阅读说明：本技术 经修饰的人促红细胞生成素 (Modified human erythropoietin ) 是由 马科斯·奥盖罗-埃伯哈特 玛丽亚·德洛斯·米拉格罗斯·布尔吉-菲索洛 阿奎尔斯·多雷拉 加芙列 于 2019-09-26 设计创作，主要内容包括：本发明涉及经修饰的人促红细胞生成素,其具有增加的血浆半衰期并且具有相对天然促红细胞生成素小于0.5％的促红细胞生成活性,其维持了神经保护和神经重构能力并且通过掺入共有的N-糖基化位点而包括同二聚体或异二聚体受体的至少一个结合位点的突变。(The present invention relates to modified human erythropoietin having an increased plasma half-life and having less than 0.5% erythropoietic activity relative to native erythropoietin, which maintains neuroprotective and neuro-reconstructive capabilities and includes a mutation of at least one binding site of a homodimeric or heterodimeric receptor by incorporating a common N-glycosylation site.)

1. A modified human erythropoietin having less than 0.5% erythropoietic activity relative to native erythropoietin and maintaining its neuroprotective and neuro-reconstituting ability, characterized in that said modified human erythropoietin comprises at least one mutation of a binding site for binding to a homodimeric or heterodimeric receptor by addition of a common glycosylation site.

2. The modified human erythropoietin according to claim 1, wherein the binding site for binding to a receptor is selected from the group of amino acids comprising the following positions: 45-47, 15-17, 104, 98-100, 106, 149, 151, 153, 76-78, 72-74, 62-64, 65-67, and combinations thereof.

3. The modified human erythropoietin of claim 1, wherein the mutation is selected from the group consisting of:

lys45asn and Asn47 Thr;

tyr15asn and Leu17 Thr;

c.Ser104Asn；

Ala98Asn and Ser100 Thr;

e.Thr106Asn and Leu108 Thr;

f.Leu149Thr；

gly151asn and Leu153 Thr;

arg76asn and Gln78 Thr;

glu72asn and Val74 Thr;

j.Glu 62Asn and Trp64 Thr; and

gln65asn and Leu67 Thr.

4. The modified human erythropoietin of claim 1, which has an erythropoietic activity of at most 0.2% relative to human erythropoietin.

5. The modified human erythropoietin of claim 1, which has no erythropoietic activity.

6. The modified human erythropoietin of claim 1, which is encoded by a DNA sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

7. The modified human erythropoietin of claim 1, comprising an amino acid sequence selected from the group consisting of: SEQ ID N ° 2, SEQ ID N ° 4, SEQ ID N ° 8, SEQ ID N ° 10, SEQ ID N ° 12, SEQ ID N ° 14, SEQ ID N ° 16, SEQ ID N ° 18, SEQ ID N ° 20, SEQ ID N ° 22 and SEQ ID N ° 24.

8. A nucleic acid comprising at least a nucleotide sequence selected from the group comprising: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

9. A transformation vector comprising a nucleotide sequence selected from the group consisting of: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

10. An expression vector comprising a nucleotide sequence selected from the group consisting of: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

11. A lentiviral vector comprising a nucleotide sequence selected from the group consisting of: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

12. A genetically modified cell comprising a nucleic acid molecule selected from the group comprising: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

13. The genetically modified cell according to claim 12, comprising an animal or plant cell line or any cellular host that allows the addition of N-glycans.

14. The genetically modified cell of claim 12, comprising an animal cell line.

15. The genetically modified cell of claim 12, selected from the group consisting of: k1, HEK293, NS0, BHK-21 and HeLa.

16. A pharmaceutical composition comprising a therapeutically effective amount of the modified human erythropoietin of claim 1.

17. A pharmaceutical composition comprising a therapeutically effective amount of the modified human erythropoietin of claim 1 for treating a disease selected from the group comprising: alzheimer's disease; parkinson's disease; amyotrophic Lateral Sclerosis (ALS); motor neuron diseases; huntington's disease; spinocerebellar atrophy; creutzfeld-jakob disease; disability disorders such as depression or schizophrenia; developmental diseases, such as down syndrome; nervous tissue injury caused by cerebrovascular accident and craniocerebral injury.

18. Use of a modified human erythropoietin according to claim 1 for the treatment of a disease selected from the group comprising: alzheimer's disease; parkinson's disease; amyotrophic Lateral Sclerosis (ALS); motor neuron diseases; huntington's disease; spinocerebellar atrophy; creutzfeld-jakob disease; disability disorders such as depression or schizophrenia; developmental diseases, such as down syndrome; nervous tissue injury caused by cerebrovascular accident and craniocerebral injury.

19. A method for obtaining the modified human erythropoietin of claim 1, comprising the steps of:

a. providing a nucleic acid sequence encoding a modified human erythropoietin;

b. constructing at least one co-transfection vector for the packaging cells;

c. co-transfecting said packaging cell producing said lentiviral particle comprising a nucleic acid sequence encoding a modified human erythropoietin;

d. harvesting the lentiviral particles produced by the packaging cells of step c;

e. transducing cells capable of expressing and folding the modified human erythropoietin with said lentiviral particles from step d;

f. selecting the cells comprising the nucleic acid sequence encoding the modified human erythropoietin in step e;

g. culturing the cell of step f such that the cell is capable of expressing the modified human erythropoietin; and

h. isolating and purifying the modified human erythropoietin.

20. The method of claim 19, wherein in step a, the nucleic acid sequence is selected from the group comprising: SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13, SEQ ID N ° 15, SEQ ID N ° 17, SEQ ID N ° 19, SEQ ID N ° 21 and SEQ ID N ° 23.

21. The method of claim 19, wherein the step b comprises: a vector that allows entry of lentiviral particles into a cell; a vector encoding a matrix protein, a capsid, a protease, a reverse transcriptase, and an integrase; a transfer vector comprising a modified human erythropoietin sequence; and a vector that induces nuclear export of the transfer vector.

22. The method of claim 19, wherein in step e, the cells are selected from the group comprising: k1, HEK293, NS0, BHK-21 and HeLa.

23. The method of claim 19, wherein step h is a purification by immunoaffinity comprising an anti-rhEPO antibody and an eluent.

24. The method of claim 23, wherein the eluent is selected from the group comprising: glycine, acetic acid-NaCl, acetate, citric acid, phosphate, ethanol, isopropanol, dioxane, ethylene glycol, Tris-HCl, and mixtures thereof.

25. The method of claim 23, wherein the eluent is selected from the group comprising: glycine, acetic acid-NaCl.

26. The method of claim 23, wherein the eluent is selected from the group comprising: 0.1M glycine (pH 2); 0.15M glycine (pH 2.5); and 0.2M acetic acid, 0.15M nacl (pH 3).

Technical Field

Modified erythropoietin molecules having neuro-reconstructive (neuroplastic) and neuroprotective (neuroprotective) capabilities are described which are useful in the treatment of central nervous system diseases such as cerebrovascular accidents, neurotrauma, neuroinflammation and neurodegeneration.

Prior Art

Erythropoietin (EPO) is part of the type I cytokine superfamily and is characterized by important pleiotropic activities [1 ]. This cytokine is one of the major regulators of erythropoiesis, and acts synergistically with other molecules to promote the proliferation, differentiation and survival of erythroid lineage cell progenitors and to maintain most circulating erythrocytes [2 ].

Human epo (hepo) is a highly glycosylated protein with a molecular weight in the range of 30 to 39 kDa. It has three common N-glycosylation sites and one O-glycosylation site [3], which may occur in a total occupancy rate. The sugar chains consist of variable monosaccharide sequences and variable numbers of Sialic Acids (SA) [4,5 ]. The N-linked carbohydrate may comprise two, three or four branches, each branch ending with a negatively charged SA molecule. As such, carbohydrates bound at O-glycosylation sites can contain up to two SA molecules [6 ].

Glycosylation, especially the SA-terminus of N-glycans, is critical for the in vivo biological activity of EPO, but not for in vitro receptor binding [7,8 ]. This is why EPO molecules with a low glycoside content have a high affinity for EPO receptor (EPOR); however, their in vivo activity decreases with increasing plasma clearance [8 ]. The degree of glycosylation of these cytokines affects their efficiency of production, affinity for receptors, plasma half-life, secretion and protein stability [5,9 ].

Since the cloning of the hEPO gene in 1985, the knowledge of cytokine biology has changed enormously. One of the earliest developments was the discovery of a new biological role for this molecule that extends its erythropoietic capacity and involves several important physiological processes. Some of the most important are angiogenesis, regulation of vascular resistance and, more importantly, cytoprotection [10,11 ]. Although the most important activity of erythropoietin is hematopoiesis, the presence of EPO and its receptors in various tissues and non-erythropoietics confirms the above hypothesis that EPO has multiple functions, and the most important one of them is the cytoprotective function of the central nervous system, heart, kidney, gastrointestinal system, reproductive tract and endothelial cells [12], promotes cell proliferation, angiogenesis and inhibits apoptosis [13 ]. These findings expand the expectations of clinical treatments for other diseases such as heart attack, cerebrovascular attack and many other neuroprotective related diseases [14 ].

Neuroprotection can be defined as a method to maintain and restore cellular interactions in the brain, thereby maximizing the protection of neuronal function [15 ]. The goal of neuroprotection is to prevent pathological neuronal loss in central nervous system disorders, such as cerebrovascular accidents, nerve trauma, neuroinflammation and neurodegeneration.

Neurodegenerative diseases are a series of pathologies that affect the nervous system, resulting in cognitive disorders, behavioral disorders and changes in the body's regulatory system. They are characterized by long-term and progressive nature. These diseases include diseases such as parkinson's disease, various types of dementia, alzheimer's disease, multiple sclerosis and Huntington's disease (Huntington), which are among others problems that all countries have to face from the point of view of medicine, health care, society and economy [16 ]. However, as the world population ages, the impact of neurological diseases is greater in both developed and developing countries. The burden of neurological disease is reaching a considerable proportion in countries with an increasing population over the age of 65. Considering only alzheimer's disease, statistical data indicate that about 4400 million people worldwide suffer from dementia, and this figure is estimated to increase to 1.15 billion by 2050. This is why this disease is considered to be a global epidemic [17-19 ]. Therefore, many groups worldwide are looking for treatments that can control this neurodegenerative disease.

The concerted efforts of many research groups have led research progress to new eosins as the source of the problem, to hope for early detection, and to define more specific methods of attack. However, even with such efforts, no biotherapeutics have been found that can cure this disease. In this sense, the pharmaceutical market only provides drugs that slow down the progression of these diseases after their discovery, but the benefits of these drugs are often poorly perceived, which is why it is necessary to develop new therapies. Today, the success of addressing the health problems associated with neurodegenerative diseases will depend, among other things, on developing therapies that produce beneficial and long-lasting effects by favorably affecting the etiology or underlying pathogenesis, as well as preventing or delaying the onset or clinical progression of the disease in a safe, successful and effective manner. However, in turn, there is a need for an effective technique that is usable by a large number of people. In recent years, the main goal of the pharmaceutical industry has been to find compounds that can attack a common key point in the development of many central nervous system diseases (e.g. apoptosis, oxidative stress, inflammation, metabolic dysfunction or impaired neuro-remodelling).

In this field of research, EPO plays a very important role due to its ability to generate a broad cellular response in the brain that is directly related to the protection and repair of cellular injury [20 ]. EPO can induce neuroprotection through anti-inflammatory, antioxidant, anti-neurotoxic, angiogenic, neurotrophic, regenerative, and anti-apoptotic mechanisms.

In view of this, another extremely important advance in the study of EPO is the identification of two distinct molecular sites involved in their erythropoietic and cytoprotective biological activities. These two activities are produced by the binding of cytokines to two different receptor systems, the homodimeric receptor responsible for erythropoietic activity (EPOR)2 and the heterodimeric receptor involved in cytoprotective activity, EPOR- β CR [21 ]. These findings are important because they provide the necessary information to understand the pathways by which EPO develops its biological activity, thereby allowing its erythropoietic or cytoprotective response to be selectively modulated, avoiding or at least reducing the side effects associated with the use of non-selective agents (e.g., EPO or EPO analogs).

In this sense, although EPO is considered a safe and well-tolerated drug for the treatment of anemia, its hematological effects should be considered as side effects when EPO is intended for use as a cytoprotective agent in patients with cerebrovascular or heart attacks, i.e. as a neuroprotective agent in patients not suffering from anemia, since it causes polycythemia, hypertension and thrombotic events [22-25 ]. This is why the development of EPO analogs that selectively modulate their erythropoietic and cytoprotective effects is of great importance [14 ]. To this end, various strategies have been devised to abrogate the erythropoietic activity of cytokines and maintain their neuroprotective potential by chemically modifying the molecule or modulating the glycoside content.

As a strategy for chemical modification on EPO molecules, the carbamoylation of seven lysine residues has been evaluated, resulting in homocitrulline residues [26 ]. However, this approach can produce conformational changes in the protein that affect its function. Based on these results, different working groups have completely modified recombinant hEPO (rhEPO) by carbamoylation, obtaining a new molecule, called CEPO, which retains its cytoprotective activity, but lacks erythropoietic activity [26-28 ]. However, high amounts and multiple doses are required to achieve the desired purpose and maintain its therapeutic efficacy.

On the other hand, rhEPO has been modified by controlling its Sialic Acid (SA) content. In 2003, Erbayrakratr et al completely eliminated the SA residues present at the end of the EPO glycosidic chain, resulting in the so-called Asialo EPO [29 ]. This novel EPO variant shows high in vitro activity. However, its neuroprotective activity in vivo was comparable to that obtained with rhEPO.

On the other hand, in order to increase the circulating half-life of cytokines that stimulate erythropoiesis, egr and Brown developed a protein that stimulates erythropoiesis: NESP, which is derived from hEPO and has two additional N-glycosylation sites [6 ]. This modification results in a three-fold increase in plasma half-life and its hematopoietic potency in vivo.

With respect to the regulation of the glycoside content, the inventors of the present application have obtained rhEPO variants with similar characteristics to cerebral epo (rhEPO), which is a combination of less acidic isoforms (isofom) of rhEPO. This variant exhibits neuroprotective activity comparable to rhEPO and exhibits less than 4% hematopoietic activity [30 ]. However, the rapid plasma clearance of rhNEPO is a disadvantage when rhNEPO molecules are proposed as candidates for the treatment of chronic neurological diseases that require plasma concentrations to be maintained in a timely manner and sufficiently for their biological effects. Furthermore, given that the combination of glycoforms retains its in vitro erythropoietic activity, the administration of high and frequent doses to achieve this purpose carries the risk of producing hematological effects, which are considered to be adverse side effects.

Furthermore, there have been many other efforts in the prior art to obtain erythropoietin molecules or peptides derived therefrom which exhibit neuroprotective activity and are devoid of erythropoietic activity. In this respect, patent US2015119325 describes asialoerythropoietin (asialo-rhEPO) produced in plants. Patent applications US2009170759, US2003130197, MXPA02011727 and US2003130197 describe peptides binding to the EPO receptor for the treatment of diseases involving the central nervous system.

Document WO2004043382 describes variants of human erythropoietin polypeptides comprising an amino acid sequence with an amino acid difference in two or more different EPO modification regions and having enhanced erythropoietin activity. The object of the present invention is a human variant of an erythropoietin polypeptide comprising a human erythropoietin amino acid sequence which has an amino acid difference in two or more different EPO modified regions and which has an intermediate erythropoietin activity in relation to its cytoprotective ability.

Patent US2011008363 describes different variants of EPO in which 1-10 amino acids are deleted at the C-terminus of the protein. These are lower molecular weight variants with reduced erythropoietic activity and retained neuroprotective effect.

The application US2007027068 describes glycopegylated EPO peptides. A mutated EPO peptide comprises an amino acid sequence (SEQ ID No.: 73) and has at least one mutation selected from the group consisting of Arg <139> to Ala <139>, Arg <143> to Ala <143>, and Lys <154> to Ala <154 >.

ES 247398 (T3) mentions polynucleotides encoding EPO variants.

PCT WO2005025606(a1) describes a modified EPO incorporating an oligosaccharide to increase erythropoietic activity and maintain its cytoprotective activity.

Likewise, WO2006127910 describes EPO with glycosylation to enhance the production of erythrocytes. However, it is mentioned that it can also be used for the treatment of neurodegenerative diseases due to its cytoprotective function.

The application filed by argentina (AR055654) describes recombinant erythropoietin for the treatment of neurodegenerative diseases. The specification details amino acids that can be modified to add glycosylation sites, and emphasizes the modification of the following residues: 87. 88, 90//30, 32, 87, 88, 90//24, 87, 88, 90//38, 87, 88, 90//83, 87, 88, 90. The aim is to incorporate a glycan to increase the circulating half-life and thus increase erythropoietic activity. The same objective is addressed in the modification introduced in patent WO9505465, which describes variants of erythropoietin with additional glycosylation sites. Some of the sites mentioned in the patent are: 25. 30, 51, 57, 69, 88, 89, 136, 138.

Furthermore, the following substitutions are also mentioned:

Asn<30>Thr<32>EPO；

Asn<51>Thr<53>EPO；Asn<57>Thr<59>EPO；

Asn<69>EPO；

Asn<69>Thr<71>EPO；

Ser<68>Asn<69>Thr<71>EPO；

Val<87>Asn<88>Thr<90>EPO；

Ser<87>Asn<88>Thr<90>EPO；

Ser<87>Asn<88>Gly<89>Thr<90>EPO；

Ser<87>Asn<88>Thr<90>Thr<92>EPO；

Ser<87>Asn<88>Thr<90>Ala<l 62>EPO；

Asn<69>Thr<72>Ser<87>Asn<88>Thr<90>EPO；

Asn<30>Thr<32>Val<87>Asn<88>Thr<90>EPO；

Asn<89>Ile<90>Thr<91>EPO；

Ser<87>Asn<89>Ile<90>Thr<91>EPO；

Asn<136>Thr<138>EPO；

Asn<138>Thr<140>EPO；

thr <125> EPO; and

Pro<124>Thr<125>Epo。

document WO2005103076 describes EPO variants having an even number of cysteine residues, preferably no more than four cysteine residues, or more preferably no more than two cysteine residues. Preferably, the cysteine residues should be at positions 7, 29, 33 and 161, even more preferably at positions 7 and 161. Other variants provided in this application include any mutation caused by addition at one or more of the following positions: 6. 29, 33, 45, 47, 48, 49, 61, 64, 74, 88, 92, 107, 109, 133, 135, 154, 157 and 158.

Application US2011003744 describes an erythropoietin formulation comprising a polyethylene glycol conjugated protein or a polyethanolamine conjugated protein by enzymatic modification of the glycosidic residues to increase the hematopoietic properties.

The document MXPA05000063 describes a tissue protective recombinant cytokine lacking at least one effect of erythropoietin on bone marrow; the tissue protective recombinant cytokine will lack erythropoietic activity; more preferably, the tissue protective recombinant cytokine lacks all the effects of erythropoietin in the bone marrow. It is mentioned in the specification that EPO may be altered by one or more amino acids, or deleted or added. In a preferred embodiment, the tissue protective recombinant cytokine has one or more modifications in one or more of the following regions: VLQRY (amino acids 11-15 of natural human erythropoietin, SEQ ID No.: 1) and/or TKVNFYAW (amino acids 44-51 of natural human erythropoietin, SEQ ID No.: 2) and/or SGLRSLTTL (amino acids 100 and 108 of natural human erythropoietin, SEQ ID No.: 3) and/or SNFLRG (amino acids 146 and 151 of natural human erythropoietin, SEQ ID No.: 4). Can be found in SEQ ID No.: 10, amino acids 7, 20, 21, 29, 33, 38, 42, 59, 63, 67, 70, 83, 96, 126, 142, 143, 152, 153, 155, 156, and 161. These other mutations may be unique or additional to at least one mutation in at least one of the foregoing regions. In certain embodiments, changes in one or more amino acids of a TKVNFYAW (amino acids 44-51 of native human erythropoietin, SEQ ID No.: 2) result in a modified erythropoietin molecule that is partially functional, i.e., has less erythropoietic activity than rhEPO. In other embodiments, one or more of the amino acids of SGLRSLTTL (amino acids 100-108 of native human erythropoietin, SEQ ID No.: 3) are altered, even in the presence of modifications of the content of sialic acid or molecules lacking glycans or modifications of carbohydrates, such as oxidation, reduction, or variants with chemical modifications, such as nitration, acylation, succinylation, biotinylation, iodination, and carbamoylation. There is no mention of adding a new glycan to the site responsible for erythropoietic activity in order to reduce or block erythropoietic activity.

It will be appreciated that the efforts described in the prior art to obtain erythropoietin exhibiting neuroprotective activity and absent erythropoietic activity have not been successful to date. The present invention provides novel hEPO muteins that have shown neuroprotective and neurotrophic effects. These muteins were obtained by an original approach that modified the hEPO molecule by creating new N-glycosylation consensus sites on the regions of the hEPO molecule responsible for binding homodimeric and heterodimeric receptors. Unexpectedly, the novel hEPO muteins lack erythropoietic activity, but their neuroprotective/neuroremodelling activity is not altered or even enhanced, and thus they are also improved in their pharmacokinetic properties. The original EPO is modified only rarely, thus maintaining a high degree of similarity to the structure of the native protein.

Brief description of the invention

The present invention describes a modified human erythropoietin which is absent or has reduced erythropoietic activity, preferably having up to 0.5% erythropoietic activity relative to human erythropoietin, and having a longer half-life in plasma, which maintains its neuroprotective and neuroreconstructive capabilities. The binding of the modified human erythropoietin to at least one of a homodimeric receptor or a heterodimeric receptor is partially or completely abolished. This failure involves mutating one binding site to the homodimeric or heterodimeric receptor by introducing a consensus site for N-glycosylation.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: tyr15Asn and Leu17Thr, and comprises SEQ ID No. 2.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: lys45Asn and Asn47Thr, and comprises SEQ ID No. 4.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: glu62Asn and Trp64Thr, and comprises SEQ ID No. 8.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: gln65Asn and Leu67Thr and comprises SEQ ID No. 10.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: glu72Asn and Val74Thr, and comprises SEQ ID No. 12.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: arg76Asn and Gln78Thr, and comprising SEQ ID No. 14.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: ala98Asn and Ser100Thr, and comprises SEQ ID No. 16.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: ser104Asn, and comprises SEQ ID No. 18.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: thr106Asn and Leu108Thr, and comprises SEQ ID No. 20.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: leu149Thr and comprises SEQ ID No. 22.

In a preferred embodiment of the invention, the modified human erythropoietin has the following mutations: gly151Asn and Leu153Thr, and comprising SEQ ID No. 24.

The modified human erythropoietin of the invention has up to 1% erythropoietic activity relative to human erythropoietin. Preferably, it has an erythropoietic activity of at most 0.5% relative to human erythropoietin. More preferably, it has an erythropoietic activity of at most 0.2% relative to human erythropoietin.

In another aspect, the invention features a nucleic acid comprising a nucleotide sequence of an erythropoietin of the invention. In addition, the DNA sequences encoding each of the muteins described and produced are listed. These DNA sequences are SEQ ID No.1, SEQ ID No.3, SEQ ID No.7, SEQ ID No.9, SEQ ID No.11, SEQ ID No.13, SEQ ID No.15, SEQ ID No.17, SEQ ID No.19, SEQ ID No.21 and SEQ ID No. 23. In an alternative embodiment of the invention, the nucleic acids are vectors for transforming cells, or are expression vectors or lentiviral vectors.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 1.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 3.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 7.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 9.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 11.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 13.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 15.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 17.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 19.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 21.

In a preferred embodiment of the invention, the nucleic acid sequence encoding the modified human erythropoietin of the invention is SEQ ID No. 23.

Furthermore, the present invention describes a genetically modified cell having any DNA sequence selected from the group comprising: SEQ ID No.1, SEQ ID No.3, SEQ ID No.7, SEQ ID No.9, SEQ ID No.11, SEQ ID No.13, SEQ ID No.15, SEQ ID No.17, SEQ ID No.19, SEQ ID No.21 and SEQ ID No. 23; wherein the genetically modified cell is capable of expressing the modified erythropoietin of the invention. In a preferred embodiment, the genetically modified cell is a plant cell, or an animal cell or any cellular host that allows for the addition of N-glycans. Preferably, the cells are derived from an animal cell line. Preferably, the cell line is selected from the group comprising CHO.K1, HEK293, NS0, BHK-21 and HeLa.

In another aspect, the invention features a method of obtaining a modified human erythropoietin, the method comprising the steps of:

a. providing a nucleic acid sequence encoding said modified human erythropoietin;

b. constructing at least one co-transfection vector for the packaging cells;

c. co-transfecting a packaging cell that produces a lentiviral particle comprising a nucleic acid sequence encoding the modified human erythropoietin;

d. harvesting the lentiviral particles produced by the packaging cells of step c;

e. transducing cells capable of expressing modified human erythropoietin with said lentiviral particles of step d;

f. selecting the cells comprising the nucleic acid sequence encoding the modified human erythropoietin in step e;

g. culturing the cell of step f such that the cell is capable of expressing the modified human erythropoietin; and

h. isolating and purifying the modified human erythropoietin.

Wherein, in said step a, the nucleic acid sequence is selected from the group comprising: SEQ ID No.1, SEQ ID No.3, SEQ ID No.7, SEQ ID No.9, SEQ ID No.11, SEQ ID No.13, SEQ ID No.15, SEQ ID No.17, SEQ ID No.19, SEQ ID No.21 and SEQ ID No. 23.

Wherein step b comprises: a vector that allows entry of lentiviral particles into a cell, a vector encoding a matrix protein, a capsid, a lentiviral protease, a reverse transcriptase and an integrase, a transfer vector comprising a modified human erythropoietin sequence; and a vector for inducing nuclear export of the transfer vector.

Wherein, in said step e, said cell is selected from the group comprising CHO.K1, HEK293, NS0, BHK-21 and HeLa.

Wherein step h is a purification by immunoaffinity comprising an anti-rhEPO antibody and an eluent.

Wherein the eluent is selected from the group comprising: glycine, acetic acid-NaCl, acetate, citric acid, phosphate, ethanol, isopropanol, dioxane, ethylene glycol, Tris-HCl, and mixtures thereof. Preferably, the eluent is selected from the group comprising: glycine, acetic acid-NaCl. More preferably, the eluent is selected from the group comprising: 0.1M glycine (pH 2); 0.15M glycine (pH 2.5); and 0.2M acetic acid, 0.15M NaCl (pH 3).

Brief description of the drawings

FIG. 1 is a sequence diagram of the steps for obtaining 12 hEPO muteins by site-directed mutagenesis.

FIG. 2. fragments obtained in each PCR reaction were analyzed using agarose gel: a-a fragment obtained from PCR 1; b-fragment obtained from PCR 2.

FIG. 3 in silico analysis of the potential antigenicity of hEPO muteins and unmodified molecules using the IEDB database.

FIG. 4 Western blot confirmed the insertion of a new N-glycosylation site.

FIG. 5 evaluation of the elution ability of rhEPO molecule or its muteins by ELISA sandwich technique:

■ protocol A (elution Capacity after formation of Complex Ag-Ac);

■ protocol B (degree of retention of binding ability to target molecule after treatment of mAb with different eluents).

Figure 6 purification of hEPO mutein Mut104 by immunoaffinity chromatography (IAC) using mAb 2B 2:

complete chromatogram obtained during A-purification of hEPO mutein Mut104

B-enlargement of the elution zone of chromatogram A.

FIG. 7 mutant protein Mut104 purification was assessed by immunoaffinity chromatography (IAC) using 0.15M glycine (pH 2.5) as eluent. Sample preparation: 1-inoculation; 2-flow through; 3-washing 1; 4-washing 2; 5-washing 3; 6-mixture of elution fractions; 7-rhEPO Standard (Zelltek S.A.).

FIG. 8 analysis of the purity of the eluate obtained after immunoaffinity chromatography (IAC) of the hEPO mutein. Sample preparation: 1-a molecular weight marker; 2-rhEPO standard (Zelltek s.a.); 3-eluate Mut45 — 47; 4-eluate Mut 104; 5-eluate 151_ 153.

FIG. 9 determination of apparent molecular weight of hEPO muteins. MM: a molecular mass marker.

FIG. 10 IEF of hEPO mutein purified by immunoaffinity chromatography (IAC). Sample preparation: 1-Mut 45_ 47; 2-Mut 104; 3-rhEPO Standard (Zelltek S.A).

FIG. 11 ECZ electrophoretogram of obtained rhEPO and muteins thereof. A: mut45_ 47; b: mut 104; c: rhEPO. The term "peak" corresponds to each peak assigned in the ECZ electropherogram; the "area" (%) represents the percentage of each isoform calculated by integrating the area under the curve for each peak.

Figure 12-a-. comparison of specific erythropoiesis activities evaluated in vitro for hEPO muteins.

Figure 12-b-. evaluation of erythropoiesis activity in vivo for hEPO muteins. The in vivo erythropoietic activity of the hEPO mutein (Mut) was evaluated in normal red blood cell (normocytic) mice (n-4), which were appropriately treated with the same rhEPO or hEPO Mut, or PBS as control. Following treatment, the percent reticulocytes for each treatment was quantified. P ≦ 0.001 and ns (no significance) represent the degree of statistical significance after ANOVA test y post-ANOVA Tukey test (n ═ 4).

FIG. 13 cell/neuroprotective activity of rhEPO and Mut104 using SH-SY5Y cell culture of neuronal origin. CSTP: a control with Staurosporine (STP) addition; ccel: cell control (no STP or mutein addition). P ≦ 0.05 and p ≦ 0.01 indicate the degree of statistical significance after the ANOVA test y post-ANOVA Dunnet test (n ═ 3).

FIG. 14 schematic of neuronal development in primary hippocampal cultures.

Figure 15 neurite formation was assessed by murine N2a cells. (a) A representative graph for each analysis group; (b) representative graphs obtained by evaluating the following neurite parameters: average length, extension of longest neurites, and average number of neurites per neuron. P ≦ 0.05 and p ≦ 0.01 indicate the statistical significance after ANOVA test y post-ANOVA Bonferroni test (n ═ 3).

Figure 16. primary cultures of rat embryonic hippocampal neurons were used to assess silk foot density. P.ltoreq.0.05 and p.ltoreq.0.01 represent the degree of statistical significance after the ANOVA test y post-ANOVA Bonferroni test (n. 3).

FIG. 17. Primary culture of rat embryonic hippocampal neurons was used to assess synapse formation. P.ltoreq.0.05 and p.ltoreq.0.001 represent the degree of statistical significance after the ANOVA test y post-ANOVA Bonferroni test

FIG. 18 evaluation of the neuroprotective biological activity of hEPO muteins on primary neural cultures cultured in vitro (DIV) for 11 days. In vitro neuroprotective activity of hEPO mutein (Mut) was evaluated in primary hippocampal cultures of Sprague-Dawley rats at 11 DIV. The cultures were optionally treated with equal amounts of rhEPO or the mutein or with PBS as control. Apoptosis was then induced by incubation with Staurosporine (STP). Immunofluorescence was performed with Hoescht and Phalloidin-FITC reagent to analyze the percentage of apoptotic nuclei. P.ltoreq.0.001, p.ltoreq.0.01 and ns (no significance) represent the degree of statistical significance after the ANOVA test y post-ANOVA Bonferroni test.

Detailed Description

As mentioned in the prior art, the aim was to try to devise different strategies to reduce the erythropoietic activity of cytokines, maintaining their neuroprotective and neurotrophic potential, based on the use of chemical modifications to the molecule, or based on the modulation of its glycoside content. However, the prior art has not described the use of glycosylation as a blocking mechanism for the part of the molecule involved in the interaction responsible for erythropoiesis.

Accordingly, the present invention provides a novel modified erythropoietin which solves the problems mentioned in the prior art by simultaneously realizing the following technologies:

inhibition of hEPO hematopoiesis in patients in need of treatment associated with neuroprotection and with erythropoiesis as an adverse effect.

Prolongation of hEPO half-life to improve in vivo biological activity and reduce dosing.

The invention therefore comprises the use of hyperglycosylated muteins derived from hEPO for the preparation of a pharmaceutical composition intended for the prevention or treatment of diseases in which neural remodeling and/or neuroprotection have a beneficial effect, or of a genetic predisposition to suffer from such diseases. The present invention may be administered to a patient suffering from a neurodegenerative disease, such as Alzheimer's Disease (AD), Parkinson's Disease (PD), Amyotrophic Lateral Sclerosis (ALS), etc.; administered to a patient suffering from a motor neuron disorder, such as Huntington's disease, spinocerebellar atrophy, Creutzfeld-Jakob disease, or the like; administration to incapacitating disorders such as depression or schizophrenia; developmental diseases, such as down syndrome; and persons suffering from nerve tissue damage due to cerebrovascular accidents or craniocerebral injuries.

In this context, the term "mutein" refers to a protein that has been modified by site-directed mutagenesis, which involves the substitution of 1 or 2 of its amino acid residues in order to introduce a common potential N-glycosylation site.

The creation or addition of consensus sites for N-glycosylation includes amino acid mutations at sites or regions of the target molecule. For the cell to undergo glycan addition, there must be an Asn-Xaa-Ser/Thr site where Xaa can be any amino acid other than Pro. For this reason, if an Asn residue is present in the site to which the N-glycosylation site is to be added, the amino acid at position +2 (relative to Asn) is mutated to Thr, which has a higher efficacy compared to Ser so that the Asn residue is occupied by a glycan. Alternatively, if the site to be modified has an amino acid at position +2 indicating the presence of Ser or Thr, then that amino acid is mutated to Asn. That is, there is conservative change from time to time.

The present invention describes human erythropoietin with modifications of the amino acid structure such that the following objectives can be achieved:

i. amino acid residues are retained, which constitute key sites for the formation of molecular conformation or neuroprotective/neuroremodelling activity.

Amino acid modifications proposed in the elimination of hematopoietic activity.

Generation of consensus sites for N-glycosylation.

12 hEPO muteins have been constructed. In these muteins, 1 or 2 amino acid modifications were made to incorporate a consensus site for N-glycosylation, thereby abolishing hematopoietic activity, retaining neuroprotective/neuroremodelling activity and obtaining mutants with excellent plasma half-lives.

The assays performed to obtain the molecules of the invention are detailed below. These assays are intended to illustrate the present application and should be understood in their broadest sense and not to limit the scope of the present invention.

Design and acquisition of hEPO derived muteins that abolish erythropoiesis, and preserves neuroprotective/neuroreconstructive effects.

We designed 26 oligonucleotides: of these, 2 were used to amplify the new complete EPO sequence, and the remaining 24 (forward and reverse oligonucleotides) were used to introduce 12 point mutations.

According to the description provided herein, a modification should be construed as a substitution of an amino acid at a given position with another amino acid at the same position. Thus, taking the mutation 1(Lys45 → Asn45) + (Asn47 → Thr47) as an example, it should be interpreted as a change of the lysine residue at position 45 to the asparagine residue at that position; and asparagine at position 47 to threonine.

The strategy for generating hEPO muteins by site-directed mutagenesis is outlined in the scheme shown in figure 1.

Using hEPO DNA as template, the oligonucleotide of each mutant and the oligonucleotide pmato pf (gccgtcaaggccacgtcttgtcca) and pmato (aggccagtttgtgctccaggtaccg) which binds complementarily to the end of the hEPO sequence, a first PCR was performed to introduce each of the above mutations. 24 fragments were obtained, corresponding to 12 hEPO muteins. The nucleotide and amino acid sequences of the 12 synthetic hEPO muteins (muteins) were:

the primers are as follows:

Mut15_17F：GTGCTGGAAAGAAACCTGACGGAAGCCAAA

MUT15_17R：TTTGGCTTCCGTCAGGTTTCTTTCCAGCAC

nucleotide sequence of mutein 15-17 (SEQ ID No.1)

Amino acid sequence of mutein 15-17 (SEQ ID No.2)

Mutein 45-47(Ls45 → Asn45) + (Asn47 → Thr47)

The primers are as follows:

Mut45_47F：CCCGACACCAACGTGACCTTCTACGCC

Mut45_47R：GGCGTGAAGGTCACGTTGGTGTCGGG

nucleotide sequence of mutein 45-47 (SEQ ID No.3)

Amino acid sequence of mutein 45-47 (SEQ ID No.4)

Mutein 49(Tyr49 → Thr49)

The primers are as follows:

Mut49F：AAAGTGAACTTCACCGCCTGGAAGCGG

Mut49R：CCGCTTCCAGGCGGTGAAGTTCACTTT

nucleotide sequence of mutein 49 (SEQ ID No.5)

Amino acid sequence of mutein 49 (SEQ ID No.6)

Mutein 62-64(Glu62 → Asn62) + (Trp64 → THr64)

The primers are as follows:

Mut62_64F：CAGGCTGTGAACGTGACGCAGGGACTG

MUT62_64R：CAGTCCCTGCGTCACGTTCACAGCCTG

nucleotide sequence of mutein 62-64 (SEQ ID No.7)

Amino acid sequence of mutein 62-64 (SEQ ID No.8)

Mutein 65-67(Gln65 → Asn65) + (Leu67 → Thr67)

The primers are as follows:

Mut65_67F：GAAGTGTGGAACGGAACGGCTCTGCTG

MUT65_67R：CAGCAGAGCCGTTCCGTTCCACACTTC

nucleotide sequence of mutein 65-67 (SEQ ID No.9)

Amino acid sequence of mutein 65-67 (SEQ ID No.10)

The primers are as follows:

Mut72_74F：CTGCTGAGCAACGCTACGCTGAGAGGA

MUT72_74R：TCCTCTCAGCGTAGCGTTGCTCAGCAG

nucleotide sequence of mutein 72-74 (SEQ ID No.11)

Amino acid sequence of mutein 72-74 (SEQ ID No.12)

Mutein 76-78(Arg76 → Asn76) + (Gln78 → Thr78)

The primers are as follows:

Mut76_78F：GCTGTGCTGAACGGAACGGCCCTGCTC

MUT76_78R：GAGCAGGGCCGTTCCGTTCAGCACAGC

nucleotide sequence of mutein 76-78 (SEQ ID No.13)

Amino acid sequence of mutein 76-78 (SEQ ID No.14)

Mutein 98-100(Ala98 → Asn98) + (Ser100 → Thr100)

The primers are as follows:

Mut98_100F：GTGGACAAGAATGTGACCGGCCTGAGATCC

MUT98_100R：GGATCTCAGGCCGGTCACATTCTTGTCCAC

nucleotide sequence of mutein 98-100 (SEQ ID No.15)

Amino acid sequence of mutein 98-100 (SEQ ID No.16)

Mutein 104(Ser104 → Asn104)

The primers are as follows:

Mut104F：TCCGGCCTGAGAAACCTGACCACCCTG

MUT104R：CAGGGTGGTCAGGTTTCTCAGGCCGGA

nucleotide sequence of mutein 104 (SEQ ID number 17)

Amino acid sequence of mutein 104 (SEQ ID No.18)

Mutein 106-108(Thr106 → Asn106) + (Leu108 → Thr108)

The primers are as follows:

Mut106_108F：AGATCCCTGAACACCACGCTGAGAGCA

MUT106_108R：TGCTCTCAGCGTGGTGTTCAGGGATCT

the nucleotide sequence of mutein 106-108 (SEQ ID No.19)

Amino acid sequence of mutein 106-108 (SEQ ID number 20)

Mutein 149(Leu149 → Thr149)

The primers are as follows:

Mut149F：TACTCCAACTTCACGCGGGGCAAGCTG

MUT149R：CAGCTTGCCCCGCGTGAAGTTGGAGTA

nucleotide sequence of mutein 149 (SEQ ID No.21)

Amino acid sequence of mutein 149 (SEQ ID No.22)

Mutein 151-153(Gly151 → Asn151) + (Leu153 → THr153)

The primers are as follows:

Mut151_153F：AACTTCCTGCGGAACAAGACGAAGCTGTAC

MUT151_153R：GTACAGCTTCGTCTTCTTCCGCAGGAAGTT

nucleotide sequence of mutein 151-153 (SEQ ID No.23)

Amino group of mutein 151-153Sequence (SEQ ID No.24)

Human EPO sequence

Nucleotide sequence of human EPO (SEQ ID No.25)

Amino acid sequence of human EPO (SEQ ID No.26)

This is shown in figure 2 a. These fragments were used as templates for a second PCR, this time using only oligonucleotides bound to the hEPO ends to obtain the sequences of 12 mutants (fig. 2 b). After the PCR reaction, the product corresponding to the 12 hEPO muteins was digested with the restriction enzymes XbaI/SalI, which flank the hEPO molecule, and cloned into the pLV-PLK vector digested with the same restriction enzymes. Ampicillin was transformed and the first 10 bacteria were selected. 3-4 colonies of each hEPO mutein were amplified in liquid medium for miniprep of plasmid DNA. We then confirmed the presence of the insertion by restriction enzyme digestion of sites present in the hEPO sequence and absent in the vector sequence. Finally, plasmid DNA minipreparations were sequenced to confirm insertion of mutations on the hEPO molecule.

In silico analysis of the potential antigenicity of hEPO muteins

In silico analysis was performed using the IEDB database (immune epitope database and analytical resources) to compare the potential antigenicity of the hEPO muteins with the potential antigenicity of the unmodified molecules. For all, prediction of T epitopes (recognized in major histocompatibility complex class II (MHC II)) was performed by analyzing 8 most representative alleles worldwide (human, HLA-DR: DRB1 × 01.01, DRB1 × 03.01, DRB1 × 04.01, DRB1 × 07.01, DRB1 × 08.01, DRB1 × 11.01, DRB 1.01, DRB1 × 15.01). An antigenic score is obtained for each hEPO variant and each antigenic score is compared to the score obtained for hEPO. Figure 3 schematically summarizes their respective potential antigenic extents. Thus, two muteins with the same degree of antigenicity as hEPO were observed (Mut98_100, Mutl51_153), two muteins likely had higher antigenicity (Mut72_74 and Mut62_64), and 8 muteins likely had lower antigenicity (Mut45_47, Mut49, Mutl5_17, Mut65_67, Mutl49, Mut76_78, Mut104 and Mut106_108), the last two antigenicity being lower.

3. Obtaining a cell line producing said mutein

Lentiviral particles were assembled for subsequent transduction of cho. k1 cells. Thus, HEK 293T/17 cells (packaging cells) were co-transfected with 4 vectors to generate the corresponding lentiviral particles for each of the 12 muteins. The 4 vectors used were: pREV (which induces nuclear export of transfer vector and its packaging); pVSVG (encodes the VSV envelope G protein, is essential for entry of the viral particle into the cell, and has a wide range of tropisms); two days after transfection of HEK 293T/17 cells with pMDL (which encodes matrix and capsid proteins (capable of packaging expression vectors), protease, reverse transcriptase and integrase (required to cleave structural elements and integrate into the cell genome) and the transfer vector pLV-PLK-Mut X (in which all viral genes have been removed and replaced by target genes corresponding to the hEPO muteins of the invention), the supernatant of each cell containing Mut X lentiviral particles was collected and used to transduce cho.k1 cells after 12 cho.k1 Mut X hEPO lines were obtained 72 hours, the supernatant was collected and stored for later characterization. 10% (v/v) DMSO) and stored in a liquid nitrogen tank.

Initially, the concentration was determined by sandwich ELISA technique and antibodies specific for hEPO molecules using cell line cultures obtained by transduction. Monoclonal antibodies were used for capture and rabbit polyclonal antibodies were used for detection (both types of antibodies were developed in our laboratory). The obtained concentrations (shown in table I) were considered sufficient for the study.

In addition, the culture supernatant was analyzed by Western blotting (Western Blot) technique using polyclonal antibodies to detect all hEPO muteins. This approach visualizes muteins that exhibit higher molecular weights than unmodified hEPO, which is consistent with the insertion of a new N-glycosylation site in the molecular structure (fig. 4).

Similarly, isoelectric focusing analysis was performed followed by western blot analysis to study the number of glycoisoforms (glycoisoforms) in each hEPO mutein expressed in cho. k1 cell culture supernatant. The number of isoforms obtained in 11 of the 12 muteins evaluated was higher than that of unmodified hEPO. The isoforms range from 8 to 16 isoforms compared to the 7 isoforms observed in culture supernatants of unmodified hEPO.

The present invention provides hEPO muteins with little or no erythropoietic activity to avoid side effects produced by cytokines when used as potential neuroprotective/neuroremodeling candidates. Therefore, the in vitro activity was studied using TF-1 cells whose proliferation was dependent on the presence of hEPO. To measure erythropoietic activity, proliferation of these cells was assessed 96 hours after stimulation with hEPO standards with well-known biological activity. All of the hEPO muteins developed successfully exhibited reduced or no erythropoietic activity compared to the commercial hEPO standards and unmodified hEPO molecules, except Mut49 (which maintained erythropoietic activity). The results are summarized in table I.

Table i characterization of hepo muteins. The concentration was quantified in the culture supernatants by sandwich ELISA, the number of measured isoforms was evaluated by isoelectric focusing and the in vitro biological activity was determined, expressed as a percentage of unmodified molecules.

NDA: no detectable activity; rhEPO: recombinant human erythropoietin; mut: a mutein.

The present invention provides hEPO muteins comprising a site susceptible to N-glycosylation at a position that does not abrogate the cytoprotective biological activity but abrogates the hematopoietic activity. They were expressed in cho. k1 cell culture supernatants and subsequently characterized. All of them show a higher degree of glycosylation with the aim of including additional N-glycosylation sites to increase their plasma half-life. Also, modifications to the molecule have been shown to have an effect on hematopoietic biological activity, with the hematopoietic biological activity being abolished in most of the muteins and greatly reduced in the remaining muteins.

4. Purification of hEPO-derived muteins by immunoaffinity chromatography

The purification method of the mutant protein of the present invention is given below. To better understand this approach, the following muteins are described below, using an Immunoaffinity (IA) purification scheme as an example: mut45_47, Mut104, Mut 151_ 153. Initially, we simulated a process identical to that occurring in IA stroma, with the aim of determining the most favorable conditions for eluting each of the hyperglycosylated hEPO muteins captured by an anti-rhEPO monoclonal antibody developed for this purpose in our laboratory (scheme a). Based on the above, a sandwich ELISA assay was performed to quantify the proportion of hEPO derivatives that remained bound to mAb 2B2 after subjecting the antigen-antibody complex to each elution condition. Also, in view of future reuse procedures for IA matrices, we evaluated the effect of each elution solution on antibodies to determine if they would affect the binding capacity to hEPO muteins (scheme B).

The following solutions were evaluated for elution ability:

1. glycine 0.1M pH2

2. Glycine 0.15M pH 2.5

3. Acetic acid 0.2M; sodium chloride 0.15M pH 2.5

4. Glycine 0.15M pH 3

5. Citric acid 0.1M pH 3

6. Acetic acid 0.2M, sodium chloride 0.15M pH 3

7. Glycine 0.15M pH 3.5

8. Sodium acetate 0.1M pH 4

9. Sodium acetate 0.1M/dioxane 10% (v/v) pH 4

10. Sodium acetate 0.1M pH 5

11. Sodium phosphate 0.1M pH 6

12. 40% Isopropanol (v/v) in Phosphate Buffered Saline (PBS), pH 7

13.PBS pH 7

40% (v/v) ethanol in PBS, pH 7

10% (v/v) dioxane in PBS, pH 7

40% (v/v) ethylene glycol in PBS, pH 7

17.Tris/HCl 0.1M pH 8

18. Glycine 0.1M pH 9

19. Glycine 0.1M pH 10

20. Glycine 0.1M pH 11

21. Sodium phosphate 0.1M pH 11

22. Sodium phosphate 0.1M pH 11.7.

The resulting absorbance values of the antigen-antibody complexes treated with PBS were considered a control (i.e., no desorption of rhEPO or its muteins), assuming 100% formation of the antigen-antibody complex. For protocol B, the absorbance values obtained for the antibody treated with PBS (prior to formation of the Ag-Ac complex) were considered as a control for the retention of the binding capacity of the antibody to the molecule under investigation. Thus, the results obtained for the remaining test solutions are expressed relative to the control evaluated with PBS (figure 5).

In all cases, the highest antigen desorption capacity was observed for the conditions established by glycine 0.1M pH2 compared to the other solutions. However, the former complex formation ability is significantly reduced after the pretreatment with it. Therefore, the use of such elution in immunoaffinity chromatography is not convenient, as it would affect the reuse of the chromatography matrix.

On the other hand, the assay selects two elution solutions as candidate solutions in immunoaffinity chromatography (IAC): glycine 0.15M pH 2.5 and acetic acid 0.2M, NaCl 0.15M pH 3. Both solutions were able to dissociate the Ag-Ac complexes, strip the target protein (table II), and did not affect the ability of the antibody to bind antigen after pre-treatment with them.

TABLE II elution of hEPO mutein taking into account the selected elution solution

(2) Glycine 0.15M pH 2.5

(6) Acetic acid 0.2M, NaCl 0.15M pH 3

The 2B2 mAb used in IA resin had previously been purified by protein a affinity chromatography and dialyzed against carbonate solution. Resin CNBr-activated Sepharose4B was then coupled. The degree of coupling was calculated by measuring the concentration of immunoglobulin in the solution before and after the immobilization reaction, and the result was 96%. Therefore, the theoretical capacity is 481. mu.g/ml of rhEPO gel.

FIG. 6 shows an exemplary chromatogram for the purification of the mutein Mut104 using a 0.15M glycine elution solution at pH 2.5.

Sandwich ELISA techniques were used to assess the presence of hEPO variants in different fractions (flow through, wash, elution) in each chromatographic procedure to calculate parameters that allow performance of the assay method.

The purification results obtained are shown in Table III. Some differences in target protein recovery efficiency were observed under dynamic conditions compared to static conditions evaluated in the plates. Compared to the solution at pH 3, recovery was higher for muteins Mut104 and Mut 151_153 when eluted with the solution at pH 2.5 (54% vs.19%, 55% vs.21%, respectively), and for the Mut45_47 variant, higher when eluted with the solution at pH 3 (49% vs.34%).

Table iii purification parameters of immunoaffinity chromatography (IAC) of hepo muteins

Sol.I: acetic acid 0.2M; NaCl 0.15M pH 3.0; and sol.ii: glycine 0.15M pH 2.

When analyzing the different stages of the chromatographic process of the mutein Mut104 by SDS-PAGE followed by staining with Coomassie Brilliant Blue dye (FIG. 7), it can be observed that most of the contaminants present in the sample are not retained, but are part of the flow-through and wash-up. Thus, as observed in lane 6 of the figure, high purity was obtained.

Although IAC does not show high recovery of the target protein, it is the most suitable method for purifying hEPO muteins because it can be purified 37-90 fold relative to the starting sample, with very high purity and in a single chromatographic step.

The purity of the eluate corresponding to each hEPO mutein was assessed by densitometry (fig. 8).

Prior to electrophoresis, the samples were concentrated 75-80 fold using a diafiltration cartridge with a cut-off of 10 kDa. All muteins obtained had a purity of more than 89% (table IV), which is a characteristic value of the IA purification procedure.

Purity of the eluate obtained from each immunoaffinity chromatography (IAC)

The IAC result is that the hEPO mutein is very pure, which is considered suitable for the following tests. Thus, IAC is established as a suitable, simple and practical method for purifying the hEPO muteins of the invention.

Physicochemical characterization of hEPO muteins

5.1. Determination of apparent molecular masses of different hEPO muteins

FIG. 9 shows a Western blot of a mutein purified by immunoaffinity chromatography (IAC). The molecular mass of such muteins is calculated using known molecular mass markers.

The determination of the apparent molecular mass of the hyperglycosylated mutein of hEPO is carried out by inserting the migration distance of the leading and trailing ends of the band corresponding to each variant in the curve of the change in migration distance per marker according to the logarithm of the molecular mass per marker. The apparent molecular masses calculated for each variant are summarized below:

*Mut 45_47:34-66kDa

*Mut 104:29-66kDa

*Mut 151_153:35-45kDa

*rhEPO:31-43kDa

this assay confirms the successful incorporation of additional N-glycosylation sites into the hEPO molecule, as the muteins exhibited an average molecular mass greater than that of the unmodified hEPO.

5.2. Determination of isomorphic spectra by IEF

To assess the degree of heterogeneity of hEPO muteins due to glycosylation, in particular the content of sialic acid residues, samples were evaluated by IEF to determine the isoforms with different pI that make up each hEPO hyperglycosylated variant.

FIG. 10 shows the determination of 13 isoforms constituting the Mut45_47 variant, 14 isoforms of the Mut104 variant and 6 isoforms of standard rhEPO. It is worth mentioning that the rhEPO standard is a hormone produced as a biotherapy for promoting erythropoiesis, in which the most acidic isoforms of the hEPO molecule are prevalent, which are obtained after the purification process formed in the 4 chromatographic steps. In addition, it can be seen that the muteins Mut45_47 and Mut104 contain 5-7 more acidic isoforms than the rhEPO isoform, reflecting a higher sialic acid content in these molecules.

The data obtained in the apparent molecular mass measurement and the data from IEF confirm that the resulting mutein has a higher degree of glycosylation compared to rhEPO.

5.3. Isotype profile analysis by Capillary Zone Electrophoresis (CZE) of IAC purified hEPO muteins

CZE was also used to determine the isoform of each hEPO variant considered as an application example. Samples obtained from the IAC purification of hEPO mutein, diafiltered with water and concentrated to about 1mg/ml, were processed.

CZE provides quantitative information of the different isoforms observed. Thus, using CZE data, for each hEPO variant, an isoform was assigned to each observed peak. From 1 to 11 for Mutins Mut45_47 and Mut104, and from 1 to 7 for rhEPO standard; isoform 1 is the isoform that migrates most along the capillary zone (fig. 11). Next, the percentage of each isoform is calculated by integrating the area under the curve for each peak.

When comparing the electrophoretic mobility of each variant with the isoforms of rhEPO, the latter isoforms were found to be consistent with isoforms 1 to 7 of Mut45_47 and isoforms 3 to 9 of Mut104, indicating that Mut45_47 has 4 more acidic isoforms than rhEPO, whereas Mut104 has 2 less acidic isoforms and 2 more acidic isoforms than rhEPO.

When the ratio of each isoform was evaluated, it was found that rhEPO has a higher ratio of isoforms 3, 4 and 5, Mut45_47 has a higher ratio of isoforms 6, 7,8 and 9, and Mut104 has a higher ratio of isoforms 4,5, 6 and 7. This again confirms the heterogeneity of the degree of glycosylation of each hEPO variant relative to rhEPO, due to the higher content of more acidic isoforms and their greater ratio.

When looking at the electropherogram for each hEPO variant, the presence of two additional peaks (two more isoforms) can be seen in both cases, one before peak 1 and the other before peak 11, which cannot be resolved accurately. This is due to the low ratio of such isoforms in the sample, below the detection limit of the system. This explains the difference in the number of isoforms detected by IEF and CZE.

Characterization of the in vitro erythropoietic biological Activity of the muteins

The purified and designed hEPO muteins were biologically characterized. To this end, in vitro proliferation assays were performed using cultures of UT-7 cell lines to assess the erythropoiesis of the muteins that have been used as an example of application showing embodiments (a-F) of the invention, since the survival and proliferation of these cell lineages is dependent on the presence of hEPO in the growth medium. Unlike assays using the TF-1 cell line, assays using the UT-7 cell line are characterized by higher response sensitivity and are therefore selected for this phase of work.

As an example, the culture supernatants of all muteins expressed from the respective production cell lines and the three IAC purified muteins were analyzed. The proliferation produced by these molecules was compared to that produced by the rhEPO standard.

The hEPO muteins (except Mut 49), which have been considered as application examples, showed the ability to produce low or no stimulated cell proliferation when tested at the same concentration as the rhEPO standard (fig. 12-a-). To calculate the specific erythropoiesis stimulating activity (SEA) assessed in vitro, we used higher concentrations of the mutein, i.e. the mutein in the pure culture broth. Thus, muteins Mut104 and Mut 151_153 showed a complete loss of the biological activity of erythropoiesis, while Mut45_47, Mut62_64 and Mut98_100 showed very low erythropoiesis activity (SEAmut 45_ 47-0.2 UI/. mu.g, SEAmut 62_ 64-0.2 UI/. mu.g and SEAmut 98_ 100-0.1 UI/. mu.g; compare with SEA of rhEPO-120 UI/. mu.g). In contrast, Mut49 is believed to retain this activity (SEA 216 UI/. mu.g). Although there was an increase in Mut49 SEA, this was probably due to the region of the curve used to determine this parameter, since the slope of the linear response region of the Mut49 curve is significantly different from the standard curve. Thus, the modifications made to obtain such muteins are considered insufficient to inhibit their erythropoietic activity.

In addition, the in vitro cellular/neuroprotective biological activity of the purified rhEPO muteins was analyzed as an example of the use of the present invention. Evaluation was performed to investigate the cell/neuroprotective activity, the ability of rhEPO and its muteins to protect SH-SY5Y neuronal cells from the apoptotic/cytotoxic effects produced by Staurosporine (STP). Thus, the cell/neuroprotective assay involves protecting neuronal cells by the addition of rhEPO or a mutein thereof 12 hours prior to the induction of cellular damage caused by STP. After the cell damage induction time, the survival of the cultures was assessed by determining metabolically active cells.

In this assay, rhEPO and purified Mut104 (which is considered as an application example of the present invention) were used at the same concentration. (FIG. 13).

To compare each sample to CSTP, the results obtained were statistically analyzed using the ANOVA test followed by the Dunnet test. The percentage of cytotoxicity obtained by CSTP was considered to be 100% cytotoxicity, and therefore, the cytotoxicity value determined for each sample was calculated relative to CSTP.

As shown in fig. 13, rhEPO was able to reduce STP-induced cytotoxicity by 45% (p <0.05), while Mut104 significantly reduced STP-induced cytotoxicity by 65% with a degree of significance of 99% (p < 0.01).

Characterization of the in vivo erythropoietic biological Activity of the muteins

The muteins used as examples of applications have no or almost no in vitro biological activity. In turn, extensive glycosylation confers the pharmacokinetic properties necessary to increase the residence time in the blood. These properties will allow the molecule to improve the low capacity for interaction with the receptor and to exhibit erythropoietic activity.

To evaluate this in vivo activity, mice with normal erythrocytes were injected with rhEPO as a standard, or with each of the three muteins used in the previous examples, or with PBS as a negative control. In all cases corresponding to protein inoculation (protein inoculation), a protein mass equivalent to 80IU of rhEPO was used. Blood was collected 96 hours after inoculation and the percent content of thiazole orange-labeled reticulocytes was determined using flow cytometry.

Figure 12-b-shows significantly different responses (p <0.001) for each mutein and negative control relative to rhEPO. In addition, no significant difference was observed when the reticulocyte response produced by each mutein was compared to the negative control. Both types of analysis confirmed that the loss of erythropoietic activity of the expected muteins resulted from N-glycoengineering by the hyperglycosylation method.

Use of hEPO hyperglycosylated muteins in the reconstruction of structural neurons

5.5.1. Neuronal development (differentiation) and structural remodeling

Structural neuronal remodeling includes processes that stimulate or promote neuronal development and/or differentiation. In this sense, chemical agents or compounds that promote neurite formation and/or axonal growth, development of filamenta/dendritic spines, and/or an increase in the number of synapses would be considered neurotrophic compounds. Primary cultures of neurons and neuronal cell lines have been widely used for in vitro studies of such processes.

Figure 14 summarizes the stage of neuronal development in hippocampal primary cultures. These phases have been correctly characterized in the work of Dotti et al (1998) in which it is described that after inoculation, neurons develop a thin layer (lamelae) whereby they adhere to the substrate (0DIV, days of in vitro culture). Then, on the first two days (1-2DIV), immature neurites develop as the plasma membrane extends. In 2-3DIV, one of these neurites extends beyond the rest and differentiates to form an axon that has a triangular structure at its end called the axon growth cone. Thereafter, the neurite branches form secondary neurites (3-4 DIV). Thin cytoplasmic processes are formed on these neurites, these processes comprising cross-linked actin filaments (4-5DIV), known as the filament foot. The silk foot can then lead to dendritic spines, which are the preferential sites for synapse to occur (7-21 DIV).

This part of the study evaluated the neurotrophic effects of the different hEPO hyperglycosylated muteins of the invention at different stages of neuronal development.

5.5.2. Formation of neurites

To determine whether the muteins of the present invention produced a neurite outgrowth effect (increased number and length of each neuronal neurite), the N2a neuronal cell line (mouse neuroblastoma) was used. Cells (50,000) were seeded on glass in culture plates (24 wells) and stored in DMEM complete medium supplemented with 20% (V/V) Fetal Bovine Serum (FBS) inhibiting neuronal differentiation and gentamicin as an antibiotic. Then, the medium was replaced with a medium containing no FBS and supplemented with different concentrations (50 and 300ng/ml) of rhEPO or the mutein for 3 hours to induce neurite outgrowth [32 ]. After that, the cells were fixed with Phosphate Buffered Saline (PBS) with 4% sucrose and 4% Paraformaldehyde (PFA) at 4 ℃ for 10 minutes and permeabilized with PBS containing 0.1% (V/V) Triton X-100 for 2 minutes. The fixed cells were then blocked with PBS containing 3% (W/V) Bovine Serum Albumin (BSA) for 1-2 hours and neurites were labeled with 1% (W/V) BSA containing mouse anti-a-tubulin IgG monoclonal antibody (1: 1000, Sigma) at 4 ℃ for 16 hours. The following day, after washing 3 times with PBS, it was incubated with rhodamine conjugated phalloidin (1: 1000, Invitrogen) to label actin filaments and with Alexa 488 conjugated goat anti-mouse antibody (1: 1000, Invitrogen) for 1 hour at room temperature. After washing 3 times with cold PBS for 5 minutes, the glass was blocked with Fluorosave (Calbiochem).

To quantify neurite outgrowth, images were acquired with a Nikon TE2000 epifluorescence microscope (Nikon). Quantification was performed by counting the number of neurites in at least 30 neurons per condition and their average length (extension of neurites) and the length of the longest neurites (axon growth) using the NeuroJ plug-in of Image J (NIH) software. Representative images were then processed using Adobe Photoshop and statistically analyzed using GraphPadPrism 5 software.

Figure 15-a-shows a representative image for each study group. The statistical analysis of each measurement is detailed on the right. The muteins of the present invention have a significant dose-dependent neurogenic effect, which is manifested by an increase in the number of neurites per neuron, elongation of neurites and axonal growth. These effects were comparable, similar to the values obtained for rhEPO. In other words, the muteins of the invention showed similar neurotrophic effects to those observed for rhEPO in the N2a cell line.

5.5.3. Density of silk foot

The filamenta and dendritic spines are membrane processes rich in actin filaments, which occur in neurites/dendrites and act as postsynaptic compartments, very abundant in excitatory synapses in the central nervous system. The morphology of the spines is variable and is classified according to their differential structure. It is well recognized that dendritic spines can alter their shape/structure during neuronal development, facilitating neuronal reconstruction [33 ]. In this sense, certain neurodegenerative diseases are associated with changes (both increases and decreases) in the shape and number of dendritic spines. For example, in Down syndrome, a substantial reduction in the number of silk feet was identified [34 ]. In contrast, a greater number of spines were found in autism spectrum disorders [35 ].

Thus, the ability of the hyperglycosylated muteins of the invention to induce neuronal remodeling was determined by promoting the formation of silk feet. We used primary cultures of hippocampal neurons exposed to different concentrations (50 and 300ng/ml) of rhEPO or the muteins Mut104, Mut 45-47 and Mut 151-1534 days (4 DIV).

Neuronal cultures were prepared from rat embryonic hippocampus (E19) as previously described [36 ]. Briefly, tissues were treated with trypsin-EDTA (0.25% (W/V)) at 37 ℃ for 15 minutes. A fully dispersed cell solution was prepared in Neurobasal Medium (NB, Invitrogen) supplemented with 2mM glutamine, 100 units/ml Penicillin (PEN), 100. mu.g/ml streptomycin (Strp) and 10% (V/V) horse serum. Cells in an amount of 20,000-30,000 were seeded into 24-well culture plates previously treated with 0.1mg/ml poly-L-lysine hydrobromide (Sigma) and 20mg/ml laminin (Invitrogen). After 2 hours, the medium was changed to the indicated medium (NB containing 1g/1 ovalbumin, N2 and B27, which are serum free supplements to Invitrogen) and different concentrations (50 and 300ng/ml) of rhEPO or the mutein of the invention were added, maintaining 4 DIV. The cells were fixed with 4% (W/V) PFA, 4% (W/V) sucrose in PBS at 4 ℃ for 10 minutes. Then, the cells were permeabilized with PBS containing 0.1% (V/V) Triton X-100 for 2 minutes. The fixed cells were then blocked with 3% (W/V) Bovine Serum Albumin (BSA) PBS for 1-2 hours and incubated with 1% (W/V) BSA containing mouse anti-a-tubulin IgG monoclonal antibody (1: 1000, Sigma) at 4 ℃ for 16 hours to label neurites. The following day, after washing 3 times with PBS, it was incubated with rhodamine conjugated phalloidin (1: 1000, Invitrogen) to label actin filaments and with Alexa 488 conjugated goat anti-mouse secondary antibody (1: 1000, Invitrogen) for 1 hour at room temperature. After washing 3 times with cold PBS for 5 minutes, the glass was blocked with Fluorosave (Calbiochem).

To quantify the formation of silk feet, images were taken with a Nikon E600 epi-fluorescence microscope (Nikon). Quantification was performed by counting the number of filamentaria (actin-rich processes protruding from the neurite membrane) present in 20 μm neurites less than 50 μm from the neuronal soma (3 neurites/neuron out of at least 30 neurons). Representative images were then processed using Adobe Photoshop and statistically analyzed using GraphPadPrism 5 software.

Fig. 16 (left panel) shows a representative image of silk foot density, while the right panel details the statistical analysis of each group. Note that the muteins of the present invention significantly induced the formation of silk feet depending on the dose, compared to control neurons (PBS). Unexpectedly, these effects were still superior to those observed for neurons treated with rhEPO. In summary, the muteins of the invention show a better neurotrophic effect in primary cultures of hippocampal neurons than was observed with rhEPO.

5.5.3. Synapse

Synapses are defined as specific contiguous associations (associations) of membranes between two neurons. This association, known as the synaptic cleft, facilitates the conduction of electrical impulses and the transfer of substances from one association (presynaptic) to another (postsynaptic). Different techniques have been developed to quantify the number of synapses. Thus, a well-established definition of synapses is the coexistence of protein clusters from only the presynaptic compartment and protein clusters from only the postsynaptic compartment.

The neurotrophins of the invention were further investigated for their neurotrophic effects and evaluated for their ability to induce neuronal synapses.

For this purpose, immunodetection assays were performed in 15DIV primary neuronal cultures, where synapse formation was detected by overlapping presynaptic and postsynaptic markers.

Shortly, hEPO muteins were used at different concentrations (50 and 300ng/ml)rhEPO or PBS treated neurons (15,000/well) 15 DIV. Then using 90% (V/V) methanol and 10% (V/V) MES (100mM MES pH 6.9, 1mM EGTA, 1mM MgCl) at 4 deg.C₂) The solution of (2) was fixed for 10 minutes. Thereafter, the column was washed 3 times for 5 minutes with PBS filtered through Tween 20 (0.1% (V/V)). Blocking with a solution of FBS with Triton X-100 (10% FBS (V/V), 0.1% Triton X-100(V/V) in PBS) for 1 hour at room temperature, then incubating it also with a PBS solution containing 3% (W/V) BSA at room temperature for 15 minutes. Both blocking solutions were centrifuged beforehand at maximum speed for 10 minutes. They were then incubated with mouse anti-NMDA-R1 primary antibodies (post-Synaptic marker from Synaptic Systems) and rabbit anti-synaptophysin antibodies (pre-Synaptic marker from Synaptic Systems) at 4 ℃ for 12-16 hours. Both antibodies were prepared in 1% (W/V) PBS-BSA solution and centrifuged at maximum speed for 10 min. After washing 3 times with PBS, it was blocked again with 3% (W/V) BSA (centrifugation for 10 min), 10% (V/V) FBS solution, Triton X-1000.1% (V/V) PBS for 1 hour at room temperature. They were then incubated with Alexa 647-conjugated anti-mouse secondary antibodies and Alexa 568-conjugated anti-rabbit antibodies (prepared in 1% (W/V) BSA and centrifuged at maximum speed for 10 min, both from Molecular Probes). They were then mounted with fluorosave.

Photographs were taken with an Olympus FV1000 confocal microscope associated with an Olympus IX81 inverted microscope. Images were processed sequentially using FluoView software (version 3.3, Olympus; 60X objective; AN 1.42; 0.066 μm/pixel resolution) conforming to the Nyquist standard.

Synapse formation was measured by co-located sites in a 25 μm dendritic tissue between pre-and post-synaptic markers, approximately 10 to 20 neurons per condition, using 3 segments per neuron. These co-localization sites were determined using the punch analyzer Image J plug-in (version 1.28 u)) [37 ].

Figure 17 shows representative photographs of each test condition and its corresponding quantification. As with neurite outgrowth and induction of filamentarity, we observed that the muteins significantly induced the formation of new synapses in neuronal cultures. This effect is similar to that observed for rhEPO.

In view of the above data, there is strong experimental evidence that the novel hyperglycosylated hEPO muteins of the present invention have a neuronal remodeling promoting effect at different stages of neuronal development/differentiation (from neurite formation to synapse formation). Moreover, these effects are comparable to those observed with EPO, and in certain specific cases, the effects (filamentogenesis) are even greater. These surprising and novel technical effects and the innovative technical features of the present invention make the muteins of the present invention very suitable for use in therapy in which neuronal remodelling is reduced or in which there is a genetic susceptibility to such a reduction.

Study of neuroprotective biological Activity of rhEPO mutein in rat hippocampal neuronal primary cultures.

Evaluation of the anti-apoptotic effects of hEPO muteins on primary cultures of hippocampal neurons enabled us to study the effect of these compounds on metabolically invariant (same as established cell lines) cells. For this reason, an interesting model is constructed, since it is actually more similar to what happens to the brain in vivo.

The neuroprotective activity of hEPO and the modified erythropoietin of the present invention was evaluated as the ability of such molecules to protect neuronal cells from apoptotic stimuli induced by staurosporine treatment.

To assess this in vitro activity, primary cultures of hippocampal neurons from Sprague-Dawley rats were obtained. 11DIV cultures were pretreated for 24 hours with 400ng/ml of the hEPO muteins of the present invention or with 400ng/ml of rhEPO commonly used in hematopoietic recovery therapy. Thereafter, cells were exposed to 30nM STP in the presence of the molecule for 24 hours, and finally fixed and stained with Hoechst fluorochrome and Phalloidin-FITC.

Figure 18 shows that treatment with different molecules significantly reduced apoptosis compared to cell death controls (cells treated with STP alone) (. p < 0.01;. p <0.001), reaching apoptosis values similar to those of cell controls without STP. In addition, most of the molecules of the present invention showed superior effects to rhEPO with respect to protecting primary cultures of hippocampal neurons from STP.

This result also corresponds to the results obtained in the study of the neuroprotective activity of the mutein against SH-SY5Y neuronal cultures. Thus, the molecules of the invention obtained by adding additional glycosylation sites allow blocking of their haematopoietic biological activity without modifying the sites involved in neuroprotection.

Bibliography

[1]J.W.Fisher.Exp Biol Med(Maywood)228(2003)1-14.

[2]C.Lacombe,P.Mayeux.Nephrol Dial Transplant 14Suppl 2(1999)22-28.

[3]U.Hammerling,R.Kroon,T.Wilhelmsen,L.Sjodin,J.Pharm Biomed Anal 14(1996)1455-1469.

[4]H.Sasaki,B.Bothner,A.Dell,M.Fukuda.J Biol Chem 262(1987)12059-12076.

[5]E.Tsuda,M.Goto,A.Murakami,K.Akai,M.Ueda,G.Kawanishi,N.Takahashi,R.Sasaki,H.Chiba,H.Ishihara,et al.Biochemistry 27(1988)5646-5654.

[6]J.C.Egrie,J.K.Browne.Br J Cancer 84 Suppl 1(2001)3-10.

[7]A.J.Sytkowski,L.Feldman,D.J.Zurbuch,Biochem Biophys Res Commun 176(1991)698-704.

[8]E.Delorme,T.Lorenzini,J.Giffin,F.Martin,F.Jacobsen,T.Boone,S.Elliott.Biochemistry 31(1992)9871-9876.

[9]T.Toyoda,T.Arakawa,H.Yamaguchi.J Biochem 131(2002)511-515.

[10]Nangaku,M.Kidney International(2013)84,427-429.

[11]T Ng,G Marx,T Littlewood,I Macdougall.Postgrad Med J(2003)79:367-376

[12]N.Debeljak,A.J.Sytkowski,Erythropoietin:new approaches to improved molecular designs and therapeutic alternatives.Curr Pharm Des 14(2008)1302-1310.

[13]Noguchi,C.T.,Asavaritikrai,P.,Teng,R.,and Jia,Y.(2007).Role of erythropoietin in the brain.Crit Rev Oncol Hematol 64,159-171.

[14]P.a.Konstantinopoulos,M.V.Karamouzis,A.G.Papavassiliou.Biochim.Biophys.Acta 1776(2007)1-9.

[15]Siren,A.L.y Ehrenreich,H.Eur.Arch.Psychiatry Clin.Neurosci.(2001)251(4):179-184.

[16]Neurodegenerative disorders,Public health-European commission.http://ec.europa.eu/health/maj or chronic diseases/diseases/brain neurological/index en.htm

[17]Policy Brief:The Global Impact of Dementia 2013-2050-The Global voice on Dementia.Alzheimer's disease International.http://www.alz.co.uk/research/G8-policy-brief.

[18]NIH meeting advances Alzheimer's research agenda.Fogarty International Center.Advancing Science for Global Health.http://www.fic.nih.gov/news/globalhealthmatters/march-april-2015 pages/nih-alzheimers-research-summit.aspx

[19]Toledo Atucha,J.Alzheimer.Real Invest Demenc.(2011),47:16-23.

[20]Mawadda Alnaeeli,LiWang,Barbora Piknova,Heather Rogers,Xiaoxia Li,and Constance Tom Noguchi.Anatomy Research International.Volume 2012,Article ID 953264,15 pages

[21]Masuda,S.y col.J.Biol.Chem.(1993)268(15):11208-11216.

[22]Wolf y col.Thromb Haemost(1997),77:1020 1024.

[23]P.J.Stohlawetz,L.Dzirlo,N.Hergovich,E.Lackner,C.Mensik,H.G.Eichler,E.Kabrna,K.Geissler,B.Jilma.Blood 95(2000)2983-2989.

[24]Cases A y col.Kidney Internacional(1992),42:668-672.

[25]Beguin Y.,Haematologica(1999),84:541-547.

[26]M.Leist,P.Ghezzi,G.Grasso,R.Bianchi,P.Villa,M.Fratelli,C.Savino,M.Bianchi,J.Nielsen,J.Gerwien,P.Kallunki,A.K.Larsen,L.Helboe,S.Christensen,L.O.Pedersen,M.Nielsen,L.Torup,T.Sager,A.Sfacteria,S.Erbayraktar,Z.Erbayraktar,N.Gokmen,O.Yilmaz,C.Cerami-Hand,Q.W.Xie,T.Coleman,A.Cerami,M.Brines.Science 305(2004)239-242.

[27]T.Mennini,M.De Paola,P.Bigini,C.Mastrotto,E.Fumagalli,S.Barbera,M.Mengozzi,B.Viviani,E.Corsini,M.Marinovich,L.Torup,J.Van Beek,M.Leist,M.Brines,A.Cerami,P.Ghezzi.Mol.Med.12(2006)153-160.

[28]Siren,A.L.y col.Neurotherapeutics(2009),6(1):108-127.

[29]Erbayraktar,S.y col.Proc.Natl.Acad.Sci.(2003),USA 100:6741-6746.

[30]M.Mattio,N.Ceaglio,M.Oggero,N.Perotti,I.Amadeo,G.Orozco,G.Forno,R.Kratje,M.Etcheverrigaray.Biotechnol Prog 27(2011)1018-1028.

[31]Dotti CG,Sullivan CA,Banker GA.1988.J Neurosci(1988)8:1454-1468.

[32]Das KP,Freudenrich TM,Mundy WR.Neurotoxicol Teratol(2004)26:397-406.

[33]Rochefort NL,Konnerth A.EMBO Rep.(2012)Aug；13(8):699-708.DOI:10.1038/embor.2012.102.

[34]Suetsugu M,Mehraein P.Acta Neuropathol.(1980)50(3):207-10.

[35]Hutsler JJ1,Zhang H.Brain Res.(2010)Jan 14；1309:83-94.DOI:10.1016/j.brainres.2009.09.120.

[36]Alfonso J.,Fernandez M.E.,Cooper B.,Flugge G.and Frasch A.C.Proc.Natl Acad.Sci.(2005)USA 102,17196-17201.

[37]Ippolito,D.M.,Eroglu,C.,Journal of Visualized Experiments.(2010)Exp.45:2270.DOI:10.3791/2270.

Sequence listing

<110> Liltorrel national university (Universal Nacional del Litoral)

The national Committee for research on science and technology (Consejo Nacional De investigionions cis Y Tecnicas (CONICET))

Santa Martin national university (Universal Nacional De General San Martin)

<120> modified human erythropoietin

<130> -

<160> 26

<170> Patent In version 3.5

<210> 1

<211> 579

<212> DNA

<213> DNA mutant 15_17

<400> 1

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agaaacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 2

<211> 193

<212> PRT

<213> AA-mutant 15_17

<400> 2

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Asn Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 3

<211> 579

<212> DNA

<213> DNA mutant 45_47

<400> 3

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaacgtga ccttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 4

<211> 193

<212> PRT

<213> AA-mutant 45_47

<400> 4

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Asn Val Thr Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 5

<211> 579

<212> DNA

<213> DNA mutant 49

<400> 5

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttcaccgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 6

<211> 193

<212> PRT

<213> AA-mutant 49

<400> 6

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Thr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 7

<211> 579

<212> DNA

<213> DNA-mutant 62_64

<400> 7

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtgaacgtg acgcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 8

<211> 193

<212> PRT

<213> AA-mutant 62_64

<400> 8

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Asn Val Thr Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 9

<211> 579

<212> DNA

<213> DNA-mutant 65_67

<400> 9

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggaacggaa cggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 10

<211> 193

<212> PRT

<213> AA-mutant 65_67

<400> 10

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Asn Gly Thr Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 11

<211> 579

<212> DNA

<213> DNA-mutant 72_74

<400> 11

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcaacgct 300

acgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 12

<211> 193

<212> PRT

<213> AA-mutant 72_74

<400> 12

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Asn Ala Thr Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 13

<211> 579

<212> DNA

<213> DNA-mutant 76_78

<400> 13

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgaacg gaacggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 14

<211> 193

<212> PRT

<213> AA-mutant 76_78

<400> 14

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Asn Gly Thr Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 15

<211> 579

<212> DNA

<213> DNA-mutant 98_100

<400> 15

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca agaatgtgac cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 16

<211> 193

<212> PRT

<213> AA-mutant 98_100

<400> 16

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Asn Val Thr Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 17

<211> 579

<212> DNA

<213> DNA-mutant 104

<400> 17

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga aacctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 18

<211> 193

<212> PRT

<213> AA-mutant 104

<400> 18

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Asn Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 19

<211> 579

<212> DNA

<213> DNA-mutant 106_108

<400> 19

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgaaca ccacgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 20

<211> 193

<212> PRT

<213> AA-mutant 106_108

<400> 20

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Asn Thr Thr Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 21

<211> 579

<212> DNA

<213> DNA-mutant 149

<400> 21

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcacgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 22

<211> 193

<212> PRT

<213> AA-mutant 149

<400> 22

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Thr

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 23

<211> 579

<212> DNA

<213> DNA-mutant 151_153

<400> 23

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gaacaagacg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 24

<211> 193

<212> PRT

<213> AA-mutant 151_153

<400> 24

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Asn Lys Thr Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg

<210> 25

<211> 579

<212> DNA

<213> DNA - hEPO

<400> 25

atgggcgtgc acgaatgtcc tgcttggctg tggctgctgc tgtccctgct gtctctgcct 60

ctgggactgc ctgtgctggg cgctcctcct agactgatct gcgactcccg ggtgctggaa 120

agatacctgc tggaagccaa agaggccgag aacatcacca ccggctgcgc cgagcactgc 180

tccctgaacg agaatatcac cgtgcccgac accaaagtga acttctacgc ctggaagcgg 240

atggaagtgg gccagcaggc tgtggaagtg tggcagggac tggctctgct gagcgaggct 300

gtgctgagag gacaggccct gctcgtgaac tcctcccagc cttgggaacc cctgcagctg 360

cacgtggaca aggctgtgtc cggcctgaga tccctgacca ccctgctgag agcactggga 420

gcccagaaag aggccatctc tccacctgac gccgcctctg ctgctcctct gagaaccatc 480

accgccgaca ccttcagaaa gctgttccgg gtgtactcca acttcctgcg gggcaagctg 540

aagctgtaca ccggcgaggc ttgccggacc ggcgacaga 579

<210> 26

<211> 193

<212> PRT

<213> AA - hEPO

<400> 26

Met Gly Val His Glu Cys Pro Ala Trp Leu Trp Leu Leu Leu Ser Leu

1 5 10 15

Leu Ser Leu Pro Leu Gly Leu Pro Val Leu Gly Ala Pro Pro Arg Leu

20 25 30

Ile Cys Asp Ser Arg Val Leu Glu Arg Tyr Leu Leu Glu Ala Lys Glu

35 40 45

Ala Glu Asn Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn Glu

50 55 60

Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe Tyr Ala Trp Lys Arg

65 70 75 80

Met Glu Val Gly Gln Gln Ala Val Glu Val Trp Gln Gly Leu Ala Leu

85 90 95

Leu Ser Glu Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser Ser

100 105 110

Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp Lys Ala Val Ser Gly

115 120 125

Leu Arg Ser Leu Thr Thr Leu Leu Arg Ala Leu Gly Ala Gln Lys Glu

130 135 140

Ala Ile Ser Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr Ile

145 150 155 160

Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val Tyr Ser Asn Phe Leu

165 170 175

Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu Ala Cys Arg Thr Gly Asp

180 185 190

Arg