²The description of the forms is incorporated herein by reference.

In another embodiment, the bispecific antibody is a "dual binding antibody". The term "dual binding antibody" as used herein is a bispecific antibody in which two antigen binding domains consist of V_H/V_LPairs were formed, and included FIT-Ig (see WO2015/103072, which is incorporated herein by reference), mAb-dAb, docking and latching, Fab arm exchange, SEEDbodv, Triomab, LUZ-Y, Fcab, kappa. lamda body, orthogonal Fab, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv-Fc, Fab-scFv, intracellular antibody, BiTE, bifunctional antibody, DART, tandAb, single chain bis-scFvFunctional antibody, single chain bifunctional antibody-CH 3, bifunctional antibody-CH 3, trifunctional antibody, minibody, scFv-CH₃ KIH，scFv-CH-CL-scFv，F(ab′)_2-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knob-in-hole with common light chain and charge pair, charge pair with common light chain, DT-IgG, DutaMab, IgG (H) -scFv, scFv- (H) IgG, IgG (L) -scFv, scFv- (L) IgG, IgG (L, H) -Fv, IgG (H) -V, V (H) -IgG, IgG (L) -V, V (L) -IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv and scFv 4-Ig.

The term "hypervariable region", "CDR region" or "CDR" refers to the region of an antibody variable domain which is hypervariable in sequence and/or forms structurally defined loops. Typically, the antigen binding site of an antibody includes six hypervariable regions: v_HThree of (CDRH1, CDRH2, CDRH3) and V_LThree of (CDRL1, CDRL2, CDRL 3). These regions of the heavy and light chains of the antibody confer antigen-binding specificity to the antibody. CDRs can be defined according to the Kabat system (see Kabat, e.a. et al, 1991, "Sequences of Proteins of Immunological Interest (Sequences of Proteins of Immunological Interest"), 5 th edition, NIH publication No. 91-3242, U.S. department of health and public Services). Other systems can be used to define CDRs, which are systems designed by Chothia et al (see Chothia, c. and Lesk, a.m., 1987, "Canonical structures for the hypervariable regions of immunoglobulins" journal of immunoglobulins "(j.mol.biol.), 196, 901-. Antibodies typically contain 3 heavy chain CDRs and 3 light chain CDRs. The term CDR or CDRs is used herein to denote one or several of these regions. One skilled in the art can readily compare different nomenclature systems and determine whether a particular sequence can be defined as a CDR.

A "human antibody" is an antibody having an amino acid sequence corresponding to that of an antibody produced by a human and/or made using any technique for making human antibodies, and specifically excludes humanized antibodies comprising non-human antigen-binding residues. The term "specific binding" refers to a measurable and reproducible interaction, such as binding between a target and an antibody, which determines the presence of the target in the presence of a heterogeneous population of molecules including biomolecules. For example, an antibody that specifically binds a target (which may be an epitope) is an antibody that binds the target with greater affinity, avidity, more readily, and/or with a longer duration than it binds other targets. In one embodiment, the degree of binding of the antibody to an unrelated target is less than about 10% of the binding of the antibody to the target, as measured, for example, by a Radioimmunoassay (RIA).

An antibody or fragment thereof that specifically binds to the hBMP6 antigen can cross-react with the relevant antigen. Preferably, the antibody or fragment thereof that specifically binds to the hBMP6 antigen does not cross-react with other antigens (but may optionally cross-react with BMP6 of a different species, e.g., rhesus monkey or murine). Can be detected, for example, by immunoassay, BIAcore ^TMOr other techniques known to those skilled in the art to identify antibodies or fragments thereof that specifically bind to the hBMP6 antigen. The antibody or fragment thereof specifically binds to BMP6 antigen and has a higher affinity when bound to hBMP6 antigen than any cross-reactive antigen determined using experimental techniques such as Radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA). Typically, the specific or selective reaction will be at least twice background signal or noise, and more typically more than 10 times background (e.g., more than 15 times, more than 20 times, more than 50 times, or more than 100 times). For a discussion of antibody specificity, see, e.g., Paul eds, 1989, basic Immunology, second edition, Raven Press, New York, p 332-336.

The term "aliphatic amino acid" means that the amino acid R group is non-polar and hydrophobic. Hydrophobicity increases as the number of C atoms in the hydrocarbon chain increases. Glycine, alanine, valine, leucine, and isoleucine are aliphatic amino acids.

The term "aromatic amino acid" means that the amino acid R group contains an aromatic ring system. Phenylalanine, tyrosine and tryptophan are aromatic amino acids.

The term "hydroxyl-containing amino acid" means that the amino acid R group contains a hydroxyl group and is hydrophilic. Serine, cysteine, threonine and methionine are hydroxyl-containing amino acids.

The term "basic amino acid" means that the amino acid R group contains nitrogen and is basic at neutral pH. Histidine, lysine and arginine are basic amino acids.

The term "cyclic amino acid" means that the amino acid R group has an aliphatic cyclic structure. Proline is the only cycloaliphatic amino acid.

The term "acidic amino acid" means that the amino acid R group is polar and negatively charged at physiological pH. Aspartic acid and glutamic acid are acidic amino acids.

The term "amide amino acid" means that the amino acid R group contains an amide group. Asparagine and glutamine are amino acids.

As used herein, a "license number" or "listing license number" refers to a number issued by a regulatory agency that determines that a particular medical product and/or composition can be sold and/or offered for sale in the area under the jurisdiction of the agency. As used herein, "regulatory body" refers to one of the bodies responsible for assessing the safety and efficacy of, for example, medical products and/or compositions, and controlling the sale/distribution of said products and/or compositions in a given area. The Food and Drug Administration (FDA) in the united states and the european drug administration (EPA) in europe are just two examples of such regulatory bodies. Other non-limiting examples may include SDA, MPA, MHPRA, IMA, ANMAT, hong Kong health agency drug office, CDSCO, Medsafe, and KFDA.

As used herein, "buffer" refers to a chemical agent that is capable of absorbing an amount of an acid or base without undergoing a strong pH change.

As used herein, the term "carrier" refers to a diluent, adjuvant (e.g., freund's adjuvant (complete and incomplete)), excipient, or vehicle with which the therapeutic agent is administered. The pharmaceutical carrier can be a sterile liquid, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions may also be employed as liquid carriers, particularly for injectable solutions.

The term "chemotherapeutic agent" or "chemotherapy" refers to a therapeutic agent whose primary purpose is to destroy cancer cells, typically by interfering with the growth or reproductive ability of tumor cells. There are many different types of chemotherapeutic agents, of which over 50 approved chemotherapeutic drugs are available. Chemotherapeutic drugs can be classified based on their mode of action. Alkylating drugs kill cancer cells by directly attacking the genetic material DNA of the gene. Cyclophosphamide is an alkylating drug. Antimetabolites interfere with the production of DNA and do not allow cells to grow and reproduce. An example of an antimetabolite is 5-fluorouracil (5-FU). Antitumor antibiotics are made from natural substances such as fungi in soil. They interfere with important cellular functions, including the production of DNA and cellular proteins. Rubus parvifolius (doxorubicin) and bleomycin (bleomycin) belong to the group of chemotherapeutic drugs. Plant alkaloids prevent cells from dividing normally. Vinblastine (vinblastine) and vincristine (vincristine) are plant alkaloids obtained from the vinca plant. Steroid hormones slow the growth of some hormone-dependent cancers. For example, tamoxifen (tamoxifen) is used to treat breast cancer that is dependent on the growth of hormonal estrogens. DNA Damage Response (DDR) inhibitors, such as PARP inhibitors, block DNA repair mechanisms following single or double strand breaks.

Examples of chemotherapeutic agents include doxorubicin (Adriamycin), rubus parvifolius, 5-fluorouracil, cytarabine (Ara-C), cyclophosphamide, Thiotepa (Thiotepa), Taxotere (Taxotere) (docetaxel), Busulfan (busufan), carcinosin (Cytoxin), Taxol (Taxol), methotrexate, cisplatin, Melphalan (Melphalan), vinblastine, bleomycin, Etoposide (Etoposide), ifosfamide, mitomycin C, Mitoxantrone (Mitoxantrone), vincristine, Vinorelbine (Vinorelbine), Carboplatin (Carboplatin), Teniposide (Teniposide), Daunomycin (Daunomycin), Carminomycin (Carminomycin), carbaminomycin (Aminopterin), actinomycin (actinomycin), mitomycin (mitomycin), mitomycin (Daunomycin), mitomycin (milnacomycin), and related streptomycin (see U.S. patent no. Suitable toxins and chemotherapeutic agents are described in Remington's Pharmaceutical Sciences, 19 th edition (Mack Publishing Co. 1995); and Goodman and Gilman, Pharmacological Basis of Therapeutics (The Pharmacological Basis of Therapeutics), 7 th edition (Macmillen Publishing Co., Macmillan Publishing 1985). Another example of a chemotherapeutic agent is a class of antibody-binding toxins, including, but not limited to, pyrrolobenzodiazepines, maytansinoids, calicheamicins (calicheamicins), and the like. Other suitable toxins and/or chemotherapeutic agents are known to those skilled in the art.

As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients (e.g., an antibody of the invention), in the amounts optionally specified, as well as any product which results, directly or indirectly, from combination of the specified ingredients, in the amounts optionally specified.

As used herein, the term "comprising" relates to antibodies, fragments, uses, compositions, methods, and uses of their respective components, which are essential to the method or composition, but still comprise unspecified elements, whether or not essential.

The term "consisting of … …" refers to an antibody, fragment, use, composition, method, and corresponding components thereof as described herein, which does not include any elements not listed in the description of the embodiments.

As used herein, the term "consisting essentially of … …" refers to those elements required for a given embodiment. The terms allow for the presence of elements that do not substantially affect the basic and novel or functional features of the described embodiments.

In the context of polypeptides, the term "derivative" as used herein includes polypeptides comprising the amino acid sequence of an hBMP6 polypeptide, an hBMP6 polypeptide fragment, or an antibody or fragment that specifically binds an hBMP6 polypeptide altered by the introduction of amino acid residue substitutions, deletions or additions. The term "derivative" as used herein also includes hBMP6 polypeptides, hBMP6 polypeptide fragments, or antibodies that specifically bind to hBMP6 polypeptides that have been chemically modified, e.g., by covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, the hBMP6 polypeptide, hBMP6 polypeptide fragment, or hBMP6 antibody may be chemically modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, and the like. The derivatives are modified in a manner that differs from the naturally occurring or starting peptide or polypeptide in the type or position of the linker molecule. Derivatives further include the deletion of one or more chemical groups naturally present on the peptide or polypeptide. The hBMP6 polypeptide, hBMP6 polypeptide fragment, or derivatives of the hBMP6 antibody may be chemically modified by chemical modifications using techniques known to those skilled in the art, including but not limited to specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, and the like. In addition, the hBMP6 polypeptide, hBMP6 polypeptide fragment, or derivative of the hBMP6 antibody may contain one or more than one non-canonical amino acid. The polypeptide derivative has similar or same functions as the hBMP6 polypeptide, the hBMP6 polypeptide fragment or the hBMP6 antibody.

The term "effector function" (or "effector activation") as used herein refers to one or more of antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC) -mediated responses, Fc-mediated phagocytosis or antibody-dependent cellular phagocytosis (ADCP) and antibody recycling via FcRn receptors.

An "effective amount" is an amount effective to achieve the desired effect (including a therapeutic or prophylactic result) at the dosages and periods necessary. By "therapeutically effective amount" is meant the minimum concentration required to achieve measurable improvement or prevention of a particular condition. The therapeutically effective amount herein may vary depending on such factors as: the disease state, the age, sex, and weight of the patient, and the ability of the antibody to elicit a desired response in the individual. A therapeutically effective amount is also one in which the toxic or deleterious effects of the antibody outweigh the therapeutically beneficial effects. A "prophylactically effective amount" is an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. In some embodiments, an effective amount of an antibody of the invention is from about 0.1mg/kg (mg antibody/kg body weight of the individual) to about 100 mg/kg. In certain embodiments, an effective amount of an antibody provided therein is about 0.1mg/kg, about 0.5mg/kg, about 1mg/kg, 3mg/kg, 5mg/kg, about 10mg/kg, about 15mg/kg, about 20mg/kg, about 25mg/kg, about 30mg/kg, about 35mg/kg, about 40mg/kg, about 45mg/kg, about 50mg/kg, about 60mg/kg, about 70mg/kg, about 80mg/kg, about 90mg/kg, or about 100mg/kg (or ranges therein). In some embodiments, an "effective amount" as used herein also refers to an amount of an antibody of the invention that achieves a specified result (e.g., inhibits the biological activity of hBMP6 of a cell).

The term "epitope" as used herein refers to a localized region on the surface of an antigen, such as a hBMP6 polypeptide or hBMP6 polypeptide fragment, which is capable of binding to one or more antigen binding regions of an antibody and has antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably a human, which is capable of eliciting an immune response. An epitope with immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope having antigenic activity is a portion of a polypeptide to which an antibody specifically binds, as determined by any method well known in the art, e.g., by an immunoassay as described herein. Antigenic epitopes are not necessarily immunogenic. An epitope is usually composed of chemically active surface groups of molecules such as amino acids or sugar side chains and has specific three-dimensional structural characteristics as well as specific charge characteristics. Regions of a polypeptide contributing to an epitope may be contiguous amino acids of the polypeptide, or an epitope may be grouped together by two or more non-contiguous regions of the polypeptide. An epitope may or may not be a three-dimensional surface feature of an antigen. In certain embodiments, the hBMP6 epitope is a three-dimensional surface feature of the hBMP6 polypeptide (e.g., as a trimer of the hBMP6 polypeptide). In other embodiments, the hBMP6 epitope is a linear feature of the hBMP6 polypeptide (e.g., in the trimeric or monomeric form of the hBMP6 polypeptide). The antibodies provided herein can specifically bind to an epitope of the monomeric (denatured) form of hBMP6, an epitope of the trimeric (native) form of hBMP6, or both monomeric (denatured) and trimeric (native) forms of hBMP 6. In particular embodiments, the antibodies provided herein specifically bind to an epitope of the trimeric form of hBMP6, but do not specifically bind to the monomeric form of hBMP 6.

The term "excipient" as used herein refers to inert substances commonly used as diluents, vehicles, preservatives, binders or pharmaceutical stabilizers, and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylates, etc.), surfactants (e.g., SDS, polysorbates, nonionic surfactants, etc.), sugars (e.g., sucrose, maltose, trehalose, etc.), and polyols (e.g., mannitol, sorbitol, etc.). See also "Remington pharmaceutical sciences (1990) Mack Publishing Co., Iston, Pa., which is hereby incorporated by reference in its entirety.

In the context of a peptide or polypeptide, the term "fragment" as used herein refers to a peptide or polypeptide comprising less than the full-length amino acid sequence. Such fragments may result, for example, from truncation at the amino terminus, truncation at the carboxy terminus, and/or internal deletion of residues from the amino acid sequence. Fragments may be generated, for example, by alternative RNA splicing or in vivo protease activity. In certain embodiments, a BMP6 fragment comprises a polypeptide comprising an amino acid sequence of at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, or at least 250 consecutive amino acid residues of an amino acid sequence of a hBMP6 polypeptide or an antibody that specifically binds to a hBMP6 polypeptide. In a particular embodiment, the hBMP6 polypeptide fragment or antibody that specifically binds to the hBMP6 antigen retains at least 1, at least 2, or at least 3 of the functions of the polypeptide or antibody.

The term "free" may refer to a polypeptide, such as BMP6 or fragments and variants thereof, in combination with a buffer, wherein the polypeptide does not bind to the cell surface or cell membrane. Thus, the term "free" may refer to a polypeptide that is capable of surface expression (i.e., comprises one or more transmembrane or membrane-binding domains), but that in the present state does not express or bind to a protein expressed on the surface of a cell. Free polypeptide may also refer to free recombinant or native or unbound polypeptide. In the context of phage display, free antigen can be selected in solution (referred to herein as "soluble selection") or adsorbed to a surface, for example to the surface of a 96-well plate (referred to herein as "biopanning selection").

The term "fusion protein" as used herein refers to a polypeptide comprising the amino acid sequence of an antibody and the amino acid sequence of a heterologous polypeptide or protein, i.e., a polypeptide or protein that is not typically part of an antibody (e.g., a non-anti-BMP 6 antigen antibody). The term "fusion", when used with BMP6 or an anti-BMP 6 antibody, refers to the linkage of a peptide or polypeptide, or fragment, variant and/or derivative thereof, to a heterologous peptide or polypeptide. Preferably, the fusion protein retains the biological activity of BMP6 or an anti-BMP 6 antibody. In certain embodiments, the fusion protein comprises the BMP6 antibody VH domain, VL domain, VH CDRs (one, two, or three VH CDRs), and/or VL CDRs (one, two, or three VL CDRs), wherein the fusion protein specifically binds to BMP6 epitope.

When used with respect to antibodies, the term "heavy chain" refers to five different types of amino acid sequences based on the constant domain of the heavy chain, referred to as α, δ, ε, γ, and μ. The different types of heavy chains are well known and produce five classes of antibodies, IgA, IgD, IgE, IgG and IgM, respectively, including the four subclasses of IgG, namely IgG1, IgG2, IgG3 and IgG 4. Preferably, the heavy chain is a human heavy chain. In the human population, there are multiple heavy chain constant region alleles for each immunoglobulin or immunoglobulin subclass. The nucleotide and amino acid sequences of the allelic variants are available in publicly available databases such as IMGT, ENSEMBL Swiss-Prot and Uniprot. Allelic variants may also be identified in various genome sequencing projects. In one embodiment, the antibodies and antibody fragments disclosed herein comprise heavy chains encoded by IgG1 constant region alleles, including, but not limited to, human IGHG1 @ 01(Seq ID Nos: 340, 341, and 537), IGHG1 @ (Seq ID Nos: 340, 341, and 537), IGHG1 @ 03(Seq ID Nos: 523 and 524), IGHG1 @ 04(Seq ID Nos: 525 and 526), and IGHG1 @ 05(Seq ID Nos: 340, 341, and 537). In one embodiment, the antibodies and antibody fragments disclosed herein comprise proteins encoded by IgG2 constant region alleles, including, but not limited to, human IGHG2a 01(Seq ID nos. 527 and 528), IGHG2a 02(Seq ID nos: 529 and 530), IGHG2a 03(Seq ID nos. 527 and 528), IGHG2a 04(Seq ID nos: 531 and 532), IGHG2a 05(Seq ID nos: 527 and 528), and IGHG2a 06(Seq ID nos: 533 and 534). In one embodiment, the antibodies or antibody fragments disclosed herein comprise proteins encoded by IgG3 constant region alleles, including but not limited to human IGHG3 × 01, IGHG3 × 02, IGHG3 × 03, IGHG3 × 04, IGHG3 × 05, IGHG3 × 06, IGHG3 × 07, IGHG3 × 08, IGHG3 × 09, IGHG3 × 10, IGHG3 × 11, IGHG3 × 12, IGHG3 × 13, IGHG3 × 14, IGHG3 × 15, IGHG3 × 16, IGHG3 × 17, IGHG3 × 18, and IGHG3 × 19. In one embodiment, the antibodies or antibody fragments disclosed herein comprise proteins encoded by IgG4 constant region alleles, including, but not limited to, human IGHG4 ×. 01 (see, e.g., the sequence listing herein), IGHG4 ×. 02 (see, e.g., the sequence listing herein), IGHG4 ×. 03 (see, e.g., the sequence listing herein), and IGHG4 ×. 04 (see, e.g., the sequence listing herein). In another example, the heavy chain is a forbidden IgG isotype, e.g., forbidden IgG 4. In certain embodiments, the antibodies of the invention comprise a human gamma 4 constant region. In another embodiment, the heavy chain constant region does not bind to an Fc-gamma receptor and, for example, comprises a Leu235Glu mutation. In another embodiment, the heavy chain constant region comprises a Ser228Pro mutation to increase stability. In another embodiment, the heavy chain constant region is IgG4-PE (see, e.g., the sequence listing herein). In another embodiment, the antibodies and antibody fragments disclosed herein comprise heavy chain constant regions encoded by murine IgG1 constant region alleles, including but not limited to mouse IGHG1 x 01 or IGHG1 x 02. In one embodiment, the antibodies and antibody fragments disclosed herein comprise heavy chain constant regions encoded by murine IgG2 constant region alleles, including, but not limited to, mouse IGHG2A x 01, IGHG2A x 02, IGHG2B x 01, IGHG2B x 02, IGHG2C x 01, IGHG2C x 02, or IGHG2C x 03. In one embodiment, the antibodies or antibody fragments disclosed herein comprise a protein encoded by a murine IgG3 constant region allele, including but not limited to mouse IGHG3 x 01.

The term "host" as used herein refers to an animal, preferably a mammal, and most preferably a human.

The term "host cell" as used herein refers to a particular individual cell transfected with a nucleic acid molecule and to the progeny or potential progeny of such a cell. Progeny of such cells may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences or integration of the nucleic acid molecule into the host cell genome that may occur in such progeny.

The term "combination" in the context of administering other therapies refers to the use of more than one therapy. The use of the term "combination" does not limit the order in which the therapies are administered to an individual with a disease. The first therapy may be administered prior to (e.g., 1 minute, 45 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks), concurrently with, or after (e.g., 1 minute, 45 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks) administration of the second therapy to a subject suffering from, having, or susceptible to a BMP6 mediated disease. Any additional therapy may be administered in any order with other additional therapies. In certain embodiments, an antibody of the invention may be administered in combination with one or more therapies (e.g., therapies other than the antibody of the invention that are currently administered for preventing, treating, managing and/or ameliorating BMP 6-mediated diseases). Non-limiting examples of therapies that can be administered in combination with the antibodies of the invention include analgesics, anesthetics, antibiotics or immunomodulators or any other agent listed in the united states pharmacopeia and/or physician's docket.

As used herein, "injection device" refers to a device designed for performing an injection, the injection comprising the step of temporarily fluidly connecting the injection device to human tissue, typically subcutaneous tissue. Injecting further comprises administering an amount of the liquid drug into the tissue and separating or removing the injection device from the tissue. In some embodiments, the injection device may be an intravenous device or an IV device, which is one used when the target tissue is blood within the circulatory system (e.g., blood in a vein). Common but non-limiting examples of injection devices are needles and syringes.

As used herein, "instructions" refer to displaying written, printed, or graphic material on a direct container of an article, such as written material displayed on a vial containing a pharmaceutically active agent, or details regarding the composition and use of a related product included in a kit containing a related composition. The instructions set forth contemplated methods of treatment that are administered or performed.

An "isolated" or "purified" antibody or protein is one that has been identified, isolated and/or recovered from a component (e.g., native or recombinant) of its production environment. For example, the antibody or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the antibody is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The term "substantially free of cellular material" includes antibody preparations in which the antibody is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, an antibody that is substantially free of cellular material includes antibody preparations having less than about 30%, 20%, 10%, or 5% (by dry weight) heterologous protein (also referred to herein as "contaminating protein"). When the antibody is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the protein formulation. When the antibody is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in protein synthesis. Thus, the antibody preparation has less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the relevant antibody. In a preferred embodiment, the antibody of the invention is isolated or purified.

The term "Kabat numbering" and like terms are art-recognized and refer to the numbering system of amino acid residues that are more variable (i.e., hypervariable) than other amino acid residues in the heavy chain variable region of an antibody or antigen-binding portion thereof (Kabat et al, (1971) New York academy of sciences Ann.NY Acad.Sci.), 190: 382 Across 391; and Kabat et al, (1991) protein sequences of immunological interest, fifth edition, department of health and public service, NIH publication Nos. 91-3242). For the heavy chain variable region, the hypervariable regions typically range from amino acid positions 31 to 35 of CDR1, amino acid positions 50 to 65 of CDR2, and amino acid positions 95 to 102 of CDR 3.

As used herein, "label" or "labeled" refers to the addition of a detectable moiety to the polypeptide, such as a radioactive label, a fluorescent label, an enzymatic label, a chemiluminescent label, or a biotinylation group or gold. The radioisotope or radionuclide may include³H、¹⁴C、¹⁵N、³⁵S、⁹⁰Y、⁹⁹Tc、¹¹⁵In、¹²⁵I、¹³¹I, the fluorescent label may comprise rhodamine (rhodamine), lanthanide phosphor or FITC, and the enzymatic label may comprise horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase. Other labels include (by way of illustration and not limitation): enzymes, such as glucose-6-phosphate dehydrogenase ("G6 PDH"), alpha-D-galactosidase, glucose oxidase, glucoamylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, and peroxidase; dyes (e.g. cyanine dyes, e.g. Cy5 ^TM、Cy5.5^TMOr Cy7^TM) (ii) a Additional fluorescent labels or agents include, for example, fluorescein and its derivatives, fluorochromes, GFP (GFP is "Green fluorescent protein "), other fluorescent proteins (e.g., mCherry, mTomato), dansyl (dansyl), umbelliferone (umbelliferone), phycoerythrin (phytoerythrin), phycocyanin (phytoyanin), allophycocyanin (allophycocyanin), o-phthaldehyde, and fluorescamine; fluorophores, such as cryptates and chelates of lanthanides, e.g., europium and the like (perkin elmer and Cisbio assays); chemiluminescent labels or agents, such as isoluminol, luminol, and dioxetane; a sensitizer; a coenzyme; an enzyme substrate; particles, such as latex or carbon particles; a metal sol; microcrystals; a liposome; cells, etc., which may be further labeled with a dye, catalyst, or other detectable group; molecules such as biotin, digoxigenin (digoxgenin) or 5-bromodeoxyuridine; a toxin moiety, for example a toxin moiety selected from the group consisting of: pseudomonas exotoxin (PE or a cytotoxic fragment or mutant thereof), diphtheria toxin or a cytotoxic fragment or mutant thereof, botulinum toxin A, B, C, D, E or F, ricin or a cytotoxic fragment thereof such as ricin a, abrin or a cytotoxic fragment thereof, saporin or a cytotoxic fragment thereof, pokeweed antiviral toxin or a cytotoxic fragment thereof, and bryodin 1 or a cytotoxic fragment thereof.

The term "light chain" when used with respect to an antibody refers to an immunoglobulin light chain, where two types, λ and κ, are present in mammals. Preferably, the light chain is a human light chain. Preferably, the light chain constant region is a human constant region. In the human population, there are multiple light chain constant region alleles. The nucleotide and amino acid sequences of the allelic variants are available in publicly available databases such as IMGT, ENSEMBL, Swiss-Prot and Uniprot. In one embodiment, the antibodies or antibody fragments disclosed herein comprise proteins encoded by human kappa constant region alleles, including but not limited to IGKC 01 (see, e.g., sequence listing herein), IGKC 02 (see, e.g., sequence listing herein), IGKC 03 (see, e.g., sequence listing herein), IGKC 04 (see, e.g., sequence listing herein), and IGKC 05 (see, e.g., sequence listing herein). In one embodiment, the antibodies or antibody fragments disclosed herein comprise a protein encoded by a human lambda constant region allele, including, but not limited to, IGLC1 x 01 (see, e.g., sequence listing herein), IGLC1 x 02 (see, e.g., sequence listing herein), IGLC2 x 01 (see, e.g., sequence listing herein), IGLC2 x 02 (see, e.g., sequence listing herein), IGLC2 x 03 (see, e.g., sequence listing herein), IGLC3 x 01 (see, e.g., sequence listing herein), IGLC3 x 02 (see, e.g., sequence listing herein), IGLC3 x 03 (see, e.g., sequence listing herein), IGLC3 x 04 (see, e.g., sequence listing herein), IGLC6 x 01 (see, e.g., sequence listing herein), IGLC7 x 01 (see, e.g., sequence listing herein), IGLC7 x 02 (see, e.g., sequence listing herein), IGLC7 x 03 (see, e.g., sequence listing herein). In another embodiment, the antibodies and antibody fragments disclosed herein comprise a light chain constant region encoded by a mouse kappa constant region allele, including but not limited to IGKC 01, IGKC 03, or IGKC 03. In another embodiment, the antibodies and antibody fragments disclosed herein comprise light chain constant regions encoded by mouse λ constant region alleles, including but not limited to IGLC1 × 01, IGLC2 × 01, or IGLC3 × 01.

"percent (%) amino acid sequence identity" and "homology" with respect to a peptide, polypeptide, or antibody sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the particular peptide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity and not considering any conservative substitutions as part of the sequence identity. Alignment for determining percent amino acid sequence identity can be achieved in a variety of ways within the scope of the art, e.g., using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEG ALIGN^TM(DNASTAR) software. In one embodiment, the% homology is about 70%. In one embodiment, the% homology is about 75%. In one embodiment, the% homology is about 80%. In one embodiment, the% homology is about 85%. In one embodiment, the% homology is about 90%. In one embodiment, the% homology is about 92%. In one embodiment, the% homology is about 95%. In one embodiment, the% homology is about 97%. In one embodiment, the same asThe% of source is about 98%. In one embodiment, the% homology is about 99%. In one embodiment, the% homology is 100%.

The terms "naturally-occurring" or "native" when used in connection with biological materials, such as nucleic acid molecules, polypeptides, host cells, and the like, refer to those that are found in nature and are not manipulated by humans.

As used herein, "packaging" refers to how components are organized and/or bound into units suitable for distribution and/or use. Packaging may include, for example, boxes, bags, syringes, ampoules, vials, tubes, clamshell packaging, barriers, and/or containers to maintain sterility, labeling, and the like.

The term "pharmaceutically acceptable" as used herein means approved by a regulatory agency of the federal or a state government or listed in the U.S. pharmacopeia, european pharmacopeia, or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

As used herein, the terms "polynucleotide," "nucleotide," "nucleic acid molecule," and other similar terms are used interchangeably and include DNA, RNA, mRNA, and the like.

As used herein, the term "prevention" refers to the complete or partial inhibition of the development, recurrence, onset, or spread of the hBMP 6-mediated disease and/or its associated symptoms, resulting from administration of a therapy or combination of therapies provided herein (e.g., a combination of prophylactic or therapeutic agents such as an antibody of the invention).

The term "soluble" refers to polypeptides, such as BMP6 and variants or fragments thereof, that exist in native or membrane-bound form and that lack one or more than one transmembrane or cytoplasmic domain. In one embodiment, the "soluble" form of BMP6 lacks a transmembrane domain and a cytoplasmic domain.

The term "individual" or "patient" refers to any animal, including but not limited to mammals. As used herein, the term "mammal" refers to any vertebrate that nurses a baby and either gives birth to a live baby (either a true subclass mammalia or a placental mammal) or spawns (either a postzoo subclass or a non-placental mammal). Examples of mammalian species include, but are not limited to, humans and other primates, including non-human primates, such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats, and horses; domestic mammals such as dogs and cats; laboratory animals, including rodents, such as mice, rats (including cotton rats) and guinea pigs; birds, including domestic, wild and game birds, such as chickens, turkeys and other gallinaceous chickens, ducks, geese, and the like.

As used herein, "substantially all" means at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

As used herein, the term "therapeutic agent" refers to any agent useful for treating, managing or ameliorating BMP 6-mediated diseases and/or symptoms associated therewith. In certain embodiments, the term "therapeutic agent" refers to an antibody of the invention. In certain other embodiments, the term "therapeutic agent" refers to an agent other than an antibody of the invention. Preferably, the therapeutic agent is an agent known to be useful, or already or currently used, in the treatment, management or amelioration of BMP6 mediated disease or one or more symptoms associated therewith. In a particular embodiment, the therapeutic agent is a fully human anti-BMP 6 antibody, such as a fully human anti-BMP 6 monoclonal antibody.

As used herein, the term "therapy" refers to any regimen, method and/or agent that can be used to prevent, manage, treat and/or ameliorate BMP 6-mediated diseases (e.g., cancer). In certain embodiments, the term "therapy" refers to biological, supportive, and/or other therapies useful for preventing, managing, treating, and/or ameliorating BMP6 mediated diseases known to those of skill in the art, such as physicians.

The term "treatment" refers to a reduction or amelioration in the progression, severity and/or duration of an hBMP 6-mediated disease (e.g., cancer) resulting from the administration of one or more therapies, including, but not limited to, the administration of one or more prophylactic or therapeutic agents, such as an antibody of the invention. In particular embodiments, the terms refer to a reduction or inhibition of binding of hBMP6 to a BMP receptor or HJV, and/or an inhibition or reduction of one or more symptoms associated with BMP 6-mediated diseases such as anemia.

The term "variable region" or "variable domain" refers to a portion of the light and heavy chains, typically about the amino-terminal 120 to 130 amino acids in the heavy chain and about 100 to 110 amino acids in the light chain, which vary widely in sequence among antibodies and are used for the binding and specificity of each particular antibody for its particular antigen. The variability of the sequence is concentrated in those regions called Complementarity Determining Regions (CDRs), while the more highly conserved regions in the variable domains are called Framework Regions (FRs). BMP6 and the CDRs of the heavy chain are primarily responsible for antibody-antigen interactions. The numbering of amino acid positions as used herein is according to the EU index, as in Kabat et al, (1991) protein sequences of immunological interest (department of health and public services of the united states, Washington, d.c.) 5 th edition ("Kabat et al"). In a preferred embodiment, the variable region is a human variable region.

Definitions of common terms in cell biology and molecular biology can be found in "Manual of Diagnosis and treatment of Merck (The Merck Manual of Diagnosis and Therapy"), 19 th edition, published by Merck Research Laboratories 2006(ISBN 0-911910-19-0); robert S.Porter et al (eds.), (The Encyclopedia of Molecular Biology), published by Blackwell Science Ltd., 1994(ISBN 0-632-; benjamin Lewis, "Gene X (genes X)," published by Jones & Bartlett Publishing, 2009 (ISBN-10: 0763766321); kendrew et al (eds.), "molecular biology and biotechnology: comprehensive case Reference (Molecular Biology and Biotechnology: a Comprehensive Desk Reference), published by VCH Publishers, Inc., 1995(ISBN 1-56081-; and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan, et al.

Unless otherwise indicated, the invention is carried out using standard procedures, as described, for example, in the following documents: sambrook et al, molecular cloning: a Laboratory Manual (4 th edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012); davis et al, "Basic Methods in Molecular Biology," Science Methods ", Elsevier Science Publishing, Inc., N.Y., USA (New York, USA) (1995); or "methods in enzymology: molecular Cloning guidelines (Methods in Enzymology: Guide to Molecular Cloning technologies), Vol.152, eds.L.Berger and A.R.Kimmel, Academic Press Inc. (Academic Press Inc.), San Diego, USA (1987); current Protocols for Protein Science (CPPS) (edited by John e, coligan et al, John Wiley and Sons, Inc.); current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et al, John Willi, parent publishing Co., Ltd.); and culture of animal cells: a Basic technical Manual (Culture of Animal Cells: A Manual of Basic technical), R.Ian Freshney, publisher: Wiley-Liss; 5 th edition (2005); animal Cell Culture Methods (Methods in Cell Biology), Vol.57, Jennie P.Mather and David Barnes eds, academic Press, 1 st edition, 1998), all of which are incorporated herein by reference in their entirety.

Other terms are defined herein in the description of the various aspects of the invention.

BMP6 and iron

Since iron is the basis of all life forms and must be derived from the environment, availability and usage in the body is tightly controlled. A key regulator of iron homeostasis is a peptide hormone of 25 amino acids, called hepcidin. Hepcidin is produced by the liver and, by controlling the expression of the ferroportin molecule, the membrane ferroportin, causes the major iron uptake and storage compartment, i.e., the duodenal cells and macrophages, to retain iron. After activation of the immune system during infection and/or inflammation and by erythropoiesis, hepcidin itself is regulated by iron content via homeostatic control mechanisms. Importantly, hepcidin levels are elevated in chronic inflammatory conditions, infections, and certain cancers. The increased hepcidin content chelates iron in intestinal cells, macrophages and liver cells, thereby inhibiting hemoglobin synthesis and erythropoiesis. This results in anemia despite normal iron reserves. Hepcidin gene expression is controlled by a soluble factor called BMP6 (bone morphogenic protein 6). BMP6 was considered to be the major regulator because cytokines (or other BMPs) alone could not overcome the drawbacks of BMP6 signaling in the absence of BMP 6. Thus, the present inventors have focused on BMP6 as a key drug target for controlling abnormal iron homeostasis in anemia, e.g., in Anemia of Chronic Disease (ACD).

BMP6 is a highly conserved soluble protein factor that is considered a "major" regulator of hepcidin production in mice and humans. Thus, administration of BMP6 to mice increased hepcidin levels and decreased blood and serum iron, as opposed to inhibitors of BMP 6. In addition, knock-out or human mutation of the mouse BMP6 gene within the BMP6 pathway supports a key role for BMP6 in controlling hepcidin and blood and serum iron levels. Furthermore, preclinical and clinical validation of targeting BMP6 resulted from increasing the available iron content by administering an anti-BMP 6 antibody to rodents or cynomolgus monkeys or neutralizing BMP6 with HJV-Fc (FMX-8, Ferrumax Inc) in a phase I study, respectively. Reference is made to Andriopoulos jr.b, coradini E, Xia Y, faass SA, Chen S, Grgurevic L, Knutson MD, pierrangelo a, vukivic S, Lin HY and babit.2009. BMP-6 is a key endogenous regulator of hepcidin expression and iron metabolism. Nature genetics (nat. Genet.) 41(4), 482-487; WO2016098079 and US 8980582.

anti-BMP 6 antibodies and fragments

The invention provides various anti-BMP 6 antibodies and fragments (such as Fab or scFv fragments), uses, methods and combinations (e.g. in combination with ESAs). Examples are listed in the following numbered clauses.

1. An antibody or fragment comprising a binding site that specifically binds bone morphogenetic protein 6(BMP6), wherein the binding site comprises a VH domain encoded by a recombinant nucleotide sequence derived from a human VH gene segment, a DH gene segment, and a JH gene segment, wherein the VH gene segment is selected from IGHV3-11 and IGHV 1-3.

For example, the VH gene segment is IGHV3-11 and the DH and JH gene segments are human gene segments. For example, the VH gene segment is IGHV1-3 and the DH and JH gene segments are human gene segments. Optionally, the VH segment is a human IGHV3-11 x 01 gene segment. Alternatively, optionally the VH segment is a human IGHV1-3 x 01 gene segment.

In one example, the specific binding has KD, K as further described below_offAnd/or K_on. In one example, the specific binding has a KD of 1pM to 5 nM.

Those skilled in the art are familiar with databases and other sources of antibody gene segments from humans and other species. For example, the IMGT database (www.IMGT.org) is a suitable source, such as a 9 month 1 day version in 2018.

Referring to tables 7 and 8, antibodies based on IGHV1-3 are shown. Surprisingly, the human VH gene segments produce anti-BMP 6 antibodies with the desired anti-BMP 6 properties, such as those described in the examples, for example.

Referring to Table 9, antibodies based on IGHV3-11 are shown. Surprisingly, the human VH gene segments produce anti-BMP 6 antibodies with the desired anti-BMP 6 properties, such as those described in the examples, for example. Thus, for example, the antibody or fragment comprises an amino acid sequence selected from SEQ ID NOs: 110. 113, 290, 293, 308, 311, 272 and 275. For example, the antibody or fragment comprises an amino acid sequence selected from SEQ ID NOs: 119. 122, 299, 302, 317, 320, 281 and 284. For example, the antibody or fragment comprises an amino acid sequence selected from SEQ ID NOs: 110. 113, 290, 293, 308, 311, 272 and 275 and a CDRH3 sequence selected from SEQ ID NOs: 119. 122, 299, 302, 317, 320, 281 and 284.

For example, the antibody or fragment comprises an amino acid sequence selected from SEQ ID NOs: 110 and 113 CDRH3 sequences; and a sequence selected from SEQ ID NO: 119 and 122, CDRL3 sequences. For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 110, which is identical to a VH domain comprising SEQ ID NO: 119, and VL domain pairing. For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 113, which hybridizes to a VH domain comprising SEQ ID NO: 122, in the VL domain pair.

For example, the antibody or fragment comprises the CDRH3 sequence of an antibody selected from the group consisting of CL-58838, CL-58835, CL-58756 and CL-58722 and optionally the CDRL3 of the selected antibody. For example, the antibody or fragment comprises the CDRH1 and CDRH3 sequences of an antibody selected from the group consisting of CL-58838, CL-58835, CL-58756 and CL-58722 and optionally the CDRL2 of the selected antibody. For example, the antibody or fragment comprises the CDRH1 and CDRH2 sequences of an antibody selected from the group consisting of CL-58838, CL-58835, CL-58756 and CL-58722. For example, the antibody or fragment comprises the CDRH2 and CDRH3 sequences of an antibody selected from the group consisting of CL-58838, CL-58835, CL-58756 and CL-58722. For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises a VH domain comprising the CDRH3 sequence of CL-58838, which is paired with a VL domain of CL-58838.

For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 114. 294, 312 or 276, optionally with a VH domain comprising SEQ ID NO: 123. 303, 321 or 285. For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises a heavy chain variable region comprising SEQ ID NO: 114, which hybridizes to a VH domain comprising SEQ ID NO: 123 is paired with the VL domain.

For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises a VH domain of an antibody selected from the group consisting of CL-58838, CL-58835, CL-58756 and CL-58722, which is optionally paired with a VL domain of the selected antibody. For example, the antibody or fragment comprises an anti-BMP 6 binding site, wherein the binding site comprises the VH domain of CL-58838, which is paired with the VL domain of CL-58838.

2. The antibody or fragment according to clause 1, wherein the DH gene segment is a human gene segment selected from the group consisting of IGHD3-10, IGHD6-19, IGHD7-27, IGHD4-23, IGHD5-18, IGHD3-22, and IGHD 3-16.

Optionally, the DH gene segment is selected from IGHD3-10 x 01, IGHD6-19 x 01, IGHD7-27 x 02, IGHD4-23 x 01, IGHD5-18 x 01, IGHD3-22 x 01, and IGHD3-16 x 02.

3. The antibody or fragment according to clause 1 or 2, wherein the JH gene segment is a human gene segment selected from IGHJ3, IGHJ4, and IGHJ 5.

Optionally, the JH gene segment is selected from IGHJ3 x 02, IGHJ4 x 02 and IGHJ5 x 02.

4. An antibody or fragment which specifically binds bone morphogenetic protein 6(BMP6) and comprises the CDRH3 sequence of an anti-BMP 6 antibody according to any preceding clause.

5. An antibody or fragment that specifically binds bone morphogenic protein 6(BMP6) and comprises a VH domain comprising the CDRH3 sequence of any anti-BMP 6 antibody disclosed herein (e.g., any antibody selected from the antibodies or fragments listed in any one of tables 4-11 herein), or the CDRH3 sequence comprises 3, 2, or 1 amino acid substitutions.

6. An antibody or fragment (optionally according to any preceding clause) that specifically binds bone morphogenetic protein 6(BMP6) and comprises a VH domain comprising the CDRH3 sequence of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or the sequence comprises 3, 2 or 1 amino acid substitutions.

Optionally, the VH domain comprises a sequence selected from SEQ ID NO: 110 or 113, or said selected sequence comprises 3, 2 or 1 amino acid substitutions.

7. The antibody or fragment according to clause 6, wherein the VH domain comprises (i) a CDRH3 sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, and CL-58713; or the CDRH3 sequence comprises 3, 2 or 1 amino acid substitutions; and (ii) the CDRH1 sequence of the selected antibody; or the CDRH1 sequence comprises 3, 2 or 1 amino acid substitutions.

Optionally, the VH domain of the antibody or fragment comprises (a) SEQ ID NO: 110 or 113 CDRH3 sequence; or the CDRH3 sequence comprises 3, 2 or 1 amino acid substitutions; and (b) SEQ ID NO: 108 or 111, or said CDRH1 sequence comprises 3, 2 or 1 amino acid substitutions.

8. The antibody or fragment according to clause 6 or 7, wherein the VH domain comprises (iii) the CDRH3 sequence of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or the CDRH3 sequence comprises 3, 2 or 1 amino acid substitutions; and (iv) the CDRH2 sequence of the selected antibody; or the CDRH2 sequence comprises 3, 2 or 1 amino acid substitutions.

Optionally, the VH domain of the antibody or fragment comprises (c) SEQ ID NO: 110 or 113 CDRH3 sequence; or the CDRH3 sequence comprises 3, 2 or 1 amino acid substitutions; and (d) SEQ ID NO: 109 or 112, or said CDRH2 sequence comprises 3, 2 or 1 amino acid substitutions.

Optionally, the VH domain of the antibody or fragment comprises (e) SEQ ID NO: 110 or 113 CDRH3 sequence; or the CDRH3 sequence comprises 3, 2 or 1 amino acid substitutions; (f) SEQ ID NO: 108 or 111, or the CDRH1 sequence comprises 3, 2, or 1 amino acid substitutions; and (g) SEQ ID NO: 109 or 112, or said CDRH2 sequence comprises 3, 2 or 1 amino acid substitutions.

9. An antibody or fragment (optionally according to any preceding clause) comprising a binding site that specifically binds bone morphogenic protein 6(BMP6), wherein the binding site comprises a VH domain comprising the amino acid sequence of the VH domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

Optionally, the VH domain of the antibody or fragment comprises SEQ ID NO: 114, or an amino acid sequence identical to SEQ ID NO: 114 has at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity. For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

10. An antibody or fragment according to any preceding clause, which comprises first and second copies of the VH domain.

In one example, the antibody or fragment comprises a binding site comprising a VH domain of the invention paired with a VL domain of the invention, wherein the binding site is capable of specifically binding BMP6 (e.g. mature BMP6, e.g. human and/or cynomolgus monkey BMP 6). For example, the antibody or fragment comprises two of these binding sites.

11. An antibody or fragment (optionally according to any preceding clause) comprising a binding site that specifically binds bone morphogenetic protein 6(BMP6), wherein said binding site comprises a VL domain encoded by a recombined nucleotide sequence derived from a human VL gene segment and a JL gene segment, wherein said VL gene segment is selected from IGKV3-20, IGKV1-5 and IGKV 3-15.

For example, the VL gene segment is IGKV3-20, e.g., IGKV3-20 x 01. For example, the VL gene segment is IGKV1-5, e.g., IGKV1-5 × 03. For example, the VL gene segment is IGKV3-15, e.g., IGKV3-15 x 01.

12. The antibody or fragment according to clause 11, wherein the VL is vk and the JL gene segment is a human gene segment selected from IGKJ1 and IGKJ 3.

Optionally, the JL gene segments are selected from IGKJ1 x 01 and IGKJ3 x 01.

13. An antibody or fragment that specifically binds bone morphogenetic protein 6(BMP6) and comprises the CDRL3 sequence of the anti-BMP 6 antibody according to clause 11 or 12.

14. An antibody or fragment (optionally according to any preceding clause) that specifically binds bone morphogenic protein 6(BMP6) and comprises a VL domain comprising the CDRL3 sequence of any anti-BMP 6 antibody disclosed herein (e.g., any antibody selected from the antibodies or fragments listed in any one of tables 4-11 herein), or the selected CDRL3 sequence comprises 3, 2, or 1 amino acid substitutions.

15. The antibody or fragment according to clause 14, which comprises a VH domain comprising the CDRH3 sequence of the selected antibody.

16. An antibody or fragment (optionally according to any preceding clause) that specifically binds bone morphogenic protein 6(BMP6) and comprises a VL domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 119 or 122, or said selected CDRL3 sequence comprises 3, 2 or 1 amino acid substitutions.

17. An antibody or fragment (optionally according to any preceding clause) that specifically binds bone morphogenetic protein 6(BMP6) and comprises a VL domain comprising the CDRL3 (and optionally h3) sequence of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or the sequences each comprise 3, 2 or 1 amino acid substitutions.

Optionally, the VL domain comprises a sequence selected from SEQ ID NOs: 119 or 122, or said selected sequence comprises 3, 2 or 1 amino acid substitutions, and/or optionally said VH domain comprises a sequence selected from SEQ ID NOs: 119 or 122, or said selected sequence comprises 3, 2 or 1 amino acid substitutions.

18. The antibody or fragment according to clause 17, wherein the VL domain comprises (i) a CDRL3 sequence (and optionally a CDRH3) of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, and CL-58713; or the CDR3 sequences each comprise 3, 2, or 1 amino acid substitutions; and (ii) the CDRL1 (and optionally CDRH1) sequences of the selected antibody; or the CDR1 sequences each comprise 3, 2, or 1 amino acid substitutions.

Optionally, the VL domain of the antibody or fragment comprises (a) SEQ ID NO: 119 or 122, CDRL3 sequence; or the CDRL3 sequence comprises 3, 2, or 1 amino acid substitutions; and (b) SEQ ID NO: 117 or 120, or said CDRL1 sequence comprises 3, 2 or 1 amino acid substitutions.

19. The antibody or fragment according to clause 17 or 18, wherein the VL domain comprises (iii) a CDRL3 (and optionally a CDRH3) sequence of an antibody selected from CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75320, CL-75539, CL-75565, CL-75/14, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or the CDR3 sequences each comprise 3, 2, or 1 amino acid substitutions; and (iv) the CDRL2 (and optionally CDRH2) sequences of the selected antibody; or the CDR2 sequences each comprise 3, 2, or 1 amino acid substitutions.

Optionally, the VL domain of the antibody or fragment comprises (c) SEQ ID NO: 119 or 122, CDRL3 sequence; or the CDRL3 sequence comprises 3, 2, or 1 amino acid substitutions; and (d) SEQ ID NO: 118 or 121, or said CDRL2 sequence comprises 3, 2 or 1 amino acid substitutions.

Optionally, the VL domain of the antibody or fragment comprises (e) SEQ ID NO: 119 or 122, CDRL3 sequence; or the CDRL3 sequence comprises 3, 2, or 1 amino acid substitutions; (f) SEQ ID NO: 117 or 120, or said CDRL1 sequence comprises 3, 2, or 1 amino acid substitutions; and (g) SEQ ID NO: 118 or 121, or said CDRL2 sequence comprises 3, 2 or 1 amino acid substitutions.

20. An antibody or fragment (optionally according to any preceding clause) comprising a binding site that specifically binds bone morphogenic protein 6(BMP6), wherein the binding site comprises a VL domain comprising the amino acid sequence of the VL domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

Optionally, the VL domain of the antibody or fragment comprises SEQ ID NO: 123, or an amino acid sequence identical to SEQ ID NO: 123 has a heavy chain variable domain amino acid sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical. For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

21. An antibody or fragment according to any preceding clause, which comprises first and second copies of the VL domain.

In one example, the antibody or fragment comprises a binding site comprising a VL domain of the invention paired with a VH domain, wherein the binding site is capable of specifically binding BMP6 (e.g. mature BMP6, e.g. human and/or cynomolgus monkey BMP 6). For example, the antibody or fragment comprises two of the binding sites.

22. An antibody or fragment (optionally according to any preceding clause) that specifically binds bone morphogenic protein 6(BMP6) and comprises the heavy chain amino acid sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75300, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

23. An antibody or fragment (optionally according to any preceding clause) that specifically binds bone morphogenic protein 6(BMP6) and comprises the light chain amino acid sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

24. The antibody or fragment according to clause 23, which comprises the light chain amino acid sequence of the selected antibody; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

25. An antibody or fragment (optionally according to any preceding clause) which specifically binds human BMP6 epitope in accordance with the epitope to which the antibody according to any preceding clause binds.

26. The antibody or fragment according to clause 25, wherein the epitope is identified by an unrelated amino acid scan or by X-ray crystallography.

The contact amino acid residues involved in the interaction of an antibody with an antigen can be determined by various methods known to those skilled in the art.

In one embodiment, sequential substitution of amino acids of an antigen sequence (using standard molecular biology techniques to mutate DNA of the antigen-encoding sequence), in which case BMP6 is substituted with alanine (aka an alanine scan) or another unrelated amino acid, can provide residues whose mutation reduces or eliminates the ability of an antibody to recognize the antigen. Binding can be assessed using standard techniques such as, but not limited to, SPR, HTRF, ELISA (which are described elsewhere herein). Other substitutions may be made to enhance disruption of binding, such as changing the charge on the amino acid side chains of the antigenic sequence (e.g., lysine to glutamic acid), switching polar and non-polar residues (e.g., serine to leucine). Alanine scanning or other amino substitution methods can be performed with recombinant soluble antigens or directly on the cell using transient or stable expression of mutant forms when the target is a cell membrane target.

In one embodiment, protein crystallography can be used to determine the contact residues between the antibody and the antigen (i.e., to determine the epitope to which the antibody binds), which crystallography allows direct visualization of the contact residues involved in the antibody-antigen interaction. In addition to standard X-ray crystallography, cryoelectron microscopy has been used to determine the contact residues between Antibodies and HIV capsid proteins (see Lee, Jeong Hyun et al, "Antibodies to one conformational epitope on gp41 neutralize HIV-1Antibodies to a conformation a1 epitope on gp41 neutral HIV-1 by destabilising the Env spike" Nature communications, 6, (2015)).

In one embodiment, if the antibody recognizes linear epitopes, short peptides based on the antigen sequence can be generated and the binding of the antibody to these peptides can be assessed using standard techniques such as, but not limited to, SPR, HTRF, ELISA (which are described elsewhere herein). Further investigation of epitopes may be provided by alanine scanning of any peptide showing binding. As an alternative to linear peptides, a Pepscan technique (http:// www.pepscan.com /) can be used to perform conformational scans using chemical ligation of peptides on a scaffold, which has been used to determine discrete epitopes on CD 20-targeted antibodies (Niedeerfellner, Gerhard et al, "Epitope characterization and crystal structure of GA101 provides insight into the molecular basis of CD20 antibody type I/II differentiation," (Blood characterization of GA101 precursors of the molecular basis for CD20 antibodies), "Blood (Blood), 118.2, (2011), 358-.

In one embodiment, limited proteolytic digestion and mass spectrometry analysis can be used to identify binding epitopes. The antibody-antigen complex is digested by a protease, such as but not limited to trypsin. The digested complex peptide was compared to antibody only and antigen only digestion mass spectrometry spectrophotometry to determine if a particular epitope was protected by complexation. Further studies involving amino acid substitutions, competitive binding, can then be employed to narrow down the range to individual amino acid residues involved in the interaction (see, e.g., suckuu, Detlev et al, "Molecular epitopes identified by limited proteolysis and mass spectrometric peptide mapping of immobilized antigen-antibody complexes.", "Proceedings of the national academy of Sciences, 87.24, (1990), 9848. sup. 9852).

Thus, in one embodiment, the contact residues of an epitope are identified with an unrelated amino acid scan (e.g., an alanine scan). In another embodiment, unrelated amino acid scans (e.g., alanine scans) are performed using a technique selected from SPR, HTRF, ELISA, X-ray crystallography, cryoelectron microscopy, and a combination of limited proteolytic digestion and mass spectrometry. In one embodiment, unrelated amino acid scans (e.g., alanine scans) are performed using HTRF. In one embodiment, an unrelated amino acid scan (e.g., an alanine scan) is performed using ELISA.

Amino acid residues are identified as contributing to an epitope if the signal is reduced to at least 25% when alanine scanned by ELISA or HTRF. In one embodiment, the signal reduction is at least 30%. In one embodiment, the signal reduction is at least 35%. In one embodiment, the signal reduction is at least 40%. In one embodiment, the signal reduction is at least 45%. In one embodiment, the signal reduction is at least 50%. In one embodiment, the signal reduction is at least 55%. In one embodiment, the signal reduction is at least 60%. In one embodiment, the signal reduction is at least 70%. In one embodiment, the signal reduction is at least 75%. In one embodiment, the signal reduction is at least 80%. In one embodiment, the signal reduction is at least 85%. In one embodiment, the signal reduction is at least 90%.

When alanine scanning was performed with SPR, amino acid residues were identified as contributing to the epitope if the affinity decreased by at least 10-fold. In one embodiment, the affinity is reduced by at least 15-fold. In one embodiment, the affinity is reduced by at least 20-fold. In one embodiment, the affinity is reduced by at least 30-fold. In one embodiment, the affinity is reduced by at least 40-fold. In one embodiment, the affinity is reduced by at least 50-fold. In one embodiment, the affinity is reduced by at least 100-fold.

In one embodiment, the contact residues of the epitope are identified by X-ray crystallography. In one embodiment, the contact residues of the epitope are identified by cryoelectron microscopy. In one embodiment, the contact residues of the epitope are identified by a combination of limited proteolytic digestion and mass spectrometry analysis.

27. The antibody or fragment according to clause 26, wherein the contact residues of the epitope are defined by at least a 10-fold decrease in affinity in an unrelated amino acid scan, e.g., an alanine scan as determined by SPR.

In one embodiment, the affinity is reduced by at least 15-fold. In one embodiment, the affinity is reduced by at least 20-fold. In one embodiment, the affinity is reduced by at least 30-fold. In one embodiment, the affinity is reduced by at least 40-fold. In one embodiment, the affinity is reduced by at least 50-fold. In one embodiment, the affinity is reduced by at least 100-fold.

SPR can be performed as described herein.

28. An antibody or fragment (optionally according to any preceding clause) which competes for binding to human BMP6 with an antibody according to any preceding clause.

Optionally, competition is determined by Surface Plasmon Resonance (SPR) or ELISA. For example, one skilled in the art will be familiar with such techniques and standard conditions.

In one embodiment, the antibody or fragment competes (e.g., in a dose-dependent manner) with hBMP6 (or a fusion protein thereof) for binding to cell surface-expressed hBMP 6. In one embodiment, the antibody or fragment competes (e.g., in a dose-dependent manner) for binding to soluble hBMP6 with hBMP6 (or a fusion protein thereof).

Optionally, SPR was used to compete for binding to hBMP 6. SPR can be performed as described herein.

29. An antibody or fragment according to any preceding clause that specifically binds to a polypeptide comprising SEQ ID NO: 562 human BMP 6; and/or comprises SEQ ID NO: 564 from cynomolgus monkey BMP 6; and/or comprises SEQ ID NO: 563 rat BMP 6.

Optionally, the antibody or fragment of the invention specifically binds to SEQ ID NO: 562. Optionally, the antibody or fragment of the invention specifically binds to SEQ ID NO: 563, or a pharmaceutically acceptable salt thereof. Optionally, the antibody or fragment of the invention specifically binds to SEQ ID NO: 564.

In one example, BMP6 herein is human, mouse, or cynomolgus monkey BMP 6.

In one embodiment, the antibody or fragment binds cynomolgus monkey BMP6 with an affinity of less than 1nM (e.g., 1nM to 0.01pM, or 1nM to 0.1pM, or 1nM to 1 pM). In one embodiment, the antibody or fragment binds cynomolgus monkey BMP6 with an affinity of less than 10nM (e.g., 10nM to 0.01pM, or 10nM to 0.1pM, or 10nM to 1 pM). In one embodiment, the antibody or fragment binds cynomolgus monkey BMP6 with an affinity of less than 0.1nM (e.g., 0.1nM to 0.01pM, or 0.1nM to 0.1pM, or 0.1nM to 1 pM). In one embodiment, the antibody or fragment binds cynomolgus monkey BMP6 with an affinity of less than 0.01nM (e.g., 0.011nM to 0.01pM or 0.01nM to 0.1 pM).

In one embodiment, the antibody or fragment has a binding affinity for cynomolgus monkey BMP6 that is within 2-fold of its binding affinity for hBMP 6. In one embodiment, the binding affinity of the antibody or fragment to cynomolgus monkey BMP6 is within 4-fold of its binding affinity to hBMP 6. In one embodiment, the binding affinity of the antibody or fragment to cynomolgus monkey BMP6 is within 5-fold of its binding affinity to hBMP 6. In one embodiment, the binding affinity of the antibody or fragment to cynomolgus monkey BMP6 is within 6-fold of its binding affinity to hBMP 6. In one embodiment, the binding affinity of the antibody or fragment to cynomolgus monkey BMP6 is within 8-fold of its binding affinity to hBMP 6. In one embodiment, the antibody or fragment has a binding affinity for cynomolgus monkey BMP6 that is within 10-fold of its binding affinity for hBMP 6.

Herein, "hBMP 6" is a human BMP6, e.g. comprising SEQ ID NO: 562 of human BMP6 disclosed herein.

In one embodiment, the antibody or fragment binds non-detectably to cynomolgus monkey BMP 6. In one embodiment, the antibody or fragment binds non-detectably to murine (e.g., mouse and/or rat) BMP 6.

In one embodiment, the antibody or fragment has a binding affinity for murine (e.g., mouse and/or rat) BMP6 of less than 1nM (e.g., 1nM to 0.01pM, or 1nM to 0.1pM, or 1nM to 1 pM). In one embodiment, the antibody or fragment has a binding affinity for murine BMP6 of less than 10nM (e.g., 10nM to 0.01pM, or 10nM to 0.1pM, or 10nM to 1 pM). In one embodiment, the antibody or fragment has a binding affinity for murine BMP6 of less than 0.1nM (e.g., 0.1nM to 0.01pM, or 0.1nM to 0.1pM, or 0.1nM to 1 pM). In one embodiment, the antibody or fragment has a binding affinity for murine BMP6 of less than 0.01nM (e.g., 0.011nM to 0.01pM or 0.01nM to 0.1 pM).

Optionally, the antibody or fragment comprises an effector-enabled or effector-disabled constant region, such as a human constant region, e.g., an effector null human constant region, e.g., an IgG4 constant region or an IgG1 constant region, optionally wherein the constant region is an IgG4-PE, or a disabled IgG 1. Optionally, the antibody or fragment comprises a murine (e.g., mouse and/or rat) constant region. Optionally, the antibody or fragment comprises any of the heavy chain constant region sequences described herein.

Optionally, the constant region has CDC and/or ADCC activity.

30. An antibody or fragment according to any preceding clause, wherein the antibody or fragment comprises a human constant region, e.g., an IgG4 constant region or an IgG1 constant region.

For example, the constant region comprises a heavy chain constant region comprising SEQ ID NO: 429. 431, 433, 435, 437, 439, 440, 442, 444, 446, 448, 450, 454 or 456. Optionally, the heavy chain constant region is a heavy chain constant region comprising SEQ ID NO: 429. 431, 433, 435 or 437. Optionally, the heavy chain constant region is a heavy chain constant region comprising SEQ ID NO: 439. 440, 442 or 444. Optionally, the heavy chain constant region is a heavy chain constant region comprising SEQ ID NO: 446. 448, 450, 454 or 456, preferably SEQ ID NO: 454, preferably SEQ ID NO: 456 amino acid sequence, IGHG4 constant region. In one example, the heavy chain constant region consists of a sequence comprising SEQ ID NO: 451. 452 or 453.

In one example (optionally in addition to the heavy chain region according to the above paragraph), the constant region comprises a light chain constant region comprising the amino acid sequence of SEQ ID NO: 458. 460, 462, 464, 466, 468, 470, 473, 476, 478, 480, 482, 484, 486, 488, or 490. Optionally, the light chain constant region is a light chain constant region comprising SEQ ID NO: 458. 460, 462, 464 or 466, preferably SEQ ID NO: 458. Optionally, the light chain constant region is a light chain constant region comprising SEQ ID NO: 468. 470, 473, 476, 478, 480, 482, 484, 486, 488, or 490.

31. The antibody or fragment according to clause 30, wherein the constant region is an IgG4-PE constant region.

Optionally, the antibody or fragment comprises a heavy chain constant region, wherein the constant region comprises SEQ ID NO: 454.

The anti-BMP 6 antibody or fragment according to the invention may comprise a constant region, such as a human constant region, for example an effector empty human constant region, for example an IgG4 constant region or an IgG1 constant region, optionally wherein the constant region is IgG4-PE, or IgG1 is disabled as defined in the sequence listing herein.

In other embodiments, the antibody or fragment is any isotype or constant region as defined herein. In one embodiment, the constant region is wild-type human IgG 1. For example, the constant region is an effector-enabled IgG1 constant region, optionally having ADCC and/or CDC activity. In one embodiment, the constant region is designed to enhance ADCC and/or CDC and/or ADCP. In another embodiment, the constant region is designed to enhance effector function.

The IgG4 constant region can be any IgG4 constant region amino acid sequence or encoded by any nucleic acid sequence of the sequence listing herein. The heavy chain constant region may be IgG4 comprising a Leu235Glu mutation and a Ser228Pro mutation. The "IgG 4-PE" heavy chain constant region (see sequence listing for examples) is an effector void.

The surrogate effector empty human constant region is a forbidden IgG1, which is an IgG1 x 01 allele comprising L235A and/or G237A mutations (e.g., LAGA, see sequence listing). In one embodiment, an antibody or antibody fragment disclosed herein comprises an IgG1 heavy chain constant region, wherein the sequence contains an alanine at position 235 and/or 237(EU index numbering).

The performance of Fc-mediated effects can be enhanced by engineering the Fc domain by any technique apparent to those skilled in the art. In another embodiment, the antibodies and fragments disclosed herein may comprise triple mutations (M252Y/S254T/T256E) that enhance binding to FcRn.

32. An antibody or fragment (e.g., a bispecific antibody) according to any preceding clause, further comprising an antigen binding site that specifically binds to another target antigen (e.g., human hemojuvelin, transferrin receptor (e.g., TFR2), or BMP receptor (e.g., BMPRI or bmpriii)) or to BMP6 and another BMP (e.g., BMP2, 4, 7, or 9).

For example, the bispecific antibody specifically binds BMP6 and BMP 2. For example, the bispecific antibody specifically binds BMP6 and HJV. For example, the bispecific antibody specifically binds BMP6 and BMPRI (i.e. BMPR1, e.g. BMPR1A or BMPR 1B). For example, the bispecific antibody specifically binds BMP6 and BMPRII. For example, the bispecific antibody specifically binds BMP6 and BMP 2. For example, the bispecific antibody specifically binds BMP6 and BMP 4. For example, the bispecific antibody specifically binds BMP6 and BMP 9. For example, the bispecific antibody specifically binds BMP6 and BMP 7. For example, the bispecific antibody specifically binds BMP6 and TFR 2.

In one example, the additional binding site is an agonist binding site for the other antigen. In one example, the additional binding site is an antagonist binding site for the other antigen.

In one example, the additional binding site is an antibody binding site comprising a VH and a VL; a binding site comprised by the constant domain of an antibody (e.g., Fcab binding site) or a non-immunoglobulin binding site (e.g., fibronectin domain). Optionally, the antigen binding site is any antigen binding site disclosed herein.

For example, the antibody or fragment is a bispecific antibody or fragment. For example, the antibody or fragment is a dual binding antibody or fragment, or a fusion protein comprising an antibody or fragment thereof as defined in any preceding clause. The dual binding antibody has the meaning as described above.

In one example, the antibody, fragment or fusion protein of clause 24 or 24a comprises a bispecific form selected from: DVD-Ig, mAb²FIT-Ig, mAb-dAb, dock and lock, SEEDbody, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intrabodies, BiTE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH ₃Bifunctional antibody-CH₃A minibody, a knob access hole with a common light chain andknob-in-hole for charge pairs, charge pairs with a common light chain, in particular mAbs²Knob access hole, knob access hole with common light chain and charge pair and FIT-Ig, e.g. mAb²And FIT-Ig.

In one embodiment, the bispecific format is selected from the group consisting of DVD-Ig, mAb²FIT-Ig, mAb-dAb, docking and latching, Fab arm exchange, SEEDbody, Triomab, LUZ-Y, Fcab, kappa lambda body, orthogonal Fab, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intrabodies, BiTE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH₃Bifunctional antibody-CH₃Trifunctional antibody, minibody, TriBi minibody, scFv-CH₃ KIH、scFv-CH-CL-scFv、F(ab′)₂-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knob-in with common light chain and charge pair, charge pair with common light chain, DT-IgG, Dutamab, IgG (H) -scFv, scFv- (H) IgG, IgG (L) -scFv, scFv- (L) IgG, IgG (L, H) -Fv, IgG (H) -V, V (H) -IgG, IgG (L) -V, V (L) -IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig and zybody.

In one embodiment, the bispecific form is selected from the group consisting of DVD-Ig, FIT-Ig, mAb-dAb, dock and lock, Fab arm swap, SEEDbody, Triomab, LUZ-Y, Fcab, kappa lambda body, orthogonal Fab, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intrabody, BiTE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH₃Bifunctional antibody-CH₃Trifunctional antibody, minibody, TriBi minibody, scFv-CH₃ KIH、scFv-CH-CL-scFv、F(ab′)₂-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knob-in-hole with common light chain and charge pair, charge pair with common light chain, DT-IgG, Dutamab, IgG (H) -scFv, scFv- (H) IgG, IgG (L) -scFv, scFv- (L) IgG, IgG (L, H) -Fv, IgG (H) -V, V (H) -IgG, IgG (L) -V, V (L) -IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig and zybody, e.g. DVD-Ig, FIT-Ig, mAb-dAb, dock and lock, SEEDbody, single-chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intrabodies, BITE, bifunctional antibody, DART, tandAb, single-chain bifunctional antibody-CH ₃Bifunctional antibody-CH₃A minibody, a knob inlet hole with a common light chain and a charge pair, a charge pair with a common light chain, in particular a knob inlet hole, a knob inlet hole with a common light chain and a charge pair, and FIT-Ig, for example FIT-Ig.

In one embodiment, the bispecific format is selected from the group consisting of DVD-Ig, mAb²mAb-dAb, docking and latching, Fab arm exchange, SEEDbody, Triomab, LUZ-Y, Fcab, kappa lambda body, orthogonal Fab, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intrabody, BiTE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH₃Bifunctional antibody-CH₃Trifunctional antibody, minibody, TriBi minibody, scFv-CH₃ KIH、scFv-CH-CL-scFv、F(ab′)₂scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knob-in-hole with common light chain and charge pair, charge pair with common light chain, DT-IgG, Dutamab, IgG (H) -scFv, scFv- (H) IgG, IgG (L) -scFv, scFv- (L) IgG, IgG (L, H) -Fv, IgG (H) -V, V (H) -IgG, IgG (L) -V, V (L) -IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig and zybody, for example DVD-Ig, mAb ²mAb-dAb, docking and docking, SEEDbody, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intrabodies, BiTE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH₃Bifunctional antibody-CH₃Minibody, knob inlet with common light chain and charge pair, charge pair with common light chain, in particular mAb²Knob access hole, knob access hole with common light chain and charge pair and knob access hole with common light chain, e.g. mAb²。

In one embodiment, the bispecific format is selected from the group consisting of DVD-Ig, mAb-dAb, dock and lock, Fab arm swap, SEEDbody, Triomab, LUZ-Y, Fcab, kappa lambda body, orthogonal Fab, single chain bifunctional antibody-Fc, tandem scFv-Fc, Fab-scFv, intracellular antibody, BiTE, bifunctional antibody, DART, tandAb, single chain bifunctional antibody-CH₃Bifunctional antibody-CH₃Trifunctional antibody, minibody, TriBi minibody, scFv-CH₃ KIH、scFv-CH-CL-scFv、F(ab′)₂-scFv, scFv-KIH, Fab-scFv-Fc, tetravalent HCab, ImmTAC, knob-in-hole with common light chain and charge pair, charge pair with common light chain, DT-IgG, Dutamab, IgG (H) -scFv, scFv- (H) IgG, IgG (L) -scFv, scFv- (L) IgG, IgG (L, H) -Fv, IgG (H) -V, V (H) -IgG, IgG (L) -V, V (L) -IgG, KIHIgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig and zybody, such as DVD-Ig, mAb-dAb, docking and docking, SEEDbody, single-chain bifunctional antibody-Fc, tandem-Fc, Fab-scFv-Fc, scFv-monoclonal-scFv-monoclonal, Intracellular antibodies, BiTE, bifunctional antibodies, DART, TandAb, single chain bifunctional antibodies, single chain bifunctional antibody-CH ₃Bifunctional antibody-CH₃The micro-antibody is connected with the knob access hole through a common light chain, the knob access hole is connected with the knob access hole through a common charge pair, the charge pair is connected with the charge pair through a common light chain, and the knob access hole is connected with the knob access hole through a common light chain.

33. An anti-BMP 6 antibody or fragment as defined in any preceding clause for use in treating or preventing a BMP6 mediated disease or condition (e.g. anemia) in an individual.

In one example, the subject is a human. In the alternative, the subject is a non-human animal. In one example, the individual is an adult. In one example, the subject is a child. In one example, the subject is a human CKD patient undergoing dialysis treatment. In one example, the subject is a human having end stage renal disease.

In one example, the antibodies or fragments herein are used to treat or prevent a disease or condition in a subject (e.g., a human) selected from anemia, Pulmonary Arterial Hypertension (PAH) (e.g., primary PAH or secondary PAH), cerebral cavernous vascular malformation (CCM) (e.g., familial CCM or sporadic CCM), Restless Leg Syndrome (RLS), cancer (e.g., breast cancer, pancreatic cancer, colorectal cancer, salivary gland cancer, esophageal cancer, or melanoma), cancer metastasis, systemic sclerosis, sjogren syndrome: (r) ((RLS)) Syndrome), endothelial cell-to-mesenchymal transition (EndoMT), cardiovascular disease, atherosclerosis, systemic sclerosis associated pulmonary fibrosis and cardiac fibrosis.

Examples of diseases or conditions mediated by EndoMT are cardiovascular disease, atherosclerosis, systemic sclerosis-associated pulmonary fibrosis, cardiac fibrosis, PAH, tumor formation, tumor invasion, tumor metastasis, fibrotic disease and the production of cancer-associated fibroblasts (e.g. in pancreatic cancer).

In one example, the disease or condition is in a human. In one example, the disease or condition is in an animal.

In one example, the antibody or fragment of the invention is for use in treating or preventing a TIGIT-mediated disease or condition in a human, e.g., selected from a neoplastic or non-neoplastic disease, a chronic viral infection, and a malignancy, such as melanoma, Merkel cell carcinoma, non-small cell lung cancer (squamous and non-squamous), renal cell carcinoma, bladder carcinoma, head and neck squamous cell carcinoma, mesothelioma, virally-induced cancer (such as cervical and nasopharyngeal carcinoma), soft tissue sarcoma, hematologic malignancies such as hodgkin's disease and non-hodgkin's disease, and diffuse large B-cell lymphoma (e.g., melanoma, Merkel cell carcinoma, non-small cell lung cancer (squamous and non-squamous), renal cell carcinoma, bladder carcinoma, head and neck squamous cell carcinoma and mesothelioma), or, e.g., virally-induced cancer (such as cervical and nasopharyngeal carcinoma) and soft tissue sarcoma).

In one example, the BMP6 mediated disease or condition is a neurodegenerative disease, disorder or condition, e.g., a retinal degenerative disorder selected from alzheimer's disease, amyotrophic lateral sclerosis, parkinson's disease, huntington's disease, primary progressive multiple sclerosis, secondary progressive multiple sclerosis, corticobasal degeneration, Rett syndrome, selected from age-related macular degeneration and retinitis pigmentosa; anterior ischemic optic neuropathy, glaucoma, uveitis, depression, trauma-related stress or post-traumatic stress disorder, frontotemporal dementia, dementia with lewy bodies, mild cognitive impairment, posterior cortical atrophy, primary progressive aphasia and progressive supranuclear palsy or age-related dementia, in particular a neurodegenerative disease, disorder or condition selected from alzheimer's disease, amyotrophic lateral sclerosis, parkinson's disease and huntington's disease, such as alzheimer's disease.

In one example, the antibodies, fragments, combinations of the invention are administered intravenously to an individual; or for intravenous administration to an individual. In one example, the antibodies, fragments, combinations of the invention are administered subcutaneously to an individual; or for subcutaneous administration to a subject.

34. The antibody or fragment according to clause 33, wherein the antibody or fragment is administered to the subject simultaneously or sequentially with an Erythropoietin Stimulating Agent (ESA).

35. A combination (e.g., comprising multiple doses of the antibody and/or ESA) of an amount of an anti-BMP 6 antibody or fragment and an amount of an ESA, wherein the antibody or fragment is according to any of clauses 1-34.

Also provided are: a medical kit comprising the combination, a first sterile container comprising the amount of antibody or fragment, and a second sterile container comprising the amount of ESA, and optionally instructions for using the combination to treat anemia in an individual.

In one example, the combination is for treating or preventing anemia in an individual, wherein the total dose of the antibody and the total dose of ESAs are given in X: y, wherein X is from 10 to 2X 10⁶And Y is 4, for example, X is 10 to 2 × 10⁶Microgram and Y ═ 4 microgram.

In one example, the treatment increases (or is used to increase) one, more or all of Hb concentration, Mean Corpuscular Hemoglobin (MCH) and transferrin saturation in the individual. The person skilled in the art will be familiar with the parameters and how to determine them, e.g. using one or more than one serum sample of an individual. For example, transferrin saturation (measured as a percentage) is the value of serum iron divided by total iron binding capacity.

In one example, the subject suffers from Anemia of Chronic Disease (ACD) at the start of treatment, and optionally wherein the anemia is associated with chronic inflammation (e.g., the subject suffers from arthritis) or a bacterial infection (e.g., a streptococcal infection), or wherein the subject is a Chronic Kidney Disease (CKD) patient.

36. An antibody, fragment or combination according to any of clauses 1 to 34 for use in a method comprising:

(a) preventing a decrease in blood hemoglobin levels of less than 10g/dL in a subject, said method comprising administering to said subject said antibody or fragment and an Erythropoiesis Stimulating Agent (ESA);

(b) raising blood hemoglobin to a level of at least 10g/dL in a subject suffering from anemia, the method comprising administering to the subject the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated;

(c) treating or preventing anemia in a subject suffering from an inflammatory disease or condition, the method comprising administering to the subject the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented;

(d) eliminating or reducing the need to administer iron or a blood transfusion to an individual suffering from anemia, the method comprising administering to the individual the antibody or fragment and an Erythropoiesis Stimulating Agent (ESA), wherein the need is eliminated or reduced;

(e) Treating or preventing anemia in a subject suffering from a microbial infection, the method comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA);

(f) reducing administration of an Erythropoiesis Stimulating Agent (ESA) to a subject suffering from anemia to treat anemia, the method comprising administering the antibody or fragment and the ESA, wherein anemia in the subject is treated; or

(g) Treating or reducing the risk of anemia in a subject suffering from or at risk of anemia, the method comprising administering to the subject the antibody or fragment and a low dose of an Erythropoiesis Stimulating Agent (ESA), wherein anemia is treated or the risk of anemia is reduced in the subject.

37. The antibody, fragment or combination according to any one of clauses 1 to 34 and 36, wherein the ESA is

a. Epoetin alpha (epoetin alfa) and is administered at a weekly dose of less than 1000, 1500, 2500, 5000, 11000, 18000, 34000, or 90000 units, optionally wherein the subject has previously received weekly < 1500, 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90000 units of epoetin alpha, respectively;

b. dabbepotin alpha (darbepoetin alfa) or And is administered at a weekly dose of less than 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms, optionally wherein the individual has previously received 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms per week of dabbepotein alpha orTreatment; or

c. Dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 20, 40, 60, 100 or 200 micrograms, optionally wherein the subject has previously received 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90,000 units of epoetin alpha per week, respectively.

38. The antibody, fragment, or combination of clauses 1-34, 36, and 37 for use in maintaining or increasing blood hemoglobin content in the subject to at least 10g/dL at least 13 or 14 days after the subject has received the anti-BMP 6 antibody or fragment and an ESA.

39. Use of an antibody, fragment or combination as defined in any preceding clause in the manufacture of a medicament for administration to a subject for treating or preventing a BMP6 mediated disease or condition, such as anemia.

40. A method of treating or preventing a BMP6 mediated disease or condition (e.g. anemia) in an individual, the method comprising administering to the individual a therapeutically effective amount of an antibody, fragment or combination as defined in any of clauses 1-38, wherein the BMP6 mediated disease or condition is thereby treated or prevented.

The disease or condition can be any disease or condition disclosed herein.

41. The use according to clause 39 or the method according to clause 40, wherein the BMP6 mediated disease or condition is anemia.

42. The antibody, fragment, combination, use or method of any of clauses 33 to 41, further comprising administering to the individual another therapy, e.g., another therapeutic agent, optionally wherein the other therapeutic agent is selected from the group consisting of:

(a) intravenous iron;

(b) ESA (e.g., EPO);

(c) an ActRIIa inhibitor;

(d) an ActRIIb inhibitor;

(e) IL-6 or IL-6 receptor inhibitors (e.g., anti-IL-6 or IL-6 receptor antibodies);

(f) TNF-alpha or TNF-alpha receptor inhibitors (e.g., anti-TNF-alpha or TNF-alpha receptor antibodies);

(g) HJV inhibitors (e.g., anti-HJV antibodies);

(h) a BMP inhibitor (e.g., another anti-BMP antibody or fragment), e.g., where the BMP is BMP2, 4, 5, 6, 7, or 9;

(i) a proteinase-2 (MTP2) agonist (e.g., a proteinase-2 (MTP2) agonist antibody);

(j) HIF-PH inhibitors;

(k) transferrin receptor 2(TFR2) inhibitors;

(l) An HFE inhibitor;

(m) NRf2 inhibitors;

(n) a transforming growth factor beta superfamily type I activin receptor-like kinase (ALK) receptor inhibitor;

(o) activin receptor inhibitors (e.g., activin receptor Fc fusions);

(p) GDF11 inhibitors; and

(q) myostatin inhibitors.

Optionally, the other agent is Luspatercept^TMOr Sotatercept^TM. Optionally, the other agent is a TGF- β superfamily inhibitor. In one example, the other agent is a transforming growth factor beta superfamily type I activin receptor-like kinase (ALK) receptor inhibitor; ALK2 inhibitors, ALK3 inhibitors; ALK4 inhibitors; ALK5 inhibitors; or an ALK7 inhibitor.

In one example, the other agent is an IL-6 or IL-6R inhibitor, such as thalidomide (Sarilumab), Vobaizumab (Vobailizumab), or tocilizumab (tocilizumab) (e.g.Or)。

In one example, the other agent is a TNF- α or TNF- α receptor inhibitor, such as adalimumab,Or

In one embodiment, the NRf2 inhibitor increases the efficacy of the anti-BMP 6 antibody or fragment by breaking the more iron feedback loop, thereby inducing more BMP6 expression in the treated subject.

The present disclosure includes imitation forms of branded drugs, and the disclosure of the imitation drugs is included herein by reference for possible use with the present invention, e.g., as part of a combination.

In one example, the combination comprises the following inhibitors: BMP6 and HJV; or BMP6 and HFE; or BMP6 and TFR 2; or BMP6 and BMP 2; or BMP6 and BMP 4; or BMP6 and ALK2, wherein the BMP6 inhibitor comprises the antibody or fragment of the invention.

43. A pharmaceutical composition comprising an antibody, fragment or combination as defined in any one of clauses 1 to 38 and 42 and a pharmaceutically acceptable excipient, diluent or carrier, optionally in combination with another therapeutic agent selected from those described above (e.g. in clause 42).

44. The pharmaceutical composition according to clause 43, for use in the treatment and/or prevention of a BMP6 mediated condition or disease, such as anemia.

Suitable diseases and conditions include anemia, Pulmonary Arterial Hypertension (PAH) (e.g., primary or secondary PAH), cerebral cavernous vascular malformation (CCM) (e.g., familial or sporadic CCM), Restless Leg Syndrome (RLS), cancer (e.g., breast cancer, pancreatic cancer, colorectal cancer, salivary gland cancer, esophageal cancer, or melanoma), cancer metastasis, systemic sclerosis, sjogren's syndrome, endothelial cell-to-mesenchymal transition (EndoMT), cardiovascular disease, atherosclerosis, systemic sclerosis-associated pulmonary fibrosis, and cardiac fibrosis.

Examples of diseases or conditions mediated by EndoMT are cardiovascular disease, atherosclerosis, systemic sclerosis-associated pulmonary fibrosis, cardiac fibrosis, PAH, tumor formation, tumor invasion, tumor metastasis, fibrotic disease and the production of cancer-associated fibroblasts (e.g. in pancreatic cancer).

45. The pharmaceutical composition according to clause 43 or 44, in combination with a label or instructions for use, for treating and/or preventing the disease or condition in a human; optionally wherein the tag or instruction includes a marketing approval number (e.g., an FDA or EMA approval number); optionally wherein the kit comprises an IV or injection device comprising the antibody or fragment.

46. A nucleic acid encoding a VH domain and/or a VL domain of an antibody or fragment as defined in any one of clauses 1 to 32.

47. A nucleic acid encoding a VH domain comprising the amino acid sequence of the VH domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

Optionally, there is provided a nucleic acid encoding a polypeptide comprising SEQ ID NO: 114, or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

48. A nucleic acid encoding a VL domain comprising the amino acid sequence of a VL domain of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

Optionally, the nucleic acid further encodes a VH domain comprising the amino acid sequence of the VH domain of the selected antibody; or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

Optionally, there is provided a nucleic acid encoding a VL domain comprising SEQ ID NO: 123, or an amino acid having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

49. A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 115. 520 or 521 has a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical; and/or

(b) And SEQ ID NO: 124. 522 or 523 has a nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical.

In an alternative, there is provided:

a nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 115 has a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And SEQ ID NO: 124 has a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 520 has a nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical; and/or

(b) And SEQ ID NO: 522 has a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 521 has a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical; and/or

(b) And SEQ ID NO: 523 has a nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical.

Combinations of a first nucleic acid and a second nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell), each comprising

(a) And SEQ ID NO: 115. 520 or 521 has a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical; and/or

(b) And SEQ ID NO: 124. 522 or 523 has a nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical.

Combinations of a first nucleic acid and a second nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell), each comprising

(a) And SEQ ID NO: 115 has a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And SEQ ID NO: 124 has a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

Combinations of a first nucleic acid and a second nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell), each comprising

(a) And SEQ ID NO: 520 has a nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical; and/or

(b) And SEQ ID NO: 522 has a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical.

Combinations of a first nucleic acid and a second nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell), each comprising

(a) And SEQ ID NO: 521 has a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical; and/or

(b) And SEQ ID NO: 523 has a nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical.

For example, for (a), the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

For example, for (b), the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

Herein, in any case where% consistency is mentioned, there is 100% consistency in one example.

50. A nucleic acid encoding the heavy and/or light chain of an antibody or fragment as defined in any one of clauses 1 to 32.

51. A nucleic acid encoding a polypeptide comprising an amino acid sequence substantially identical to SEQ ID NO: 116 has an amino acid sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

52. A nucleic acid encoding a polypeptide comprising an amino acid sequence substantially identical to SEQ ID NO: 125 having an amino acid sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

For example, the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

53. A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) A nucleotide sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a selected heavy chain sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713; and/or

(b) A nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to a selected sequence of an antibody selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680 and CL-58713.

Preferably, the selected antibodies in (a) and (b) are the same antibody, e.g., CL-58838. In the alternative, the first nucleic acid comprises (a) and the second nucleic acid comprises (b), e.g., in a host cell, e.g., a CHO or HEK293 or Cos cell.

All of the nucleic acids of the invention herein may be expressed in a host cell, e.g., CHO or HEK293 or Cos cells, such as for expression of the variable domains or chains of the antibodies or fragments of the invention.

For example, there is provided:

a nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And a sequence selected from SEQ ID NO: 512. 514, 516, 518, and 519 having a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And a sequence selected from SEQ ID NO: 513. 515 and 517 have a nucleotide sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 512 nucleotide sequences having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And SEQ ID NO: 513 a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 514 has a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And SEQ ID NO: 515 having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 516 a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And SEQ ID NO: 517 have a nucleotide sequence of at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 518 a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity; and/or

(b) And SEQ ID NO: 513. 515 or 517, or a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

A nucleic acid (e.g., in a host cell, such as a CHO or HEK293 or Cos cell) comprising

(a) And SEQ ID NO: 519 nucleotide sequences having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity; and/or

(b) And SEQ ID NO: 513. 515 or 517, or a nucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

For example, for (a), the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

For example, for (b), the consistency is at least 85%. For example, the consistency is at least 90%. For example, the consistency is at least 95%.

54. A vector comprising a nucleic acid (e.g., a nucleic acid according to any of clauses 46-53); optionally wherein the vector is a CHO or HEK293 vector.

55. A host cell comprising a nucleic acid (e.g., a nucleic acid according to any of clauses 46 to 53) or a vector according to clause 54.

Optionally, the VH gene segment is selected from IGHV1-3 x 01 and IGHV3-11 x 01. Optionally, the VL gene segment is selected from IGKV1-5 x 03, IGKV3-20 x 01, and IGKV3-15 x 01.

In one example, the VH, DH, and JH are IGHV1-3, IGHD3-10, and IGHJ4 (e.g., IGHV1-3 × 01, IGHD3-10 × 01, and IGHJ4 × 02).

In one example, the VH, DH and JH are IGHV1-3, IGHD3-10 and IGHJ3, e.g., IGHV1-3 × 01, IGHD3-10 × 01 and IGHJ3 × 02.

In one example, the VH, DH and JH are IGHV3-11, IGHD6-19 and IGHJ4, e.g., IGHV3-11 × 01, IGHD6-19 × 01 and IGHJ4 × 02.

In one example, the VH, DH and JH are IGHV1-3, IGHD7-27 and IGHJ4, e.g., IGHV1-3 × 01, IGHD7-27 × 02 and IGHJ4 × 02.

In one example, the VH, DH and JH are IGHV1-3, IGHD4-23 and IGHJ4, e.g., IGHV1-3 × 01, IGHD4-23 × 01 and IGHJ4 × 02.

In one example, the VH, DH and JH are IGHV1-3, IGHD5-18 and IGHJ4, e.g., IGHV1-3 × 01, IGHD5-18 × 01 and IGHJ4 × 02.

In one example, VL and JL are IGKV1-5 and IGKJ1, e.g., IGKV1-5 × 03 and IGKJ1 × 01.

In one example, the VL and JL are IGKV3-20 and IGKJ1, e.g., IGKV3-20 × 01 and IGKJ1 × 01.

In one example, the VL and JL are IGKV3-15 and IGKJ3, e.g., IGKV3-15 a 01 and IGKJ3 a 01.

In one example, the VL and JL are IGKV3-20 and IGKJ3, e.g., IGKV3-20 × 01 and IGKJ3 × 01.

In one example, the antibody or fragment comprises an HCDR3 length of 9, 10, 11, or 12 residues, e.g., 10 residues, e.g., 11 residues. In one example, the antibody or fragment comprises an LCDR3 length of 7, 8, or 9 residues, e.g., 8 residues, e.g., 9 residues. In one example, each VH domain of the antibody or fragment comprises 1-11 non-germline residues, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 non-germline residues. In one example, each VL domain of the antibody or fragment comprises 3-8 non-germline residues, e.g., 3, 4, 5, 6, 7, or 8 non-germline residues.

In one embodiment, the CDR sequences herein are determined according to Kabat. In an alternative, the CDR sequences are determined according to IMGT.

In one example, the selected antibody is CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, or CL-58713. In one example, the selected antibody is CL-58838.

In one example, the selected antibody comprises a heavy chain of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, or CL-58713. In one example, the selected antibody comprises the heavy chain of CL-58838.

In one example, the heavy chain of an antibody or fragment of the invention is of the human gamma-1, gamma-2, gamma-3, gamma-4, mu, delta, epsilon or alpha isotype, preferably of the gamma isotype (e.g., the IgG4 isotype). In one example, the light chain of an antibody or fragment of the invention comprises a human kappa constant region. Alternatively, in one example, the light chain of an antibody or fragment of the invention comprises a human λ constant region.

Optionally, the antibody is a 4 chain antibody comprising a heavy chain dimer in combination with a light chain dimer. In one example, the heavy chain comprises one or a heavy chain CDR or combination of CDRs as disclosed herein and/or the light chain comprises one or a heavy chain CDR or combination of CDRs as disclosed herein, e.g., from the same selected antibody. In one example, the heavy chain comprises a VH domain as disclosed herein and/or the light chain comprises a VL as disclosed herein, e.g., from the same selected antibody. In one example, the heavy and light chains are from the same selected antibody, e.g., any antibody disclosed in the sequence listing herein or the tables in the examples herein.

In one example, the selected antibody comprises a light chain of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, or CL-58713. In one example, the selected antibody comprises a light chain of CL-58838.

In one example, the selected antibody comprises a variable domain of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, or CL-58713. In one example, the selected antibody comprises the variable domain of CL-58838.

In one example, the selected antibody comprises a VH domain of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, or CL-58713. In one example, the selected antibody comprises the VH domain of CL-58838.

In one example, the selected antibody comprises VH and VL domains of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, or CL-58713. In one example, the selected antibody comprises the VH and VL domains of CL-58838.

Optionally, the VH segment is a human IGHV3-11 gene segment, e.g., the VH is encoded by a recombinant nucleotide sequence derived from human IGHV3-11 and IGHJ4 (e.g., human gene segments IGHV3-11 x 01 and IGHJ4 x 02; IGHV3-11, IGHD6-19, IGHJ 4; or IGHV3-11 x 01, IGHD6-19 x 01, and IGHJ4 x 02). Optionally, the JH is IGHJ4 x 02. Optionally, VL is encoded by a recombinant nucleotide sequence derived from a human VL gene segment and a JL gene segment, wherein the VL gene segment is selected from IGKV1-5, IGKV3-20, and IGKV 3-15. Optionally, VL is human IGKV3-20 (e.g., IGKV3-20 x 01). Optionally, JL is IGKJ1 (e.g. IGKJ1 × 01). For example, the VL is encoded by a recombined nucleotide sequence derived from human IGKV3-20 (e.g., IGKV3-20 x 01) and human IGKJ1 (e.g., IGKJ1 x 01).

In one example, the binding site comprises a VH/VL pair that specifically binds human BMP6 (e.g., human BMP6 comprising or consisting of the bold sequence of SEQ ID NO: 1 of the sequence Listing herein). In one example, the antibody or fragment comprises 2 (e.g., 2 and no more than 2) copies of the binding site.

In one example, the antibody or fragment comprises a HCDR3 length of 9-12 residues and/or the antibody or fragment comprises a LCDR3 length of 7-9 residues. In one example, the antibody or fragment comprises an HCDR3 length of 9, 10, 11, or 12 residues, e.g., 10 residues, e.g., 11 residues. In one example, the antibody or fragment comprises an LCDR3 length of 7, 8, or 9 residues, e.g., 8 residues, e.g., 9 residues. In one example, each VH domain of the antibody or fragment comprises 1-11 non-germline residues, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 non-germline residues. In one example, each VL domain of the antibody or fragment comprises 3-8 non-germline residues, e.g., 3, 4, 5, 6, 7, or 8 non-germline residues.

Optionally, the antibody or fragment competes with CL-58838 (e.g., CL-58838 in IgG form, e.g., IgG-PE) for binding to BMP6 (e.g., human BMP6, e.g., mature human BMP6, e.g., BMP6 comprising or consisting of the sequence of mature BMP6 disclosed in the sequence listing herein, i.e., the bold sequence of SEQ ID NO: 1), as determined by SPR.

Optionally, the amino acid substitutions are conservative amino acid substitutions, optionally wherein each conservative substitution is from groups (1) to (6):

1) alanine (a), serine (S), threonine (T);

2) aspartic acid (D), glutamic acid (E);

3) asparagine (N), glutamine (Q);

4) arginine (R), lysine (K);

5) isoleucine (I), leucine (L), methionine (M), valine (V); and

6) phenylalanine (F), tyrosine (Y), tryptophan (W).

Any SPR herein is Surface Plasmon Resonance (SPR), for example at 37 ℃ and pH 7.6.

Optionally, any BMP6 herein (e.g. tested in vitro) is a human BMP6, e.g. hBMP6(Peprotech 120-06).

In one example, an antibody or fragment of the invention is at, e.g., 5X 10⁶M^-1x s^-1(ii) a Or about 5X 10⁶M^-1x s^-1Binds to human BMP6 under Ka. In one example, an antibody or fragment of the invention is in, e.g., 4 or 5s^-1(ii) a Or about 4 or 5s^-1Binds to human BMP6 at Kd of (a). In one example, the present inventionThe antibodies or fragments of the invention are present at, e.g., 0.07 or 0.14 nM; or about 0.07 or 0.14nM, with human BMP 6. In one embodiment, the fragment is a Fab fragment. In one embodiment, the fragment is an scFv.

In one example, the antibody comprises heavy chains, wherein each heavy chain comprises SEQ ID NO: 116 or by the amino acid sequence of SEQ ID NO: 116; and the light chains each comprise SEQ ID NO: 125 or by the amino acid sequence of SEQ ID NO: 125, or a pharmaceutically acceptable salt thereof.

In one example, the antibody or fragment comprises a heavy chain VH domain, wherein each VH comprises SEQ ID NO: 418 or the amino acid sequence consisting of SEQ ID NO: 418; and the light chain VL domains each comprise SEQ ID NO: 426 or by the amino acid sequence of SEQ ID NO: 426.

Alternative antibodies or fragments:

in any of the configurations of the invention, the invention may relate to an antibody or fragment (alternative antibody or fragment) as follows.

Optionally (option 1), the antibody or fragment comprises

a. Each comprising SEQ ID NO: 403 or 566 or a sequence consisting of SEQ ID NO: 403 or 566, and each comprises the amino acid sequence of SEQ ID NO: 411 or by the amino acid sequence of SEQ ID NO: 411; or

b. Each comprising SEQ ID NO: 419 or by SEQ ID NO: 419, and each comprises the amino acid sequence of SEQ ID NO: 427 or by the amino acid sequence of SEQ ID NO: 427 to a light chain consisting of the amino acid sequence of seq id no.

Optionally (option 2), the antibody or fragment comprises

a. Each comprising SEQ ID NO: 402 or 565 or a VH domain amino acid sequence consisting of SEQ ID NO: 402 or 565, and each comprises the VH domain amino acid sequence of SEQ ID NO: 410 or by the VL domain amino acid sequence of SEQ ID NO: 410, a VL domain amino acid sequence; or

b. Each comprising SEQ ID NO: 418 or a VH domain consisting of SEQ ID NO: 418, and each comprises the VH domain amino acid sequence of SEQ ID NO: 426 or by the VH domain amino acid sequence of SEQ ID NO: 426 in a VH domain amino acid sequence; and

c. optionally the heavy chain comprises a human gamma-1 (e.g. IGHG1 x 01) or gamma-4 (e.g. IGHG4 x 01 or IGHG4 x 01-PE) constant region, or SEQ ID NO: 429. 437, 446, 454 or 456.

Optionally, the antibody or fragment competes for binding to BMP6 with a reference antibody, wherein the reference antibody is mAb507(R & D Systems) or a surrogate antibody (e.g., an option 1 or option 2 antibody as defined herein). Competition can be by SPR or ELISA, for example, or in a functional assay such as the assays described herein (e.g., in the examples). BMP6 can be human BMP6 (e.g., mature BMP6 comprising the sequence of SEQ ID NO: 562), rat BMP6 (e.g., mature BMP6 comprising the sequence of SEQ ID NO: 56), or cynomolgus monkey BMP6 (e.g., mature BMP6 comprising the sequence of SEQ ID NO: 564).

The human IgG heavy chain gene naturally encodes a C-terminal lysine. The residues are largely absent in antibodies isolated from serum and are present in low but variable amounts on therapeutic antibodies expressed in mammalian cell culture systems. Since the C-terminal lysine is naturally cleaved in serum and is not known to affect overall antibody function, it can be removed from the heavy chain coding sequence to provide a cognate "lysine cleaved" heavy chain and hence a cognate drug product. Thus, any IgG antibody, constant region, or heavy chain shown herein that is terminated at the C-terminus with a G can alternatively be provided in a form that terminates with GK (i.e., a lysine bonded at the C-terminal side of the G shown).

Examples of options 1 and 2 are:

option 1 a: in one example, the antibody comprises heavy chains, wherein each heavy chain comprises SEQ ID NO: 403 or an amino acid sequence consisting of SEQ ID NO: 403 amino acid sequence composition; and light chains, each light chain comprising SEQ ID NO: 411 or by the amino acid sequence of SEQ ID NO: 411.

Option 1 b: in one example, the antibody comprises heavy chains, wherein each heavy chain comprises SEQ ID NO: 566 or an amino acid sequence consisting of SEQ ID NO: 566; and light chains, each light chain comprising SEQ ID NO: 411 or by the amino acid sequence of SEQ ID NO: 411.

Option 1 c: in one example, the antibody comprises heavy chains, wherein each heavy chain comprises SEQ ID NO: 419 or by SEQ ID NO: 419; and light chains, each light chain comprising SEQ ID NO: 427 or by the amino acid sequence of SEQ ID NO: 427 of the amino acid sequence of (b).

Option 2 a: in one example, the antibody or fragment comprises a heavy chain VH domain, wherein each VH comprises SEQ ID NO: 402 or the amino acid sequence consisting of SEQ ID NO: 402; and a light chain VL domain, each VL comprising SEQ ID NO: 410 or by the amino acid sequence of SEQ ID NO: 410, or a pharmaceutically acceptable salt thereof.

Option 2 b: in one example, the antibody or fragment comprises a heavy chain VH domain, wherein each VH comprises SEQ ID NO: 565 or by SEQ ID NO: 565, and a light chain VL domain, each VL comprising the amino acid sequence of SEQ ID NO: 410 or by the amino acid sequence of SEQ ID NO: 410, or a pharmaceutically acceptable salt thereof.

In one example, the antibody or fragment comprises a heavy chain VH domain, wherein each VH comprises SEQ ID NO: 114 or by the amino acid sequence of SEQ ID NO: 114; and a light chain VL domain, each VL comprising SEQ ID NO: 123 or the amino acid sequence consisting of SEQ ID NO: 123 in a sequence of amino acids.

Optionally, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 1. Additionally or alternatively, optionally, the antibody or fragment competes with the reference antibody for binding to the amino acid sequence of SEQ ID NO: 492. Additionally or alternatively, optionally, the antibody or fragment competes with the reference antibody for binding to the amino acid sequence of SEQ ID NO: 491 amino acid sequence. Additionally or alternatively, optionally, the antibody or fragment competes with the reference antibody for binding to the amino acid sequence of SEQ ID NO: 4. Alternatively or additionally, the antibody or fragment competes with the reference antibody for binding to the mature form of any one or more of the.

Optionally, the antibody or fragment competitively inhibits the binding of soluble Hemojuvelin (HJV) to BMP 6. Optionally, the HJV herein is a human HJV.

Optionally, the antibody or fragment does not competitively inhibit the binding of soluble Hemojuvelin (HJV) to BMP 6.

As used herein, "inhibit" or the like refers to the ability of an antagonist (e.g., an antibody or fragment thereof) to bind to an epitope (e.g., an epitope of hBMP 6), which partially or completely prevents binding of another antigen. If the epitope to which the antagonist binds completely blocks the binding site of the ligand, ligand binding is completely prevented (which may be a physical block, in the case of overlapping epitopes; or a spatial block where the antagonist is so large that it prevents the ligand from binding to its unique epitope), and the ligand is not removed from the circulation. Thus, the concentration of circulating ligand appears to increase. If the epitope to which the antagonist binds partially blocks the binding site of the ligand, the ligand may be able to bind, but only weakly (in the case of partial inhibition), or in a different orientation than the natural binding interaction. In such cases, some ligands may be removed from circulation, but not as much as the ligand binding site is completely free and available for binding. Thus, inhibition refers to the physical interaction of a ligand with a receptor. Inhibition can be measured by HTRF, which is described in more detail elsewhere herein and in Mathis (1995) Clinical Chemistry 41(9), 1391-. Inhibition can also be measured by flow cytometry, where the receptor is expressed on the cell, or by ELISA, where the receptor is adsorbed onto a culture plate.

Optionally, the antibody comprises a VH domain encoded by a VDJ region sequence, wherein the VDJ is derived from the recombination of a VH gene segment, a D gene segment, and a JH gene segment, wherein the VH is a human germline (i) VH1-3, (ii) VH2-5, or (iii) VH3-15 gene segment. Additionally or alternatively, optionally the antibody comprises a VL domain encoded by a VJ region sequence, wherein the VJ is derived from recombination of VL gene segments and JL gene segments, wherein the VL is human germline (iv) vk 3-20, (V) V λ 3-1, (vi) vk 1-17 or (vii) V λ 1-40.

Optionally, the antibody or fragment binds BMP6 with a stronger affinity (lower KD as determined by SPR) than BMP 7; and/or optionally binds with greater affinity to BMP6 than to BMP 5.

For example,

(a) the antibody or fragment binds BMP6 with a stronger affinity (lower KD as determined by SPR) than BMP 7; and optionally binds BMP6 with a stronger affinity than BMP 5; and

(b) the antibody or fragment competes for binding to BMP6 with a reference antibody, wherein the reference antibody is mAb507(R & D Systems) or a surrogate antibody (e.g., an option 1 antibody or an option 2 antibody).

Optionally, the antibodies of the invention bind BMP6 with an affinity (KD) of 1pM to 5nM, optionally wherein binding is determined by SPR using Fab of the antibody at 37 ℃ at pH 7.6.

Optionally, the antibody has an off-rate (K) for binding to BMP6_off) Is 1 × 10^-5To 1X 10^-3 S^-1Optionally wherein binding is determined by SPR using Fab of the antibody at 37 ℃ at pH 7.6.

Optionally, the binding rate (K) of the antibody to BMP6_on) Is 1 × 10⁵To 1X 10⁷M^-1S^-1Optionally wherein binding is determined by SPR using Fab of the antibody at 37 ℃ at pH 7.6.

In one example, the antibody (e.g., in Fab form) or fragment binds BMP6 (e.g., human BMP6) with an affinity (KD) of

(a)2, 3, 4, 5 or 10pM to 3, 4 or 5 nM;

(b)1-10pM to 5 nM;

(c)10pM to 3, 4 or 5 nM;

(d)50 or 80pM to 200 nM;

(e)50 or 80pM to 150 nM; or

(f)50 or 80pM to 100 nM.

In one example, the KD is (or is about) 5-15pM (e.g., 10 pM). In one example, the KD is (or is about) 2-5nM (e.g., 3 nM). In one example, the KD is (or is about) 100-400pM (e.g., 140 or 390 pM).

In one example, the antibody (e.g., in Fab form) or fragment binds to BMP6 (e.g., human BMP6) with an off-rate (K) _off) Is composed of

(a)1×10^-5To 5X 10^-4S^-1；

(b)1×10^-5To 6X 10^-4S^-1；

(c)1×10^-5To 7X 10^-4S^-1；

(d)1×10^-5To 8X 10^-4S^-1；

(e)2×10^-5To 1X 10^-3S^-1；

(f)2×10^-5To 5X 10^-4S^-1；

(g)2×10^-5To 6X 10^-4S^-1；

(h)2×10^-5To 7X 10^-4S^-1(ii) a Or

(i)2×10^-5To 8X 10^-4S^-1。

In one example, K_offIs (or is about) 5X 10^-4S^-1(e.g., when the KD is (or is about) 2nM to 400 pM; when the KD is (or is about) 2-5nM (e.g., 3 nM; or when the KD is (or is about) 100 pM to 400pM (e.g., 140 or 390 pM)). In one example, K_offIs (or is about) 3X 10^-5 S^-1(e.g., when the KD is (or is about) 5-15pM (e.g., 10 pM)).

In one example, the antibody (e.g., in Fab form) or fragment binds to BMP6 (e.g., human BMP6) at a binding rate (K)_on) Is composed of

(a)1×10⁵To 1X 10⁶M^-1S^-1；

(b)1×10⁵To 2X 10⁶M^-1S^-1；

(c)1×10⁵To 3X 10⁶M^-1S^-1；

(d)1×10⁵To 4X 10⁶M^-1S^-1；

(e)1×10⁵To 5X 10⁶M^-1S^-1；

(f)2×10⁵To 5X 10⁶M^-1S^-1；

(g)3×10⁵To 5X 10⁶M^-1S^-1；

(h)4×10⁵To 5X 10⁶M^-1S^-1；

(i)5×10⁵To 5X 10⁶M^-1S^-1(ii) a Or

(i)6×10⁵To 5X 10⁶M^-1S^-1。

In one example, K_onIs (or is about) 1 or 2X 10^-5M^-1S^-1(e.g., when the KD is 2-5nM (e.g., 3 nM)). In one example, K_onIs (or is about) 1-4, 1, 2, 3 or 4X 10^-6M^-1S^-1(e.g. when the KD is (or is about) 5-400pM (e.g. 140 or 390pM) or 5-15pM (e.g. 10 pM)).

As provided in clauses or other aspects herein, an anti-BMP 6 antibody or fragment can bind to BMP6, e.g., human BMP6, K thereof_DLess than 50nM, less than 40nM, less than 30nM, as determined by surface plasmon resonance. In another embodiment, the anti-BMP 6 antibody or fragment can bind to BMP6, e.g., human BMP6, K of which _DLess than 20nM, less than 15nM, less than 10nM as determined by surface plasmon resonance. The anti-BMP 6 antibody or fragment can bind to BMP6, e.g., human BMP6, K_DLess than 8nM, less than 5nM, less than 4nM, less than 3nM, less than 2nM or less than 1nM as determined by surface plasmon resonance. K_DCan be 0.9nM or less, 0.8nM or less, 0.7nM or less, 0.6nM or less, 0.5nM or less, 0.4nM or less, 0.3nM or less, 0.2nM or less, or 0.1nM or less.

In another embodiment, K_DIn the range of 0.01 to 1nM,or in the range of 0.05 to 2nM, or in the range of 0.05 to 1 nM. K_DPossibly with respect to hBMP6, cynomolgus monkey (i.e., "cyno") BMP6 and/or mouse BMP 6.

In another embodiment, the K of the anti-BMP 6 antibody described herein_ONThe rate (e.g., as measured by SPR, e.g., at 25 ℃ or at 37 ℃) is about 0.5 to 10 μ M, e.g., about 1 to 8 μ M or about 1 to 7 μ M. In another embodiment, K_ONThe rate is about 1 to 5. mu.M, e.g., about 1. mu.M, about 1.5. mu.M, about 2. mu.M, about 2.5. mu.M, or about 3. mu.M. In another embodiment, K_ONThe rate is about 3.5. mu.M, about 4. mu.M, about 4.5. mu.M, about 5. mu.M or about 5.5. mu.M.

In another embodiment, the K of the anti-BMP 6 antibody described herein _OFFThe rate (e.g., as measured by SPR, e.g., at 25 ℃ or at 37 ℃) is about 0.01 to 100mM, e.g., about 0.1 to 50mM or about 0.5 to 50 mM. In another embodiment, K_OFFThe rate is about 0.5 to 10mM, or about 0.5 to 10mM, e.g., about 1mM, about 2mM, about 3mM, about 4mM, or about 5 mM. In another embodiment, K_OFFThe rate is about 0.6mM, about 0.7mM, about 0.8mM, or about 0.9 mM.

The invention also provides the following methods (or antibodies or fragments of the invention for use in said methods):

a method of treating anemia in a subject, the method comprising

(a) On the initial day (D)₀) Administering to the individual an anti-BMP 6 antibody or fragment; and

(b) for a period of at least 3 consecutive weeks, starting at D₀Administering multiple doses of an Erythropoietin Stimulating Agent (ESA), wherein the blood hemoglobin (Hb) concentration in the individual is compared to D over the duration of the period₀The baseline concentration at the time of the treatment is increased,

(c) such that for the entire duration of the period:

(i) hb concentration is not less than 100% of baseline Hb concentration; and the Hb concentration reaches at least 120% of baseline over said period of time; and/or

(ii) The Hb concentration is increased by at least 1g/dl compared to baseline.

Optionally, the antibody, fragment or combination inhibits iron release from human hepatocytes, e.g., in an in vitro assay or in a human. Standard assays, such as those mentioned in the examples herein, will be known to those skilled in the art.

Optionally, the antibody, fragment or combination is for use in treating or preventing a BMP6 mediated disease or condition in a human as disclosed herein by inhibiting iron release from human hepatocytes in the human. Optionally, the antibody, fragment or combination is for use in the treatment or prevention of anemia, PAH or fibrosis in a human by inhibiting iron release from human hepatocytes in the human.

Optionally, the antibody, fragment or combination is for use in treating or preventing a BMP6 mediated disease or condition in a human as disclosed herein by inhibiting hamp gene expression in human hepatocytes in the human. Optionally, the antibody, fragment or combination is for use in the treatment or prevention of anemia, PAH or fibrosis in a human by inhibiting hamp gene expression in human hepatocytes.

Optionally, the antibody, fragment or combination is for use in treating or preventing a BMP6 mediated disease or condition in a human as disclosed herein by inhibiting hepcidin or its expression in human hepatocytes in the human. Optionally, the antibody, fragment or combination is for use in the treatment or prevention of anemia, PAH or fibrosis in a human by inhibiting hepcidin or its expression in human hepatocytes.

Optionally, the antibody, fragment or combination is for use in treating or preventing a BMP6 mediated disease or condition in a human as disclosed herein, which is activated by BMP6 inhibiting hamp gene expression in the human (e.g., in its hepatocytes). Optionally, the antibody, fragment or combination is for use in the treatment or prevention of anemia, PAH or fibrosis in a human, which is activated by BMP6 inhibiting the expression of the hamp gene in the human (e.g., in its hepatocytes).

Optionally, the antibody, fragment or combination is for use in treating or preventing a BMP6 mediated disease or condition in a human as disclosed herein by HJV-mediated activation that inhibits hamp gene expression in a human (e.g., in a hepatocyte thereof). Optionally, the antibody, fragment or combination is for use in treating or preventing anemia, PAH or fibrosis in a human by HJV-mediated activation that inhibits hamp gene expression in a human (e.g., in a hepatocyte thereof). In one example, the antibody or fragment competitively inhibits HJV binding to BMP6 in vitro and/or in humans. In vitro competition can be determined by, for example, standard SPR or ELISA.

In one example, the antibody or fragment inhibits human BMP 6-induced luciferase expression in HepG2 cells under the control of an in vitro hamp regulatory region.

Optionally, the antibody, fragment or combination is used to treat or prevent a BMP6 mediated disease or condition in a human as disclosed herein by inhibiting BMP binding in the human (e.g., in hepatocytes thereof). Optionally, the antibody, fragment or combination is for use in the treatment or prevention of anemia, PAH or fibrosis in a human by inhibiting BMP binding in the human (e.g. in hepatocytes thereof). In one example, the antibody or fragment binds to an epitope, wherein the HJV contacts BMP6 to form an HJV-BMP6 complex that is capable of activating hamp gene expression in a human hepatocyte.

In one example, the human cell is an in vitro HepG2 cell. Further details are provided in the examples herein. In one example, inhibition is inhibition in an in vitro HepG2 cell assay, e.g., as determined by reporter gene inhibition under the control of one or more human hamp regulatory elements in vitro. For example, the regulatory element comprises a response element to pSMAD (BMP) and pSTAT (IL 6). In one example, the assay is performed using human BMP6, cynomolgus monkey BMP6, rat BMP6, or mouse BMP 6; and/or using human HJV, cynomolgus monkey HJV, rat HJV or mouse HJV. In one example, the reporter gene is a luciferase gene. In one example, the antibody or fragment neutralizes BMP activation of reporter gene expression in an assay, e.g., neutralization is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% or is complete neutralization.

In one example, the antibody or fragment competes with a reference antibody for binding to BMP6, e.g., as determined by SPR, ELISA, or in a HepG2 assay (e.g., a HepG2 assay as described herein), e.g., using a labeled reference antibody in vitro. In one example, competition reduces the binding by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% or inhibits binding completely. For example, the reference antibody is MAb507 or MAb 2365; for example, the reference antibody is a replacement antibody (e.g., an option 1 or option 2 antibody).

In one example, BMP6 herein is human BMP6(Peprotech #120-06) (SEQ ID NO: 2). In one example, BMP6 herein is any other human BMP6 disclosed herein.

In one example, the antibody or fragment binds human BMP6 with an off-rate of 1 x 10^-4S^-1Or lower as determined by Surface Plasmon Resonance (SPR), e.g. at room temperature or rtp. See the examples.

In one example, the antibody competes for binding to human BMP6 with a reference antibody selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example, selected from the group consisting of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945; for example, selected from the group consisting of CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650 and CL-58756.

In the alternative, the reference antibody herein is selected from the group consisting of CL-58838, CL-66833, CL-57931, CL-57945, CL-58102, CL-58252, CL-58851, CL-75183, CL-75500, CL-75506, CL-75520, CL-75539, CL-75565, CL-75714, CL-58722, CL-58835, CL-58756, CL-58650, CL-58679, CL-58680, and CL-58713. Optionally, the reference antibody is CL-58838.

In one example, the antibody competes for binding to human BMP6 with a reference antibody comprising a heavy chain variable region selected from the group consisting of SEQ ID nos: 24. 42, 114, 132, 96, 78, 60, 258, 240, 222, 204, 186, 168, 150, 276, 384, 366, 348, 294, 330, and 312C; for example selected from SEQ ID nos: 24. 42, 114, 132, 96, 78, and 60; for example selected from SEQ ID nos: 276. 384, 366, 348, 294, 330 and 312; and/or the reference antibody comprises (e.g. comprises respectively) a sequence selected from SEQ ID nos: 33. 51, 123, 141, 105, 87, 69, 267, 249, 231, 213195, 177, 159, 285, 393, 375, 357, 303, 339, and 321; for example selected from SEQ ID nos: 33. 51, 123, 141, 105, 87, and 69; for example selected from SEQ ID nos: 285. 393, 375, 357, 303, 339 and 321 VL amino acid sequences. In one example, the reference antibody is an IgG4 (e.g., IgG4-PE) antibody. In one example, the reference antibody is an IgG1 antibody. In one example, the antibody of the invention is an IgG4 (e.g., IgG4-PE) antibody. In one example, the antibody of the invention is an IgG1 antibody. In one example, the antibody of the invention preferentially binds human BMP6 over human BMP5 and/or human BMP 7. Binding or competition can be determined, for example, by SPR or ELISA as known to those skilled in the art.

In one example, the antibody competes for binding to human BMP6 with a reference antibody comprising the VH amino acid sequence of the VH of an antibody selected from the sequence listing herein; or selected from the tables in the examples; or selected from CL-66833, CL-57890, 42CL-57931, 114CL-58838, 132CL-58851, 96CL-58252, 78CL-58102, CL-57859, CL-58832, 60CL-57945, 258CL-75714, CL-75605, 240CL-75565, 222CL-75539, 204CL-75520, CL-75519, CL-75511, 186CL-75506, 168CL-75500, CL-75496, CL-75194, 150CL-75183, 276CL-58722, 384CL-58713, 366CL-58680, 348CL-58679, CL-58921, CL-58676, 294CL-58835, 330CL-58650 and 312 CL-58756; and/or the reference antibody comprises the VL amino acid sequence of the VH of the selected antibody. In one example, the reference antibody is an IgG4 (e.g., IgG4-PE) antibody. In one example, the reference antibody is an IgG1 antibody. In one example, the antibody of the invention is an IgG4 (e.g., IgG4-PE) antibody. In one example, the antibody of the invention is an IgG1 antibody. In one example, the antibody of the invention preferentially binds human BMP6 over human BMP5 and/or human BMP 7. Binding or competition can be determined, for example, by SPR or ELISA as known to those skilled in the art.

In one example, an antibody or fragment of the invention comprises VH and VL domains of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, or CL-58756.

In one example, the antibodies or fragments of the invention comprise the VH and VL domains of CL-66833. In one example, an antibody or fragment of the invention comprises the VH and VL domains of CL-57931. In one example, an antibody or fragment of the invention comprises the VH and VL domains of CL-58838. In one example, an antibody or fragment of the invention comprises the VH and VL domains of CL-58851. In one example, an antibody or fragment of the invention comprises the VH and VL domains of CL-58252. In one example, an antibody or fragment of the invention comprises the VH and VL domains of CL-58102. In one example, an antibody or fragment of the invention comprises the VH and VL domains of CL-57945.

In one example, the selected antibody is CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, or CL-58102. In one example, the antibody of choice is CL-66833. In one example, the antibody of choice is CL-58838.

In one example, the selected antibody comprises the variable domains of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, or CL-58102. In one example, the selected antibody comprises the variable domain of CL-66833. In one example, the selected antibody comprises the variable domain of CL-58838.

In one example, the selected antibody comprises the VH domain of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, or CL-58102. In one example, the selected antibody comprises the VH domain of CL-66833. In one example, the selected antibody comprises the VH domain of CL-58838.

In one example, the selected antibody comprises the VH and VL domains of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, or CL-58102. In one example, the selected antibody comprises the VH and VL domains of CL-66833. In one example, the selected antibody comprises the VH and VL domains of CL-58838.

In one example, the antibodies or fragments of the invention comprise VH domains encoded by nucleotide sequences that are recombinants of human gene segments IGHV3-11 and IGHJ4 (e.g., human gene segments IGHV3-11 x 01 and IGHJ4 x 02; IGHV3-11, IGHD6-19, IGHJ 4; or IGHV3-11 x 01, IGHD6-19 x 01 and IGHJ4 x 02). Additionally or alternatively, the antibody or fragment of the invention optionally comprises a VL domain encoded by a nucleotide sequence that is a recombinant of the human gene segments IGKV3-20 and IGKJ1 (e.g., IGKV3-20 x 01 and IGKJ1 x 01). Additionally or alternatively, the antibody or fragment of the invention optionally comprises HCDR3 of CL-58835.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example HCDR3 from an antibody selected from the group consisting of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945. Optionally, the antibody or fragment of the invention comprises HCDR1 and/or HCDR2 of said selected antibody.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example HCDR1 from an antibody selected from the group consisting of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945. Optionally, the antibody or fragment of the invention comprises HCDR2 and/or HCDR3 of said selected antibody.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example HCDR2 from an antibody selected from the group consisting of CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945. Optionally, the antibody or fragment of the invention comprises HCDR1 and/or HCDR3 of said selected antibody.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example selected from CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945; for example, a VH of an antibody selected from the group consisting of CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650 and CL-58756. Optionally, the antibody or fragment of the invention comprises the VL of said selected antibody.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example selected from CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945; for example, VL of an antibody selected from the group consisting of CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650 and CL-58756. Optionally, the antibody or fragment of the invention comprises the VH of said selected antibody.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example selected from CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945; for example, a heavy chain of an antibody selected from the group consisting of CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650 and CL-58756. Optionally, the antibody or fragment of the invention comprises the light chain of said selected antibody.

Optionally, the antibody or fragment of the invention comprises a sequence selected from the group consisting of CL-66833, CL-57890, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102, CL-57859, CL-58832, CL-57945, CL-75714, CL-75605, CL-75565, CL-75539, CL-75520, CL-75519, CL-75511, CL-75506, CL-75500, CL-75496, CL-75194, CL-75183, CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650, and CL-58756; for example selected from CL-66833, CL-57931, CL-58838, CL-58851, CL-58252, CL-58102 and CL-57945; for example, a light chain of an antibody selected from the group consisting of CL-58722, CL-58713, CL-58680, CL-58679, CL-58921, CL-58676, CL-58835, CL-58650 and CL-58756. Optionally, the antibody or fragment of the invention comprises the heavy chain of said selected antibody.

In one example, the selected antibody is CL-58835.

Optionally, the antibodies of the invention comprise a human IgG4 constant region.

Preferably, an antibody or fragment thereof that specifically binds hBMP6 will not cross-react with other antigens (but may optionally cross-react with a different BMP6 species such as rhesus monkey, cynomolgus monkey or murine; and or may optionally cross-react with a different BMP such as BMP2, 4 or 9). For example, by immunoassay, BIAcore ^TMOr other techniques known to those skilled in the art, may be usedIdentifying an antibody or fragment thereof that specifically binds to the BMP6 antigen. An antibody or fragment thereof specifically binds to the hBMP6 antigen when it binds with higher affinity to the hBMP6 antigen than to any cross-reactive antigen, as determined using experimental techniques such as Radioimmunoassay (RIA) and enzyme-linked immunosorbent assay (ELISA). Typically, the specific or selective reaction will be at least twice background signal or noise and more typically more than 10 times background. For a discussion of antibody specificity, see, e.g., Paul eds, 1989, basic immunology, second edition, Raven Press, New York, pages 332-336.

The contact amino acid residues involved in the interaction of an antibody with an antigen, such as BMP6, can be determined by a variety of methods known to those skilled in the art.

In one embodiment, if the antibody recognizes a linear epitope, a short peptide based on the antigen sequence can be generated and the binding of the antibody to the peptide can be assessed using standard techniques.

In one embodiment, limited proteolytic digestion and mass spectrometry analysis can be used to identify binding epitopes.

In one embodiment, the contact residues of the epitope are identified by X-ray crystallography. In one embodiment, the contact residues of the epitope are identified by cryoelectron microscopy. In one embodiment, the contact residues of the epitope are identified by a combination of limited proteolytic digestion and mass spectrometry analysis.

In another embodiment, the anti-BMP 6 antibodies (and fragments) described herein provide improved transient expression levels over other anti-BMP 6 antibodies and fragments. Thus, in one embodiment, the anti-BMP 6 antibody (or fragment) is expressed in HEK293 cells (e.g., HEK293T cells) in an amount of about 100 μ g/mL, or in a range of about 100 to 350 μ g/mL. In another embodiment, the expression level is greater than about 350 μ/mL.

In another embodiment, the anti-BMP 6 antibody (or fragment) is expressed in CHO cells (e.g., Expi-CHO cells) in an amount of about 100 μ g/mL, or in a range of about 100 to 350 μ g/mL. In another embodiment, the expression level is greater than about 350. mu.g/mL.

In another embodiment, the anti-BMP 6 antibody (or fragment) is expressed in CHO cells (e.g., Expi-CHO cells or CHO-E7 EBNA cells) in an amount of about 100 μ g/mL, or in a range of about 100 to 350 μ g/mL. In another embodiment, the expression level is greater than about 350. mu.g/mL. The antibody for example comprises the VH and VL domains of any one of CL-58838 in the form of human IgG1 or human IgG4 (e.g. IgG 4-PE).

In any of the expression systems, expression is in the range of between about 0.5mL to 3mL, for example about 0.5mL to 2 mL. In any of the expression systems, the anti-BMP 6 antibody (or fragment) may be expressed from a pTT5 vector. In any of the expression systems, the anti-BMP 6 antibody (or fragment) may be expressed in combination with a lipofectin, and may optionally be expressed in CHO cells (e.g., Expi-CHO cells). In any of the expression systems, the anti-BMP 6 antibody (or fragment) may be expressed in combination with a PEI transfection reagent, and may optionally be expressed in CHO cells (e.g., CHO-E7 EBNA cells). In any of the expression systems, the anti-BMP 6 antibody (or fragment) can be expressed in combination with a helper plasmid (e.g., an AKT helper plasmid), and can optionally be expressed in CHO cells (e.g., CHO-E7 EBNA cells).

In any of the expression systems, the amount expressed is between about 100 μ g/mL and about 1500 μ g/mL, such as between about 100 μ g/mL and about 1000 μ g/mL, or between about 200 μ g/mL and about 1000 μ g/mL, or between about 350 μ g/mL and about 1000 μ g/mL. In any of the expression systems, the lower limit of expression can be about 100. mu.g/mL, about 200. mu.g/mL, about 300. mu.g/mL, or about 400. mu.g/mL. In another embodiment, the lower limit of expression may be about 500. mu.g/mL, about 600. mu.g/mL, about 700. mu.g/mL, or about 800. mu.g/mL. In any of the expression systems, the lower limit of expression can be about 2000. mu.g/mL, about 1800. mu.g/mL, about 1600. mu.g/mL, or about 1500. mu.g/mL. In another embodiment, the lower limit of expression may be about 1250. mu.g/mL, about 1000. mu.g/mL, about 900. mu.g/mL, or about 800. mu.g/mL.

In another embodiment, the expression system is a Lonza expression system, e.g., LonzaProvided is a system. In the Lonza expression system, expression may be performed in a range of about 30mL to 2L, e.g., 50mL to 1L, or 1L to 2L. In the Lonza expression system, the anti-BMP 6 antibody (or fragment) can be expressed in conjunction with electroporation, and optionally in the absence of any helper plasmid. In the Lonza expression system, the anti-BMP 6 antibody (or fragment) may be expressed in an amount of about 1g/L, or about 900mg/L, or about 800mg/L, or about 700 mg/L. In another embodiment, the anti-BMP 6 antibody (or fragment) may be expressed in an amount of about 600mg/L or about 500mg/L or about 400mg/L in a Lonza expression system. In the Lonza expression system, the anti-BMP 6 antibody (or fragment) may be expressed in an amount between about 400mg/L and about 2g/L, such as between about 500mg/L and about 1.5g/L, or between about 500mg/L and about 1 g/L. In another embodiment, the expression level is greater than 1 g/L. In another embodiment, the anti-BMP 6 antibody provides improved half-life compared to other anti-BMP 6 antibodies.

In one embodiment, the antibody or fragment is a human antibody or fragment. In one embodiment, the antibody or fragment is a fully human antibody or fragment. In one embodiment, the antibody or fragment is a fully human monoclonal antibody or fragment.

In one embodiment, the antibody or fragment is a humanized antibody or fragment. In one embodiment, the antibody or fragment is a humanized monoclonal antibody or fragment.

The contact amino acid residues involved in the interaction of an antibody with an antigen can be determined by various methods known to those skilled in the art, such as alanine scanning, protein crystallography, mass spectrometry, or any other technique apparent to those skilled in the art.

In one embodiment, the CDR comprises one amino acid substitution, which may be a conservative amino acid substitution. In one embodiment, the CDR comprises two amino acid substitutions, which may be conservative amino acid substitutions. In one embodiment, the CDR comprises three amino acid substitutions, which may be conservative amino acid substitutions. In one embodiment, the CDR comprises four amino acid substitutions, which may be conservative amino acid substitutions. In one embodiment, the CDR comprises five amino acid substitutions, which may be conservative amino acid substitutions. In one embodiment, the CDR comprises six amino acid substitutions, which may be conservative amino acid substitutions.

Amino acid substitutions include changes in which an amino acid is replaced with a different naturally occurring amino acid residue. Such substitutions may be classified as "conservative", in which case an amino acid residue contained in a polypeptide is replaced with another naturally occurring amino acid having similar properties in terms of polarity, side chain functionality, or size. Such conservative substitutions are well known in the art. Substitutions encompassed by the invention may also be "non-conservative," wherein an amino acid residue present in a peptide is substituted with an amino acid having different properties, such as a naturally occurring amino acid from a different group (e.g., a charged or hydrophobic amino acid is substituted with alanine), or wherein a naturally occurring amino acid is substituted with a non-conventional amino acid.

In one embodiment, conservative amino acid substitutions are as described herein. For example, substitution may be Y with F, T with S or K, P with A, E with D or Q, N with D or G, R with K, G with N or A, T with S or K, D with N or E, I with L or V, F with Y, S with T or A, R with K, G with N or A, K with R, A with S, K or P. In another embodiment, a conservative amino acid substitution may be where Y is substituted with F, T is substituted with A or S, I is substituted with L or V, W is substituted with Y, M is substituted with L, N is substituted with D, G is substituted with A, T is substituted with A or S, D is substituted with N, I is substituted with L or V, F is substituted with Y or L, S is substituted with A or T, and A is substituted with S, G, T or V.

Combination of

The antibodies or fragments of the invention can be included with an ESA by a combination therapy for the treatment or prevention of anemia, particularly moderate to severe anemia (i.e., as indicated by blood hemoglobin less than 9.5 g/dL). The combination is effective in treating anemia such as ACD (anemia of chronic disease), inflammation, or infection and the combination therapy can produce maintenance and elevation of blood hemoglobin concentration, which is statistically significant compared to the use of anti-BMP 6 antibody alone. Furthermore, the effect may last for weeks (even after a single dose administration of the anti-BMP 6 antibody). Furthermore, the combination therapy of the invention may be used for ESA palliative therapy, i.e. ESA treatment with a lower than standard dose of ESA. This is useful in view of the potentially harmful side effects of ESAs. The invention may also be used for the treatment of anemia in individuals who are ESA refractory or who respond poorly to standard ESA therapy. The present invention can be useful to maintain blood hemoglobin outside the range of moderate to severe anemia and/or to prevent blood hemoglobin from falling into such a range. Thus, the present invention can be used to reduce the need for iron or transfusion therapy.

The invention can be used for treating anemia in inflammatory disease environments and microbial infection environments.

To this end, the present invention provides the following configurations 1 to 13:

1. a method of maintaining a blood hemoglobin content of at least 10g/dL in an individual comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

2. A method of preventing a blood hemoglobin level of an individual from decreasing below 10g/dL, the method comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

3. A method of raising blood hemoglobin to at least 10g/dL in a subject suffering from anemia, comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated.

4. A method of treating or preventing moderate or severe anemia in a subject, the method comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

5. A method of treating or preventing anemia in a subject suffering from an inflammatory disease or condition, comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

6. A method of eliminating or reducing the need for administration of iron or a blood transfusion to an individual suffering from anemia, the method comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the need is eliminated or reduced.

In one example, one, more or all of unstable plasma iron (LPI), enhanced LPI (etlpi), and non-transferrin bound iron (NTBI) are reduced in the individual. In one example, one, more or all of unstable plasma iron (LPI), enhanced LPI (etlpi), and non-transferrin bound iron (NTBI) are reduced in the individual.

7. A method of treating or preventing anemia in a subject suffering from a microbial infection, comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

8. A method of reducing administration of an Erythropoiesis Stimulating Agent (ESA) in a subject suffering from anemia, to treat anemia, comprising administering an anti-BMP 6 antagonist and the ESA, wherein anemia in the subject is treated.

9. A method of treating or reducing the risk of anemia in a subject suffering from or at risk of anemia, comprising administering to the subject an anti-BMP 6 antagonist and a low dose of an Erythropoiesis Stimulating Agent (ESA), wherein anemia is treated or the risk of anemia is reduced in the subject.

10. A therapeutic regimen for treating or preventing anemia in a subject suffering from or at risk of anemia, comprising administering to the subject, simultaneously or sequentially, an anti-BMP 6 antagonist and an ESA, wherein

a. Administering the antagonist to the individual on day 0; and administering the ESA to the individual no later than day 7 (e.g., day 1); or

b. Administering the ESA to the individual on day 0; and administering the antagonist to the individual no later than day 7 (e.g., day 1); or

c. Administering to the individual the antagonist and the ESA simultaneously on day 0; or

d. (ii) the individual has received the ESA on day 0 and the antagonist is administered to the individual on day 0; or

e. The individual has received the antagonist on day 0 and the individual is administered the ESA on day 0;

whereby, on or after day 14, the blood hemoglobin content in the subject is at least 10g/dL, wherein the anemia is treated or prevented.

11. A combination therapy for treating or preventing anemia in an individual for use in a method or regimen of any of the preceding claims, the combination comprising

a. An anti-BMP 6 antagonist;

ESA; and

c. optionally instructions for use in the methods or protocols.

12. An anti-BMP 6 antagonist for use in a method or regimen according to any preceding configuration, for treating or preventing anemia in a subject.

13. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of treating or preventing anemia in a subject, the method comprising administering to the subject the anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

When reference is made herein to an "anti-BMP 6 antagonist," the antagonist can be any anti-BMP 6 antibody or fragment disclosed herein, such as an alternative antibody or fragment (as described elsewhere herein) or any antibody or fragment as claimed or referred to in the statements of the invention or in the examples (as in tables 4-11).

In one aspect, the antagonist comprises or consists of an anti-BMP 6 antibody or fragment, the method comprising

(a) On the initial day (D)₀) Administering the anti-BMP 6 antibody or fragment to the individual; and

(b) for a period of at least 3 consecutive weeks, starting at D₀Administering multiple doses of an ESA, wherein the blood Hb concentration in the individual is compared to D for the entire duration of the period₀The baseline concentration at the time of the treatment is increased,

Such that:

(i) the Hb concentration is no less than 100% of the baseline Hb concentration for the entire duration of the period; and, over the period, the Hb concentration reaches at least 120% of baseline; and/or

(ii) Throughout the duration of the period, the Hb concentration increases by at least 1g/dl compared to baseline.

Aspects of the invention are as follows, and the aspects (and any unnumbered paragraphs) may be combined with any other configuration, embodiment, feature, aspect or clause of the invention as described herein; antagonists (e.g., anti-BMP 6 antibodies or fragments) or ESAs of the invention can provide methods for (or can be used in) the following:

1. a method of maintaining a blood hemoglobin content of at least 10, 10.5, 11, 11.5, 12, 12.5, or 13g/dL in an individual comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

In one example, the Hb level in the subject is no greater than 11, 11.5, or 12 g/dl.

2. A method of preventing a blood hemoglobin level of an individual from decreasing to less than 10, 10.5, 11, 11.5, 12, 12.5, or 13g/dL, the method comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

3. A method of increasing blood hemoglobin levels to at least 10, 10.5, 11, 11.5, 12, 12.5, or 13g/dL in a subject suffering from anemia, comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated.

In examples of any aspect, the individual suffers from moderate or severe anemia prior to administration of the BMP6 antagonist. In one embodiment, the result of the method is that the subject does not have anemia or has mild (not moderate or severe) anemia.

4. A method of treating or preventing moderate or severe anemia in a subject, the method comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

5. A method of treating or preventing anemia in a subject suffering from an inflammatory disease or condition, comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

In one example, the inflammatory disease or condition is selected from the group consisting of a microbial infection (e.g., a bacterial infection) or inflammation of rheumatoid arthritis. In one example, the anemia is inflammatory anemia (also known as anemia of chronic disease, ACD).

6. A method of eliminating or reducing the need for administration of iron or a blood transfusion to an individual suffering from anemia, the method comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the need is eliminated or reduced.

In one embodiment, the method reduces the dose (e.g., weekly, biweekly, or monthly dose) or frequency of administration of iron.

7. A method of treating or preventing anemia in a subject suffering from a microbial (e.g., bacterial) infection, comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

8. A method of reducing administration of an Erythropoiesis Stimulating Agent (ESA) to a subject suffering from anemia to treat anemia, the method comprising administering an anti-BMP 6 antagonist and the ESA, wherein anemia in the subject is treated.

9. A method of treating or reducing the risk of anemia in a subject suffering from or at risk of anemia, comprising administering to the subject an anti-BMP 6 antagonist and a low dose of an Erythropoiesis Stimulating Agent (ESA), wherein anemia is treated or the risk of anemia is reduced in the subject.

The dose is lower than the standard dose typically used to treat or reduce anemia in an individual (e.g., a human or adult, such as a male or female). Typical dosages for treatment or prophylaxis will be apparent to those skilled in the art. See, for example, aspect 10.

Epogen is typically formulated as vials of multiple formulations. Single dose vials formulated with isotonic sodium chloride/sodium citrate buffer are provided in a variety of strengths. Each 1mL vial contained 2000, 3000, 4000 or 10,000 units of epoetin α, albumin (human) (2.5mg), citric acid (0.06mg), sodium chloride (5.9mg) and sodium citrate (5.8mg) in water for injection USP (pH 6.9. + -. 0.3). A single dose 1mL vial formulated with isotonic sodium chloride/sodium phosphate buffer contained 40,000 units of epoetin alpha, albumin (human) (2.5mg), citric acid (0.0068mg), sodium chloride (5.8mg), sodium citrate (0.7mg), disodium hydrogen phosphate anhydrous (1.8mg), and sodium dihydrogen phosphate monohydrate (1.2mg) in water for injection USP (pH 6.9. + -. 0.3). A multi-dose 2mL vial contains 10,000 units of epoetin alpha per 1mL of water for injection USP (pH 6.1 ± 0.3), albumin (human) (2.5mg), benzyl alcohol (1%), sodium chloride (8.2mg) and sodium citrate (1.3 mg). A multi-dose 1mL vial contains 20,000 units of epoetin alpha per 1mL of water for injection USP (pH 6.1 ± 0.3), albumin (human) (2.5mg), benzyl alcohol (1%), sodium chloride (8.2mg), citric acid (0.11mg), and sodium citrate (1.3 mg). In one embodiment of the invention, the ESA is administered as one of the formulations.

10. The method according to any preceding aspect, wherein the ESA is

a. Epoetin alpha and is administered at a weekly dose of less than 1000, 1500, 2500, 5000, 11000, 18000, 34000, or 90000 units, optionally wherein the subject has previously received < 1500, 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90000 units of weekly epoetin alpha treatment, respectively;

b. dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms, optionally wherein the individual has previously received 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms of dapoxetine alpha or per week, respectivelyTreatment; or

c. Dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 20, 40, 60, 100 or 200 micrograms, optionally wherein the subject has previously received 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90,000 units of weekly epoetin alpha treatment, respectively.

11. The method according to any preceding aspect, wherein the anti-BMP 6 antagonist is an antibody and is administered at a total dose of no more than 30mg/kg (e.g. 0.1 to 30mg/kg), such as every 1 week, 2 weeks or 3 weeks, or monthly, 2 months or 3 months. Administration can be, for example, intravenous or subcutaneous administration, and the subject is a human, such as an adult.

12. A therapeutic regimen for treating or preventing anemia in a subject suffering from or at risk of anemia, comprising administering to the subject, simultaneously or sequentially, an anti-BMP 6 antagonist and an ESA, wherein

a. Administering the antagonist to the individual on day 0; and by no later than day 56, 28, 14 or 7 (e.g., on day 1, 6 or 7), administering the ESA to the individual; or

b. Administering the ESA to the individual on day 0; and administering the antagonist to the individual no later than day 56, 28, 14, or 7 (e.g., on day 1, 6, or 7); or

c. Administering to the individual the antagonist and the ESA simultaneously on day 0; or

d. (ii) the individual has received the ESA on day 0 and the antagonist is administered to the individual on day 0; or

e. The individual has received the antagonist on day 0 and the individual is administered the ESA on day 0;

whereby, at or after day 14 (e.g., at day 28, 56, or 70), the blood hemoglobin content in the subject is at least 10, 10.5, 11, 11.5, 12, 12.5, or 13g/dL, wherein the anemia is treated or prevented.

Optionally, the antagonist is administered a second time not later than day 7 (e.g., the antagonist is administered on day 6).

13. The method or regimen according to any of the preceding aspects, wherein the anti-BMP 6 antagonist and ESA are administered to the individual no more than 7 days apart.

14. The method or regimen according to any of the preceding aspects, wherein the method or regimen maintains blood hemoglobin content in the subject at greater than 10g/dL in the subject.

15. The method or regimen according to any preceding aspect, wherein the method or regimen maintains or increases blood hemoglobin levels in the subject to at least 10g/dL at least 13 or 14 days after the subject has received the anti-BMP 6 antagonist and ESA.

16. The method or regimen according to aspect 14 or 15, wherein the anti-BMP 6 antagonist and ESA are administered to the individual no more than 1 day apart.

17. The method or regimen according to any of the preceding aspects, wherein the anti-BMP 6 antagonist and ESA are administered to the individual simultaneously.

18. The method or regimen according to any preceding aspect, wherein the subject is prevented from having a blood hemoglobin content that falls to less than 10, 10.5, 11, 11.5, 12, 12.5, or 13g/dL (e.g., on day 14).

19. The method or regimen according to any of the preceding aspects, wherein the subject's blood hemoglobin is raised to a level of at least 10, 10.5, 11, 11.5, 12, 12.5, or 13g/dL (e.g., on day 14).

20. The method or regimen according to any of the preceding aspects, wherein moderate or severe anemia in the subject is prevented (e.g., on day 14).

21. The method or regimen according to any of the preceding aspects, wherein said subject suffers from

a. An inflammatory disease or condition; or

b. (ii) infection;

c. renal disease;

HIV or treatment with HIV; or

e. Cancer; and is

Anemia in the subject is treated or prevented.

In one example, the subject is suffering from HIV infection, HIV, hepatitis, rheumatoid arthritis, chronic kidney disease, or end stage renal disease. For example, the infection is a gram-negative bacterial infection. For example, the infection is a gram positive bacterial infection.

Anemia may occur in HIV-infected humans treated with anti-HIV therapy. Thus, the present invention may be used for treating or preventing anemia in said patient. In one example, the methods or regimens may utilize administration of anti-HIV therapy, e.g., < 4200 mg/week zidovudine (zidovudine), to treat or prevent anemia in HIV-infected humans.

Anemia may arise in cancer patients treated with anti-cancer chemotherapy (e.g., immunotherapy, e.g., by administering to the individual an immune checkpoint inhibitor, e.g., anti-CTLA 4, anti-PD-L1, anti-TIGIT, anti-ICOS, or anti-PD 1 antibody). Thus, the present invention may be used for treating or preventing anemia in said patient. In one example, the method or regimen treats or prevents anemia in a human suffering from cancer. In the art, ESAs such as erythropoietin are typically initially administered at a dose of 150 units/kg IV or SC 3 times per week; or 40,000 units SC once per week to the patient until completion of the chemotherapy course. In one example, the present invention treats or prevents anemia in a human cancer patient, wherein the ESA is administered intravenously or subcutaneously to the human less than 150 units/kg 3 times per week; or less than 450 units/kg of total weekly dose to a human; or less than 40,000 units per week administered subcutaneously to a human.

ESA treatment is used in the art to reduce the need for Red Blood Cell (RBC) transfusions in patients, for example in patients undergoing surgery. Thus, ESA treatment is used in human patients with, for example, perioperative hemoglobin > 10g/dL but ≦ 13g/dL, which has a high risk of perioperative blood loss due to surgery such as elective, non-cardiac, non-vascular surgery. ESA was administered once daily at 300 units/kg SC for 15 consecutive days (10 days before surgery, day of surgery, 4 days after surgery); alternatively, 600 units/kg SC were administered at 4 doses on 21, 14 and 7 days before surgery and on the day of surgery. In one example, the present invention treats or prevents anemia in a human surgical patient, wherein the ESAs are administered to the human as follows: less than 300 units/kg once a day for 15 consecutive days (10 days before surgery, the day of surgery, 4 days after surgery); or a total daily dose of 15 days of less than 4500 units/kg; or less than 600 units/kg, in 3-5 or 4 doses, e.g., 21, 14 and 7 days prior to surgery and the day of surgery.

22. The method according to aspect 21, wherein moderate or severe anemia in the subject is treated or prevented.

23. The method or regimen according to any of the preceding aspects, wherein the subject is a mammal.

24. A combination therapy for use in a method or regimen according to any of the preceding aspects to treat or prevent anemia in an individual, said combination comprising

a. An anti-BMP 6 antagonist;

ESA; and

c. optionally instructions for use of the method or protocol.

25. An anti-BMP 6 antagonist for use in a method or regimen according to any preceding aspect to treat or prevent anemia in an individual.

26. A combination according to aspect 24 or an antagonist according to aspect 25 for use in the treatment or prevention of moderate or severe anemia.

27. A combination of an antagonist according to any one of aspects 24 to 26 and an anti-inflammatory agent.

28. A method, regimen, combination or antagonist according to any preceding aspect, wherein the antagonist comprises an anti-BMP 6 antibody binding site, e.g. wherein the antagonist is an antibody or an anti-BMP 6 capture agent.

In one example, the capture agent comprises a human BMP6 receptor domain fused to a human antibody Fc region. In one embodiment, the Fc comprises a human gamma-1 or gamma-4 heavy chain constant region.

29. A method, regimen, combination or antagonist according to any preceding aspect, wherein the ESA is erythropoietin.

30. The method or regimen of any one of aspects 1-23, 28, and 29, wherein the individual is administered an anti-inflammatory agent.

In one example of the above-described method,the present invention uses monoclonal antibodies (mabs) against BMP6 to mobilize endogenous iron stores and increase hemoglobin synthesis and optionally erythropoiesis. In one aspect, the invention can reduce the need for simultaneous and widespread use of intravenous iron or blood transfusions in ACD patients. Additionally or alternatively, the invention can reduce the dose of ESA (e.g., EPO) to base standard of care therapy or to render ESA (e.g., EPO) non-responsive (or those with low responsiveness) responsive to coadministration of ESA with an anti-BMP 6 antagonist. Additionally or alternatively, the invention can treat or prevent anemia in patients who are refractory anemia or who do not respond to the ESA standard of care. In patients with uncontrolled hypertension or suffering from a predisposition to receive ESA (e.g. dabbepotin alpha, e.g. bepotin alpha)Or e.g. epoetin alpha, e.g.Or) ESA may be contraindicated in patients with induced pure red blood cell aplasia (PRCA), an anemia.

Thus, in one embodiment of the invention, the subject (e.g., human) is

ESA (e.g. dabecortine α or epoetin α) refractory or non-responsive to ESA;

suffering or having suffered from hypertension (e.g., uncontrolled hypertension); or

Suffering or having suffered from pure red blood cell aplasia (e.g. caused by receiving an ESA such as bepotein alpha or epoetin alpha).

"refractory" in connection with drug treatment, such as ESA treatment, is readily apparent to one skilled in the art and means, for example, that an individual is resistant to ESA or has a low response to ESA (i.e., has less than an average response) and is not effective for anemia treatment by use of the standard of care of ESA.

ESA is typically used to maintain hemoglobin at a minimum level, both to minimize transfusion and to maximize patient demand. As noted above, the present invention, in its various configurations, aspects, embodiments and embodiments, is useful in ESA palliative anemia therapy, i.e., capable of ESA treatment with lower than standard doses of ESA. This is useful in view of the potentially harmful side effects of ESAs. Tables A-D provide relevant information for the aspects.

Table a: drug administration information

In one example, the subject is a Chronic Kidney Disease (CKD) patient that has not undergone dialysis. In one example, the subject is a Chronic Kidney Disease (CKD) patient undergoing dialysis. In one example, the individual is a chemotherapy patient (e.g., receiving or having received cancer chemotherapy treatment).

[ Table B below ]

Table B: side effects

In one embodiment, the treatment or prevention of the invention reduces the incidence or risk of one or more side effects (e.g., one or more "common", "more common", or "very common" side effects) listed in table B in an individual.

In one aspect, the invention provides a method of reducing side-effect ESA therapy in a subject suffering from or at risk of anemia, the method comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented. Optionally, the incidence or risk of one or more ESA side effects (e.g., one or more "common", "more common", or "very common" side effects) listed in table B is reduced. In one example, the therapy is an anemia treatment. In one example, the therapy is anemia prevention. In one example, the anemia is moderate or severe anemia.

Table C: american Black frame Warning

In one embodiment, the treatment or prevention of the invention reduces the incidence or risk, e.g., shortens overall survival and/or increases the risk of tumor progression or recurrence, of one or more of the side effects listed in table C in an individual who is a breast cancer, non-small cell lung cancer, head and neck cancer, lymphoma, and cervical cancer patient; or cardiovascular or thromboembolic responses, such as stroke.

In one aspect, the invention provides a method of reducing side-effect ESA therapy in a subject suffering from or at risk of anemia, the method comprising administering to the subject an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented. Optionally, the incidence or risk (e.g., shortening overall survival and/or increasing risk of tumor progression or recurrence in a subject having breast cancer, non-small cell lung cancer, head and neck cancer, lymphoma and cervical cancer, or cardiovascular or thromboembolic responses, such as stroke) of one or more of the ESA side effects listed in Table C is reduced. In one example, the therapy is an anemia treatment. In one example, the therapy is anemia prevention. In one example, the anemia is moderate anemia. In one example, the anemia is moderate to severe anemia. In one example, the anemia is severe anemia. In one example, the anemia in the present invention is anemia arising from myelosuppressive chemotherapy.

Table D: estimated Aranesp start dose for dialysis CKD patients based on previous epoetin alpha dose (unit intimate) (microgram/week)

For pediatric patients receiving < 1,500 units/week epoetin alpha dose weekly, the current data is insufficient to determine Aranesp conversion doses.

Aspects of the present invention provide (i) and (ii)

(i) A method of reducing Erythropoiesis Stimulating Agents (ESAs) administered to a subject suffering from anemia to treat anemia, comprising administering an anti-BMP 6 antagonist and the ESAs, wherein anemia in the subject is treated.

(ii) A method of treating or reducing the risk of anemia in a subject suffering from or at risk of anemia, comprising administering to the subject an anti-BMP 6 antagonist and a low dose of an Erythropoiesis Stimulating Agent (ESA), wherein anemia is treated or the risk of anemia is reduced in the subject.

In an example of such an aspect, the ESA is

a. Epoetin alpha and is administered at a weekly dose of less than 1000, 1500, 2500, 5000, 11000, 18000, 34000, or 90000 units, optionally wherein the subject has previously received < 1500, 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90000 units of epoetin alpha therapy, respectively, per week;

b. Dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms, optionally wherein the individual has previously received 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms per week of dabbepotein alpha orTreatment; or

c. Dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 20, 40, 60, 100 or 200 micrograms, optionally wherein the subject has previously received 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90,000 units of epoetin alpha per week, respectively.

In an example, the ESA is

(i) Epoetin α and is administered at a weekly dose in the range of 3000 to 30000 units; or

(ii) Dabecortine α orAnd is administered at a weekly dose in the range of 15 to 100 micrograms; and is

Wherein the subject is a human, such as an adult.

In one example, the blood hemoglobin is raised to or maintained at a level above 10 g/dL.

In one example, the individual is an adult. In one example, the subject is a child. In one example, the subject is a human CKD patient undergoing dialysis treatment. In one example, the subject is a human having end stage renal disease.

In the methods of the invention, a therapeutically or prophylactically effective amount of the antagonist and the ESA are administered to the individual. In one example, the anti-BMP 6 antagonist is administered to the individual with an ESA no more than 10, 14, 21, or 28 days apart. For example, the anti-BMP 6 antagonist is administered to the subject with an ESA no more than 1 or 2 months apart.

Examples of erythropoiesis-stimulating agents (ESAs) are epoetin alpha,Erythropoietin, bepotastin alpha,Epoetin beta,Methoxypolyethylene glycol-epoetin beta,Andin one embodiment, the ESAs of the present invention are any one of the recited or a combination of two or more of the recited.

In one example, the ESA comprises or consists of a recombinant erythropoietin, e.g., selected from the following table. Erythropoietin has multiple glycosylation patterns, producing the α, β, δ and ω forms:

_______________________

table E: exemplary erythropoietin

In one example, the ESAs of the present invention are selected from the group consisting of alpha, beta, delta, zeta, and omega forms.

In one example, the ESA is a hypoxia inducible factor-prolyl hydroxylase (HIF-PH) inhibitor, such as roxadestat or FG-4592. HIF is a major regulator of Red Blood Cell (RBC) production in the body and a potential new mechanism for treating anemia. The new mechanism of action is known as hypoxia inducible factor-prolyl hydroxylase (HIF-PH) inhibitors. HIF-PH inhibitors work by mimicking the natural response of the human body to anemia. This allows for controlled adaptive stimulation of the erythropoiesis system in vivo. This activation of the entire system results in increased Red Blood Cell (RBC) production and increased stability of the bone marrow iron supply, which ensures proper incorporation of iron into hemoglobin required for said RBC production. This adaptive simulation closely resembles the natural response of a person as altitude rises. At higher altitudes, circulating hypoxic levels in the bloodstream result in decreased HIF-PH activity of the relevant cells in the kidney and liver. HIF-PH activity decreases, stabilizes, and increases the levels of the intracellular proteins HIF1 α and HIF2 α (collectively HIF α). For most cells, HIF2 α was stabilized more than HIF1 α, ultimately resulting in increased Erythropoietin (EPO) secretion and subsequent increased RBC production. HIF-PH inhibitors act by blocking the action of prolyl hydroxylase, which promotes the breakdown of HIF α proteins. As degradation is inhibited, the level of HIF α protein in the cell increases. The HIF is the major protein mediator that allows the body and all its individual cells to adapt to changes in oxygen levels. HIF α protein is continuously produced and its levels in cells are regulated by the activity of HIF-PH enzymes, which target HIF α protein for degradation. HIF1 α contributes to cell survival under very low oxygen conditions, while HIF2 α helps cells and the body adapt to moderate oxygen changes, which can occur from sea level to 7500 feet of altitude change. When HIF α is stabilized, it migrates to the nucleus of the cell where it binds to the protein HIF β. When combined together, induce genetic signals to produce EPO and several other proteins. HIF-PH inhibitors can greatly increase HIF α levels in the same manner as increasing HIF α levels by lowering hypoxia through inhibition of HIF-PH enzymes in the body. As HIF α continues to stabilize (either by remaining at higher altitudes or by daily administration of HIF-PH inhibitors), hemoglobin and RBC levels will rise in order to increase the amount of oxygen circulating in the blood.

An example of an anti-BMP 6 antibody is MAB507, which is commercially available from R & D Systems (monoclonal mouse IgG2B, clone # 74219). Other suitable antibodies are disclosed in US8980582, WO2016098079 and US20160176956a1, the disclosures of which (and specifically the sequences of the antibodies, variable regions and CDRs therein) are incorporated herein by reference for possible use in the present invention.

In one embodiment, the antagonist comprises or consists of an antibody or antigen-binding fragment thereof that binds human BMP-6(SEQ ID NO: 1) comprising a Light Chain Variable Region (LCVR) and a Heavy Chain Variable Region (HCVR), wherein the LCVR comprises Complementarity Determining Regions (CDRs) LCDR1, LCDR2 and LCDR3, and the HCVR comprises CDRs HCDR1, HCDR2 and HCDR3, wherein LCDR1 is SEQ ID NO: 2, LCDR2 is SEQ ID NO: 3, LCDR3 is SEQ ID NO: 4, HCDR1 is SEQ ID NO: 5, HCDR2 is SEQ ID NO: 6 or SEQ ID NO: 7, and HCDR3 is SEQ ID NO: 8. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the antagonist comprises or consists of an antibody or antigen-binding fragment thereof that binds human BMP-6(SEQ ID NO: 1) comprising a Light Chain Variable Region (LCVR) and a Heavy Chain Variable Region (HCVR), wherein the LCVR comprises Complementarity Determining Regions (CDRs) LCDR1, LCDR2 and LCDR3, and the HCVR comprises CDRs HCDR1, HCDR2 and HCDR3, wherein LCDR1 is SEQ ID NO: 2, LCDR2 is SEQ ID NO: 3, LCDR3 is SEQ ID NO: 4, HCDR1 is SEQ ID NO: 5, HCDR2 is SEQ ID NO: 6, and HCDR3 is SEQ ID NO: 8. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the antagonist comprises or consists of an antibody or antigen-binding fragment thereof that binds human BMP-6(SEQ ID NO: 1) comprising a Light Chain Variable Region (LCVR) and a Heavy Chain Variable Region (HCVR), wherein the LCVR comprises Complementarity Determining Regions (CDRs) LCDR1, LCDR2 and LCDR3, and the HCVR comprises CDRs HCDR1, HCDR2 and HCDR3, wherein LCDR1 is SEQ ID NO: 2, LCDR2 is SEQ ID NO: 3, LCDR3 is SEQ ID NO: 4, HCDR1 is SEQ ID NO: 5, HCDR2 is SEQ ID NO: 7, and HCDR3 is SEQ ID NO: 8. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the antagonist comprises or consists of an antibody or antigen-binding fragment thereof that binds human BMP-6(SEQ ID NO: 1), comprising a LCVR and a HCVR, wherein the LCVR is SEQ ID NO: 9 and said HCVR is SEQ ID NO: 10 or SEQ ID NO: 11. In another embodiment, the antagonist comprises or consists of an antibody or antigen-binding fragment thereof that binds human BMP-6(SEQ ID NO: 1), comprising a LCVR and a HCVR, wherein the LCVR is SEQ ID NO: 9 and said HCVR is SEQ ID NO: 10. In another embodiment, the antagonist comprises or consists of an antibody or antigen-binding fragment thereof that binds human BMP-6(SEQ ID NO: 1), comprising a LCVR and a HCVR, wherein the LCVR is SEQ ID NO: 9 and said HCVR is SEQ ID NO: 11. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the antagonist comprises or consists of an antibody that binds human BMP-6(SEQ ID NO: 1), which comprises a LCVR that is a variant of SEQ ID NO: 9 and said HCVR is SEQ ID NO: 10 or SEQ ID NO: 11. In another embodiment, the invention provides an antibody that binds to human BMP-6(SEQ ID NO: 1), comprising a LCVR and a HCVR, wherein the LCVR is SEQ ID NO: 9 and said HCVR is SEQ ID NO: 10. In another embodiment, the antagonist comprises or consists of an antibody that binds human BMP-6(SEQ ID NO: 1), which comprises a LCVR that is a variant of SEQ ID NO: 9, and the HCVR is SEQ ID NO: 11. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the antagonist comprises or consists of an antibody that binds human BMP-6(SEQ ID NO: 1) comprising a Light Chain (LC) and a Heavy Chain (HC), wherein the LC is SEQ ID NO: 12, and the HC is SEQ ID NO: 13 or SEQ ID NO: 14. In another embodiment, the antagonist comprises or consists of an antibody that binds human BMP-6(SEQ ID NO: 1), comprising LC and HC, wherein the LC is SEQ ID NO: 12, and the HC is SEQ ID NO: 13. In another embodiment, the antagonist comprises or consists of an antibody that binds human BMP-6(SEQ ID NO: 1), comprising LC and HC, wherein the LC is SEQ ID NO: 12, and the HC is SEQ ID NO: 14. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the antagonist comprises or consists of an antibody that binds to human BMP-6(SEQ ID NO: 1) comprising two light chains and two heavy chains, wherein each light chain is SEQ ID NO: 12, and each heavy chain is SEQ ID NO: 13. In one embodiment, the antagonist comprises or consists of an antibody that binds to human BMP-6(SEQ ID NO: 1) comprising two light chains and two heavy chains, wherein each light chain is SEQ ID NO: 12, and each heavy chain is SEQ ID NO: 14. The SEQ ID NOs in the paragraphs are those disclosed in US8980582 and the sequences are expressly incorporated herein by reference for possible use in the present invention and may be included in one or more of the technical aspects herein.

In one embodiment, the invention provides a pharmaceutical composition comprising an anti-BMP 6 antagonist of the invention (e.g., an antibody or BMP 6-binding fragment thereof) and an acceptable carrier, diluent or excipient. More specifically, the compositions of the present invention further comprise one or more than one additional therapeutic agent, such as an ESA and/or an anti-inflammatory agent. Suitable anti-inflammatory agents may be antibodies or antibody fragments, e.g., anti-TNF α antibodies (e.g., adalimumab, mab), Infliximab (infliximab),Golimumab (golimumab),) (ii) a Or a capture agent (e.g. etanercept) or) (ii) a Or an anti-TNFR antibody or antibody fragment, or an anti-IL 6R antibody (e.g., sarilumab, tositumumab, or tocilizumab))。

In one example, the anti-BMP 6 antagonist, antibody, or fragment is at less than about 1 x 10^-8M, preferably less than about 1X 10^-9KD of M binds to BMP6, as determined by common methods known in the art, e.g., by using a Surface Plasmon Resonance (SPR) biosensor at 37 ℃.

By "effective amount" is meant an amount of an antagonist (e.g., an antibody) or ESA of the invention or a pharmaceutical composition of the invention that will elicit the biological or medical response or desired therapeutic effect of a subject, mammal or human that is being sought by a researcher, physician or other clinician. The effective amount may vary depending on factors such as the disease state, the age, sex, and weight of the individual, and the ability of the antibodies and/or ESAs to elicit a desired response in the individual. An effective amount is also an amount where any toxic or detrimental effects are outweighed by the therapeutically beneficial effects.

The terms "treat", "treating" and the like are intended to include slowing or reversing the progression of a condition such as anemia, moderate anemia, severe anemia, or blood hemoglobin reduction. The term also includes alleviating, ameliorating, reducing, eliminating, or reducing one or more symptoms of a disorder or condition (e.g., anemia of moderate, severe, or hypohemoglobin), even if the disorder or condition is not actually completely eliminated. An individual or patient refers to a mammal, preferably a human, having a disease, disorder or condition (e.g., anemia or the risk of anemia) that would benefit from inhibition of BMP-6 activity. The term "prevention" is, for example, reducing the risk of a disease or condition such as anemia.

The ESA, anti-BMP 6 antagonist antibody, or antigen-binding fragment thereof, including combinations or pharmaceutical compositions thereof, of the present invention can be administered by parenteral routes (e.g., subcutaneous, intravenous, intraperitoneal, intramuscular, or transdermal). Administration can be administered to a subject in single or multiple doses, alone or in combination with pharmaceutically acceptable carriers and/or diluents. The pharmaceutical compositions, combinations or antagonists of The invention may be prepared by methods well known in The art (e.g., Remington: The Science and Practice of Pharmacy, 19 th edition (1995), A.Gennaro et al, Mack Publishing Co., and may contain or be combined with one or more pharmaceutically acceptable carriers, diluents or excipients).

In one example, the subject suffers from moderate or severe anemia prior to administration of the BMP6 antagonist, and the moderate or severe anemia is treated. In one embodiment, the subject suffers from moderate anemia prior to administration and the subject has mild anemia or no anemia after treatment. In one embodiment, the subject suffers from severe anemia prior to administration and the subject has mild, moderate anemia, or no anemia after treatment. In one embodiment, the subject has mild anemia or no anemia, rather than moderate or severe anemia, after treatment. In another embodiment, the subject does not have anemia after treatment. In one embodiment, the subject has a blood hemoglobin content of less than 9.5g/dL prior to administration and the subject has a blood hemoglobin content of at least 10, 11, 12, 13, or 14g/dL after treatment.

Anemia is generally considered when the hemoglobin concentration of pregnant women is below 11g/dL, non-pregnant women below 12g/dL, and men below 13 g/dL.

The severity of anemia is classified by the following hemoglobin concentration ranges:

when hemoglobin is 9.5-13.0g/dL, mild anemia is considered

When hemoglobin is 8.0-9.5g/dL, moderate anemia is considered

When the hemoglobin concentration is below 8.0g/dL, severe anemia is considered

In one example, the hemoglobin content is at or equal to a measurement of sea level.

In one embodiment, the subject is a human male, such as an adult or infant. In one embodiment, the subject is a human female, such as an adult or an infant, such as a non-pregnant female or a pregnant female. For example, the human is a dialysis patient. The infant may be a human being > 1 month of age.

In one example, the method is a method of eliminating or reducing the need to administer iron or blood transfusions to an individual suffering from anemia, e.g., for reducing the dose or frequency of administration of iron to an individual.

The invention may comprise the simultaneous or sequential administration of an anti-BMP 6 antagonist and an ESA. In one example, antagonist and ESA are administered no more than 1 month, 4 weeks, 3 weeks, 2 weeks, 1 week, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day apart. As exemplified herein, an antagonist and an ESA can be effective if they are administered no more than 7 days apart (e.g., no more than one day). In one example, the anti-BMP 6 antagonist and the ESA are administered to the individual no more than 10, 14, 21, or 28 days apart.

In one example, the ESA is administered 2, 3, or 4 times per week. In one example, the ESA is administered 1, 2, 3, or 4 times per month or over an 8 week period. In one example, an ESA (e.g., epoetin α) is administered at a total dose of < 3000, 2900, 2800, 2700, 2600, < 2500, 2400, 2300, 2200, 2100, < 2000, 1900, 1800, 1700, 1600, 1500, 1400, 1300, 1200, 1100, or 1000 units/kg per week. In another example, the ESA is administered 1, 2, 3, or 4 times per month or over an 8 week period. In one example, the ESA (e.g., dabbepotein α) is administered at a total dose of < 15, < 30, 12, 11, 10, 9, 8, 7, 6, or 5 micrograms/kg per week.

In one example, the ESA and/or antagonist is administered to the individual intravenously or subcutaneously.

In one example, the anemia is in an individual who has received or has received zidovudine treatment.

Optionally, any configuration of the invention is also one or more of the following:

(a) increasing or maintaining an increase in blood iron, e.g., for treating or reducing the risk of anemia;

(b) treating iron deficiency;

(c) treating or reducing the risk of chronic inflammatory Anemia (ACI);

(d) treating or reducing the risk of Anemia of Chronic Disease (ACD);

(e) Treating or reducing the risk of anemia associated with cancer, renal conditions, or GvHD;

(f) increasing blood or serum iron content;

(g) increasing reticulocyte count;

(h) increasing red blood cell count;

(i) increasing hemoglobin; and

(j) increasing hematocrit in an individual (e.g., a human).

In one embodiment, the invention is for modulating (e.g., increasing) erythropoiesis in an individual.

In one embodiment, the individual is a human comprising the BMP6 gene SNP rs 111588693. This may be associated with an increased predisposition to anemia.

In one example, the anemia is Anemia of Chronic Disease (ACD), such as anemia of cancer, or anemia of Chronic Kidney Disease (CKD). Certain chronic diseases, such as cancer, kidney disease and autoimmune disorders, can lead to ACD when overactive inflammatory cytokines cause dysregulation of iron homeostasis, decreased erythropoiesis and shortened red blood cell life. Hepcidin has been identified as a key hormone involved in iron homeostasis; high levels of hepcidin are associated with iron-restricted erythropoiesis seen in ACD. BMP-6 has been shown to increase hepcidin expression. In one example, the invention is used to reduce or maintain reduced hepcidin levels in an individual.

CKD anemia is an anemia of an early common complication in CKD patients. Anemia of cancer is anemia arising from hematologic malignancies and some solid tumors; however, chemotherapy-induced (e.g., immunotherapy-induced) anemia is anemia arising from treatment of cancer patients with chemotherapeutic agents. Anemia in CKD exacerbates diabetic neuropathy, cardiovascular disease, and retinopathy, among other conditions. Cancer-related anemia is associated with an increased relative risk of death. Current treatment options for cancer-related anemia are limited to blood transfusions, as erythropoiesis stimulating agents are only applicable to chemotherapy-induced anemia.

In one example, the subject suffers from a chronic disease, such as cancer (e.g., a hematological malignancy or a solid tumor), kidney disease, an autoimmune disorder, or chemotherapy-induced anemia. In one example, a subject (e.g., a human) suffers from CKD, and one or more of diabetic neuropathy, cardiovascular disease, and retinopathy.

In one example, the anemia is hepcidin-associated iron-limiting anemia. In one example, the anemia is Iron Refractory Iron Deficiency Anemia (IRIDA). In one embodiment, the IRIDA is caused by a deficiency in the TMPRSS6 gene of the individual, e.g., wherein the IRIDA is caused by a TMPRSS6 gene mutation (e.g., a SNP, such as rs855791, rs2543519, rs2235324, or rs1421312 1312).

In one example, the method is a method of treating or preventing sjogren's syndrome in addition to or in place of treating or preventing anemia.

In one example, the invention is used to increase blood iron content, serum iron content, reticulocyte count, red blood cell count, hemoglobin, and/or hematocrit in an individual (e.g., a human).

In one embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament. In another embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment or prevention of anemia (e.g., moderate to severe anemia). In another embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment of anemia of chronic disease. In another embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment of anemia of chronic kidney disease. In another embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment of anemia of cancer. In one embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment of IRIDA. In another embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment of IRIDA, wherein the IRIDA is caused by a TMPRSS6 gene mutation (e.g., a SNP such as rs855791, rs2543519, rs2235324, or rs 1421312). In one embodiment, the invention provides the use of an anti-BMP 6 antagonist and an ESA for the manufacture of a medicament for the treatment of sjogren's syndrome.

Detailed description of the preferred embodiments

Embodiments of the invention are as follows, and the embodiments (and any unnumbered paragraphs) may be combined with any other configuration, clause, paragraph, example, feature, or aspect of the invention as described herein; antagonists (e.g., anti-BMP 6 antibodies or fragments) or ESAs of the invention can be provided for use (or can be used) in methods in the following embodiments:

1. an anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of treating or preventing anemia in a subject, the method comprising administering to the subject the anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

In one embodiment, the method is for treating anemia in a subject, wherein the anemia is treated.

In one example, the antagonist comprises or consists of: an anti-BMP 6 antibody or fragment, such as a human, humanized or chimeric antibody. Instead of antibodies or fragments, the invention encompasses different antagonists of BMP6, e.g., an anti-BMP 6 capture agent or HJV-Fc.

2. An antagonist according to embodiment 1, wherein said antagonist comprises or consists of an anti-BMP 6 antibody or fragment, said method comprising:

(a) On the initial day (D)₀) Administering the anti-BMP 6 antibody or fragment to the individual; and

(b) for a period of at least 3 consecutive weeks, starting at D₀Administering multiple doses of an ESA, wherein the blood Hb concentration in the individual is compared to D for the entire duration of the period₀The baseline concentration at the time of the treatment is increased,

such that:

(i) the Hb concentration is no less than 100% of the baseline Hb concentration for the entire duration of the period; and, over the period, the Hb concentration reaches at least 120% of baseline; and/or

(ii) Throughout the duration of the period, the Hb concentration increases by at least 1g/dl compared to baseline.

In any of the embodiments herein, the Hb concentration is increased from baseline by at least 1g/dl, e.g., at least 1.5, 2, or 2.5g/dl throughout the duration of the time period. In one example, the Hb concentration does not exceed 11, 11.5, or 12g/dl in an individual (e.g., an adult male or female human).

Hb concentration and MCH (see below) can be determined using one or more blood samples obtained from an individual. For example, as using blood samples taken at the end of each week of the period (and as used at D)₀A baseline determined from the sample taken).

3. A combination of an amount of an anti-BMP 6 antibody or fragment and an amount of an ESA (e.g., comprising multiple doses of the ESA), for use in a method of treating anemia, wherein the antibody, fragment and method are according to embodiment 2.

4. A combination according to embodiment 3 wherein the method comprises obtaining a single dose from the amount of antibody or fragment, wherein at D₀Administering said single dose to said individual, and obtaining a plurality of doses of said ESA, wherein at least one dose is from D₀Administered weekly.

In any embodiment herein, in one example, at D₀The first dose of ESA is administered.

5. The combination according to embodiment 3 or 4, wherein the antibody or fragment is comprised by a pharmaceutical composition, wherein the antibody or fragment is mixed with a dose of the ESA to be at D₀Is administered to the individual.

6. A medical kit comprising a combination according to any of embodiments 3 to 5, a first sterile container comprising said amount of antibody or fragment, and a second sterile container comprising said amount of ESA, and optionally instructions for carrying out said method.

7. The antagonist according to embodiment 1, wherein said antagonist comprises or consists of an Erythropoietin Stimulating Agent (ESA) (e.g., comprises multiple doses of said ESA), said method comprising:

(a) On the initial day (D)₀) Administering to the individual an anti-BMP 6 antibody or fragment; and

(b) for a period of at least 3 consecutive weeks, starting at D₀Administering multiple doses of the ESA, wherein the blood hemoglobin (Hb) concentration in the individual is compared to D for the entire duration of the period₀The baseline concentration at the time of the treatment is increased,

such that:

(i) the Hb concentration is no less than 100% of the baseline Hb concentration for the entire duration of the period; and, over the period, the Hb concentration reaches at least 120% of baseline; and/or

(ii) Throughout the duration of the period, the Hb concentration increases by at least 1g/dl compared to baseline.

8. An antagonist, combination or kit according to any one of embodiments 2 to 7, wherein

(iii) The Hb concentration of the last day of the consecutive week period is at least 120% of the Hb concentration of the 7 th day immediately preceding the last day.

9. An antagonist, combination or kit according to any one of embodiments 2 to 8, wherein the individual is administered an ESA within 24 hours of the administration of the anti-BMP 6 antibody or fragment.

10. The antagonist, combination or kit according to any one of embodiments 2 to 9, wherein said continuous weekly period consists of a period of 3 or 4 consecutive weeks.

11. An antagonist, combination or kit according to any one of embodiments 2 to 10 (e.g. embodiment 10), wherein the Hb concentration reaches an increase in the range of 1 to 8g/dl over the baseline over the period.

In any of the embodiments herein, in instances over the period of time, the Hb concentration achieves an increase from baseline in the range of 1 to 3, 2.5, 2, 1.5, or 1.25 g/dl. For example, an increase of 1 to 2g/dl in Hb concentration is achieved.

12. The antagonist, combination or kit according to any one of embodiments 2 to 11, wherein said period consists of 3 or 4 consecutive weeks and the Hb concentration reaches at least 150% of baseline at the end of said period.

13. The antagonist, combination or kit according to any one of embodiments 2 to 12, wherein said period consists of 3 or 4 consecutive weeks, and

(a) the Hb concentration is no less than 110% of the baseline Hb concentration for the entire duration of the period; and, over the period, the Hb concentration reaches at least 150% of baseline; and/or

(b) The Hb concentration increases by at least 1g/dl from baseline throughout the duration of the time period, and the Hb concentration increases by in the range of 1 to 8g/dl from baseline during the time period. For example, the Hb concentration reaches an increase from 1g/dl to 2 g/dl.

14. An antagonist, combination or kit according to any one of embodiments 2 to 13, wherein during said period at D₀The antibody or fragment is administered.

15. An antagonist, combination or kit according to embodiment 14, wherein at D₀Administering the antibody or fragment to the individual in a single dose.

In any embodiment herein, in one example, at D₀Administering the antibody or fragment to the individual in a single dose, wherein the single dose is administered to the individual in one or more divided doses.

16. An antagonist, combination or kit according to any one of embodiments 2 to 15, wherein the initial ESA dose is at D₀Or administered no more than 2 days thereafter.

17. An antagonist, combination or kit according to any one of embodiments 2 to 16, wherein the dose of ESA is at D₀Followed by administration on days 4-9 (e.g., day 7).

18. An antagonist, combination or kit according to any one of embodiments 2 to 17, wherein the dose of ESA is at D₀Followed by administration on days 12-16 (e.g., day 14).

19. An antagonist, combination or kit according to any one of embodiments 2 to 18, wherein the dose of ESA is at D₀Followed by administration on days 19-23 (e.g., day 21).

Herein, the text In any embodiment of (a), in one example, the dose of ESA is at D₀Followed by administration on each of (i) days 4-9 (e.g., day 7), (ii) days 12-16 (e.g., day 14), and (iii) days 19-23 (e.g., day 21).

20. The antagonist, combination or kit according to any one of embodiments 2 to 19, wherein an equivalent of 4 doses of ESA are administered within said period.

By "equivalent" herein is meant that multiple aliquot doses of the ESA can be administered (e.g., on the same day or sequentially), wherein the aliquot doses sum to the total dose of the ESA. In one example, the ESA is dabbepotin alpha orAnd the dose range is 15 to 100mcg (micrograms); or 30 to 100 micrograms. In one example, the ESA is epoetin α and the dose range is 3000 to 30000 units (i.e., units refer to international units, also known in various languages as IU, UI, IE, ME, NE).

In general, herein, a dose (e.g., of an antibody, fragment, or ESA) can be administered in one aliquot or in multiple aliquots (e.g., on the same day, simultaneously, within a 30, 1, or 24 hour window).

21. The antagonist, combination, or kit according to any one of embodiments 2-20, wherein the ESA is administered to the individual during each of the first and second weeks following the initial ESA dose.

22. The antagonist, combination, or kit according to any one of embodiments 2-21, wherein the ESA is administered to the subject during each of the first, second and third weeks following the initial ESA dose.

23. The antagonist, combination or kit according to embodiment 21 or 22, wherein the ESA is administered as a single dose at the end of each said week, optionally wherein said period consists of an onset from D₀Of 3 or 4 weeks.

In an example of any implementation, the period of time starts at D₀And anemia is treated at week 4.

24. The antagonist, combination or kit according to any one of embodiments 2 to 23, wherein no more than 4 doses of an ESA and optionally a single dose of said antibody or fragment are administered to said individual over said period of time.

25. The antagonist, combination or kit according to any one of embodiments 2 to 24, wherein over said period of time (wherein said period of time is a continuous 4 week period), the total dose of antibody and the total dose of ESAs are administered to said individual in a ratio of X: Y, wherein X is from 10 to 2X 10⁶And Y is 4.

In one example, the total weekly dose of ESAs (e.g., where the subject is a human) is 10 or 15 to 80, 100, 200, or 300mcg (micrograms). For example, the total weekly dose is 10 to 80; 15 to 80; or 30 to 80 micrograms. For example, the ESA comprises or consists of dabigatran a, epoetin a, or any other ESA disclosed herein. In one example, each dose (or weekly dose) of ESA administered to an individual is in the range of 1.5 to 2 micrograms/kg ESA.

In certain configurations, the methods involve reducing or curtailing administration of ESA. In such cases, for example, the total weekly dose of an ESA (e.g., where the individual is a human) is from 1 to 20 micrograms, e.g., from 1 to 15 micrograms. In examples in which ESA is reduced or decreased, each dose (or weekly dose) of ESA administered to an individual is in the range of 0.01 or 0.1 to 0.3 or 1 microgram/kilogram ESA, e.g., 0.01 to 0.3; or 0.1 to 0.3; or 0.01 to 1; or 0.1 to 1 microgram/kg.

26. An antagonist, combination or kit according to any one of embodiments 2 to 25, wherein the Hb concentration at the end of said period (e.g. a consecutive 3 or 4 week period) is at least 130% of the Hb concentration in a control anemia patient of the same species who has received anti-BMP 6 antibody or fragment administration in the same dosing regimen as the individual, with the exception that the patient has not received ESA administration during said period.

27. The antagonist, combination or kit according to embodiment 26, wherein the Hb concentration at the end of the period is significantly higher than the control at the end of the period, as determined by a p-value of p < 0.0001.

28. An antagonist, combination or kit according to any one of embodiments 2 to 27, wherein the Mean Corpuscular Hemoglobin (MCH) at the end of the time period is at least 109% of MCH in control anemic patients of the same species who have received an anti-BMP 6 antibody or fragment administered in the same dosing regimen as the individual with the exception that the patients have not received ESA administration during the time period.

Mean Corpuscular Hemoglobin (MCH) is the average mass of hemoglobin per erythrocyte in a blood sample.

29. The antagonist, combination or kit according to any one of embodiments 2 to 28, wherein the Hb concentration at the end of said period (e.g. a period of 3 or 4 consecutive weeks) is at least 120% of the Hb concentration in a control anemia patient of the same species who has received said ESA administration in the same dosing regimen as said individual, with the exception that said patient has not received anti-BMP 6 antibody or fragment administration during said period. Optionally, the control patient has received a control IgG4 antibody that does not specifically bind BMP6 (e.g., wherein the BMP6 antibody and the control antibody are administered to the individual and the control patient, respectively, at the same dose). Optionally, X is 10 to 2X 10⁵、2×10⁴Or 2X 10³。

30. The antagonist, combination or kit according to embodiment 29, wherein said Hb concentration at the end of said period is significantly higher than said control at the end of said period, as determined by a p-value of p < 0.0001.

31. An antagonist, combination or kit according to any one of embodiments 2 to 30, wherein the Mean Corpuscular Hemoglobin (MCH) at the end of the period (e.g. a period of 3 or 4 consecutive weeks) is at least 119% of MCH in a control anemia patient of the same species who has received said ESA administration in the same dosing regimen as said individual, with the exception that said patient has not received an anti-BMP 6 antibody or fragment administration during said period.

32. An antagonist, combination or kit according to embodiment 31, wherein said MCH at the end of said period is significantly higher than said control at the end of said period as determined by a p-value of p < 0.0001.

33. An antagonist, combination or kit according to any one of embodiments 2 to 32, wherein the individual is at D₀Is suffering from Anemia of Chronic Disease (ACD) and optionally wherein the anemia is associated with chronic inflammation (e.g., the subject is suffering from arthritis) or a bacterial infection (e.g., a streptococcal infection), or wherein the subject is a Chronic Kidney Disease (CKD) patient.

34. The antagonist, combination or kit according to any one of embodiments 2 to 33, wherein the anemia in said individual at the end of said period is not as good as D₀It is severe.

35. The antagonist according to embodiment 1, wherein said antagonist comprises or consists of an anti-BMP 6 antibody or fragment.

36. An antagonist, combination or kit according to any one of embodiments 2 to 34, wherein said antibody or fragment competes for binding to BMP6 with a reference antibody, wherein said reference antibody is mAb507(R & D Systems) or an antibody comprising:

a. heavy chains, each of which comprises SEQ ID NO: 1 or 2 or an amino acid sequence consisting of SEQ ID NO: 1 or 2, and a light chain, each of which comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence consisting of SEQ ID NO: 3; or

b. Heavy chains, each of which comprises SEQ ID NO: 4 or an amino acid sequence consisting of SEQ ID NO: 4, and a light chain, each of which comprises the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence consisting of SEQ ID NO: 5.

Competition herein may be, for example, by SPR (e.g. at 37 ℃ at pH 7.6 and optionally as Fab); by ELISA; by Fluorescence Activated Cell Sorting (FACS); or in a homogeneous time-resolved fluorescence (HTRF) assay. Biacore can be used as SPR^TM、Proteon^TMOr another standard SPR technique. In one embodiment, by ForteBioCascade interferometry (BLI) to determine competition, which technique is known in the artAs will be apparent to the skilled person.

In one alternative, the reference antibody is any anti-BMP 6 antibody disclosed in WO2016098079 (the sequence and disclosure regarding said antibody are incorporated herein for possible use in the present invention).

37. An antagonist, combination or kit according to any one of embodiments 2 to 36, wherein said antibody or fragment competes with said reference antibody for binding to the amino acid sequence of SEQ ID NO: 6. the nucleotide sequence of SEQ ID NO: 6 may be used as the peptide itself, as part of a larger peptide or as part of the BMP6 protein (e.g., wild-type human BMP6 or recombinantly produced BMP 6).

Additionally or alternatively, the antibody or fragment competes with the reference antibody for binding to a polypeptide selected from the group consisting of SEQ ID NOs: 7-19. The further sequence may be used as the peptide itself, as part of a larger peptide (e.g.comprising SEQ ID NO: 6) or as part of the BMP6 protein (e.g.wild-type human BMP6 or recombinantly produced BMP6, e.g.comprising SEQ ID NO: 6). For example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 7. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 8. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 9. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 10. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 11. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 12. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 13. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 14. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 15. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 16. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 17. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 18. for example, the antibody or fragment competes with the reference antibody for binding to SEQ ID NO: 19. the sequence ID numbers in the paragraphs and embodiments herein are those disclosed in WO2017191437, the disclosure of which is incorporated herein.

38. An antagonist, combination or kit according to any one of embodiments 2 to 37, wherein said antibody or fragment competitively inhibits the binding of soluble Hemojuvelin (HJV) to BMP 6.

39. An antagonist, combination or kit according to any one of embodiments 1 to 38, wherein the antibody or fragment does not competitively inhibit the binding of soluble Hemojuvelin (HJV) to BMP6 (e.g. as determined by SPR, HTRF or ELISA).

40. An antagonist, combination or kit according to any one of embodiments 2 to 39, wherein the antibody comprises a VH domain encoded by a VDJ region sequence, wherein the VDJ is derived from the recombination of a VH gene segment, a D gene segment and a JH gene segment, wherein the VH is a human germline (i) VH1-3, (ii) VH2-5 or (iii) VH3-15 gene segment.

41. An antagonist, combination or kit according to any one of embodiments 2 to 40, wherein the antibody comprises a VL domain encoded by a VJ region sequence, wherein the VJ is derived from recombination of VL gene segments and JL gene segments, wherein the VL is a human germline (iv) vk 3-20, (V) V λ 3-1, (vi) vk 1-17 or (vii) V λ 1-40.

42. An antagonist, combination or kit according to any one of embodiments 2 to 41, wherein the antibody or fragment binds BMP6 with a stronger affinity (lower KD as determined by SPR) than BMP 7; and optionally binds BMP6 with a stronger affinity than BMP 5.

Optionally, the antibody or fragment binds BMP6 with a stronger affinity than each of BMP2, 4, 5 and 9.

43. An antagonist, combination or kit according to any one of embodiments 2 to 42, wherein the antibody or fragment binds to a polypeptide comprising SEQ ID NO: 6, human BMP6 sequence.

44. An antagonist, combination or kit according to any one of embodiments 2 to 43, wherein the antibody binds BMP6 with an affinity (KD) of 1pM to 5nM, optionally wherein binding is determined by SPR using Fab of the antibody at 37 ℃ at ph 7.6.

In one example, the antibody (e.g., as a Fab) or fragment binds BMP6 with an affinity (KD) of

(a)2, 3, 4, 5 or 10pM to 3, 4 or 5 nM;

(b)1-10pM to 5 nM;

(c)10pM to 3, 4 or 5 nM;

(d)50 or 80pM to 200 nM;

(e)50 or 80pM to 150 nM; or

(f)50 or 80pM to 100 nM.

In one example, the KD is (or is about) 5-15pM (e.g., 10 pM). In one example, the KD is (or is about) 2-5nM (e.g., 3 nM). In one example, the KD is (or is about) 100-400pM (e.g., 140 or 390 pM).

45. An antagonist, combination or kit according to any one of embodiments 2 to 44 (e.g. embodiment 44), wherein the antibody has an off-rate (K) for binding to BMP6 _off) Is 1 × 10^-5To 1X 10^-3S^-1Optionally wherein binding is determined by SPR using Fab of the antibody at 37 ℃ at pH 7.6.

In one example, the antibody (e.g., as a Fab) or fragment has an off-rate (K) to bind BMP6_off) Is composed of

(a)1×10^-5To 5X 10^-4S^-1；

(b)1×10^-5To 6X 10^-4S^-1；

(c)1×10^-5To 7X 10^-4S^-1；

(d)1×10^-5To 8X 10^-4S^-1；

(e)2×10^-5To 1X 10^-3S^-1；

(f)2×10^-5To 5X 10^-4S^-1；

(g)2×10^-5To 6X 10^-4S^-1；

(h)2×10^-5To 7X 10^-4S^-1(ii) a Or

(i)2×10^-5To 8X 10^-4S^-1。

In one example, K_offIs (or is about) 5X 10^-4S^-1(e.g., when the KD is (or is about) 2nM to 400 pM; when the KD is (or is about) 2-5nM (e.g., 3nM), or when the KD is (or is about) 100-400pM (e.g., 140 or 390 pM)). In one example, K_offIs (or is about) 3X 10^-5S^-1(e.g., when the KD is (or is about) 5-15pM (e.g., 10 pM)).

46. An antagonist, combination or kit according to any one of embodiments 2 to 45 (e.g. embodiments 44 and/or 45), wherein the antibody binds to BMP6 at a rate (K)_on) Is 1 × 10⁵To 1X 10⁷M^-1S^-1Optionally wherein binding is determined by SPR using Fab of the antibody at 37 ℃ at pH 7.6.

In one example, the binding rate (K) of the antibody (e.g., as a Fab) or fragment to bind BMP6_on) Is composed of

(a)1×10⁵To 1X 10⁶M^-1S^-1；

(b)1×10⁵To 2X 10⁶M^-1S^-1；

(c)1×10⁵To 3X 10⁶M^-1S^-1；

(d)1×10⁵To 4X 10⁶M^-1S^-1；

(e)1×10⁵To 5X 10⁶M^-1S^-1；

(f)2×10⁵To 5X 10⁶M^-1S^-1；

(g)3×10⁵To 5X 10⁶M^-1S^-1；

(h)4×10⁵To 5X 10⁶M^-1S^-1；

(i)5×10⁵To 5X 10⁶M^-1S^-1(ii) a Or

(j)6×10⁵To 5X 10 ⁶M^-1S^-1。

In one example, K_onIs (or is about) 1 or 2X 10^-5M^-1S^-1(e.g., when the KD is 2-5nM (e.g., 3 nM)). In one example, K_onIs (or is about) 1-4, 1, 2, 3 or 4X 10^-6M^-1S^-1(e.g. when the KD is (or is about) 5-400pM (e.g. 140 or 390pM) or 5-15pM (e.g. 10 pM)).

47. An antagonist, combination or kit according to any one of embodiments 2 to 46, wherein

(a) Said period consisting of 3 or 4 consecutive weeks, and

(i) the Hb concentration is no less than 110% of the baseline Hb concentration for the entire duration of the period; and, over the period, the Hb concentration reaches at least 120% of baseline; and/or

(ii) An increase in Hb concentration of at least 1g/dl from baseline for the entire duration of the period, and an increase in Hb concentration in the range of 1 to 8g/dl from baseline is achieved during the period;

(b) wherein a dose of ESA is administered at least twice within two or three weeks prior to the period;

(c) wherein the antibody or fragment binds BMP6 with a stronger affinity (lower KD as determined by SPR) than BMP 7; and optionally binds BMP6 with a stronger affinity than BMP5 (and optionally binds BMP6 with a stronger affinity than each of BMP2, 4, 5 and 9); and is

(d) Wherein the antibody or fragment competes for binding to BMP6 with a reference antibody, wherein the reference antibody is mAb507(R & D Systems), or an antibody comprising:

I. heavy chains, each of which comprises SEQ ID NO: 1 or 2 or an amino acid sequence consisting of SEQ ID NO: 1 or 2, and a light chain, each of which comprises the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence consisting of SEQ ID NO: 3; or

Heavy chains, each comprising SEQ ID NO: 4 or an amino acid sequence consisting of SEQ ID NO: 4, and a light chain, each of which comprises the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence consisting of SEQ ID NO: 5.

Optionally, in part I, the heavy chain consists of SEQ ID NO: 1 and the light chain consists of the amino acid sequence of SEQ ID NO: 3. Optionally, in part I, the heavy chain consists of SEQ ID NO: 2 and the light chain consists of the amino acid sequence of SEQ ID NO: 3. Optionally, in part II, the heavy chain consists of SEQ ID NO: 4 and the light chain consists of the amino acid sequence of SEQ ID NO: 5.

In one example (according to the antibody used in example 2 below), in part (d), the anti-BMP 6 antibody of the invention is an antibody that competes with the reference antibody of part I or part II in the HTRF assay. For example, wherein in an HTRF assay, the antibodies of the invention are labeled antibodies preincubated with human BMP6 and subsequently combined with unlabeled reference antibodies (according to part I or II), wherein competition between the antibodies is detected by the assay. In one example, the assay uses AlexaFluor ^TM647 labeled antibodies of the present invention. In one alternative, human BMP6 is labeled (e.g., with AlexaFluor)^TM647, the test antibody is labeled with biotin to bind Eu3+ cryptate-streptavidin, and the reference antibody is unlabeled).

Optionally, the anti-BMP 6 antibody (test antibody) of the invention competes for binding to human BMP6 (or the same epitope as the reference antibody that binds to human BMP 6) with the reference antibody in an HTRF assay using direct or indirect use of a donor (such as, e.g., Eu3+ cryptate) or acceptor fluorophore (such as, e.g., AlexaFluor)^TM647) A labeled test antibody, directly or indirectly labeled, and a target BMP6 labeled with a donor or acceptor fluorophore to effect energy transfer between the donor and acceptor, thereby generating and detecting a fluorescent signal. In one example, AlexaFluor is used therein^TM647 label, a competition is detected when the fluorescent signal of the test antibody at 665nM in the presence of the reference antibody is reduced by at least 20% compared to the signal in the absence of the reference antibody. Optionally, the reduction in signal at 665nM is at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%。

Optionally, the anti-BMP 6 antibody (test antibody) is an antibody that competes with a reference antibody for binding to human BMP6 (or the same epitope as the reference antibody for binding to human BMP 6) in an HTRF assay, wherein the reference antibody comprises two or more epitopes each comprising SEQ ID NOs: 1 or 2 and heavy chains each comprising the amino acid sequence of SEQ ID NO: 3, wherein the assay uses a label with a donor label (such as e.g. Eu3+ cryptate) or an acceptor fluorophore (such as e.g. AlexaFluor) ^TM647) A test antibody labeled directly or indirectly and human BMP6 labeled with an acceptor fluorophore or donor to effect energy transfer between the donor and acceptor, respectively, wherein the competition between the antibodies is detected by when the fluorescent signal of the test antibody in the presence of the reference antibody is reduced by at least 20% compared to the signal in the absence of the reference antibody. For example, AlexaFluor for testing antibodies^TM647 directly or indirectly, and a competition is detected when the test antibody reduces the fluorescent signal at 665nM in the presence of the reference antibody by at least 20% compared to the signal in the absence of the reference antibody. Optionally, the reduction in signal at 665nM is at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

Optionally, the anti-BMP 6 antibody (test antibody) also competes for binding to human BMP6 (or the same epitope as the reference antibody that binds to human BMP 6) in an HTRF assay with the reference antibody, wherein the reference antibody comprises two epitopes each comprising SEQ ID NO: 4 and each comprising the amino acid sequence of SEQ ID NO: 5, wherein the assay uses, for example, labeling with a donor label (such as, for example, Eu3+ cryptate) or an acceptor fluorophore (such as, for example, AlexaFluor) ^TM647) A test antibody labeled directly or indirectly and human BMP6 labeled with an acceptor fluorophore or donor to effect energy transfer between the donor and acceptor, respectively, wherein the competition between the antibodies is detected by when the fluorescent signal of the test antibody in the presence of the reference antibody is reduced by at least 20% compared to the signal in the absence of the reference antibody. For example, AlexaFluor for testing antibodies^TM647 direct or indirect labeling, and by the presence of a test antibody in a reference antibodyCompetition was detected by at least a 20% decrease in the fluorescent signal at 665nM compared to the signal in the absence of the reference antibody. Optionally, the reduction in signal at 665nM is at least 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

For example, in part (b), the dose of ESA is administered 2, 3 or 4 times within 3 weeks prior to or within the period.

In one alternative, the reference antibody is any anti-BMP 6 antibody disclosed in WO2016098079 (the sequence and disclosure regarding said antibody are incorporated herein for possible use in the present invention).

48. An antagonist, combination or kit according to any one of embodiments 1 to 47 for use

a. Treating ACD in an individual;

b. Treating or preventing moderate or severe anemia in an individual;

c. treating or preventing anemia in a subject, wherein the subject is suffering from an inflammatory disease or condition;

d. eliminating or reducing the need to administer iron or blood transfusions to an individual;

e. treating or preventing anemia in a subject, wherein the subject is suffering from a microbial infection; or

f. Reducing ESA administration in an individual.

49. A method of treating anemia in a subject, the method comprising:

(a) on the initial day (D)₀) Administering to the individual an anti-BMP 6 antibody or fragment; and

(b) for a period of at least 3 consecutive weeks, starting at D₀Administering multiple doses of an Erythropoietin Stimulating Agent (ESA), wherein the blood hemoglobin (Hb) concentration in the individual is compared to D over the duration of the period₀The baseline concentration at the time of the treatment is increased,

such that for the entire duration of the period:

(i) hb concentration is not less than 100% of baseline Hb concentration; and, over the period, the Hb concentration reaches at least 120% of baseline; and/or

(ii) The Hb concentration is increased by at least 1g/dl compared to baseline.

50. The method according to embodiment 49, wherein the method, antibody fragment or ESA is as described in any one of embodiments 2 to 48.

51. The antagonist, combination, kit or method according to any preceding embodiment, wherein said anemia is moderate or severe anemia.

52. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of maintaining a blood hemoglobin (Hb) level of at least 10g/dL in an individual, the method comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

Any anti-BMP 6 antibody or fragment of the invention can be used as an anti-bone morphogenic protein 6(BMP6) antagonist.

53. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of preventing a blood hemoglobin content of an individual from decreasing to less than 10g/dL, the method comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

54. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of elevating blood hemoglobin to a level of at least 10g/dL in an individual suffering from anemia, comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated.

55. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of treating or preventing anemia in an individual suffering from an inflammatory disease or condition, comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the anemia is treated or prevented.

56. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of eliminating or reducing the need for administering iron or blood transfusion to an individual suffering from anemia, comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA), wherein the need is eliminated or reduced.

57. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of treating or preventing anemia in an individual suffering from a microbial infection, comprising administering to the individual an anti-BMP 6 antagonist and an Erythropoiesis Stimulating Agent (ESA).

58. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of reducing administration of an Erythropoiesis Stimulating Agent (ESA) to an individual suffering from anemia for treating anemia, comprising administering an anti-BMP 6 antagonist and the ESA, wherein anemia in the individual is treated.

59. An anti-bone morphogenic protein 6(BMP6) antagonist for use in a method of treating or reducing the risk of anemia in an individual suffering from or at risk of anemia, comprising administering to the individual an anti-BMP 6 antagonist and a low dose of an Erythropoiesis Stimulating Agent (ESA), wherein anemia is treated or the risk of anemia is reduced in the individual.

60. An antagonist according to any one of embodiments 52 to 59, wherein said antagonist is according to any one of embodiments 1 to 1, 2, 7 to 48 and 51.

61. An antagonist according to any one of embodiments 52 to 59, wherein said antagonist is according to any one of embodiments 52 to 59.

62. An antagonist, combination, kit or method according to any preceding embodiment, wherein the ESA is

a. Epoetin alpha and is administered at a weekly dose of less than 1000, 1500, 2500, 5000, 11000, 18000, 34000, or 90000 units, optionally wherein the subject has previously received < 1500, 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90000 units of epoetin alpha therapy, respectively, per week;

b. dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms, optionally wherein the individual has previously received 6.25, 10, 12.5, 20, 25, 40, 60, 100 or 200 micrograms per week of dabbepotein alpha orTreatment; or

c. Dabecortine α orAnd is administered at a weekly dose of less than 6.25, 10, 20, 40, 60, 100 or 200 micrograms, optionally wherein the subject has previously received 1500 to 2499, 2500 to 4999, 5000 to 10999, 11000 to 17999, 18000 to 33999, 34000 to 89999, or ≧ 90,000 units of epoetin alpha per week, respectively.

63. An antagonist, combination, kit or method according to any preceding embodiment, wherein the anti-BMP 6 antagonist is an antibody and each dose is administered in a total amount of no more than 30 mg/kg.

64. An anti-BMP 6 antagonist and/or ESA for use in a method of treatment regimen for treating or preventing anemia in a subject suffering from or at risk of anemia, the regimen comprising administering to the subject, simultaneously or sequentially, an anti-BMP 6 antagonist and an ESA, wherein

a. Administering the antagonist to the individual on day 0; and administering the ESA to the individual no later than day 7 (e.g., day 1); or

b. Administering the ESA to the individual on day 0; and administering the antagonist to the individual no later than day 7 (e.g., day 1); or

c. Administering to the individual the antagonist and the ESA simultaneously on day 0; or

d. The individual has received the ESA on day 0 and the antagonist is administered to the individual on day 0; or

e. The subject has received the antagonist on day 0 and the ESA is administered to the subject on day 0;

whereby, on or after day 14, the blood hemoglobin content in the subject is at least 10g/dL, wherein the anemia is treated or prevented.

65. The antagonist and/or ESA according to embodiment 64, further according to any one of embodiments 1 to 1, 2, 7 to 48 and 51.

66. The antagonist and/or ESA according to embodiment 64 or 65, wherein the anti-BMP 6 antagonist and ESA are administered to the individual no more than 7 days apart.

67. The antagonist and/or ESA according to embodiment 64, 65, or 66, wherein said regimen maintains in said individual a blood Hb level in said individual of more than 10 g/dL.

68. The antagonist and/or an ESA according to any one of embodiments 64-67, wherein said method maintains or increases blood hemoglobin levels to at least 10g/dL in said individual at least 13 or 14 days after said individual receives said anti-BMP 6 antagonist and an ESA.

69. The antagonist and/or ESA according to embodiment 67 or 68, wherein said anti-BMP 6 antagonist and ESA are administered to said individual no more than 1 day apart.

70. The antagonist and/or ESA according to any one of embodiments 64 to 69, wherein said anti-BMP 6 antagonist and ESA are administered to said individual simultaneously.

71. The antagonist and/or ESA according to any one of embodiments 64 to 70, wherein the subject's blood hemoglobin content is prevented from decreasing to less than 10g/dL (e.g., on day 14).

72. The antagonist and/or ESA according to any one of embodiments 64 to 71, wherein said subject's blood hemoglobin is raised to a level of at least 10g/dL (e.g., on day 14).

73. The antagonist and/or ESA according to any one of embodiments 64 to 72, wherein moderate or severe anemia in said individual is prevented (e.g. on day 14).

74. The antagonist, combination, kit, ESA or method according to any preceding embodiment, wherein said subject is suffering from

a. An inflammatory disease or condition; or

b. (ii) infection;

c. renal disease;

HIV or treatment with HIV; or

e. Cancer; and is

Anemia in the subject is treated or prevented.

75. An antagonist, combination, kit, ESA or method according to any preceding embodiment, wherein said individual is a mammal.

76. The antagonist, combination, kit, ESA or method according to any preceding embodiment in combination with an anti-inflammatory agent, or wherein an anti-inflammatory agent is administered to said individual.

77. An antagonist, combination, kit, ESA or method according to any preceding embodiment, wherein said ESA is erythropoietin.

In one example, the subject suffers from Chronic Kidney Disease (CKD). Reference to "Clinical Practice Guideline for KDIGO Chronic Kidney Disease anemia (KDIGO Clinical Practice for analemia in Chronic Kidney Disease)", "International journal of renal Disease supplement (2012)2, 279; doi: 10.1038/kish.2012.37. It discusses the stage of chronic kidney disease (stages 1-5), diagnosis, CKD nomenclature, Hb levels and range in people of various ages and ESA hyporesponsiveness. The references disclose:

Diagnosis of anemia

Anemia is diagnosed in adults with CKD and children > 15 years of age when the Hb concentration in men is < 13.0g/dl and the Hb concentration in women is < 12.0 g/dl. (not rating)

Anemia is diagnosed in children with CKD if the Hb concentration of children aged 0.5-5 years < 11.0g/dl, the Hb concentration of children aged 5-12 years < 11.5g/dl, and the Hb concentration of children aged 12-15 years < 12.0 g/dl. (not rating)

Thus, in the present invention, optionally

(a) The individual is an adult with CKD or a child > 15 years of age, and is within that period (e.g., at D-free₀Starting at week 3) Hb concentration < 13.0g/dl (when the subject is male) or < 12.0g/dl (when the subject is female); or

(b) The individual has CKD and is within the time period (e.g., at slave D)₀Starting at week 3) Hb concentration < 11.0g/dl (where the subject is 0.5-5 years of age), < 11.5g/dl (where the subject is 5-12 years of age), or < 12.0g/dl (where the subject is 12-15 years of age).

Optionally, the subject is a CKD patient who has been diagnosed with a malignancy, has undergone one or more strokes, and/or has undergone a malignancy. ESA therapy is usually performed cautiously, if at all, in the patient and therefore the invention, particularly in terms of its ESA reduction or sparing, is advantageous in the subject.

Optionally, the subject is a CKD 5D patient (e.g., adult, such as male or female) having a Hb concentration of 9.0 to 10.0 g/dl.

Optionally, the invention is used to maintain a Hb concentration above 11.5g/dl in an adult patient with CKD.

Optionally, the invention is used to maintain a Hb concentration of 9.0 to 13g/dl (e.g., 9.0 to 11.5g/dl) in an adult patient with CKD.

Optionally, the invention is used to maintain a Hb concentration of 11.0 to 12g/dl in a pediatric human patient with CKD. In one example, the patient is 15 years old or under 15 years old; or less than 15 years old; or 10 years or under 10 years old.

In one example, the CKD patient is an adult male. In another example, the CKD patient is an adult female.

Optionally, the subject (e.g., adult) is a CKD 5HD patient, a hemofiltration patient, or a hemodiafiltration therapy patient, wherein the method comprises intravenous or subcutaneous administration of ESA.

Optionally, the individual (e.g., adult) is a CKD ND or CKD 5PD patient, wherein the method comprises subcutaneous administration of ESA.

Optionally, prior to administration of the anti-BMP 6 antibody or fragment, the patient is ESA hyporesponsiveness, as indicated by a less than 5% or no increase in Hb concentration after one month of ESA treatment (prior to performing the methods of the invention).

For general methods and tests, reference is made to WO2017191437 (see for example therein).

Inhibition of HJV-independent BMP receptor dimerization and signaling

Signaling involving BMP6 in complex with HJV has been studied in the art. However, Latour et al proposed an alternative pathway in which BMP 6-mediated BMP receptor dimerization occurred without complexing of HJV to BMP6 (Hepatology) 2016, 1, 63(1), 126-37. doi: 10.1002/hep.28254, 2015, 12, electronically published "deletion of hemochromatosis-associated molecules HFE and transferrin receptor-2 had a different effect on the iron phenotype of mice lacking bone morphogenetic protein 6or hemojuvelin" (differentiating of the deletion of hemochromatosis-associated molecules HFE and transferrin receptor-2on the iron phenotype of mice lacking bone morphogenetic protein 6or hemojuvelin) ". As shown in example 8, the inventors have surprisingly found that HJV-independent dimerization of BMP receptors in human cells can be inhibited by BMP6 using an anti-BMP 6 antagonist, such as an antibody (e.g. in the form of IgG 4). Thus, in one configuration, the invention relates to inhibiting the formation of BMP-BMPR complexes lacking HJV, or intracellular signaling triggered by the complexes, for use in treating or preventing a hepcidin-mediated disease or condition in a human or animal subject.

For example, the following concepts are provided:

1. an antibody or fragment that specifically binds to a Bone Morphogenetic Protein (BMP) for use in a method of treating or preventing a disease or condition caused by a Hemojuvelin (HJV) -deficient BMP-BMP receptor (BMPR) complex in a human or animal subject, wherein the method comprises administering the antibody or fragment to the subject for inhibiting formation of the complex and/or inhibiting the complex from triggering intracellular signaling in the subject, thereby treating or preventing an HJV-independent BMP-BMPR mediated disease or condition.

2. An antibody or fragment that specifically binds to a Bone Morphogenetic Protein (BMP) for use in a method of treating or preventing HJV-independent anemia or osteoporosis in a human or animal subject, wherein said method comprises administering said antibody or fragment to said subject for inhibiting the formation of a Hemojuvelin (HJV) -deficient BMP-BMP receptor (BMPR) complex and/or inhibiting said complex from triggering intracellular signaling in said subject, thereby treating or preventing HJV-independent anemia or osteoporosis.

3. An antibody or fragment that specifically binds to a Bone Morphogenetic Protein (BMP) for use in a method of treating or preventing Hemojuvelin (HJV) -independent anemia or osteoporosis in a human or animal subject, wherein said method comprises administering said antibody to said subject, thereby treating or preventing HJV-independent anemia or osteoporosis.

4. An antibody or fragment for use in the treatment or prevention of a disease or condition in a human or non-human animal subject, wherein

a. The disease or condition is mediated by multimerization of Bone Morphogenetic Protein (BMP) receptors in hepatocytes or bone cells of the individual; and

b. the antibody or fragment is administered to the subject for inhibiting the receptor multimerization, thereby treating or preventing the disease or condition.

5. An antibody or fragment according to any preceding concept, wherein the BMP is BMP2, 4, 5, 6, 7 or 9.

6. An antibody or fragment according to any preceding concept, wherein the BMP is BMP 6.

7. An antibody or fragment according to any preceding concept, wherein the BMP and receptor are human BMP and BMPR.

8. An antibody or fragment according to any preceding concept, wherein the antibody is anti-BMP 6 selected from the group consisting of: (i) mAb507, (ii) an antibody comprising a VH domain, wherein each domain comprises SEQ ID NO: 402; and a VL domain, wherein each domain comprises SEQ ID NO: 410; (iii) an antibody comprising VH domains, wherein each domain comprises SEQ ID NO: 418; and a VL domain, wherein each domain comprises SEQ ID NO: 426, and (iv) an antibody comprising a VH domain, wherein each domain comprises the amino acid sequence of SEQ ID NO: 114; and a VL domain, wherein each domain comprises SEQ ID NO: 123; or wherein the antibody or fragment competes (as determined by SPR) for binding to human BMP6 with an antibody selected from (i) to (iv).

9. An antibody or fragment according to any preceding concept, wherein the antibody or fragment is in the form of IgG4 (e.g. IgG4 PE).

10. An antibody or fragment according to any preceding concept, wherein the multimerization or complex is formed as a multimerization of (I) a type I BMP receptor and (II) a type II BMP receptor.

11. The antibody or fragment according to concept 10, wherein the type I BMP receptor is SKR1, CD292 or CDw 293.

12. An antibody or fragment according to any preceding concept, wherein the individual is a human whose genome comprises an SKR1 nucleotide sequence comprising SNPrs13406336 and/or rs 188547477; or wherein the human expresses SKR1 having an alanine at position 15 and/or an arginine at position 160; wherein the multimerization is (iii) multimerization of the SKR1 or SKR1 encoded by the nucleotide sequence and (iv) a BMP receptor.

13. An antibody or fragment according to any preceding concept, wherein the individual is a human whose genome comprises a CD292 nucleotide sequence comprising one, two or three SNPs selected from rs11528010, rs142454490 and rs 35619497; or wherein the human expresses CD292 comprising one, two, or three amino acids selected from the group consisting of proline at position 2, threonine at position 33, and arginine at position 443; wherein the multimerization is (v) a multimerization of the CD292 or the CD292 encoded by the nucleotide sequence and (vi) a BMP receptor.

14. An antibody or fragment according to any of the preceding concepts, wherein the individual is a human, the genome of which comprises a CDw293 nucleotide sequence comprising one, two or three SNPs selected from rs34231464, rs138801821, rs200035802, rs143554488, rs35973133 and rs 112111860; or wherein the human expresses a CDw293 comprising one, two or three amino acids selected from arginine at position 149, valine at position 140, arginine at position 31, serine at position 175, arginine at position 224, and aspartic acid at position 297; wherein the multimerization is (vii) multimerization of the CDw293 or CDw293 encoded by the nucleotide sequence and (viii) BMP receptor.

15. The antibody or fragment according to any one of concepts 10-14, wherein the type II BMP receptor or the receptor of (iv), (vi) or (viii) is BRK-3, ACVR2A or ACVR 2B.

16. An antibody or fragment according to any of the preceding concepts, wherein the individual is a human, the genome of which comprises a BRK-3 nucleotide sequence comprising one, two or three SNPs selected from rs2228545, rs112862820, rs140683387 and rs 201067849; or wherein the human expresses BRK-3 comprising one, two, or three amino acids selected from serine at position 775, asparagine at position 29, glutamine at position 31, and valine at position 348; wherein the multimerization is of (ix) the BRK-3 or BRK-3 encoded by the nucleotide sequence and (x) the BMP receptor.

An antibody or fragment according to any preceding concept, wherein the individual is a human whose genome comprises an ACVR2B nucleotide sequence comprising SNPB rs 121434437; or wherein the human expresses an ACVR2B comprising an arginine at position 40; wherein the multimerization is (xi) multimerization of the ACVR2B or ACVR2B encoded by the nucleotide sequence and (xii) BMP receptor.

17. An antibody or fragment according to any preceding concept, wherein the or each receptor is the BMP6 receptor, BMP7 receptor, BMP2 receptor or BMP9 receptor.

18. An antibody or fragment according to any preceding concept for use in inhibiting signaling in a hepatocyte or a osteocyte of the individual, wherein the signaling is mediated by multimerization of the receptor.

19. An antibody or fragment according to any preceding concept, wherein said signaling is Smad signaling.

20. An antibody or fragment according to any preceding concept for use in inhibiting the elevation of Smad mRNA in hepatocytes of the individual, thereby treating or preventing the disease or condition.

21. A method of treatment or prophylaxis of a disease or condition in a human or non-human animal subject, wherein

a. The disease or condition is mediated by multimerization of the HJV-independent Bone Morphogenetic Protein (BMP) receptor in hepatocytes or bone cells of the individual; and

b. The method comprises administering to the individual an anti-BMP antibody or fragment to inhibit multimerization of the receptor, thereby treating or preventing the disease or condition.

22. The method according to concept 22, wherein the antibody, fragment and/or receptor is according to any one of concepts 1 to 21.

ESA reductionMethods and treatment of ESA refractory or low response subjects

In one example, the antibody or fragment is used to increase plasma hemoglobin in a human or animal subject.

In one example, the antibody or fragment is for increasing Mean Corpuscular Hemoglobin (MCH) in a human or animal subject.

In one example, the antibody or fragment is used to increase red blood cell volume (MCV) (and optionally Mean Corpuscular Hemoglobin (MCH)) in a human or animal subject.

In one example, the antibody or fragment is for use in increasing iron availability in a human or animal subject.

In one example, the antibody or fragment is used to increase transferrin saturation in a human or animal subject.

In one example, the antibody or fragment is used to increase the binding of transferrin to iron in a human or animal subject.

In one example, the antibodies or fragments are used to reduce the total dose of ESAs (e.g., EPO, dabigatran a) administered to a human or animal subject over a 4 week period to treat or prevent anemia, osteoporosis, or any other disease or condition disclosed herein.

In one example, the antibody or fragment is used to reduce the total dose required to 1/2 to 1/3 in a control individual who receives the same treatment over a 4 week period with the exception that the human or animal individual is administered ESA without an anti-BMP 6 antagonist (e.g., antibody or fragment) for the treatment or prevention of anemia, osteoporosis, or any other disease or condition disclosed herein.

In one example, the antibody or fragment is used to reduce administration of ESA 1/2 to 1/3 to a human or animal subject for administration over a treatment period (e.g., a 4-week period) for treatment or prevention of anemia, osteoporosis, or any other disease or condition disclosed herein.

Optionally, the subject suffers from chronic anemia of inflammation or CKD. Optionally, the anemia is chronic inflammatory anemia in the subject.

Optionally, the antibody is an IgG4 antibody.

Optionally, the dose of ESA administered to the individual is ineffective when administered in the absence of an anti-BMP 6 antagonist.

Optionally, the dose of ESA administered to the subject is ineffective when administered in the absence of an anti-BMP 6 antagonist to produce one, more, or all of the effects in the subject selected from:

(a) An increase in hemoglobin;

(b) an increase in Mean Corpuscular Volume (MCV);

(c) an increase in Mean Corpuscular Hemoglobin (MCH);

(d) increased iron availability; and/or

(e) The iron saturation of transferrin increases;

wherein the ESA and anti-BMP 6 antagonist are administered to the individual to produce the selected effect.

In one example, the antibodies or fragments of the invention are for administration to a human or animal subject to produce in said subject one, more or all of the effects selected from:

(a) an increase in hemoglobin;

(b) an increase in Mean Corpuscular Volume (MCV);

(c) an increase in Mean Corpuscular Hemoglobin (MCH);

(d) increased iron availability; and/or

(e) The iron saturation of transferrin increases;

wherein the ESA and anti-BMP 6 antagonist are administered to the individual to produce the selected effect.

In one example, the subject herein is refractory to a dose of ESA, but responds to treatment of anemia, osteoporosis, or another disease or condition when the antibodies or fragments of the invention and doses of ESA are administered.

Thus, in one example, an antibody or fragment of the invention is for administration to a human or animal subject in combination with a dose of an ESA for treating a BMP 6-associated disease or condition in the subject, wherein the subject is treated with the combination, but the disease or condition cannot be treated by administering the dose of the ESA without administering the antibody or fragment.

The disease or condition may be anemia or any other disease or condition disclosed herein.

Examples

Example 1

HepG2 luciferase reporter cell line was generated for studying the effect on hamp expression

The aim was to generate a human liver cell line which expresses a reporter gene under the control of a hamp regulatory element to allow testing of BMP 6-induced expression of the hepcidin-encoding (hamp) gene. An intact regulatory region of about 3kb with response elements to pSMAD (BMP) and pSTAT (IL6) has been characterized in the literature (Casanovas et al, 2014). Genomic DNA from HepG2 cells was isolated and PCR was performed to amplify the hamp regulatory region and add the restriction sites Spe1 and Xhol (Hep Prom SPE1 forward AAAAAAACTAGTAAATGGCCCCATGTGGCCCCCGCCTTGTCTGC SEQ ID NO: 6); hep Prom XHO1, isozyme TTTTTTCTCGAGCTGTCTGGCTGTCCCACTGCTGGGTCTTGAGCTT SEQ ID NO: 7). The PCR product was cloned into the pMCS-firefly Luc (ThermoFisher) plasmid vector by standard molecular biology methods.

The hamp regulatory region after the firefly luc insert was re-amplified by PCR and Kpn1 and AsiS1 restriction sites were introduced to allow subcloning into the PiggyBac expression vector containing the internally constructed puromycin selection cassette (Yusa et al, 2011).

HepG2 cells (ATCC) were transfected with the constructed Luc plasmid of firefly rubra containing the cloned hamp regulatory region using Freestyle max transfection reagent (Thermoscientific).

Determination of the Activity of HepG2 hamp reporter cell line

The stable cell line with the red firefly luciferase gene was tested for function under the control of the entire 2.8kB human hepcidin promoter regulatory element as described above by stimulating the cells with various recombinant human BMP proteins known to stimulate the SMAD pathway. FIG. 1 shows that human BMP2(R & D Systems 355-BM SEQ ID NO: 493), BMP4(R & D Systems 314-BP; SEQ ID NO: 494), BMP5(R & D Systems 615-BMC; SEQ ID NO: 495), BMP6(Peprotech 120-06; SEQ ID NO: 2), and BMP7(R & D Systems 354-BP; SEQ ID NO: 496) are all able to induce expression of cloned luciferase reporter genes to a similar extent. BMP6 and BMP7 consistently provided the highest degree of stimulation even with different media conditions. For some BMPs, the detection window was elevated in MEM medium compared to hybridoma growth medium with 25% MEM (compare fig. 1A/B)). The HepG2 luciferase reporter line (FIG. 2) was also tested with different commercially available batches of human and mouse BMP6 protein (R & D Systems 507-BP; SEQ ID NO: 3, Peprotech 120-6; SEQ ID NO: 2 and R & D Systems 6325-BM; SEQ ID NO: 5). The cell lines were also used to assess the cross-reactivity and ability to neutralize activation of BMP6 with the anti-BMP 6 monoclonal antibodies MAB507 and MAB2365 (both from R & D Systems) (for mouse and human BMP6, respectively). This indicates that although the commercially available antibodies MAB507 and MAB2365 are described by the manufacturer as human BMP6 and mouse BMP6 specific monoclonal antibodies, respectively, they both cross-react with BMP6 from both species, although the performance is slightly different (figure 3).

Materials and methods for stimulus assays

The HepG2 hamp luciferase reporter cell line was inoculated into two 96-well culture plates (2X 10)⁴Cells/well in 50. mu.l MEM medium (minimal essential medium- # 31095-; 1% v/v FBS). The different BMP proteins described above were diluted in 25. mu.l MEM containing 1% FBS and serially diluted 1: 3 starting at a concentration of 50 nM. Subsequently 25 μ l MEM or 25 μ l hybridoma medium (HMM) was added to each well (corresponding to 25% of the final volume) according to the experiment. Subsequently, 25. mu.l of each dilution was added to each well containing cells, and the plates were incubated at 37 ℃ for 6 hours. After 24 hours of incubation, 100. mu.l firefly luciferase luminogenic reagent (Thermo Scientific #16197) was added to each well. Cells were placed on a shaker for three minutes followed by incubation in the dark for ten minutes at room temperature. Using Envision^TMReadingThe instrument (perkin elmer) measures luminescence. In some cases (fig. 2) experiments were performed using 25% HMM in a total volume of 60 μ Ι, or fixing BMP6 at a final concentration of 1nM and antibody dilutions prepared in HMM (final concentration of 25% HMM) (fig. 3).

Example 2

^TMImmunization and Generation of human anti-BMP 6 monoclonal antibodies Using Kvmouse

The examples describe the use of Kymouse^TMThe platform generates human anti-BMP 6 antibodies (see, e.g., WO2011/004192, WO2011/158009, and WO 2013/061098). For the program, Kymouse containing human immunoglobulin genes was generated^TMAn HK strain that produces a kappa (HK) antibody having a human variable domain in which the murine bmp6 gene has been knocked out. The Kymouse was treated with recombinant human BMP6(Peprotech 120-06; SEQ ID NO: 2) using a prime/boost protocol (Table 1)^TMHK bmp 6-/-mice were immunized. At the end of each regimen, a final boost was administered and the spleen and lymph nodes were removed after about 6-7 days. In some cases only splenocytes were used, in other cases also cells obtained from draining lymph nodes (table 2). Tissues were disaggregated into single cell suspensions for antigen-driven B cell selection using B cell FACS selection techniques. When determining serum titers during immunization, the DELFIA assay was used as outlined below. Exemplary serum titers of anti-BMP 6 IgG after 3 boosts are shown in figure 4 for 5 animals (KM 089). As is apparent from table 1, KM152 is a direct repeat unit from KM089 and yielded similar titers (data not shown).

^TMTable 1: overview of the immunization protocol Using KymouseHK bmp 6-/-mice

Immunization of	KymouseTMLine of	Primary/reinforcing scheme
			KM089	HK bmp6-/-	First, then 3-4 times of reinforcement;
KM152	HK bmp6-/-	first, then 2-3 times of reinforcement;

by passing Determination of serum titer:

by reversingSerum titers of anti-BMP 6 antibodies were determined by an assay (Perkin Elmer) in which antibodies were captured via the Fc domain (goat anti-mouse IgG; Southern Biotech 1030-01), blocked with blocking buffer (PBS containing 1% w/v BSA), followed by addition of biotinylated BMP6(Peprotech 120-06, SEQ ID NO: 2) to the wells. Bound BMP6 was detected using 1: 1000 dilution of DELFIA Eu-N1 streptavidin (Perkin Elmer). The strengthening solution was added for 5 minutes and allowed to stand at room temperature in the dark, followed by a reading at 615nm (Perkin Elmer Envision). The plates were washed 3 times with wash buffer (PBS 0.1% v/v Tween) between each incubation step. Anti-human BMP6 antibody (R)&D Systems MAB507) was used as a positive control.

Murine tissue isolation and preparation:

selected animals were given a final boost based on anti-BMP 6 titers, and spleens were excised 6-8 days later, washed in 1xPBS and kept on ice until further processing. Tissues were prepared in buffer containing 1 × PBS (Invitrogen) and 3% heat-inactivated FBS (Invitrogen). Spleen cells were dispersed by crushing the tissue through a 40 μm filter (BD Falcon) and washing with 30ml of 3% FBS/PBS buffer, followed by centrifugation at 500g for 10 min at 4 ℃. To remove red blood cells, the pelleted splenocytes were resuspended in 1ml ACK lysis buffer (invitrogen). After 2 min incubation at room temperature, the lysis reaction was stopped by adding 9ml of 3% FBS/1 XPBS buffer. The cell pellet was filtered off with a 40 μm filter. The remaining splenocytes pellet was used for further procedures.

BCT sorting and processing for expression

For KM089, B-cell sorting was performed once using 4 animals, while for KM152, B-cell sorting was performed twice using a total of 6 animals (table 2). Splenocytes and in some cases lymph nodes were prepared from selected animals and antigen-specific B cell selection and sorting was performed. To this end, biotinylated BMP6 material was generated from recombinantly produced human BMP6(Peprotech 120-06SEQ ID NO: 2) and tested for binding activity to anti-BMP 6 MAB507(R & D Systems; data not shown). Background binding of labeled material was assessed by measuring binding of labeled BMP6 material to B cells isolated from animals immunized with an unrelated immunogen. Antigen positive and B cell marker positive single B cells were sorted into 96-well culture plates and immediately frozen for molecular biology processing. B-cell technology (see WO2015040401 for general description) was used to expand the V-regions from those antigen-selected B-cells. From the primary PCR product, V regions were recovered by further PCR and standard molecular biology methods in the art and cloned into mammalian expression vectors in HEK cells in 96-well culture plates, with the recovered heavy and light chains paired as recombinant chimeric IgG or as chimeric Fab fragments. After 6-8 days of culture, the supernatants were tested for binding or neutralizing activity, as outlined below. In some cases, primary PCR products derived from antigen-selected individual B cells are also subjected to NGS sequencing and V regions are generated from synthetic DNA, cloned into mammalian expression vectors and plasmid DNA is prepared for transfection of mammalian cells for expression.

Example 3

Preliminary screening

Preliminary screening was performed by homogeneous time-resolved fret (htrf) to determine binding of the recovered antibodies to human BMP6(Peprotech120-06SEQ ID NO: 2), and in some cases also by Surface Plasmon Resonance (SPR) using human Fab fragments bound to immobilized human BMP 6. In some cases, the hemap luciferase reporter gene assay based on HepG2 described in example 1 using human BMP6(Peprotech120-06SEQ ID NO: 2) was used in a primary screening setup to directly select neutralizing antibodies (Table 2). In case of using the off-rate rating as a selection criterion, use is made of at least 10 at 37 ℃^-4[1/s]The dissociation rate (kd) threshold of (c).

Table 2: for culture supernatants or purified IgG or Fab fragments recovered and expressed in mammalian cells Preliminary screening and summary of results

HTRF assay for binding to human BMP6

Biotinylated BMP6(Peprotech120-06SEQ ID NO: 2) and antibodies that bound BMP6 were detected using anti-mouse IgG labeled with cryptate (Southem Biotech # 1030-01). MAB507(R & D Systems) was used as a positive control and mouse IgG isotype as a negative control. The plates were read using an Envision plate reader (perkin elmer) and the data analyzed using IDBS software. Positivity is generally defined as > 10% signal of positive control.

Screening for functional inhibition of human BMP 6-induced luciferase expression under the control of the hamp regulatory region in HepG2 cells System for making

In some cases, primary assessments of recovered IgG were performed using the HepG2 hamp luciferase reporter assay described in example 1 to assess the neutralizing capacity of BMP 6. 15ul of a known BMP6 signaling inhibitor was used as a positive control (R & D Systems MAB 507; (Andriopoulos et al, 2009)) and human or mouse IgG was used as a negative control. Purified antibodies were prepared in HMM 25% E medium (1: 3 dilution curve, 11 points from 150 nM) or IgG-containing supernatant samples were added to 15ul of human BMP6(Peprotech120-06SEQ ID NO: 2) at a final concentration of 10nM in MEM 1% FBS and incubated for 30 minutes at room temperature followed by 30ul of HepG2 reporter cells at 10000 cells/well and incubated overnight at 37 ℃. The next day, 30ul luciferase substrate buffer (Pierce Firefly Luc One-Step Glow assay kit, cat # 16197, Perbio) was added to the entire plate and read using an Envision plate reader (Perkin Elmer).

SPR off-rate rating analysis

At ProteOn^TMOff-rate screening was performed on the XPR36 system (BioRad). Biotinylated BMP-6(Peprotech 120-06SEQ ID NO: 2) was captured on the NLC sensor chip surface and 50. mu.l of purified Fab material was used as the analyte diluted in 200. mu.l of HBS-EP buffer. Dissociation rate analysis was performed using ProteOn-resident software and all assay operations were performed at 37 ℃. The inventors set the decision criterion, i.e. show < 1 × 10 ^-4[1/s]Or better off-rate, antibodies were identified as positive.

Example 4

Secondary screening and leader panel selection

Table 3 summarizes the secondary screening and further selection criteria designed by the inventors and applied to lead to the selection of lead panels for in vivo analysis. The retesting involved the use of HepG2 hamp luciferase reporter gene assays graded using BMP6 stimulation and/or SPR dissociation rates, which were not used in the primary screen. In addition, all selected hits were tested for their specificity for BMP6 by testing their ability to neutralize the associated BMP molecules in the HepG2 reporter gene assay. In the first case, BMP5(SEQ ID NO: 495) and BMP7(SEQ ID NO: 496) were tested because of their higher amino acid homology to BMP6 (in the mature protein, human BMP5 shares 81% amino acid homology with human BMP6 and human BMP7 shares 72% amino acid homology with human BMP 6). As outlined in example 1, all of the BMPs were able to effectively trigger luciferase reporter expression in HepG2 cells under the control of the hamp regulatory element region. MAB507 was used as a control in the assay, as the MAB had previously been specifically shown to cross-react with BMP5 and BMP7 (Andriopoulos et al, 2009). The inventors set decision criteria to exclude antibodies showing consistent neutralization of BMP5(SEQ ID NO: 495) and BMP7(SEQ ID NO: 496), or both. In the case of the KM089-B1 secondary screen, a HepG2 reporter assay was also performed using murine BMP6(R & D Systems; SEQ ID NO: 5) to test murine cross-reactivity, however, for subsequent activities, murine cross-reactivity was typically observed on all hits, presumably due to the high homology between humans and mouse BMP6, and the screen was therefore eliminated from the secondary screen.

___________________________

Table 3: for culture supernatant or purified IgG or Fab fragments recovered and expressed in mammalian cells Summary of secondary and further evaluation of preliminary hits in (1)

Selection of leader groups for in vivo testing

23 combination hits were identified from KM089 secondary screen (table 3). Using a combination of secondary screening of primary hits from single B cell PCR and NGS analysis of all sorted antigen-specific B cells, 4 clones were also identified from KM152-B1 (table 3). Detailed sequence analysis was performed on the 27 antibodies to identify unique cloned sequences and sequences that were not clearly developable in the inventors' judgment. Following the gating criteria, the inventors selected 12 antibodies, re-expressed and purified to fully human IgG4(SEQ ID NO: 454). Two of the 12 antibodies showed signs of quality problems after expression or purification and were therefore not further investigated. The remaining 10 antibodies were then tested for specificity for human BMP6 and for neutralizing properties of human BMP6 using the HepG2 hamp luciferase reporter gene assay (table 4).

Table 4: 10 antibodies derived from KM089 and KM152 were pre-selected and evaluated in secondary screening for humans Selectivity of BMP6 (antibodies selected for in vivo analysis are shown in bold)

Thereafter, 7 clones (shown in bold in Table 4) that did not observe cross-reactivity with either BMP5(R & D Systems 615-BMC; SEQ ID NO: 495) or BMP7(R & D Systems 354-BP; SEQ ID NO: 496) were subjected to in vivo rat studies (example 11) and were therefore re-expressed in scaled-up CHO suspension cells and purified for in vivo use.

For KM152-B2, 12 combination hits (Table 2) selected after the primary neutralization screen were re-expressed. The purified leader panel was further tested by comparing the neutralization performance of human BMP6(Peprotech 120-06; SEQ ID NO: 2) with the best leader from KM089 in the 11 dilution point curve in the HepG2 hamp luc reporter assay and considering the neutralization for BMP5(R & D Systems 615-BMC; SEW ID NO: 495) and BMP7(R & D Systems 354-BP; SEQ ID NO: 496). Thus 5 antibodies that did not show excellent performance against the previous lead from KM089 were excluded, leaving 7 clones for in vivo testing (data not shown; Table 5).

Table 5: 12 antibodies selected from KM152-B2 evaluated in a secondary screen for selectivity to human BMP6 (selected from Antibodies selected for in vivo analysis are shown in bold

Antibody ID	Source	hBMP5 neutralization	hBMP7 neutralization	Selection for in vivo evaluation
					CL-75714	KM152-B2	Whether or not	Whether or not	Is that
CL-75605	KM152-B2	Whether or not	Whether or not	If not; (ii) an expression problem; no excellent neutralization
					CL-75565	KM152-B2	Whether or not	Whether or not	Is that
CL-75539	KM152-B2	Whether or not	Whether or not	Is that
					CL-75520	KM152-B2	Whether or not	Whether or not	Is that
CL-75519	KM152-B2	Whether or not	Whether or not	If not; (ii) an expression problem; no excellent neutralization
					CL-75511	KM152-B2	Whether or not	Whether or not	If not; (ii) an expression problem; no excellent neutralization
CL-75506	KM152-B2	Whether or not	Whether or not	Is that
					CL-75500	KM152-B2	Whether or not	Whether or not	Is that
CL-75496	KM152-B2	Whether or not	Whether or not	If not; no excellent neutralization
					CL-75194	KM152-B2	Whether or not	Whether or not	If not; no excellent neutralization
CL-75183	KM152-B2	Whether or not	Whether or not	Is that

After analyzing the 7 antibodies in the first panel (table 4) and observing the superior activity of CL-58838 (see example 11), it was decided to use the data obtained by Next Generation Sequencing (NGS) to potentially extend the leader cloning panel by identifying antibodies based on their Vh (SEQ ID NO: 114) and Vk (SEQ ID NO: 123) class sequences. The paired Vh and Vk chains obtained from NGS on the amplified V regions after B cell sorting were analyzed for sequences with high homology to CL-58838 with the aim of obtaining antibody sequences slightly mutated but highly related to CL-58838. The search was driven by the same use of human V, D and the J-region (IGHV3-11 x 01, IGHD6-19 x 01, IGHJ4 x 02/IGKV3-20 x 01, IGKJ1 x 01) and the same CDRH3 sequence. A total of 21 antibodies were identified by the method, expressed, purified and evaluated for function, specificity and performance to BMP6 (table 3). The 21 antibodies were derived from 5 different immunized mice from immunization campaigns KM089 and KM 152. Initially 10 antibodies were demonstrated as neutralizing agents for BMP6, but after assessing the specificity of BMP6 compared to BMP5 and BMP7 and comparing the performance of neutralizing human BMP6 and CL-58838 in the HepG2 luc assay, 7 antibodies were selected, as shown in table 6. Comparison with the cross-sequences of the antibodies tested in all previous screening campaigns excluded 3 additional antibodies evaluated, and then left four new unique antibodies expressed and purified for in vivo analysis. Of the four, CL-58713 was not expressed in sufficient quantities at the scale and was therefore excluded. The remaining three new antibodies were studied in vivo in rats (shown in bold in table 6 and shown in example 17) and from two different immunized bmp 6-/-mice immunized KM 089.

Table 6: identification by NGS of the same V Gene usage and CDRH3 Length as CL-58838 and by functional screening Antibodies for selection

Example 5

Sequence analysis of leader clones

Analysis of V region Gene usage for selection of antibodies for in vivo use and in Kymouse^TMThe degree of mutation introduced during naturally occurring in vivo maturation during immunization. Tables 7-9 summarize the information for the antibodies selected in tables 4-6. All CDR definitions shown here are IMGT definitions.

Table 7: 7 antibodies selected from KM089 and KM152-B1 for in vivo studies

Table 8: KM152-B27 antibodies selected from KM152-B2 for in vivo studies

Table 9: CL-58838-like antibodies identified by NGS and sequence mining

Example 6

Binding kinetics of antibody CL-58838 measured by SPR

The kinetics of binding of CL-58838IgG4(SEQ ID NO: 116 and SEQ ID NO: 125) to human BMP6 was determined by Surface Plasmon Resonance (SPR) at 37 ℃ at pH 7.6. As with the other antibodies used in the examples, the CL-58838IgG4 antibody comprises SEQ ID NO: 454 (hereinafter referred to as "IgG 4-PE"), which is effector function inactive and hinge stable. Briefly, for the measurements, biotinylated recombinant human BMP6(Peprotech 120-06) (SEQ ID NO: 2) was immobilized on streptavidin-coated biosensor chips and binding was studied using a single cycle kinetic method operating at 5 different IgG concentrations. In the device, the bivalent IgG4 antibody interacts with the dimeric BMP6 antigen, which means that avidity will play a role in the overall binding kinetics measured due to the potential multiple interactions occurring per molecule. The bivalent model used for data analysis is intended to deconvolute the effect, but is not as reliable as measuring true 1: 1 interactions. Thus, in this setting, the KD values should be referred to as "relative" affinity values. The relative KD value determined by the method for CL-58838 was 0.07nM (Table 10).

Table 10: binding kinetics of CL-58838IgG4 to human BMP6 was measured at 37 ℃ and pH 7.6

Sample (I)	ka[1/Mx1/s]	kd[1/s]	Relative KD [ nM]
				CL-58838 IgG4	5.2206	3.69-04	0.07

In a second experimental setup, Fab fragments of CL-58838 were generated by expression in CHO cells and the interaction was measured, wherein the Fab fragments were analytes in a flow cell bound to immobilized biotinylated human BMP6(Peprotech120-06) (SEQ ID NO: 2) on a neutravidin biosensor chip NLC (Biorad). Since the experimental setup involved monomeric Fab fragments that avoided bivalent interactions, which means interactions were either very limited in avidity or not contributing to the binding kinetics, the true KD values could be determined (table 11). CL-58838 showed that the interaction of the Fab fragment with human BMP6 at 37 ℃ and pH 7.6 had a true KD of about 140 pM.

Table 11: representative results from two experiments measuring Fab fragments and immobilization based on CL-58838 Binding kinetics of humanized BMP6 at 37 ℃ and pH 7.6

Sample (I)	Ka[1/Mx1/s]	Kd[1/s]	KD[nM]
				CL-58838 Fab	3.6406	4.99-04	0.14

The method comprises the following steps:

SPR analysis of IgG

Recombinant human BMP6(Peprotech120-06) (SEQ ID NO: 2) was biotinylated and immobilized on a SA biosensor chip (GE Healthcare) and IgG was manipulated with 5 different concentrations of CL-58838(0.1, 0.5, 2.5, 12.5 and 62.5nM) as analyte using a single cycle kinetic approach. The same set of injections containing buffer was used instead of antibody, double referencing the binding sensorgram. The data were fitted to a bivalent model inherent to Biacore 8K (GE medical) analysis software. The assay was performed at 37 ℃ using HBS-EP as the running buffer at pH 7.6.

SPR analysis of Fab fragments

Human BMP6(Peprotech 120-06) (SEQ ID NO: 2) was biotinylated and immobilized on a neutravidin biosensor chip NLC (Biorad 1765021). Fab fragments of CL-58838 were generated by expression in HEK cells and purified with protein G and size exclusion chromatography. As analytes, 64, 16, 4, 1 and 0.25nM Fab were used. Double reference binding sensorgrams were used with injection buffer. The data were fitted to a 1: 1 model inherent to the ProteOn XPR36 analytical software. The assay was performed at 37 ℃ using HBS-EP as the running buffer at pH 7.6.

Example 7

Test for Cross-reactivity of CL-58838 with other BMPs

The antibody CL-58838IgG4(SEQ ID NO: 116 and SEQ ID NO: 125) was evaluated in more detail for its lack of cross-reactivity with other BMP family members. The screening strategy has effectively excluded any impact on BMP5 and BMP7, with BMP5 and BMP7 being the two most relevant BMP amino acid sequences (81% and 72%, respectively). Cross-reactivity was assessed using the HepG2 reporter gene assay developed in example 1, as outlined in example 4, with the expansion panel also including the less homologous members of the BMP family, such as BMP2 (56%), BMP4 (58%) and BMP9 (54%). Assays were performed at a fixed final concentration of 10nM of all BMP, which provided sufficient stimulation of hamp-driven reporter gene expression and an 11-point dilution range of CL-58838 antibody starting at a final concentration of 600 nM. Cross-reactivity tests were carried out once for BMP2(R & D Systems 355-BM; SEQ ID NO: 493), BMP4(R & D Systems 314-BP; SEQ ID NO: 494) and BMP9(Peprotech 120-7; SEQ ID NO: 497), while n is 2 for BMP5(R & D Systems 615-BMC SEQ ID NO: 495) and BMP7(R & D Systems 354-BP; SEQ ID NO: 496). One experiment is shown in each case in fig. 7. The results show that CL-58838 has no detectable neutralizing effect on any BMP tested here. Commercial control antibodies specific for the relevant BMPs tested in each assay neutralized reporter gene expression as expected (anti-BMP 2/4R & D Systems MAB 3552; anti-BMP 5R & D Systems MAB7151, anti-BMP 7R & D Systems MAB3541, anti-BMP 9R & D Systems 3209).

Method

Human BMPs were prepared in MEM 1% FBS at 40nM (10nM final assay concentration). Use of anti-BMP 2/4 (R)&D Systems), anti-BMP 5(MAB7151, R)&D Systems), anti-BMP 7(MAB3541, R)&D Systems) and human IgG4 isotype control (internally generated) control curves were prepared. The reference antibody (600nM final assay concentration) was titrated from 2.4 μ M PBS solution using a three-fold dilution series to generate an 11-point curve. BMP standard curves (200nM final assay concentration) were prepared from 800nM PBS solution using a three-fold dilution series to generate 11-point curves. Titration of each molecule tested was generated by three-fold dilution in PBS (11-point curve). Subsequently 15 μ L was transferred from the dilution to an assay plate (LUC). mu.L of PBS was added to total binding and non-specific binding wells, 15. mu.L of 40nM human BMP was added to test wells and to total binding control wells, and 15. mu.L of MEM 1% FBS was transferred to non-specific binding control wells. The plates were left at room temperature while HepG2 reporter cells were prepared. Cells were isolated from flasks, pelleted and resuspended in MEM supplemented with 1% FBS at a concentration of 3.3 × 10⁵Individual cells/ml. 30 μ l cells were added at 10,000 cells/well to the entire test plate.

The plates were incubated at 37 ℃ with 5% CO₂Following overnight incubation, the next day, 30 μ l luciferase substrate (contained in the Pierce Firefly Luc one-step luminescence assay kit) was added to the assay plate. The plates were incubated at room temperature for 10 minutes in the dark and read using Envision (perkin elmer).

Example 8

Testing the interference of anti-RMP 6 antibodies on receptor dimerization

ALK2 and ALK3 have been proposed in the literature as the major type I BMP receptors expressed in mouse and human liver (Mayeur et al, 2014; Xia et al, 2008) that are capable of achieving BMP-induced signaling in hepatocytes. Therefore, we focused on how blocking the biological activity of BMP6 with anti-BMP 6 antibodies would affect dimerization of BMPR1 and BMPR2, which has been described as requiring triggering of phosphorylation of BMPR1 and subsequent signaling via SMAD pathway. We investigated the effect of BMPR1A (ALK3, CD292) on dimerization with BMPR2(T-ALK) and BMPR1B (ALK6) and with BMPR2 (T-ALK). Use ofThe eXpress dimerization assay (discover X) measures dimerization. In the system, U2OS cells were treated with modified human ALK3/ALK6 and inactive enzyme subunit, ProLink, respectively^TM(PK) or enzyme receptor (EA) intracellular marker BMPR2 was stably transfected. Upon ligand-induced activation, the two receptors dimerize, forcing the two enzyme components to complement each other, producing an active enzyme, which then hydrolyzes the substrate to generate a chemiluminescent signal. In both cases, here we use BMP6 to trigger the dimerization event.

Initially, BMP6 response curves were established using a series of concentrations of BMP6 starting at a final concentration of 5 μ g/ml and further double diluted. Finally, a fixed concentration of 200ng/ml BMP6 was selected for analysis of the effect of anti-BMP 6 antibodies on BMP 6-induced receptor dimerization. The effect of monoclonal mouse anti-BMP 6 antibody MAB507(R & D Systems) and various other anti-BMP 6 antibodies on dimerization was studied at a range of antibody concentrations. Antibody a is an anti-BMP 6 antibody comprising a VH domain, wherein each domain comprises SEQ ID NO: 402, performing a chemical reaction; and a VL domain, wherein each domain comprises SEQ ID NO: 410. antibody B is an anti-BMP 6 antibody comprising a VH domain, wherein each domain comprises SEQ ID NO: 418; and a VL domain, wherein each domain comprises SEQ ID NO: 426.

fig. 6A shows representative results of two experiments performed on dimerization of BMPR1A (ALK3)/BMPR 2. All human anti-BMP 6 antibodies tested for reduced ALK3/BMPR2 receptor dimerization in a concentration-dependent manner, resulting in complete inhibition of dimerization at concentrations greater than 10 nM. For the human anti-BMP 6 antibodies tested, the IC50 value in the experiment was 2 nM. Murine monoclonal MAB507(R & D Systems) has an IC50 slightly below 3 nM. While not wishing to be bound by any particular theory, the most likely explanation for this observation is that binding of an anti-BMP 6 antibody to BMP6 prevents BMP6 from interacting with one or both BMP receptors, thus preventing BMP 6-driven dimerization of type I and type II receptors. However, it is also envisioned that some anti-BMP 6 antibodies may bind BMP6 in a manner that still allows the BMP 6-antibody complex to interact with one of those receptor molecules, and wherein the antibody still binds BMP6 when the complex interacts with one of the receptors. The bound receptor-antibody complex can then sterically prevent or interfere with subsequent interaction of the receptor-antibody complex with other paired receptors, thus avoiding efficient dimerization and signal generation in the assay.

Fig. 6B shows representative results of two experiments performed on dimerization of BMPR1B (ALK6)/BMPR 2. Human anti-BMP 6 antibodies 1-8 were tested for their ability to affect ALK6/BMPR2 receptor dimerization in a concentration-dependent manner. All antibodies tested resulted in complete inhibition of dimerization. Some of the anti-BMP 6 antibodies used here only showed complete neutralization at concentrations of 100nM or higher. In the assay, murine monoclonal MAB507(R & D Systems) has an IC50 of about 0.2 nM.

Such as human protein map (https：//www.proteinatlas.org/ENSG00000168509-HFE2/ cell#rna) As shown, U2O2 cells did not express HJV (also known as hemojuvelin, HFE2A, HJV, JH, and RGMC). Furthermore, we designed cell lines to express exogenous sourcesHuman BMP receptor, but without any engineering to express exogenous HJV. Thus, the results surprisingly indicate that HJV-independent dimerization of BMP receptors can be inhibited by BMP6 using anti-BMP 6 antagonists.

Method

Creating a cell line expressing human ALK3+ human BMPR2 and creating a cell line expressing human ALK6+ human BMPR2 with inactive enzyme subunit ProLink^TM(PK) and BMPR2 were engineered with the enzyme receptor (EA). Will be provided withU2OS cells (DiscoverX #93-1053C3 or #93-1063E3) transfected with eXpress BMPR1A + BMPR2 and BMPR1B + BMPR2 were resuspended in the provided cell seeding reagent, and 100. mu.l of the cell suspension was added to each well (1X 10) of a 96-well white-walled clear-bottom tissue culture plate (DiscoverX #15-073) ⁴Individual cells/well) and incubated at 37 ℃ for 24 hours. To establish the appropriate assay window, a titration of human BMP6(Peprotech 120-06) (SEQ ID NO: 2) starting at a final concentration of 5. mu.g/ml and diluted 1: 3 (. times.11) in cell seeding reagent was prepared. From the results of the dilution series, a fixed final concentration of 200ng/ml BMP6 was selected for both experiments. The antibodies were then tested by adding a final concentration of 200ng/ml of hBMP6 to a serial dilution of anti-BMP 6 antibody in wells of a microtiter plate and incubating at room temperature for 1 hour. Thereafter, 10. mu.l of the preincubated mixture was then added to each well of U2OS cell culture plates and incubated for a further 16 hours at 37 ℃. Detection reagents were prepared by adding 1 volume of scintillation cell assay buffer (discover x #30-390) to 4 volumes of scintillation substrate reagent (discover x # 10-219). 110 μ l of the prepared detection mixture was added to each well and incubated for 1 hour at room temperature in the dark. The plates were read and analyzed using an envision (perkinelmer) plate reader.

Example 9

Linear epitope mapping using overlapping peptide arrays

Linear epitope mapping was performed using a linear peptide encompassing the entire sequence of mature human BMP 6. The BMP6 peptide was extended at the C-and N-termini with neutral glycine-serine (gsgsg) linkers to avoid the production of peptides truncated at the C-and N-termini. The extended BMP6 sequence was then converted into an overlapping 15 amino acid peptide, where the overlap was 14 amino acids. A printed microarray chip containing all overlapping peptides and peptide variants of all positions of the mouse BMP6 sequence different from human BMP6 (peperpint GmbH). The resulting BMP6 peptide microarray contained 232 different peptides, printed in duplicate (464 peptide spots). CL-58838, antibody A, antibody B, mab155963 (Ebosin (Abcam)) were incubated with the linear synthetic BMP6 peptide and Morph 6.1(Acris BM4103) with the synthetic BMP6 peptide (SEQ ID NO: 17; Schluesener et al, 1995).

Method

The antibody was used at concentrations of 1. mu.g/ml, 10. mu.g/ml and 100. mu.g/ml in the culture buffer; incubate at 4 ℃ for 16 hours and shake at 140 rpm. Species-specific secondary antibodies were used: staining was performed with the control antibody mouse monoclonal antibody HA (12CA5) DyLight800 (1: 2000) simultaneously with secondary antibodies goat anti-human IgG (H + L) DyLight680 (1: 5000) and sheep anti-rabbit IgG (H + L) DyLight680 (1: 5000). However, to avoid any interference between the secondary antibody and the control antibody, staining was performed with the mouse control antibody after staining with the secondary antibody goat anti-mouse IgG (H + L) DyLight 680. Read out via the LI-COR Odyssey imaging system; scan offset 0.65mm, resolution 21 μm, scan intensity 7/7 (red 700 nm/green 800 nm).

A clear response was observed for antibody A against a single epitope-like spot pattern formed by adjacent peptides with the common motif TLVHLMNPEYV (SEQ ID NO: 8). Also, a clear response of antibody B was observed against a single epitope-like spot pattern formed by adjacent peptides with the common motif HLMNPEY (SEQ ID NO: 9). Weaker but still significant responses were observed for mab155963 against the four epitope-like spot patterns formed by adjacent peptides of either human or mouse, thereby identifying common motifs SASDYNSSELKTA (human; SEQ ID NO: 10), ELKTACRKHELYV (human; SEQ ID NO: 11), GSSDYNGSELKTA (mouse; SEQ ID NO: 12) and ELKTACKKHELYV (mouse/rat; SEQ ID NO: 13). All of those motifs show that the common core motif, ELKTA (SEQ ID NO: 14), may correspond to the core epitope recognized by the rabbit anti-BMP 6 monoclonal antibody and may be part of the peptide used to generate the monoclonal antibody. A very strong response of Morph6.1 was observed against the two patterns formed by the adjacent peptides, where the common motifs QSQDVAR (human; SEQ ID NO: 15) and QSQDVSR (mouse/rat; SEQ ID NO: 16) differ only by one exchange of amino acids S and A visible between BMP6 peptides of human and rat/mouse groups. The motif is fully contained in the peptide sequence of BMP6 (QSRNRSTQSQDVARVSSASDYNSSELKTAC SEQ ID NO: 17; Schluesener et al, 1995) which was used as an immunogen for the generation of the monoclonal antibody. In contrast to the results, NO staining above the assay noise level was observed with CL-58838IgG4(SEQ ID NO: 116 and SEQ ID NO: 125) even at significantly improved brightness and contrast. However, all positive control linear epitopes used in the assay were performed as expected. The results are most likely explained by the fact that: in contrast to all antibodies mapped above, CL-58838 binds to conformationally sensitive or discrete epitopes that are not mimic or represented by linear antigen-derived peptides in a microarray.

Example 10

Western blot analysis of binding to human BMP6

Since the peptide mapping experiment in example 9 showed that CL-58838 was unable to bind the overlapping linear peptide produced by BMP6 primary sequence, the antibody was subjected to western blotting in which human BMP6 was applied to SDS-PAGE under reducing and non-reducing conditions. Since BMP6 is a disulfide-linked dimer, reducing conditions should produce monomers on the gel rather than dimers on the non-reducing gel. In both cases, the presence of SDS will result in a general unfolding of the protein structure, revealing potential linear epitopes, but also eliminating or at least reducing secondary structure. Based on the results of example 9, it was expected that CL-58838 might not recognize the unfolded BMP6 presented on SDS-PAGE, whereas antibodies a and B clearly recognized the linear part of BMP6 sequence. Fig. 5 shows the results of the analysis. The coomassie stained gel clearly shows the monomer of BMP6 at 18kDa in the reducing lane and the dimer at about 32kDa in the non-reducing lane, confirming the formation of monomer when reducing conditions are applied. CL-58838 produced a signal on the non-reducing disulfide-linked dimers but not on the reducing monomers. In contrast, antibody a produced a signal on the dimer and a very well-defined signal on the BMP6 monomer, indicating that an epitope sufficient to bind antibody a does not require specific folding or dimerization of BMP 6. Antibody B closely resembles antibody a in results, again emphasizing the similarity of the epitopes of the two antibodies. The results also indicate that CL-58838 is still able to recognize BMP6 in the presence of SDS, but requires a conformational interface that binds disulfide-linked dimers of BMP 6. This is consistent with the results seen in example 9 and may indicate that epitopes of CL-58838 encompass residues that are only clustered together in the BMP6 dimer and/or that key residues mediating binding activity are located near the intermolecular disulfide bond between BMP6 monomers.

Example 11

Evaluation of anti-BMP 6 antibodies after a single intravenous injection (iv) in normal rats

Male Wistar rats (250-. Two or three control groups were included in each study, which received a single 1mg/kg iv dose, a hIgG4 isotype control antibody (labeled "isotype"), and one or two additional human IgG anti-BMP 6 antibodies (antibodies a and B).

Animals were pre-dose bled one hour prior to dosing (-1) to obtain baseline measurements, followed by measurements at 5 minutes, 6 hours, and 24 hours, and days 3, 7, 9, 14, 22, 29, and 36. Plasma Transferrin Saturation (TSAT) was determined at each time point.

The experiment was designed to measure the TSAT changes following a single intravenous injection of fully human IgG4 anti-BMP 6 antibody produced by the present invention. A total of 17 antibodies were evaluated in three independent studies (tables 4-6 and 7-9) according to the experimental procedures outlined above. Tables 12-14 show the TSAT results of the 3 experiments.

Table 12: calculation from iron parameters measured in plasma following a single intravenous injection of the antibodies selected in table 7 TSAT. As described above, all antibodies and controls were administered at 1mg/kg

Table 13: calculation from iron parameters measured in plasma following a single intravenous injection of the antibodies selected in table 8 TSAT. As described above, all antibodies and controls were administered at 1mg/kg

Table 14: calculation from iron parameters measured in plasma following a single intravenous injection of the antibodies selected in table 9 TSAT. As described above, all antibodies and controls were administered at 1mg/kg

The plotted results are shown in FIGS. 8A-D (Table 12), FIGS. 8E-G (Table 13), and FIGS. 8H and I (Table 14). In conclusion, the two antibodies that showed the highest effect on TSAT amount in terms of TSAT peak increase and duration of action were CL-58838 (FIG. 8A) and CL-58835 (FIG. 8H) according to all three experiments.

Example 12

Evaluation of dose response of CL-55838 following a single intravenous injection in normal rats

Antibody CL-58838 is one of the antibodies that showed a preferred profile in example 11, and therefore attention was given to determining the effect on transferrin saturation and duration of action after IV injection of CL-58838 over a range of doses. Male Wistar rats (250-325g, n 6/group) were given a single intravenous injection of 0.3, 1 or 3mg/kg of CL-58838 fully human IgG4(SEQ ID NO: 116 and SEQ ID NO: 125). Also included are the hIgG4 isotype control (labeled "isotype") and antibody a, which received a single 1mg/kg iv dose.

Animals were pre-dose bled one hour prior to dosing (-1) to obtain baseline measurements, followed by measurements at 5 minutes, 6 hours, and 24 hours, and days 3, 7, 9, 14, 22, 29, and 36. Plasma TSAT was determined for each time point (table 15).

Table 15: iron parameter meter measured from plasma after single intravenous injection of antibody CL-58838 at different doses And calculating the TSAT. Isotype control and antibody A were administered at only 1mg/kg

Fig. 9 shows the results of the experiment. There was a rapid and strong increase in TSAT after treatment with CL-58838, as well as dose-dependent peak levels and dose-dependent TSAT adjustment duration. 3mg/kg had the highest and longest duration of action, with TSAT elevated for at least 864 hours compared to isotype control (fig. 9A). CL-58838 showed a similar increase in TSAT and duration of action as antibody a when compared at the same dose of 1mg/kg, but the peak level of antibody a appeared slightly higher but restored to isotype level for 696 hours, while CL-58838 was still higher than the isotype at that time point (fig. 9B).

Fig. 11 shows the Pharmacokinetic (PK) profile of CL-58838 in the experiment (fig. 11A), with the peak concentration and duration of exposure increasing with each dose increment. CL-58838 showed a similar peak concentration but increased duration of exposure when the PK profile was compared to that of antibody a at a 1mg/kg dose (fig. 11B).

Example 13

Evaluation of the dose response of CL-55838 after a single subcutaneous (sc) injection in normal rats

Male Wistar rats (250-325g, n 6/group) were given a single subcutaneous (sc) injection of 0.3, 1 or 3mg/kg of CL-58838 in the form of fully human IgG4 anti-BMP 6 antibodies (SEQ ID NO: 116 and SEQ ID NO: 125). Also included are the hIgG4 isotype control antibody (labeled "isotype") and the anti-BMP 6 antibodies a and B, each receiving a single 1mg/kg sc dose.

Animals were bled prior to dosing one hour prior to dosing (-1) to obtain baseline measurements, and then measurements at 5 minutes, 6 hours, and 24 hours, and days 3, 7, 9, 14, 22, 29, and 36. Plasma TSAT was determined for each time point (table 16).

Table 16: TSAT was calculated from iron parameters measured in plasma after a single subcutaneous injection of antibody CL-58838. Isoforms Control and antibodies A and B were administered at only 1mg/kg

Fig. 10 shows the results. After treatment with CL-58838, there was a rapid and strong increase in TSAT at all doses, with dose-dependent peak content ranging from 24 to 72 hours and dose-dependent TSAT adjustment duration. 3mg/kg had the longest duration, TSAT was elevated at least 864 hours compared to isotype control (fig. 10A). At 1mg/kg, CL-58838 showed a very similar increase in TSAT as antibodies A and B (FIG. 10B). In the experiment, the duration of action was more similar to antibody B, all higher than isotype control at 528 hours.

Figure 11 shows the Pharmacokinetic (PK) profile of CL-58838 after a single subcutaneous dose, with the peak concentration and duration of exposure increasing with each dose increment (figure 11C). CL-58838 showed similar peak exposure and increase in exposure duration when the PK profile of CL-58838 was compared to anti-BMP-6 antibodies A and B at a 1mg/kg dose (FIG. 11D).

Example 14

Evaluation of CL-58838 in a PG-PS rat model of Chronic anemia of inflammation

The PG-PS rat disease model is a disease model of persistent and long-lasting joint inflammation after administration of group a streptococcal peptidoglycan-polysaccharide (PG-PS). Most of the rats also develop severe anemia over a period of two to three weeks, so the model also represents a model for the inflammation-driven functional iron deficiency anemia observed in many chronic inflammatory diseases, i.e. a model representing chronic disease anemia (ACD; (therrl et al, 2011)).

Female Lewis rats, 6-8 weeks old, were given a single intraperitoneal (ip) injection of 15mg/kg PG-PS on day-14. On day-1 (week 0), animals were bled from the tail vein, plasma was collected and whole blood was collected and used for Complete Blood Count (CBC) analysis. Animals with anemia (hemoglobin content less than 15g/dl) and increased white blood cell counts entered the study. The treatment naive group was included in the study for baseline readings (n-5). On day 0, animals were randomized to give similar mean hemoglobin content and white blood cell count in all treatment groups (n-6-9). The rats were subsequently treated with a single subcutaneous injection of IgG4 isotype control (n-8), CL-588383mg/kg (n-9), dabecortine α (EPO)10 μ g/kg (n-8) or a combination of CL-588383mg/kg and EPO 10 μ g/kg (n-7). EPO administration was repeated weekly in the group receiving EPO.

Blood was taken from the tail vein on day-1 (week 0), day 7 (week 1), day 14 (week 2), day 21 (week 3) and picked on day 28 (week 4) to allow further analysis of iron status and anemia.

The experiment was designed to investigate whether CL-58838 could have a positive effect on anemia in rats compared to untreated controls. To determine its effect on hemoglobin, TSAT, complete blood count and hepcidin content were measured after a single dose of CL-58838 alone or in combination with Erythropoietin (EPO), representing a common treatment option for anemia of chronic disease.

Table 17: hemoglobin (g/dl), hematocrit (%), average measured at weeks 0, 1, 2, 3, and 4 after initiation of treatment ³Mean cell volume (MCV, fL), mean cell hemoglobin (MCH, pg), and white blood cells (WBC x10/μ L). CL-58838 and type control was administered at 3mg/kg and EPO (Dabepottine alpha) at 10. mu.g/kg.

Table 17 and figure 12 show that treatment with CL-58838 itself increased TSAT at all four time points compared to animals treated with isotype control (figure 12A). Administration of CL-58838 in combination with EPO further maintained an increase of more than 50% in TSAT over the duration of the experiment, similar to TSAT observed in native animals. CL-58838 also prevented the hemoglobin drop seen for isotype-treated animals between weeks 3 and 4 (fig. 12B). Administration of CL-58838 in combination with EPO resulted in a large synergistic increase in hemoglobin beyond that observed in the native animals (fig. 12B). Similar observations were made for MCH, where co-treatment restored the MCH content observed for native animals (fig. 12C). Fig. 12D-F show results of cycling hepcidin levels at week 0 (fig. 12D), week 1 (fig. 12E) and week 2 (fig. 12F). At the start of treatment (12D), all groups had a greatly increased content of kinesins due to the rapid onset of inflammation compared to the native animals. At weeks 1 and 2 after initiation of treatment, the isotype control animals further increased hepcidin levels, probably due to persistent inflammation and hepcidin overproduction (fig. 12E and 12F). Treatment with EPO alone failed to reduce the increase in hepcidin content and still increased over time, remaining within 20-30% of the isotype control. Treatment with CL-58838 alone had a significant effect on hepcidin content, initially significantly decreased compared to isotype control-treated animals, and subsequently remained at about 50% of the hepcidin content of the isotype control-treated animals. Treatment with CL-58838 and EPO administration initially reduced hepcidin levels to a similar extent to CL-58838 alone, but maintained or even further reduced hepcidin levels compared to isotype, CL-58838 or EPO treated animals. The addition of EPO with CL-58838 appears to have a synergistic effect on hepcidin content, possibly via effective stimulation of erythropoiesis with increased available iron content, and leading to a possible down-regulation of hepcidin production (Nai et al, 2015).

Example 15

Evaluation of dose response of CL-58838 following Single dose intravenous injection in cynomolgus monkeys

A single intravenous injection of 1, 3 and 10mg/kg of CL-58838 human IgG4(SEQ ID NO: 116 and SEQ ID NO: 125) was administered to 15 male healthy cynomolgus monkeys weighing 2.5-4.0 kg. anti-BMP 6 antibodies A and B were also included in a single intravenous injection of 3 mg/kg.

Animals were bled on days-6, -1, and immediately prior to dosing (0) for baseline measurements, followed by 6/24 hours, and days 3, 7, 9, 14, 22, 29, 35, and 43. Plasma TSAT and hepcidin levels were measured at each time point to assess the efficacy of CL-58838 in regulating iron metabolism. The TSAT values at all time points and in all groups are shown in Table 18.

Table 18: TSAT was calculated from iron parameters measured in cynomolgus monkey plasma after a single intravenous injection of antibody. Isoforms Control and antibodies A and B were administered at 3mg/kg only

FIG. 13 shows the increase in TSAT and duration of action following a single iv dose of 3mg/kg CL-58838, which is similar to the same doses of antibodies A and B (A). There was a dose-dependent increase in the overall effect of TSAT, peak TSAT content, and duration of TSAT modulation after treatment with different doses of CL-58838 (fig. 13B). CL-58838 and antibodies A and B both showed a similar decrease in plasma hepcidin levels at 3mg/kg and similar duration of action (FIG. 13C). Hepcidin reduction after treatment with CL-58838 was greatest at 3mg/kg, and treatment with 10mg/kg showed no further reduction in hepcidin content (FIG. 13D).

Fig. 14 shows the PK profile of CL-58838 in the experiment (fig. 14A), where exposure and peak concentration and duration of exposure increased with each dose increment. When CL-58838 was compared to the exposure curves of antibodies a or B at 3mg/kg, all antibodies showed similar curves, but CL-58838 showed a trend that the duration of exposure could increase (fig. 14B).

Example 16

Sequence analysis of CL-58838 and CL-58838-like antibodies

From the results of in vivo analysis of the selected antibodies (example 11), the functional activity of the antibody sequences was again analyzed, and compared based on the fact that only CL-58838 showed very effective prolongation of iron content and increased activity of TSAT. Since from Kymouse^TMThe sequences of all antibodies recovered were available, thus a sequence pool of antibodies with the same VDJ region (IGHV3-11 x 01, IGHD6-19 x 01, IGHJ4 x 02/IGKV3-20 x 01, IGKJ1 x 01) and the same CDRH3 sequence was developed. As explained in example 5 (table 6), several antibodies were identified from the NGS sequence pool in both immunization protocols. Finally three new antibodies were selected for in vivo analysis (shown in bold in tables 6 and 9). However, none of the CL-58722 or CL-58756 identified by the methods showed similar activity to CL-58838 and only CL-58835 was similar after in vivo testing (example 11, table 14). This is surprising in view of the high degree of homology between the amino acid sequences in the antibody panel. FIG. 15 shows an alignment of all unique antibodies from Table 6 with the Vh (IGHV3-11) and Vk (IGKV3-20) regions of CL-58838. It should first be noted that CL-58838 and CL-58835 have identical light chains, which are unique to the two antibodies and differ by only one amino acid in CDRH 2. Antibodies tested in vivo but not showing similar performance to CL-58838 or CL-58835 in vivo did not show the germline Vh changes at residues 75 and 76(Kabat) for M75 and D76 observed for CL-58838 or CL-58835. This difference can be explained by testing the mutation without other Vh or other significant differences. Thus, the two mutations may be the main sequence motifs mediating the specific properties observed for the two antibodies. It cannot be excluded that the unique Vk region also contributes to CL -58838 and CL-58835, although it is known in the art that Vh regions and especially CDRH3 are often the major contributors to antibody specificity and performance (Xu and Davis, 2000).

Another observation was made when considering cross-reactivity with BMP 7. The antibodies in this group that showed some degree of cross-reactivity with BMP7 were CL-58680, CL-58679 and CL-58680. Sequence differences in the Vh domain cannot be attributed to the effect, as they also occur in other clones. However, for clones cross-reactive with BMP7, positions 52 and 53(Kabat) were unchanged in the Vk domain compared to germline IGKV3-20, whereas all clones that did not cross-react with BMP7 had one or two of the residue changes.

The in vitro performance of those antibodies was similar when tested in a head-to-head competition assay in a homogeneous time-resolved fret (htrf) assay, in which biotinylated CL-58838 detected with an antiproteinin-cryptate was bound to BMP6 labeled with 647 (fig. 16). The interaction of labeled CL-58838 with labeled human BMP6 was then competed by unlabeled antibodies tested in the experiment. As expected, CL-58838 competed completely with labeled CL-58838. CL-58722 and CL-58756 showed a slightly lower ability to compete with labeled CL-58838, which might also reflect some of the effects of sequence changes on BMP6 affinity. The analysis surprisingly showed that although the antibodies selected from the series for in vivo analysis (with the same VDJ usage and the same CDRH3) showed very similar ability to bind and neutralize human BMP6, and all antibodies competed with CL-58838 for binding to BMP6 but still differed significantly in their in vivo performance.

Example 17

Evaluation of CL-58838 ability to reduce ESA in PG-PS rat model of Chronic anemia of inflammation

As detailed in example 14, the PG-PS rat disease model is a well-established model for studying chronic inflammatory anemia.

The objective of the study was to test whether the anti-BMP-6 IgG4 antibody CL-58838(SEQ ID NO: 116 and SEQ ID NO: 125) in combination with dabbepotin alpha (EPO) could reduce the dose of EPO required to effectively restore hematological parameters using the model compared to EPO monotherapy.

Method

Female Lewis rats, 6-8 weeks of age, were given a single intraperitoneal (ip) injection of 15mg/kg PG-PS at time point "week-2", and two weeks later (i.e., time point "week 0") the animals were bled from the tail vein for complete blood count analysis. Rats were included in the experiment only when they had increased granulocyte counts at time point week 0 (see figure 17A). The untreated native group was included in the study for baseline readings (group I, see table 19). In addition, hemoglobin (Hgb) values of the incorporated rats were studied. If the Hgb value is < 13.5g/dL, the rats are assigned to a specific treatment group (II-IV, see Table 19). If the Hgb value > 13.5g/dL, the rats were not assigned to a specific treatment group and re-analyzed in the next week (see FIG. 17B). Plasma was collected at all time points for further analysis. After the animals were assigned to one of the respective treatment groups, rats in group II were treated with a single s.c. injection of IgG4 control antibody, rats in group III were treated with 10 μ g/kg of dabbepotin α, and rats in group IV received a combination of 3mg/kg CL-58838 and 10 μ g/kg of dabbepotin α (see table 19).

Table 19: treatment cohort evaluating ESA-sparing ability of CL-58838 to treat ACD

Group I	Natural control rat
		Group II	Receiving IgG4 control antibody [3mg/kg]s.c. ACD rats
Group III	Receiving bepotastine alpha [10 mug/kg]s.c. ACD rats
		Group IV	Receiving CL-58838[3mg/kg]And bepotastine alpha [10 mug/kg)]ACD rat

After the initial treatment, CL-58838 (group IV) or IgG4 control (group II) was administered repeatedly every three weeks. In contrast, any further EPO administration was dependent on Hgb values, which were evaluated in each individual rat weekly throughout the study. As shown in fig. 17B, EPO alone was administered if the Hgb values in treatment groups III and IV were lower than the mean Hgb value of the natural control rats (group 1). We chose the experimental setup to mimic the real clinical setting in humans, since CKD patients only receive EPO dependent on a certain predetermined Hgb content.

Blood was collected weekly from the tail vein (i.e. time points "week 0-week 6") and picked at "week 7" to allow further analysis of iron status and anemia.

Starting from "week 0", rats were assigned to one of the treatment groups according to the above criteria. After week 3, all rats were assigned to one of the treatment groups and treatment could begin. Importantly, Hgb values were evenly distributed among groups on the day of treatment 1 (fig. 17C). Details regarding the number of rats and the time point of treatment initiation are shown in table 20.

Table 20: rats listed according to time points included in the experiment

Group of	Treatment of	Quantity (incorporated at 0/1/2/3 weeks)
			Group I	Natural control	5(5/0/0/0)
Group II	ACD/IgG4 control antibody [3mg/kg]	7(2/2/2/1)
			Group III	ACD/dabecortin alpha [10 mug/kg [)]	10(1/5/2/1)
Group IV	ACD/CL-58838[3mg/kg]And bepotastine alpha [10 mug/kg)]	11(1/5/3/2)

Results

As outlined above, if the Hgb value of the rats is < 13.5g/dL, the rats are assigned to the treatment group. ACD rats treated with isotype control antibody remained anemic throughout the experiment. Treatment with EPO alone restored Hgb levels to near normal values. However, the combination of CL-58838 with EPO showed a synergistic effect on the Hgb value. One week after treatment initiation, Hgb values were normalized and increased further over time (fig. 17C). Furthermore, Mean Corpuscular Volume (MCV) and Mean Corpuscular Hemoglobin (MCH), which are sensitive indicators of iron availability, were normalized in ACD rats treated with CL-58838 in combination with EPO, whereas ACD control rats and rats treated with EPO maintained only microcytosis and low color throughout the experiment (fig. 17D and E).

In addition, to assess whether the combination therapy had an EPO-sparing effect, the amount of EPO administered in the treated group III and IV rats was monitored. The following calculations are based on additional EPO doses, thus excluding EPO doses administered for the first treatment:

A total of up to 40 (ACD/dabbepoten α) and 44 (ACD/dabbepoten α + CL-58838) EPO administrations theoretically could reduce all rats to below the defined threshold of the mean Hgb value of the natural control rats after 4 weeks of treatment. Following the criteria explained above and outlined in fig. 17B, 21 out of 40 possible doses had to be administered to group III rats. In contrast, of the 44 possible EPO administrations, only 8 additional EPO doses had to be applied to group IV rats. In other words, although EPO-treated rats "consumed" 53% of all possible EPO doses, the combination group required only 18% to maintain Hb values above the cut-off (fig. 17F). This clearly demonstrates that combination therapy can correct Hgb values more effectively than EPO monotherapy. Thus, addition of CL-58838 can produce EPO sparing effect.

Example 18

Evaluation of CL-58838 in a mouse model of Chronic Kidney disease

In addition to the rat models described in examples 14 and 17, the human IgG4 anti-BMP-6 antibody CL-58838(SEQ ID NO: 116 and SEQ ID NO: 125) was also tested in the murine model of Chronic Kidney Disease (CKD). Renal injury was induced via a special diet containing 0.2% adenine (Akchurin et al, 2016). The purpose of the study was to test the role of CL-58838 as monotherapy or in combination with dabbepotin α (EPO) in the disease model.

Method

Male C57BL/6N mice at 3 weeks of age were fed a special diet (called adenine diet) containing 0.2% adenine, 0.9% phosphate and 30mg iron. Untreated control mice (n-7) were fed a diet containing 30mg Fe without adenine.

At time point "week 0", CKD animals were randomly assigned to different treatment groups (see table 21 for details). Thus, group II was treated with a single s.c. injection of IgG4 control [3mg/kg ] (n ═ 5), group III received CL-58838[3mg/kg ] (n ═ 6), group IV was treated with dabbepotin α [10 μ g/kg ] (n ═ 6), and group V received a combination of CL-58838[3mg/kg ] and dabbepotin α [10 μ g/kg ] (n ═ 6). The untreated native group was included in the study for baseline readings (n-7). EPO treatment was repeated weekly, i.e. mice were treated 4 times with EPO. CL-58838 administration was performed every other week, i.e., mice received two injections of drug. The experiment was terminated after 4 weeks of treatment.

The experimental setup is shown in fig. 18A.

Table 21: evaluation of CL-58838 treatment group in a mouse model of chronic kidney disease

Group I	Healthy controls
		Group II	CKD mice received IgG4 control antibody [3mg/kg]i.p.
Group III	CKD mice received CL-58838[3mg/kg]i.p.
		Group IV	CKD mice received bepotastine alpha [ 10. mu.g/kg ] ]i.p.
Group V	CKD mice received CL-58838[3mg/kg]And bepotastine alpha [10 mug/kg)]i.p.

Results

Mice were analyzed 4 weeks after the 1 st treatment. Monotherapy with CL-58838 or EPO can slightly improve Hgb values, however, combination therapy normalized Hgb values to baseline values (fig. 18B). In addition, CL-58838-treated animals had Mean Corpuscular Volume (MCV) and Mean Corpuscular Hemoglobin (MCH) values significantly higher than untreated or EPO-treated mice alone. Importantly, MCV and MCH were fully normalized in the double treated animals, indicating that the iron supply of the erythrocyte progenitors was improved in the treated animals (fig. 18C and 18D). Since CL-58838 regulates hepcidin expression via targeting BMP6, we studied genes, proteins and parameters associated with iron metabolism in the animals in detail. As shown in fig. 18E, liver Hamp expression was significantly reduced in animals receiving CL-58838 monotherapy or CL-58838 in combination with dabbepotin α. Plasma iron content and hence Transferrin Saturation (TSAT) values were reduced in CKD control animals. EPO and CL-58838 monotherapy resulted in a slight increase in iron content and TSAT. In addition, combination therapy caused the strongest increase in plasma iron content (fig. 18F). Accordingly, TSAT values were also significantly increased in animals receiving dual treatment compared to animals treated with EPO alone (fig. 18G). Taken together, the data clearly show that iron is efficiently mobilized, binds to Tf, and is incorporated into hemoglobin of red blood cells in the bone marrow.

Example 19

Evaluation of ESA-reducing Capacity of CL-58838 in a mouse model of Chronic Kidney disease

As detailed in example 18, CKD was induced in male mice via an adenine-containing diet, causing renal injury and anemia after 8 weeks. The purpose of the study was to test

1) Whether combination therapy of CL-58838 with EPO (dabecortin α) can lead to a better overall response and potential reduction in EPO dosage.

2) If combined with CL-58838, it is possible to see if the EPO dose itself has no effect on the improvement of the Hgb results.

Method

Male C57BL/6N mice at 3 weeks of age were fed a special diet (called adenine diet) containing 0.2% adenine, 0.9% phosphate and 30mg iron. At "week 0" CKD animals were randomly assigned to different treatment groups (see table 22 and fig. 18A for details) and treatment was initiated. Mice were analyzed 4 weeks after the 1 st treatment.

Table 22: treatment group to be evaluated

Results

Treatment of mice with CKD with the maximum EPO dose (1 μ g/kg) in this study failed to improve anemia. However, if 1 μ g/kg EPO was combined with CL-58838, anemia could be significantly improved regardless of CL-58838 doses [0.1mg/kg, 1mg/kg, and 10mg/kg ] (FIG. 19A). The effect was more pronounced with two higher doses of CL-58838. The results clearly show that EPO dosage alone can effectively have no effect on Hgb content if combined with CL-58838.

Vice versa, our experimental setup allowed to assess whether combination therapy could result in the use of lower doses of EPO in combination therapy (i.e., ESA sparing). In this regard, CL-58838 at the 10mg/kg dose was able to significantly increase Hb levels if combined with 0.1 μ g/kg EPO, 10-fold lower than the EPO dose used alone, and even 100-fold lower than the dose used in example 18 (fig. 19B).

Furthermore, Mean Corpuscular Volume (MCV), which is a surrogate for red blood cell iron availability, increased dose-dependently (fig. 19C). In other words, the higher the dose of CL-58838 administered, the better the iron supply to the red blood cells, which is reflected in a higher MCV value. It is well known that iron in the form of saturated transferrin (TSAT) represents the major iron transport pathway for developing erythrocytes, and we also assessed said parameters. As shown in FIG. 19D, TSAT was significantly increased in mice receiving 1. mu.g/kg EPO in combination with 1mg/kg and 10mg/kg CL-58838, as compared to mice receiving only EPO.

Furthermore, even though the lowest EPO dose (0.01 μ g/kg) combined with 1mg/kg CL-58838 did not result in a significant Hb increase (not shown), it did result in higher MCV values, indicating better red blood cell quality (fig. 19E).

anti-BMP 6 targets reduction in hepcidin levels via CL-58838 treatment. Therefore, hepcidin levels were analyzed (by measuring Hamp mRNA expression in the liver, which is known to correlate well with plasma hepcidin levels). Generally, there was a tendency for significant decrease in Hamp expression in all double-treated animals, except mice in group III that received the lowest CL-58838 dose tested herein [0.1mg/kg ] (fig. 19F). Interestingly, animals receiving the same CL-58838 dose but different doses of EPO (i.e., treatment groups IV-VI and VII-IX) showed a trend toward higher Hamp expression with higher EPO doses. Since the Hb content also increases dose-dependently, the higher Hamp expression must be explained in view of the crosstalk between iron homeostasis and erythropoiesis. For example, in the case of sufficient Hb content, Hamp expression is no longer strongly inhibited by signals produced by developing red blood cells, such as Erfe (Kautz et al, 2014).

Reference to the literature

Akchurin, o., Sureshbabu, a., Doty, s.b., Zhu, y., s., Patino, e., Cunningham-ruddles, s., Choi, m.e., Boskey, a., riella, s., 2016. the absence of hepcidin improves anemia and growth in an adenine-induced chronic kidney disease mouse model (rock of hepcidin analogs and improved growth of a chronic kidney disease) journal of physiology-kidney (am.j.physiol., ren.physiol., renn.physiol., 311, F877-F889.

Andriopoulos, b., coradini, e., Xia, y., faass, s.a., Chen, s., Grgurevic, l., Knutson, m.d., Pietrangelo, a., vukcevic, s., Lin, h.y., babit, j.l., 2009, BMP6 is a key endogenous regulator of hepcidin expression and iron metabolism (BMP6 is a key endogenous regulator of hepcidin expression and iron metabolism) & nature-genetics 482-7.

Casanovas, G., Banerji, A., D' Alessio, F., Multickenthaler, M.U., Legewie, S., 2014. multiscale Model of Hepcidin Promoter Regulation Reveals Factors Controlling Systemic Iron Homeostasis (A Multi-Scale Model of Hepcidin Promoter Regulation sources Controlling systematic Iron Homeostatis).: public science library: computational biology (PLoS comput. biol.) 10.

Kautz, l., Jung, g., Nemeth, e., Ganz, t., 2014, hematin, erythro-ferritin, blood 124, 2569-74, contributes to the recovery of anemia of inflammation.

Mayeur, c., Lohmeyer, l.k., Leyton, p.a., Kao, s.m., Pappas, a.e., Kolodziej, s.a., spagnolii, e.g., Yu, b.a., Galdos, r.l., Yu, p.b., Peterson, r.t., Bloch, d.b., Bloch, k.d., Steinbicker, a.u., 2014.i. BMP receptor Alk3 is necessary for interleukin-6 to induce hepatic hepcidin gene expression (The receptor I BMP Alk3 is required for The indication of The liver hepcidin gene expression of liver hepcidin ex uk-6), blood 123, 2261. d.a.

Nai, a., lidoni, m.r., Rausa, m., Mandelli, g., Pagani, a., silverstri, l., Ferrari, g., camischela, c., 2015. secondary transferrin receptor regulates mouse red blood cell production [ blood ] 125, 1170-1179.

Theurl, I., Schrol, A., Sonnweber, T., Nairz, M., Theurl, M., Willenbacher, W., Eller, K., Wolf, D., Seifert, M., Sun, C.C., Babitt, J.L., Hong, C.C., Menhall, T., Gearing, P., Lin, H.Y., Weiss, G., 2011. pharmacological inhibition of iron hormone expression can reverse anemia of chronic inflammation in rats (pharmacological inhibition of hepcidin expression reactions and acute bacterial infection), blood 118, 4977, 4984.

Xia, Y., Babitt, J.L., Sidis, Y., Chung, R.T., Lin, H.Y., 2008. Hejuvelin regulates hepcidin expression independently of neogenin expression by a selective subset of BMP ligands and receptors (Hemojuvelin modulators of BMP of ligands and receptors.) blood 111, 5195-.

Xu, j.l., Davis, m.m., 2000.V (H), whose CDR3 regions are sufficiently diverse to satisfy the specificity requirements of most antibodies (Diversity in the CDR3 region of V (H) is sufficient for the patient antibodies.) Immunity (Immunity) 13, 37-45.

Yusa, k., Zhou, l., Li, m.a., Bradley, a., Craig, n.l., 2011. hyperactive piggyBac transposase for mammalian applications, "american national academy of sciences" (proc.nature.acad.sci.u.s.a.) -108, 1531-6.

The sequence is as follows: