Multimers for sequencing and methods for making and analyzing the multimers
阅读说明：本技术 用于测序的多聚体和用于制备并且分析所述多聚体的方法 (Multimers for sequencing and methods for making and analyzing the multimers ) 是由 R·费英格施 于 2019-11-14 设计创作，主要内容包括：一种多聚体,其被配置成允许对至少一个核酸片段进行测序和序列分析,所述多聚体包括多个单元,其中每个单元包括：片段,所述片段包括待测序和分析的靶核酸序列；以及至少一个分隔子,所述至少一个分隔子至少定位在所述片段的一侧处。本文公开了所述多聚体和所述单元的另外的实施例以及用于制备所述单元和所述多聚体的方法以及用于分析所述多聚体和所述单元的序列的方法。(A multimer configured to allow sequencing and sequence analysis of at least one nucleic acid fragment, the multimer comprising a plurality of units, wherein each unit comprises: a fragment comprising a target nucleic acid sequence to be sequenced and analyzed; and at least one separator positioned at least at one side of the segment. Further embodiments of the multimers and the units are disclosed herein, as well as methods for making the units and the multimers and methods for analyzing the sequences of the multimers and the units.)
1. A multimer configured to allow sequencing and sequence analysis of at least one nucleic acid fragment, the multimer comprising a plurality of units, wherein each unit comprises:
a fragment comprising a target nucleic acid sequence to be sequenced and analyzed; and
at least one separator positioned at least at one side of the segment.
2. The multimer of claim 1, wherein at least one separator is positioned at the 5' side of the fragments.
3. The multimer of claim 1, wherein at least one separator is positioned at the 3' side of the fragments.
4. The multimer of claim 1, wherein at least one separator is positioned at the 5 'side of the fragments and at least one separator is positioned at the 3' side of the fragments.
5. The multimer of any of claims 1-4, wherein the separator is an indexer comprising nucleic acid sequences unique to the source of the fragments.
6. The multimer of claim 5, wherein the indexer is divided into a plurality of partial indexers.
7. The multimer of claim 6, wherein at least one partial indexer is attached to one side of the fragment.
8. The multimer of claim 6, wherein at least one partial indexer is attached to one side of the fragment and at least one partial indexer is attached to the other side of the fragment.
9. The multimer of any one of claims 1-4, wherein the separator is an introducer (introducer) comprising a nucleic acid sequence configured to label the ends of the units.
10. The multimer of claim 9, wherein the director is configured to label the 5' end of the unit.
11. The multimer of claim 9, wherein the director is configured to label the 3' end of the unit.
12. The multimer of any one of claims 1-4, wherein the separator is a blocker comprising a nucleic acid sequence configured to label an end of the unit.
13. The multimer of claim 12, wherein the blocking moiety is configured to label the 5' end of the unit.
14. The multimer of claim 12, wherein the blocking moiety is configured to label the 3' end of the unit.
15. The multimer of any one of claims 1-4, wherein one separator is a director comprising a nucleic acid sequence configured to label an end of the unit and the other separator is a blocker comprising a nucleic acid sequence configured to label the other end of the unit.
16. The multimer of claim 15, wherein the director is configured to label the 5 'end of the unit and the blocker is configured to label the 3' end of the unit.
17. The multimer of claim 15, wherein the blocking moiety is configured to label the 5 'end of the unit and the director is configured to label the 3' end of the unit.
18. The multimer of any of claims 1-4, wherein the separator is an identifier that comprises a nucleic acid sequence unique to each copy of the fragment, and wherein the identifier is present in the unit only if at least one other separator other than the identifier is present in the unit.
19. The multimer of claim 18, wherein the identifier is divided into a plurality of partial identifiers.
20. The multimer of claim 19, wherein at least one partial identifier is attached to one side of the fragment.
21. The multimer of claim 19, wherein at least one partial identifier is attached to one side of the fragment and at least one partial identifier is attached to the other side of the fragment.
22. The multimer of any one of claims 1-21, wherein at least some of the units differ in the sequence of their fragments.
23. The multimer of any one of claims 1-21, wherein the units have similar sequences.
Technical Field
The present subject matter relates to nucleic acid sequencing. More specifically, the present subject matter relates to the preparation of nucleic acids for sequencing.
Background
Analysis of a patient's nucleic acid sequence, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequences, enables better diagnosis and the ability to provide specific and better treatment for imparting genetic afflictions. The sequence of the entire genome or target region of an individual can be compared to known sequences of the human genome to find variations that address potential diseases, for example mutations that may cause cancer, genetic diseases such as cystic fibrosis. Understanding and understanding each patient's genetic information about a particular affliction can help prevent adverse events, provide appropriate medication and can promote maximum efficacy of drug prescriptions.
During the last years, the field of nucleic acid sequencing has rapidly developed, enabling relatively rapid sequencing of very long nucleic acid fragments ranging from thousands and even beyond a length of substantially 100,000 base pairs (bp). For example, nanopore sequencing is an advanced nucleic acid sequencing method that provides a short, convenient, and fast method of sequencing libraries of very long nucleic acid fragments. This technique has the potential to provide relatively low cost genotyping, high mobility for testing, and rapid processing of samples capable of displaying results in real time. An exemplary Nanopore sequencing platform is Minion (Oxford Nanopore Technologies Limited, UK), England.
Nanopore sequencing is configured to sequence very long nucleic acid fragments ranging from substantially 1,000-10,000 bp and even longer than substantially 100,000 bp. However, one drawback of nanopore sequencing is accuracy-essentially 90% accuracy. This is of crucial importance in the diagnosis of mutation-based diseases, since mutations in the target sequence cannot be distinguished from errors in sequencing that can be interpreted as mutations in the target sequence. In addition, one of the methods for preparing nucleic acids for nanopore sequencing is to amplify a region of interest (ROI) by Polymerase Chain Reaction (PCR). It is well known in the art that during PCR, errors in the sequence of the PCR product are introduced due to poor proofreading of the polymerase used in PCR. These errors can also be interpreted as mutations in the target sequence. In addition, sequencing is typically performed, for example, for genotyping and diagnostics, on target nucleic acid fragments that are relatively short, ranging from hundreds of base pairs as compared to thousands of base pairs sequenced by nanopore sequencing. This makes nanopore sequencing unsuitable for sequencing short nucleic acid fragments.
Disclosure of Invention
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present subject matter, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
According to one aspect of the inventive subject matter, there is provided a multimer configured to allow sequencing and sequence analysis of at least one nucleic acid fragment, the multimer comprising a plurality of units, wherein each unit comprises: a fragment comprising a target nucleic acid sequence to be sequenced and analyzed; and at least one separator positioned at least at one side of the segment.
According to one embodiment, at least one separator is positioned at the 5' side of the fragment.
According to another embodiment, at least one separator is positioned at the 3' side of the fragment.
According to yet another embodiment, at least one separator is positioned at the 5 'side of the fragment and at least one separator is positioned at the 3' side of the fragment.
According to yet another embodiment, the separator is an indexer comprising nucleic acid sequences unique to the origin of the fragments.
According to a further embodiment, the indexer is divided into a plurality of partial indexers.
According to yet a further embodiment, at least one partial indexer is attached to one side of the segment.
According to still further embodiments, at least one partial indexer is attached to one side of the segment and at least one partial indexer is attached to the other side of the segment.
According to further embodiments, the separator is an introducer (introducer) comprising a nucleic acid sequence configured to label the ends of the unit.
According to yet a further embodiment, the director is configured to mark the 5' end of the cell.
According to still further embodiments, the director is configured to mark the 3' end of the cell.
According to another embodiment, the spacer is a blocker comprising a nucleic acid sequence configured to label an end of the unit.
According to yet another embodiment, the blocker is configured to mark the 5' end of the cell.
According to yet another embodiment, the blocker is configured to mark the 3' end of the cell.
According to further embodiments, one separator is a director comprising a nucleic acid sequence configured to label an end of the unit and the other separator is a blocker comprising a nucleic acid sequence configured to label the other end of the unit.
According to yet further embodiments, the director is configured to mark the 5 'end of the cell and the blocker is configured to mark the 3' end of the cell.
According to still further embodiments, the blocking moiety is configured to mark the 5 'end of the cell and the guiding moiety is configured to mark the 3' end of the cell.
According to a further embodiment, the separator is an identifier comprising a nucleic acid sequence unique to each copy of the fragment, and wherein the identifier is present in the unit only if at least one further separator other than the identifier is present in the unit.
According to yet a further embodiment, the identifier is divided into a plurality of partial identifiers.
According to still further embodiments, at least one partial identifier is attached to one side of the segment.
According to another embodiment, at least one part identifier is attached to one side of the segment and at least one part identifier is attached to the other side of the segment.
According to yet another embodiment, at least some of the units differ in the sequence of their fragments.
According to yet another embodiment, the units have similar sequences.
Drawings
Embodiments are described herein, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the embodiments. In this regard, no attempt is made to show structural details in more detail than is necessary for a fundamental understanding, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.
In the drawings:
FIGS. 1A-K schematically illustrate units of a multimer according to some exemplary embodiments.
FIGS. 2A-B schematically illustrate a forward primer and a reverse primer, respectively, for amplification of fragment 12, according to some exemplary embodiments.
Figures 3A-B schematically illustrate multimers that allow sequencing of short nucleic acid fragments according to some exemplary embodiments.
Detailed Description
Before explaining at least one embodiment in detail, it is to be understood that the subject matter is not limited in its application to the details of construction and the arrangement of the components set forth in the following description or illustrated in the drawings. The inventive subject matter is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting. In the discussion of the various figures described below, like numerals refer to like parts. The drawings are generally not drawn to scale.
Unnecessary elements have been omitted from some of the figures for clarity.
The present subject matter provides a multimer that allows sequencing of short nucleic acid fragments, e.g., hundreds of base pairs in length, by a platform, e.g., a nanopore sequencing platform, configured to sequence long nucleic acid fragments ranging from substantially 1,000-10,000 bp, and even up to 100,000 bp and more.
The present subject matter further provides multimers that allow sequencing of short nucleic acid fragments. Short nucleic acid fragments can be as short as substantially 20 bp, up to several hundred base pairs in length. Multimers allow sequencing of short nucleic acid fragments multiple times by platforms, such as nanopore sequencing platforms, configured to sequence long nucleic acid fragments ranging from substantially 1,000-10,000 bp or nucleic acid fragments longer than substantially 2,000 or up to substantially 100,000 bp and more in length, resulting in accurate sequencing results.
The present subject matter further provides a method for simultaneously sequencing a plurality of different short nucleic acid fragments from different sources, e.g. hundreds of base pairs in length, while allowing identification of the multimer of the source of each fragment based on the obtained sequence, by a platform configured to sequence long nucleic acid fragments in the range of substantially 1,000-10,000 bp and even up to 100,000 bp and more, e.g. a nanopore sequencing platform.
The present subject matter further provides multimers that allow sequencing of short nucleic acid fragments. Short nucleic acid fragments can be as short as substantially 20 bp, up to several hundred base pairs in length. Multimers allow sequencing of short nucleic acid fragments multiple times by platforms, such as nanopore sequencing platforms, configured to sequence long nucleic acid fragments ranging from substantially 1,000-10,000 bp or nucleic acid fragments longer than substantially 2,000 or up to substantially 100,000 bp and more in length, resulting in accurate sequencing results.
The present subject matter additionally provides a multimer that allows to distinguish between mutations in a ROI and errors introduced into the obtained sequence, e.g. due to poor accuracy of the sequencing method and/or errors introduced during amplification of said ROI.
The present subject matter additionally provides a method for preparing multimers that allow sequencing of short nucleic acid fragments. Short nucleic acid fragments can be as short as substantially 20 bp, up to several hundred base pairs in length. Multimers allow sequencing of short nucleic acid fragments by platforms, such as nanopore sequencing platforms, configured to sequence long nucleic acid fragments ranging from about substantially 1,000-10,000 bp or nucleic acid fragments longer than substantially 2,000 or up to substantially 100,000 bp and more in length.
The present subject matter further provides a method for preparing multimers that allow sequencing of short nucleic acid fragments. Short nucleic acid fragments can be as short as substantially 20 bp, up to several hundred base pairs in length. Multimers allow sequencing of short nucleic acid fragments multiple times by platforms, such as nanopore sequencing platforms, configured to sequence long nucleic acid fragments ranging from substantially 1,000-10,000 bp or nucleic acid fragments longer than substantially 2,000 or up to substantially 100,000 bp and more in length, resulting in accurate sequencing results.
The present subject matter additionally provides a method for making a multimer that allows for simultaneous sequencing of multiple different short nucleic acid fragments. Short nucleic acid fragments can be as short as substantially 20 bp, up to several hundred base pairs in length. The multimers allow for the simultaneous sequencing of short nucleic acid fragments from different sources by a platform configured to sequence long nucleic acid fragments ranging from about substantially 1,000-10,000 bp or nucleic acid fragments longer than substantially 2,000 or up to substantially 100,000 bp and more in length, such as a nanopore sequencing platform, while allowing for the identification of the source of each fragment based on the sequence obtained.
The present subject matter additionally provides a method for the preparation of multimers that allow to distinguish between mutations in a ROI and errors introduced into the obtained sequence, e.g. due to poor accuracy of the sequencing method and errors introduced during amplification of said ROI.
The present subject matter further provides a method for analyzing a nucleic acid sequence obtained by sequencing a long nucleic acid fragment, e.g., nanopore sequencing, while distinguishing between mutations in the ROI and errors introduced into the ROI by the method itself, e.g., errors in sequencing and errors introduced during amplification of the ROI.
When sequencing short nucleic acid fragments, the multimers of the inventive subject matter significantly improve the accuracy of nucleic acid sequencing reads. Short nucleic acid fragments can be as short as substantially 20 bp, up to several hundred base pairs in length. The multimers allow sequencing of short nucleic acid fragments from different sources by platforms, such as nanopore sequencing platforms, configured to sequence long nucleic acid fragments ranging from about substantially 1,000-10,000 bp or nucleic acid fragments longer than substantially 2,000 or up to substantially 100,000 bp and more in length. This multimer can then be used, for example, to diagnose genetic variations with high sensitivity and specificity.
According to one embodiment, the multimer comprises a plurality of units. Various exemplary embodiments of the cell are shown in fig. 1A-K.
Here is a brief description of an embodiment of the structure and composition of the unit 1, followed by a detailed description of embodiments of the various compositions of the unit 1.
According to one embodiment, the unit 1 comprises a segment 12 and at least one separator 11 attached to an end of the segment 12. For example, the separator 11 may be attached to the 5' end of the fragment 12, as illustrated in fig. 1A; the separator 11 may be attached to the 3' end of the fragment 12, as illustrated in fig. 1B; the separator 11 may be attached to the 5 'end of the fragment 12, and the separator 11 may be attached to the 3' end of the fragment 12, as illustrated in fig. 1C; more than one separator 11 may be attached to the 5' end of the fragment (not shown); more than one separator 11 may be attached to the 3' end of segment 12 (not shown); more than one separator 11 may be attached to the 5 'end of segment 12, and separator 11 may be attached to the 3' end of segment 12, as illustrated in fig. 1D; the separator 11 may be attached to the 5 'end of the fragment 12 and more than one separator 11 may be attached to the 3' end of the fragment 12, as illustrated in fig. 1E; or more than one separator 11 may be attached to the 5 'end of fragment 12 and more than one separator may be attached to the 3' end of fragment 12, as illustrated in fig. 1F.
According to one embodiment, separator 11 may be indexer 14. According to another embodiment, the separator 11 may be a guide 18. According to yet another embodiment, the divider 11 may be a closure 19. According to further embodiments, any combination of segments 12 with at least one of the three types of spacers 11-indexer 14, guide 18, and sealer 19 described above is within the scope of the present subject matter. According to further embodiments, the separator 11 may be an identifier 16. According to yet further embodiments, the identifier 16 is attached to the segment 12 only when at least one of the separators 11 of another kind, i.e. the indexer 14, the guide 18, the sealer 19 or any combination thereof, is attached to the segment 12. FIGS. 1G and 1H illustrate an exemplary embodiment of a cell 1 that includes a segment 12, an indexer 14, an identifier 16, a director 18, and a sealer 19.
It should be noted that only some of the possible combinations of combinations are shown in the figures due to the large number of optional combinations of segments 12 and other components in unit 1. However, those skilled in the art will also understand embodiments not precisely illustrated in the drawings by reference to the written description and drawings.
According to one embodiment, the fragment 12 is a target nucleic acid sequence desired to be analyzed. This segment 12 may also be referred to as ROI. Any target nucleic acid sequence known in the art is within the scope of the inventive subject matter, e.g., a gene or portion of a gene where mutations are sought for any purpose known in the art, e.g., for diagnosis of a gene-based disease, such as cancer, a genetic disorder, etc., or for research purposes, etc. The segments 12 may be of any desired length. According to one embodiment, fragment 12 is substantially 10-100 bp long. According to another embodiment, fragment 12 is several hundred base pairs long, up to substantially 1,000 bp long. According to some other embodiments, the length of the fragment 12 may be up to substantially 100 bp, or up to substantially 200 bp, or up to substantially 300 bp, or up to substantially 400 bp, or up to substantially 500 bp, or up to substantially 600 bp, or up to substantially 700 bp, or up to substantially 800 bp, or up to substantially 900 bp. According to a preferred embodiment, the length of the fragment 12 may be in the range of substantially 100-500 bp.
As can be appreciated by those skilled in the art, during the preparation of the fragments 12, multiple copies of the fragments 12 are obtained. According to one embodiment, the copies of the fragments 12 are identical, i.e. have the same nucleic acid sequence, in the sample. An example of this embodiment is a sample containing copies of the same target sequence. According to another embodiment, the copies of the fragments 12 are similar, i.e. partially identical, in the sample. An example of this embodiment is a sample containing copies of the same target sequence that differ in some nucleotide respects, for example due to point mutations introduced during amplification of the fragments. Another example is a unit 12 that is partially overlapping, resulting in one or more portions of the sequence of the fragment 12 being the same between copies of the fragment and other portions of the fragment 12 being different between copies of the fragment 12 in the sample. According to yet another embodiment, the copies of the fragments 12 in the sample are different from each other. An example of this embodiment is a sample containing fragments 12 with sequences of different loci in the genome, such as different genes.
Fragment 12 may be obtained by any method and mechanism known in the art. According to one embodiment, the fragments 12 may be obtained by cleaving nucleic acids, e.g., cleaving genomic DNA, total ribonucleic acid (RNA), messenger ribonucleic acid (mRNA), etc. Any type of nucleic acid known in the art is within the scope of the inventive subject matter. According to this embodiment, to prepare the unit 1, at least a portion of the aforementioned constituents, i.e., the indexer 14, the guide 18, and the sealer 19, are attached to the segment 12 by any method known in the art, such as by connecting them to the segment 12, to obtain the embodiments of the unit 1 described herein.
According to another example, fragment 12 may be obtained by any nucleic acid amplification method known in the art, such as PCR, using forward and reverse primers that define the desired sequence of fragment 12, and the like. The amplification stage of fragment 12 may occasionally be referred to hereinafter as "fragment 12 amplification" or "first amplification" because a second amplification stage may be present in the methods described hereinafter. Thus, in the case of amplification of fragment 12 by using two primers, such as PCR, the forward primer for amplification of fragment 12 is specific for the sequence at the 5 'end of fragment 12, and the reverse primer for amplification of fragment 12 is specific for the sequence at the 3' end of fragment 12; or vice versa, i.e., the forward primer used for amplification of fragment 12 is specific for the sequence at the 3 'end of fragment 12 and the reverse primer used for amplification of fragment 12 is specific for the sequence at the 5' end of fragment 12. The template for amplification of fragment 12 may be any template known in the art that may be the source of fragment 12, such as genomic DNA, cDNA libraries, total RNA, messenger RNA (mrna), and the like.
According to one embodiment, indexer 14 is a nucleic acid sequence that is unique to the source of segment 12. In other words, the segments 12 of all units 1 that are obtained from the same source include indexers 14 having the same sequence, while the segments 12 of units 1 that are obtained from different sources include indexers 14 having different sequences. The source may be, for example, the individual from which the fragment 12 was obtained. Thus, indexer 14 is configured to tag the source of segments 12. It should be noted that units 1 comprising segments 12, originating from the same source, and thus comprising the same indexer 14, may comprise the same or similar or different segments 12 as described above, as well as any combination thereof. The length of indexer 14 may be any length that allows each source to be uniquely tagged. For example, indexer 14 is substantially 12 bp in length. It should be noted, however, that this is merely an exemplary length and that any length of indexer 14 is within the scope of the present subject matter. According to further embodiments, indexer 14 can be attached to the 5 'end of segment 12, as illustrated in fig. 1G, or indexer 14 can be attached to the 3' end of segment 12, as illustrated in fig. 1H.
According to one embodiment, indexer 14 may be divided into a plurality of partial indexers 14. According to another embodiment, at least one partial indexer 14 may be attached to one side of segment 12, e.g., to the 5' end of segment 12. According to another embodiment, at least one partial indexer 14 may be attached to another side of the segment 12, such as to the 3' end of the segment 12. According to yet another embodiment, at least one partial indexer 14 can be attached to the 5 'end of the segment 12 and at least one partial indexer 14 can be attached to the 3' end of the segment 12. For example, indexer 14 may be divided into two partial indexers 14, and each partial indexer 14 may be attached to either of the two ends of segment 12. For example, a 12 bp long indexer 14 can be divided into a first partial indexer 14-1 of 6 bp in length and a second partial indexer 14-2 of 6 bp in length. A first portion of indexer 14-1 can be attached to one end of segment 12 and a second portion of indexer 14-2 can be attached to the other end of segment 12. This embodiment is illustrated in FIG. 1I, which shows a first partial indexer 14-1 attached to the 3 'end of segment 12 and a second partial indexer 14-2 attached to the 5' end of segment 12.
According to one embodiment, the identifier 16 is a nucleic acid sequence unique to each copy of the fragment 12. A different identifier 16 sequence is appended to each copy of the fragment 12. Thus, the identifier 16 is configured to tag each copy of the segment 12. In the method described below, unit 1 is amplified, for example by PCR, and in a subsequent stage, the sequence of multiple copies of unit 1 is analyzed. The sequence of the fragment 12 of unit 1, including the same identifier 16, is considered to be amplified from the fragment 12 of the same source or the original target sequence. Thus, as will be discussed below, a distinction can be made between mutations or original target sequences in the original fragment 12 and errors introduced during the procedure. The length of the identifier 16 may be any length that allows each copy of the segment 12 to be uniquely tagged. For example, the length of the identifier 16 is substantially 12 bp. It should be noted, however, that this is merely an exemplary length and that any length of identifier 16 is within the scope of the inventive subject matter.
According to one embodiment, the identifier 16 may be divided into a plurality of partial identifiers 16. According to one embodiment, at least one partial identifier 16 may be attached to one side of the segment 12, for example to the 5' end of the segment 12. According to another embodiment, at least one partial identifier 16 may be attached to another side of the segment 12, for example to the 3' end of the segment 12. According to yet another embodiment, at least one partial identifier 16 may be attached to the 5 'end of the segment 12 and at least one partial identifier 16 may be attached to the 3' end of the segment 12. For example, the identifier 16 may be divided into two partial identifiers 16, and each partial identifier 16 may be attached to either of the two ends of the segment 12. For example, a tag 16 that is 12 bp long may be divided into a first partial tag 16-1 that is 6 bp long and a second partial tag 16-2 that is 6 bp long. The first portion identifier 16-1 may be attached to one end of the segment 12 and the second portion identifier 16-2 may be attached to the other end of the segment 12. This embodiment is illustrated in FIG. 1J, which shows a first partial identifier 16-1 attached to the 3 'end of segment 12 and a second partial identifier 16-2 attached to the 5' end of segment 12. FIG. 1K illustrates another exemplary embodiment of a unit 1 that includes two portion indexers 14 and two portion identifiers 16 attached to both sides of a segment 12 as described above.
According to one embodiment, indexer 14 is attached to one end of segment 12 (not shown). According to another embodiment, the unit 1 includes both an indexer 14 attached to one side of the segment 12 and an identifier 16 attached to the opposite side of the segment 12. As can be seen in fig. 1G, according to one embodiment, an indexer 14 is attached to the 5 'end of the segment 12 and an identifier 16 is attached to the 3' end of the segment 12. As can be seen in fig. 1-H, according to another embodiment, an indexer 14 is attached to the 3 'end of the segment 12 and an identifier 16 is attached to the 5' end of the segment 12. According to further embodiments, both the indexer 14 and the identifier 16 are attached to one side of the segment 12, for example to the 5 'end of the segment 12 or to the 3' end of the segment 12 (not shown).
According to one embodiment, the guide 18 comprises a nucleic acid sequence configured to label the end of the cell 1. According to another embodiment, the blocker 19 includes a nucleic acid sequence configured to tag the end of the cell. The director 18 and the blocker 19 are configured to act as target sequences for binding primers during the amplification process of unit 1. According to another embodiment, the director 18 and the blocker 19 are configured to participate in any other manipulation of the unit 1 during the preparation of the multimer 100. For example, as described in detail below, the guide 18 and the blocker 19 may act as Molecular Inversion Probes (MIPs), also known as Padlocks, in a Rolling Circle Amplification (RCA) protocol. According to yet another embodiment, it is possible to use the director 18 and the blocker 19 during the analysis of the sequence of the multimer 100 to specify the boundaries of the unit 1 and, in addition, the orientation of the fragment 12 in the unit 1, since its positioning relative to the fragment 12 is defined during the preparation of the unit 1 according to some embodiments. Any nucleic acid amplification method known in the art is within the scope of the inventive subject matter. In embodiments where unit 1 comprises a primer 18 and a blocker 19, the primer 18 and blocker 19 are configured to act as target sequences for binding two primers during an amplification process of unit 1 involving the use of two primers, e.g., PCR. For example, in embodiments amplified by PCR, the guide 18 is configured to bind with the forward primer and the blocker 19 is configured to bind with the reverse primer, or vice versa, during the amplification cycle. In addition, in the method described below, the sequence of units 1 attached sequentially to each other is analyzed. Since in some embodiments the guide 18 is positioned at one end of the cell 1 and in other embodiments the guide 18 and the closure 19 are positioned at the opposite end of the cell 1, the guide 18 or the guide 18 and the closure 19 are also configured to indicate the boundary of the sequence of cells 1.
According to one embodiment, the guide 18 may be positioned at either of the two ends of the cell 1-at the 5 'end of the cell 1 or at the 3' end of the cell 1. According to another embodiment, the closure 19 may be positioned at either of the two ends of the cell 1-at the 5 'end of the cell 1 or at the 3' end of the cell 1. According to yet another embodiment, the unit 1 comprises a guide 18 and a closure 19 positioned at opposite ends of the unit 1. According to one embodiment, illustrated in fig. 1G-K, the guide 18 is positioned at the 5 'end of the cell 1, and according to another embodiment the closure 19 is positioned at the 3' end of the cell 1.
According to one embodiment, after obtaining the fragments 12, e.g. by nucleic acid cleavage or by amplification of the fragments 12, the unit 1 is prepared by attaching at least one spacer 11 to the fragments 12 when the at least one spacer 11 may be an indexer 14 or an identifier 16 or a guide 18 or a blocker 19 or any combination thereof according to embodiments described herein. Attaching the at least one spacer 11 to the segment 12 may be by any method known in the art, for example by connecting the at least one spacer 11 to the segment 12 to obtain embodiments of the unit 1 described herein.
According to another embodiment, the attachment of the at least one separator 11 to the fragments 12 is performed during amplification of the fragments 12. According to this embodiment, the one or more primers used to amplify the fragment 12 comprise a tail having the sequence of at least one separator 11, such as an indexer 14 or an identifier 16 or a guide 18 or a blocker 19 or any combination thereof according to embodiments described herein.
FIGS. 2A-B schematically show a forward primer and a reverse primer, respectively, for amplification of fragment 12 using two primers, e.g., PCR, according to an exemplary embodiment. Shown in fig. 2A, the forward primer 20 for amplification of fragment 12 includes a specific Fwd 122 sequence specific to the 5' end of fragment 12, an indexer 14 sequence tail attached to the 5' end of the specific Fwd 122 sequence, and a leader 18 sequence tail attached to the 5' end of the indexer 14 sequence. Shown in fig. 2B, the reverse primer 30 for amplification of fragment 12 includes a specific Rev 124 sequence specific to the 3' end of fragment 12, a tag 16 sequence tail attached to the 3' end of the specific Rev 124 sequence, and a blocker 19 sequence tail attached to the 3' end of the tag 16 sequence. Those skilled in the art will recognize that the primers shown in FIGS. 2A-B, following amplification of fragment 12, produce an embodiment of Unit 1 shown in FIG. 1G. This is merely an exemplary embodiment. To obtain further embodiments of unit 1, such as those shown in FIGS. 1H-K, the primers used for amplification of fragment 12 are arranged accordingly as would be recognized by one skilled in the art.
The length ranges of the specific Fwd 122 sequence and the specific Rev 124 sequence are specified in FIGS. 2A-B to be in the range of substantially 20-25 bp. It should be noted that this range of lengths for the specific Fwd 122 sequence and the specific Rev 124 sequence is merely exemplary, and any length of the specific Fwd 122 sequence and the specific Rev 124 sequence is within the scope of the inventive subject matter. Similarly, it should be noted that the sequence of indexer 14, identifier 16, guide 18, and closure 19 shown in FIGS. 2A-B is merely exemplary, and that indexer 14, identifier 16, guide 18, and closure 19 may have any sequence of any length. In addition, the arrangement of the indexer 14, identifier 16, leader 18, and blocker 19 sequences in the forward 20 and reverse 30 primers is exemplary only. Any arrangement and existence of these elements (indexer 14, identifier 16, leader 18, and closure 19) and any type of division of either indexer 14 or identifier 16 or both indexer 14 and identifier 16 into multiple parts is within the scope of the present subject matter, e.g., according to embodiments described herein.
According to one embodiment, with respect to the fragment 12 produced by amplification of a certain sequence, the fragment 12 amplification includes a small number of amplification cycles to avoid mis-mutations in the fragment 12 due to proof-reading errors of the DNA polymerase used for the amplification of the fragment 12. Any number of cycles of amplification of fragment 12 that produces sufficient amounts of amplicon to serve as a template for amplification of unit 1 on the one hand, while minimizing the amount of mis-mutations introduced by the DNA polymerase on the other hand, is within the scope of the inventive subject matter. An exemplary number of cycles of amplification of fragment 12 is essentially 3-5 cycles. However, it should be noted that this number of cycles of amplification of fragment 12 should not be considered as limiting the scope of the inventive subject matter.
According to one embodiment, unit 1, prepared by any method known in the art, e.g., according to the above-described examples-nucleic acid cleavage and ligation, fragment 12 amplification and ligation, and fragment 12 amplification using primers containing tails as described above, is amplified.
According to one embodiment, the forward primer used in the amplification of unit 1 is specific for the leader 18 and the reverse primer used in the amplification of unit 1 is specific for the blocker 19. It should be noted that in this example, the forward and reverse primers amplified in unit 1 do not include the indexer 14 and identifier 16 sequences. Thus, the sequences of indexer 14 and identifier 16 contained in unit 1 are amplified by the DNA polymerase used in the amplification of unit 1. Thus, unit 1 amplification is configured to amplify previously prepared unit 1. According to another embodiment, the primers used for unit 1 amplification, whether forward or reverse, can comprise at least a portion of the indexer 14. According to yet another embodiment, the forward primer for unit 1 amplification can comprise a portion of indexer 14 and the reverse primer for unit 1 amplification can comprise a portion of indexer 14.
According to one embodiment, with respect to fragments 12 that are linked to each other during preparation of multimer 100, amplified unit 1 is double-stranded DNA. According to another embodiment, the 5' end of each strand of unit 1 is phosphorylated. Any method for phosphorylating the 5' end of the strand of unit 1 is within the scope of the subject matter of the present invention. For example, the 5 'end of the amplified unit 1 may be phosphorylated with an enzyme configured to add a phosphate group to the 5' end of the DNA strand. Another example is a primer amplified using Unit 1 that is phosphorylated at its 5' end.
Multimers are prepared by linking units 1 to each other that allow sequencing of short nucleic acid fragments, e.g., in the range of substantially 100-.
FIGS. 3A-B schematically show multimers that allow sequencing of short nucleic acid fragments according to exemplary embodiments. This multimer is designated hereinafter as "multimer 100". According to one embodiment shown in fig. 3A, multimer 100 includes multiple units 1 when at least some of units 1 differ in the sequence of fragments 12. In this embodiment, at least one of the separators 11 of the unit 1 may be similar or different. These different units are shown in fig. 3A as unit 1, unit 2, unit 3, etc., up to unit N. The units 1 may be in any orientation relative to each other. The length of multimer 100 is a length suitable for sequencing by a sequencing method configured to sequence long nucleic acid sequences, such as nanopore sequencing. Thus, for example, multimer 100 can be in the range of substantially 1,000-10,000 bp in length, and even up to substantially 100,000 bp and more. The units 1 may be attached to each other sequentially by any method known in the art, such as connection.
An exemplary connection procedure for attaching the units 1 to each other sequentially is referred to as "super-connection" hereinafter. The superligation method as known in the art uses a terminal repair enzyme to convert unit 1 into 5' phosphorylated flush terminal unit 1. The 5' phosphorylated flush end unit 1 is then ligated, for example by a ligase such as T4 DNA ligase. This may result in multimers 100 comprising multiple units 1 being attached to each other sequentially. Due to self-connection, some of the multimers 100 can be linear, and some of the multimers 100 can be circular. In addition, the length of multimers 100 can vary, i.e., each multimer 100 can include a different number of units 1.
Another exemplary connection procedure for attaching the units 1 to each other sequentially is referred to hereinafter as "gold gate assembly" or GGA, as is known in the art. GGA was originally developed for the attachment of multiple inserts to vector backbones using only a single type IIS restriction enzyme and DNA ligase, e.g., T4 DNA ligase. Type IIS restriction enzymes are unique in that they cut at a known distance downstream of their recognition site on both the sense and antisense strands of a DNA fragment, thereby generating an overhang that can serve as a specific sticky end for ligation. The advantage of this procedure is that after digestion, when the sticky ends are ligated, the base sequences near the contact points between adjacent ligated DNA fragments no longer contain recognition sites, and thus the fragments remain ligated despite the presence of restriction enzymes in the reaction mixture.
With respect to the present subject matter, GGA can be used without a carrier to sequentially link units 1 and produce multimer 100. In addition, GGA can be used to produce multimers 100 having a predetermined number of linked units 1 in a predetermined order. This can be achieved by designing the recognition site of the type IIS restriction enzyme at an appropriate location in unit 1 that is different for each unit 1, thereby creating a cohesive end that differs in sequence in different units 1. In other words, each type of unit 1 comprises a different sequence of its sticky ends. An exemplary type IIS restriction enzyme that can be used in GGA is Esp3I, whose restriction site is 1 and 5 nucleotides downstream of its sense and antisense strands, respectively, away from its recognition site, thereby creating a sticky end of 4 nucleotides. To achieve this, primers are used that are unique to each successive unit and indicate the order in which units 1 are connected. Some preliminary experiments with the GGA program show that up to six different units 1 can be connected sequentially in a predetermined order using GGA.
The previously described multimer 100 shown in fig. 3A includes a plurality of units 1 whose sequences of fragments 12 are different from each other. According to another embodiment illustrated in FIG. 3B, multimer 100 can comprise units 1 that have similar sequences, i.e., comprise identical fragments 12, leader 18, indexer 14, identifier 16, and blocker 19. These units 1 are shown as unit 1 in fig. 3B to designate their similarities. However, in a sample containing a plurality of such multimers 100, multimers 100 can differ from each other at least in terms of one of the compositions of unit 1 thereof, fragment 12, guide 18, indexer 14, identifier, and blocker 19. Furthermore, the sample containing multimer 100 according to this embodiment is suitable for sequence analysis by a nanopore sequencing platform, e.g., MinIon (oxford nanopore technologies, england).
An exemplary procedure for generating multimers 100 comprising similar units 1 is the Rolling Circle Amplification (RCA) protocol described in: for example, "Wilson, b.d., Eisenstein, m, and Soh, h.t.," Ultra-High fidelity Nanopore Sequencing of Ultra-Short DNA Targets, "analytical chemistry (anal. chem.)," 2019, 91, 6783-.
In this example, unit 1, as a building block of multimer 100, includes leader 18, indexer 14, segment 12, identifier 16, and blocker 19 according to embodiments described herein. The RCA protocol produces multimers 100 as tandem repeats of unit 1 in the form of DNA molecules. As known in the art, RCA protocols include: design of Molecular Inversion Probes (MIPs), which are single-stranded DNA molecules configured to match the 5 'and 3' ends of unit 1; bonding MIPs to the 5 'and 3' ends of the cell 1; circulating unit 1; polymerizing the complementary DNA strands to produce circular units 1 in the form of circular double-stranded DNA; removing remaining single-stranded DNA molecules, e.g., by using an enzyme having exonuclease activity; and amplifying the circular unit 1 with any DNA polymerase known in the art suitable for RCA, such as 29 DNA polymerase. The product of this scheme is a multimer 100 comprising a similar unit 1 in a linear single-stranded DNA molecule; and if the mixture of different units 1 is constrained by this scheme, unit 1 may differ between multimers 100, and when each multimer 100 comprises a similar unit 1, the product of the scheme is a mixture of different multimers 100. The multimers 100 obtained by the RCA protocol can be in the length of thousands of nucleotides, and even up to tens of thousands of nucleotides.
Multimer 100 is configured to be sequenced by any method known in the art for sequencing, for example, long fragments in the range of substantially 1,000-10,000 bp and even up to substantially 100,000 bp and more, such as nanopore sequencing, more specifically the Oxford nanopore technique. The result of this sequencing is the nucleotide sequence of the entire multimer 100. Any step of the sequencing method up to obtaining the nucleotide sequence of multimer 100 is within the scope of the inventive subject matter. This may comprise, for example, base calling of the sequence, i.e. the transformation of the raw data from the sequencing instrument to the nucleotide sequence. This can also include data clean-up, i.e., trimming damaged sequences and sequences unrelated to the sequence of multimer 100, such as sequences of very low quality or sequences belonging to elements of a sequencing program, such as adaptors and control sequences that are part of a nanopore sequencing method.
The present subject matter provides a method for analyzing the sequence of multimer 100 described above. The method for analyzing the sequence of multimer 1 comprises:
the sequences of units 1 are separated from each other. This is done by identifying the sequence of the ends of the unit 1 and separating it between the ends. In the other end, the sequences of units 1 are separated from each other by: cleaving the multimer 100 at the boundary between the ends of adjacent units 1;
the cells 1 having the same indexer 14 are grouped for obtaining the same set of indexer 14. In other words, at this stage, Unit 1 is sorted according to the source of the target sequence. For example, one individual sequence is grouped together as it has the same indexer 14, while another individual sequence is grouped separately as it has another indexer 14;
in each group obtained in the previous step, units 1 having the same sequence of fragments 12 are grouped to obtain groups of identical fragments 12. At this stage, each source, e.g., each individual unit 1, is grouped in a separate group of target nucleic acids, e.g., a separate gene. This is achieved by grouping units 1 with the same sequence of fragments 12 into one group;
in each group obtained in the previous step, units 1 having the same identifier 16 sequence are grouped to obtain the same identifier 16 group. At this stage, units 1 obtained from the same copy of segment 12 are grouped in a group. On the other hand, units 1 comprising different segments 12, even slightly different segments 12, comprise different identifiers 16 and are therefore grouped in different groups of identifiers 16 at this stage. As described above, Unit 1 includes various copies of a target sequence, i.e., a fragment 12. Each copy is tagged with a different identifier 16 and the tagged unit 1 is then amplified in a unit 1 amplification. Thus, each copy of the target sequence, i.e., fragment 12, is amplified during unit 1 amplification, and errors can be introduced into the fragment 12 during amplification as is known in the art. In addition, during sequencing, errors in reading the sequence of fragment 12 can be obtained. This stage of grouping units 1 having the same identifier 16 sequence is therefore important as it allows for the identification of errors in the sequence of fragments 12 due to the procedure and the elimination of said errors, while identifying mutations of the target sequence that seek diagnostic purposes. It is easy to distinguish between errors in the sequence of the fragments 12 due to the procedure and mutations in the target sequence, since mutations in the target sequence are detected in all fragments 12 tagged with the same identifier 16, while errors due to the procedure can be detected only in one or a few fragments 12 tagged with the same identifier 16. Thus, after grouping Unit 1 with the same identifier 16 sequence in each of the same set of fragments 12, the next step is:
the multiple fragment 12 sequences in each identical identifier 16 set are folded into a single sequence that accurately represents the sequence of the target sequence obtained from fragment 12. During folding, errors in the sequence due to the procedure are eliminated as described above.
According to one embodiment, the order in which the sequence of units 1 is grouped according to the indexer 14, the segment 12, and the identifier 16 is merely exemplary. Any possible order of grouping according to indexer 14, segment 12, and identifier 16 is within the scope of the present subject matter.
According to one embodiment, the method for analyzing the sequence of multimer 100 further comprises, after folding the plurality of fragment 12 sequences into a single sequence in each identical identifier 16 set, comparing the sequences obtained by folding with the known sequence of the target sequence to identify variants of the folded sequence of the target sequence (fragment 12) compared to the known sequence of the target sequence.
According to another embodiment, the method for analyzing the sequence of multimer 100 further comprises reporting the mutations found in the variants after comparing the sequences obtained by folding with the known sequence of the target sequence.
The present subject matter provides a method for making a unit 1, such as the unit 1 described above. The following method is used to prepare a unit 1 comprising a fragment 12, an indexer 14 and an identifier 16, a leader 18 and a sealer 19. The method comprises the following steps:
obtaining a fragment 12;
attaching the indexer 14, the identifier 16, the guide 18 and the sealer 19 to the segment 12, wherein the guide 18 and the sealer 19 are positioned at the ends of the segment obtained as a result of the attachment;
amplifying the obtained fragments with primers specific for the primer 18 and the blocker 19;
yielding a plurality of units 1.
According to one embodiment, the method for preparing the unit 1 further comprises: the 5' ends of the strands of units 1 are phosphorylated.
According to one embodiment, the inventive subject matter further provides a method for preparing a multimer 100, such as multimer 100 described above, comprising:
a plurality of units 1 are attached sequentially.
The present subject matter further provides another embodiment of a method for making a multimer 100, such as multimer 100 described above. The following method is based on an embodiment of the unit 1 comprising an indexer 14, an identifier 16, a director 18 and a sealer 19. The method comprises the following steps:
obtaining a fragment 12;
attaching the indexer 14, the identifier 16, the guide 18 and the sealer 19 to the segment 12, wherein the guide 18 and the sealer 19 are positioned at the ends of the segment obtained as a result of the attachment;
amplifying the obtained fragments with primers specific for the primer 18 and the blocker 19;
generating a plurality of cells 1;
phosphorylating the 5' ends of the strands of the plurality of unit 1; and
the plurality of units 1 are attached sequentially.
It should be noted that the foregoing methods for making unit 1 and multimer 100 are also applicable to embodiments of unit 1 that include only at least one of composition indexer 14, identifier 16, leader 18, and blocker 19. In such cases, the method may include necessary changes as can be appreciated by those skilled in the art.
According to one embodiment, fragments 12 are obtained by disrupting polynucleic acids. Any method known in the art for disrupting a polynucleic acid is within the scope of the present subject matter, such as shearing and enzymatic fragmentation of a polynucleic acid.
According to another embodiment, the polynucleic acid is genomic DNA.
According to another embodiment, the polynucleic acid is total RNA.
According to yet another embodiment, the polynucleic acid is mRNA.
According to one embodiment, fragments 12 are obtained by amplifying fragments 12 with one or more primers specific for fragments 12.
According to one embodiment, the indexer 14, identifier 16, leader 18 and blocker 19 are attached to the fragment 12 by attaching the indexer 14, identifier 16, leader 18 and blocker 19 to primers specific to the fragment 12 and amplifying the fragment 12, wherein the indexer 14 is attached to the 5 'end of the primers specific to the forward or reverse fragment 12, the identifier 16 is attached to the 5' end of the remaining primers specific to the reverse or forward fragment 12, the leader 18 is attached to the 5 'end of the indexer 14 or identifier 16 and the blocker 19 is attached to the 5' end of the remaining identifier 16 or indexer 14. This embodiment is merely exemplary. Based on the description given herein, a person skilled in the art should be able to produce other embodiments of the unit 1.
Additionally, the present subject matter provides an apparatus or system configured to perform the methods described herein.
According to one embodiment, there is provided an apparatus configured to perform all of the methods described above. Typically, the device is configured to obtain a nucleic acid sample and prepare fragments 12 as described herein, prepare unit 1 as described herein, prepare multimer 100 as described herein, determine the nucleic acid sequence of multimer 100 by any method known in the art, and analyze the obtained nucleic acid sequence as described herein. In other words, the device is configured to obtain at least one sample comprising a target nucleic acid sequence while performing the aforementioned method and to provide an accurate analysis of the nucleic acid sequence, including information about mutations in the target sequence. Any device known in the art as being configured to automatically or semi-automatically perform the foregoing methods is within the scope of the inventive subject matter.
According to another embodiment, the inventive subject matter also provides a system comprising a plurality of components, in other words more than one component, individually or in combination, configured to perform the methods described herein. In general, the system is configured to obtain a nucleic acid sample and prepare fragments 12 as described herein, prepare unit 1 as described herein, prepare multimers 100 as described herein, determine the nucleic acid sequence of multimers 100 by any method known in the art, and analyze the obtained nucleic acid sequence as described herein. In other words, the system is configured to obtain at least one sample comprising a target nucleic acid sequence while performing the aforementioned method and to provide an accurate analysis of the nucleic acid sequence, including information about mutations in the target sequence. Any system known in the art as configured to automatically or semi-automatically perform the foregoing methods is within the scope of the inventive subject matter. Additionally, any component known in the art that is configured to perform at least one of the foregoing methods and may be part of the system is within the scope of the inventive subject matter. Further, the components of the system may be assembled in one place or may be separated from each other.
Examples of the invention
Example 1: primers for amplification of fragment 12
For each mutation to be tested-the specific sequence is located for a primer that allows amplification of a certain target sequence, also referred to as "fragment 12", while the primer used for amplification of fragment 12 has the desired position to be tested. The amplicon size is, for example, substantially 200-400 bp long, the melting temperature (Tm) of the primers is substantially 63-65 ℃ and the primer length is substantially 18-26 bp. Examples of specific primers (forward and reverse) for the BRAF mutation at amino acid position V600:
positive direction-AGCCTCAATTCTTACCATCCAC
Reverse direction-CTTCATAATGCTTGCTCTGATAGG
For each mutation-specific sequence of the first-stage primer, the following unique elements were added.
An indexer: (12 bases) 5' (e.g., -CGTGATCGTGAT) of the forward specific sequence.
A guide piece: 24 bases were added to the indexer (forward primer example-CAAGCAGAAGACGGCATACGAGAT).
The length and sequence of the leader may vary depending on the external Fwd primer sequence.
An identifier: 12 random bases (12 XN) at the 5' end of the reverse specific primer.
A sealer: 21 bases were added upstream of the tag (reverse primer-AATGATACGGCGACCACCGAG).
The length and sequence of the blocker can itself vary depending on the Rev primer sequence.
Example 2: primers for Unit 1 amplification
The primers used for unit 1 amplification were designed to work with each fragment 12 amplified amplicon. The primer comprises:
a forward primer having the sequence of a leader. The forward primer may include a 5' phosphate group. The forward primer may also include two Phosphorothioate (PS) linkages with or without a 5 'phosphate group between the three 3' bases.
A reverse primer having the sequence of a blocker. The reverse primer may include a 5' phosphate group and two thio-orthoester (PS) linkages between the 1 st to 2 nd bases and the 2 nd to 33 th bases.
Example 3: fragment 12 amplification and Unit 1 amplification
The procedure included a fragment 12 amplification reaction and a unit 1 amplification reaction, each with unique primers as described above. Fragment 12 amplification is intended to prepare the target region for unit 1 amplification. Unit 1 amplification amplifies amplicons generated only during amplification of fragment 12.
Example 4: amplification of fragment 12
The following components were added to the sterile strip tube:
components
μl
Amplification master mix
12.5
First stage primer-Fwd (0.1nM)
1
First stage primer-Rev (0.1nM)
1
DNA(1-50ngr)
1-9.5
Nuclease-free water
Up to 25
A 50 μ l or 100 μ l pipette is set to 20 μ l and then the entire volume is pipetted up and down at least 10 times to mix thoroughly. A fast rotation is performed to collect all liquid from the side of the tube.
The tube was placed on a thermal cycler and amplification was performed using the following cycling conditions:
the amplification procedure can be altered and adjusted depending on the polymerase used.
Example 5: unit 1 amplification
While the fragment 12 amplification procedure was maintained at 10 ℃, the primers for fragment 12 amplification (1 μ l, 5-10 μ M from each primer) were carefully added and the amplification procedure was allowed to continue.
Example 6: elimination of fragment 12 from amplification reactions
The product from the previous step was cleaned for further reaction with AMPure XP magnetic beads (beckmann coulter).
Using AMPure XP beads, the beads were allowed to warm to room temperature for at least 30 minutes before use and the beads were vortexed firmly for resuspension. AMPure XP beads were used for best practice or manufacturer protocol for >250 bp size selection:
add essentially 0.4X to the amplification reaction (use 10 μ Ι of resuspended beads for 25 μ Ι amplification). Mix well by pipetting up and down at least 10 times.
The samples were incubated on the stage for at least 5 minutes at room temperature.
The tube/plate was placed on an appropriate magnetic rack to separate the beads from the supernatant.
After 5 minutes (or when the solution is clear), the supernatant is carefully removed and discarded.
While in the magnet rack, add 200 μ Ι 80% freshly prepared ethanol to the tube/plate. Incubate at room temperature for 30 seconds, and then carefully remove and discard the supernatant. This step was repeated for a second ethanol wash. Ensure that after the second wash all visible liquid is removed.
When the tube/plate is on the magnetic rack, the lid is open, the beads are air dried for up to 5 minutes.
The tube/plate is removed from the magnetic shelf. The DNA was eluted from the beads into 15. mu.l nuclease-free water.
Mix well on a vortex mixer or by pipetting up and down 10 times. Incubate at room temperature for at least 2 minutes.
The tube/plate is placed on a magnetic rack. After 5 minutes (or when the solution is clear), 13-15. mu.l are transferred to a new tube.
The tube was measured for dsDNA by using a Qubit NanoDrop (or equivalent).
Equal amounts of amplicons from different panel tubes were combined.
Example 7: preparation of multimer 100 by ligation of amplicons (Unit 1)
T4 DNA ligase (M0202, NEB Co.) was used.
The following reactions were set up in a microcentrifuge tube on ice.
Components
50 μ L reaction
T4 DNA ligase buffer (10X)
5μl
Fragments
0.1-0.5pmol
Nuclease-free water
To 50. mu.l
T4 DNA ligase
2.5μl
T4 DNA ligase buffer should be thawed and resuspended at room temperature.
T4 DNA ligase should be added last.
Mix slowly by pipetting up and down and microcentrifuge briefly.
Incubate at room temperature for 2 hours.
The inactivation heating was carried out at 65 ℃ for 10 minutes.
Cooled on ice.
Example 8: removal of ligation reactions
The ligation products from the previous step were cleaned for further reaction with AMPure XP magnetic beads (Beckman Coulter).
Using AMPure XP beads (beckmann coulter limited), the beads were allowed to warm to room temperature for at least 30 minutes before use and were vortexed firmly to resuspend. AMPure XP beads were used for best practice or manufacturer protocol for >250 bp size selection:
add about 0.1X to the amplification reaction (for 50 μ Ι amplification reaction, 5 μ Ι resuspended beads were used). Mix well by pipetting up and down at least 10 times.
The samples were incubated on the stage for at least 5 minutes at room temperature.
The tube/plate was placed on an appropriate magnetic rack to separate the beads from the supernatant.
After 5 minutes (or when the solution is clear), the supernatant is carefully removed and discarded.
While in the magnet rack, add 200 μ Ι 80% freshly prepared ethanol to the tube/plate. Incubate at room temperature for 30 seconds, and then carefully remove and discard the supernatant. This step was repeated for a second ethanol wash. Ensure that after the second wash all visible liquid is removed.
When the tube/plate is on the magnetic rack, the lid is open, the beads are air dried for up to 5 minutes.
The tube/plate is removed from the magnetic shelf. The DNA was eluted from the beads into 20. mu.l of 10mM Tris-HCl or 0.1 XTE.
Mix well on a vortex mixer or by pipetting up and down 10 times. Incubate at room temperature for at least 2 minutes.
The tube/plate is placed on a magnetic rack. After 5 minutes (or when the solution is clear), 17-20. mu.l are transferred to a new tube.
The tube was measured for dsDNA by using a Qubit NanoDrop (or equivalent).
Equal amounts of amplicons/fragments from different panel tubes were combined.
Example 9: preparation of multimers 100 by Rolling Circle Amplification (RCA)
A.Cyclic reaction：
a. Mixtures of Unit 1 and its complementary MIP (200- & 500 nM) were prepared at a 3:4 ratio, respectively. The resulting mixture is hereinafter referred to as "MIP-Unit 1 mixture".
b. To the MIP-Unit 1 mixture was added the reagents listed in the following table:
components
10 μ L reaction
MIP multimer mixtures
3μL
Phusion Hot Start Flex 2x Master mix (NEB Inc., M0536S)
5μL
Amplifier enzyme 5 u/. mu.L (Lucigen Co., E0001-5D1)
1μL
10-fold amplification enzyme buffer (Lucigen Co., SS000015-D2)
1μL
Incubate at 95 ℃ for 3 minutes, and then perform 6 cycles, at 95 ℃ for 30 seconds, 60.4 ℃ for 60 seconds, and 37 ℃ for 120 seconds.
B. Degradation of linear DNA:
a. mu.L of exonuclease I (NEB, M0293S) and 0.5. mu.L of exonuclease III (NEB, M0206S) were added.
b. Incubate at 37 ℃ for 90 minutes, then inactivate at 65 ℃ for 20 minutes.
C. Rolling circle amplification:
a. the exonuclease treated cycle product was combined with a forward primer complementary to the primer, as detailed in the table belowPolymerase, dNTP and BSA.
b. Incubate at 30 ℃ for 3-6 hours, then inactivate at 60 ℃ for 10 minutes.
Example 9: library preparation and sequencing with Oxford nanopore technology
Following one of the protocols for library preparation:
rapid sequencing kit SQK-RAD004, the entire contents of the kit protocol are incorporated herein by reference; or
The sequencing kit 1D SSK-LSK109 was ligated, and the entire contents of the kit protocol are incorporated herein by reference.
It should be noted that the foregoing methods for preparing libraries and sequencing with the Oxford nanopore technique are merely exemplary. Any method known in the art for preparing libraries and sequencing long nucleic acids can be used. The library was sequenced according to the manufacturer's protocol by using the oxford nanopore technology platform (MinION, gridios), the entire content of which is incorporated herein by reference.
Example 10: data analysis
The data analysis is preferably performed by bioinformatic techniques and comprises the above mentioned steps.
Example 11: alternative methods for preparing the units
Previously, when the primers used for amplification of fragment 12 comprised a leader, an indexer, an identifier and a blocker sequence, the unit for ligation was prepared by amplification of fragment 12 and a second amplification. Alternative methods for preparing the units for connection are described herein.
Conjugation of at least one separator by ligation
Conjugation of at least one separator by ligation
At this stage, a particular panel at the target genome is amplified in the amplification reaction, while the amplified amplicons are not tagged with at least one separator. Following the amplification reaction of fragment 12, at least one spacer is attached to the amplicon by ligation, and a second amplification reaction is performed to amplify the unit.
At this stage, the first reaction primer is a specific primer for the desired location/panel to be sequenced later, and does not include any elements at its 5' end.
This protocol uses the following reagents as recommendations, but may be replaced by alternative reagents/compounds:
1. UltraTMend repair/dA tail module (NEB # E7442).
2.A super-link module (NEB # E7445).
3.Dual-indexer UMI adaptors.
Generally, the procedure includes the following:
amplifying the target region;
ligating an adaptor to the UMI;
amplifying the ligated fragments with a secondary primer (the primer is designed to hybridize to the 5' element of the adaptor);
ligating the fragments to produce long nucleic acid fragments of conjugated fragments;
preparing a library for long nucleic acid fragments;
analyzing data;
and (5) reporting mutation.
Amplification of fragment 12-amplification of the desired target sequence
The amplification reaction is performed using a high fidelity polymerase and a limited number of cycles (5-15, depending on the number of starting materials). Target specific primers were used.
Cleaning of amplification reactions (Recommendations)
The products from the amplification of fragment 12 were cleaned for further reaction with AMPure XP magnetic beads (beckmann coulter co., ltd.) or any other clean-up protocol to eliminate residual elements from the previous stage, such as primers and buffers.
End repair/dA tails
Following from UltraTMEnd repair/dA tail module (NEB # E7442) protocol:
mixing the following components in a sterile nuclease-free tube:
(Green) end preparation of enzyme mixture-3.0. mu.l;
(Green) end repair reaction buffer (10X) -6.5. mu.l;
amplicon from previous step-55.5 μ Ι;
mix by pipetting and then spin quickly to collect all liquid from the side of the tube.
Placed in a thermal cycler, covered with a heated lid, and run the following program:
30 minutes @20 ℃;
30 minutes @65 ℃;
kept at 4 ℃.
Directly to the NEBNext super-junction module (NEB # E7445):
DNA import if it is before end repair<100ng, then 1:10 in 10mM Tris-HCl pH 7.5-8.0 or 10mM Tris-HCl pH 7.5-8.0 with 10mM NaClDilute the double-indexer UMI adaptors to a final concentration of 1.5. mu.M. It is used immediately.
The following components were added directly to the end preparation reaction mixture and mixed thoroughly:
(Red) flush/TA ligase Master mix-15. mu.l;
2.5 μ l of double-indexer UMI adapter;
(Red) ligation enhancer-1. mu.l.
Mix by pipetting and then spin quickly to collect all liquid from the side of the tube.
Incubate at 20 ℃ for 15 minutes in a thermal cycler.
The DNA is now ready for size selection or clearance.
Cleaning of amplification reactions (Recommendations)
The amplification products from the previous step are cleaned for further reaction with AMPure XP magnetic beads (beckmann coulter limited) or any other amplification clean-up protocol to eliminate residual elements from the previous stage, such as primers and buffers.
Second amplification
This stage amplifies the entire unit from the previous stage (if used with primers that hybridize to the external elements in the unit)Double-index child UMI adapters, the external elements would be P5 and P7 regions). The primer will have a 5' phosphate group for further use.
The second amplification is performed using a high fidelity polymerase and a limited number of cycles (5-15, depending on the number of starting materials). General amplification primers were used. If used, theDual-indexer UMI adaptors, the following primers were used:
Phos/CAAGCAGAAGACGGCATACGA, and
/Phos/AATGATACGGCGACCACCGA)。
cleaning of amplification reactions (Recommendations)
The second amplified product was cleaned for further reaction with AMPure XP magnetic beads (beckmann coulter limited) or any other cleanup protocol to eliminate residual elements from the previous stage, such as primers and buffers.
The units obtained are connected as described above.
Example 12: another alternative method for preparing Unit 1 and multimer 100
The following scheme is an example of the construction of multimers from enriched target amplicons. The first stage of the protocol is the construction of amplicons representing the panel/genome coordinates, followed by the tandem step.
The method is based on commercial reagents and kits from New England Biolabs (New England Biolabs). It should be noted, however, that any agent known in the art that produces similar results to the following protocol is within the scope of the invention.
Based on NEBNext Amplicon panel of Direct (NEB # E6631) program
At this stage, genomic dna (gdna) is fragmented and the target is enriched with a specific bait. The purpose of this stage is to target only the desired panel of DNA locations (the panel can be tailored to the needs and desires, e.g., exome of gene KRAS).
DNA fragmentation
The solution was thawed to stop.
The following reaction was set up on ice. First, DNA, buffer and water were mixed in a sterile nuclease-free tube. Finally, the enzyme is added.
Reagent
Per reaction
Total DNA (10-1000ng)
1-38μl
NEBNext Direct DNA Nicking buffer solution
4μl
NEBNext Direct DNA Nicking enzyme
3μl
Ice-cold nuclease-free H2O
Variable
General assembly
45μl
Hybridization of probes
The hybridization premix was prepared by adding the following components to perform an appropriate amount of reaction. Prior to pipetting, vortex the hybridization buffer for thorough mixing.
Reagent
Per reaction
Hybridization buffer
47μl
Hybridization additives
20μl
NEBNext Direct custom-made and instant bait
5μl
General assembly
72μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
To each sample of fragmented DNA from section 1.1 was added 72 μ l of the hybridization master mix, with a final volume of 122 μ l. Mixing was performed by pipetting up and down 10 times. The PCR plate or cap tube is sealed firmly to avoid evaporation.
The following procedure was run with the heating lid set to 105 ℃ and the sample was placed in the thermal cycler when the module temperature reached 95 ℃:
streptavidin beads were prepared while incubating the samples (see Streptavidin beads Preparation in section 0).
After incubation at 60 ℃ and when section 0 (streptavidin beads preparation) is complete, the tube/well is unsealed, the sample is left on a 60 ℃ thermocycler, the lid is opened, and the run is to Bead preparation (Bead Binding) in section 0.
Preparation of streptavidin beads:
the streptavidin beads were warmed to room temperature (about 15 minutes).
The streptavidin beads were vortexed for resuspension.
For each reaction, 75. mu.l of beads (82.5. mu.l, 10% excess) were required. In a 2ml Eppendorf tube, an appropriate volume of beads was added for performing multiple reactions.
Place one or more tubes on magnet and wait for the solution to clarify (about 1 minute). The supernatant is removed and then the tube or tubes are magnetically removed.
To the beads were added 150 μ l Hybridization Wash (HW) per reaction (165 μ l, 10% excess) and resuspended by vortexing or pipetting.
Place one or more tubes on magnet and wait for the solution to clarify (about 1 minute). The supernatant is removed and then the tube or tubes are magnetically removed.
Repeat step 1.3.5-1.3.6 twice, total 3 washes.
The beads were resuspended (33. mu.l, 10% excess) in 30. mu.l of bead preparation buffer per reaction.
The beads were kept at room temperature until probe hybridization (section 0) was complete.
Bead binding
Immediately prior to use, the washed streptavidin beads (from step 0) were vortexed in a bead preparation buffer to resuspend.
While the samples were on a thermocycler at 60 ℃, 30 μ Ι of resuspended beads were added to each reaction (from step 0) and then slowly mixed by pipetting up and down 10 times.
The thermocycler temperature was changed to 48 ℃ and the reaction was incubated for 10 minutes.
The sample was removed from the thermal cycler and placed on a magnet. Wait for the solution to clarify (about 15 seconds), remove the supernatant, and then remove the sample from the magnet.
To each sample was added 150. mu.l of HW. Mix slowly by pipetting up and down 10 times.
The samples were placed on a thermocycler (lid open) at 62 ℃ and incubated for 5 minutes.
The sample was removed from the thermal cycler and placed on a magnet. Wait for the solution to clarify (about 15 seconds), remove the supernatant, and then remove the sample from the magnet.
Repeat steps 0-0 for a total of 2 washes at 62 ℃.
To each sample was added 150 μ l of bead wash buffer 2(BW 2). Mix slowly by pipetting up and down 10 times.
3' leveling of DNA
While the beads were suspended in BW2 buffer, a 3' leveling master mix was prepared by adding the following components in a sterile nuclease-free tube to perform the appropriate number of reactions. Before pipetting, vortex 3' flush buffer to mix well.
Reagent
Per reaction
3' leveling buffer
97μl
3' leveling enzyme mixtures
3μl
General assembly
100μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
The DNA-bound beads were placed on a magnet and the solution was allowed to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
To each sample 100. mu.l of 3' leveling master mix was added (from step 0). Mix slowly by pipetting up and down 10 times. The samples were incubated at 37 ℃ for 10 minutes on a thermal cycler with the lid open.
The reaction was immediately followed by washing (section 0).
Post-reaction washing
The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
To each sample was added 150. mu.l of bead wash buffer 1(BW 1). Mix slowly by pipetting up and down 10 times. The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW2 was added to each sample. Mix slowly by pipetting up and down 10 times.
dA tail
While the beads were suspended in BW2 buffer, a dA tail master mix was prepared by adding the following components in a sterile nuclease-free tube to perform the appropriate number of reactions. Prior to pipetting, the dA buffer was vortexed to mix well.
Reagent
Per reaction
dA tail buffer
97μl
dA caudal enzymes
3μl
General assembly
100μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
The DNA-bound beads were placed on a magnet and the solution was allowed to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
To each sample 100 μ l of dA tail buffer was added (from step 0). Mix slowly by pipetting up and down 10 times. The reaction was incubated at 37 ℃ for 10 minutes on a thermal cycler with the lid open.
The reaction was immediately followed by washing.
Post-reaction washing
The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
To each reaction 150 μ l BW1 was added and then slowly mixed by pipetting up and down 10 times. The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the reaction was magnetically removed.
150 μ l of BW2 was added to each sample. Mix slowly by pipetting up and down 10 times.
3' adaptor ligation
While the beads were suspended in BW2 buffer, a 3' adaptor ligation master mix was prepared by adding the following components in a sterile nuclease-free tube to perform the appropriate number of reactions. Prior to pipetting, the adaptor ligation buffer was vortexed to mix well.
Reagent
Per reaction
Adapter ligation buffer
80μl
3' adapters
10μl
Ligase
10μl
General assembly
100μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
The DNA-bound beads were placed on a magnet and the solution was allowed to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
Add 100. mu.l of 3' adaptor ligation master mix to each sample. Mix slowly by pipetting up and down 10 times.
The samples were incubated at 20 ℃ for 15 minutes on a thermal cycler with the lid open.
Washing after ligation was performed immediately.
Washing after connection
The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW1 was added to each sample. Mix slowly by pipetting up and down 10 times. The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
The previous step was repeated for a total of 2 washes in BW 1.
150 μ l of BW2 was added to each sample. Mix slowly by pipetting up and down 10 times.
5' leveling of DNA
While the beads were suspended in BW2 buffer, a 5' leveling master mix was prepared by adding the following components in a sterile nuclease-free tube to perform the appropriate number of reactions. Prior to pipetting, vortex 5' flush buffer to mix well.
Reagent
Per reaction
5' leveling buffer
97μl
5' leveling enzyme mixtures
3μl
General assembly
100μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
The DNA-bound beads were placed on a magnet and the solution was allowed to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
To each sample 100. mu.l of 5' leveling master mix was added. Mix slowly by pipetting up and down 10 times.
The samples were incubated at 20 ℃ for 10 minutes on a thermal cycler with the lid open.
The reaction was immediately followed by washing.
Post-reaction washing
The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW1 was added to each sample. Mix slowly by pipetting up and down 10 times. The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW2 was added to each sample. Mix slowly by pipetting up and down 10 times.
5' adaptor ligation
While the beads were suspended in BW2 buffer, a 5' adaptor ligation master mix was prepared by adding the following components in a sterile nuclease-free tube to perform the appropriate number of reactions. Prior to pipetting, the adaptor ligation buffer was vortexed to mix well.
Reagent
Per reaction
Adapter ligation buffer
80μl
5' UMI adaptors
10μl
Ligase
10μl
General assembly
100μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
The DNA-bound beads were placed on a magnet and the solution was allowed to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
Add 100. mu.l of 5' adaptor ligation master mix to each sample. Mix slowly by pipetting up and down 10 times.
The samples were incubated at 20 ℃ for 20 minutes on a thermal cycler with the lid open.
Washing after ligation was performed immediately.
Washing after connection
Note that: the following washing step is different from the washing after the reaction.
The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW1 was added to each sample. Mix slowly by pipetting up and down 10 times. The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
The previous step was repeated for a total of 2 washes in BW 1.
150 μ l of BW2 was added to each sample. Mix slowly by pipetting up and down 10 times.
Adaptor cleavage
The cleavage master mix was prepared by adding the following components in a sterile nuclease-free tube while suspending the beads in BW2 buffer to perform the appropriate number of reactions. Prior to pipetting, vortex the cleavage buffer to mix well.
Reagent
Per reaction
Cleavage buffer
95μl
Cleavage enzyme mixture
5μl
General assembly
100μl
The master mix was mixed well by vortexing for 3-5 seconds and centrifuged briefly.
The DNA-bound beads were placed on a magnet and the solution was allowed to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
To each sample 100. mu.l of cleavage master mix was added. Mix slowly by pipetting up and down 10 times.
The samples were incubated at 37 ℃ for 15 minutes on a thermal cycler with the lid open.
The reaction was immediately followed by washing.
Post-reaction washing
The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW1 was added to each sample. Mix slowly by pipetting up and down 10 times. The sample was placed on a magnet and the solution was left to settle (about 15 seconds). The supernatant was removed and then the sample was magnetically removed.
150 μ l of BW2 was added to each sample. Mix slowly by pipetting up and down 10 times.
Library amplification
The reaction was placed on a magnet, and the solution was allowed to settle (about 15 seconds), the supernatant removed, and the reaction removed magnetically.
To each reaction 45 μ l nuclease-free molecular-grade water was added. The beads were resuspended completely by pipetting up and down 10 times to mix slowly.
45 μ l of the resuspended beads were dispensed into 3 x sterile PCR tubes (15 μ l in each tube).
In this example, only 3 different fragments were ligated.
To each tube the following components were added:
reagent
Each tube
Q5 mastermix
20μl
Primer mixture
5μl
Resuspended beads
15μl
General assembly
40μl
Primer mix will contain 5' elements to be used for downstream applications. Each tube will contain a specific/unique mixture of primers and each reaction tube will be prepared with its own specific primer mixture.
Example of primer mixture 0 for the tandem of 3 fragments:
the primers are specific primers for the 3 'and 5' ends of the NEBNext Direct product and are present in all the fragments obtained. Note that the primer sequence should be carefully adjusted to the 5' end of the product of step 0.
Tube 1 primer mix:
a forward primer:
5'-CAAGCAGAAGACGGCATACGAGATGTCGGTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′
reverse primer:
5'-ttgcctggccgttaacgctttcatAATGATACGGCGACCACCGAGATCTACAC-3'
tube 2 primer mix:
a forward primer:
5'-atgaaagcgttaacggccaggcaaCAAGCAGAAGACGGCATACGAGATGTCGGTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′
reverse primer:
5'-acggatgagatcaaacacctcttgAATGATACGGCGACCACCGAGATCTACAC-3'
tube 3 primer mix:
a forward primer:
5'-caagaggtgtttgatctcatccgtCAAGCAGAAGACGGCATACGAGATGTCGGTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′
reverse primer:
5’-AATGATACGGCGACCACCGAGATCTACAC-3'
mix slowly by pipetting up and down 10 times. Seal the PCR plate or cap the tubes.
The following procedure was run with the heated lid set to 105 ℃ and the sample was placed in the thermal cycler when the block temperature reached 98 ℃ (and importantly before the sample was placed in the thermal cycler to ensure that the block temperature had reached 98 ℃):
purification of the amplified fragments
The sample purification beads were vortexed for resuspension. The contents of the tubes were combined into a single 1.5ml tube.
0.85 fold sample purification beads were added to the PCR reaction (85. mu.l of sample purification beads were added to 100. mu.l of amplified fragment). Mix well by pipetting up and down at least 10 times.
Incubate without lid for 10 minutes at room temperature.
The tube/PCR plate was placed on the magnet. After the solution was clear (about 2 minutes), the supernatant was carefully removed and discarded. Care was taken not to interfere with the beads containing the DNA target (warning: Do not discard beads).
While the tube/plate was magnetic, 200 μ l of freshly prepared (same day) 80% EtOH was added. Incubate at room temperature for 30 seconds and then carefully remove and discard the supernatant.
Repeat the last 0 times for a total of 2 washes in 80% EtOH, ensuring that all supernatant was removed from each reaction.
Samples were incubated uncapped (or unsealed) at 37 ℃ for 5 minutes on a thermal cycler, which was opened to dry the beads.
Remove the tube/plate from the thermocycler and resuspend the dried beads in 102 μ Ι of water. Incubate at room temperature for 2 minutes.
The tube/plate was placed on the magnet and the solution was allowed to settle (about 2 minutes). 100 μ l of the eluted library was transferred to fresh tubes/plates and 85 μ l of sample purification beads were added. Mix well by pipetting up and down at least 10 times.
Incubate at room temperature for 10 minutes.
The tube/plate is placed on the magnet. After the solution was clear (about 2 minutes), the supernatant was carefully removed and discarded. Care was taken not to interfere with the beads containing the DNA target (warning: Do not discard beads).
While the tube/plate was magnetic, 200 μ l of freshly prepared (same day) 80% EtOH was added. Incubate at room temperature for 30 seconds and then carefully remove and discard the supernatant.
The previous step was repeated once for a total of 2 washes in 80% EtOH, ensuring that all supernatant was removed from each well.
Samples were incubated uncapped (or unsealed) at 37 ℃ for 2 minutes on a thermal cycler, which was opened to dry the beads.
Remove the tube/plate from the thermocycler and resuspend the dry beads in 30 μ l of 1 × TE by slow pipetting (or slow vortex capping tube/plate then fast rotation). Incubate at room temperature for 2 minutes.
The tube was placed on a magnet and the solution was allowed to settle (about 2 minutes).
Transfer 28 μ l of eluted library to fresh tube and proceed to step 0.
Using NEBuilder HiFi Basic multimers of DNA assembly programs
At this stage, the targeted amplicons from stage 0 are concatenated for long DNA strands. The amplicon is the result of stage 0 target enrichment and represents the sequence of the gDNA enriched with bait/panel. In the amplification step, unique 5' elements are added to the amplicon. Unique 5' elements will be used to concatemer fragments into multimers using the NEBuilder assay.
Reagents and consumables are specified in the NEB # E2621 protocol.
HiFi DNA assembly master mix allows seamless assembly of multiple DNA fragments regardless of fragment length or end compatibility.
The following reactions were set up on ice:
the number of fragments used may be significantly higher.
Increase the volume of the reaction if a larger number of fragments were assembled, and assemble the master mix using additional NEBuilder HiFi DNA.
The samples were incubated in a thermocycler at 50 ℃ for 15 minutes (when assembling 2 or 3 fragments) or 60 minutes (when assembling 4-6 fragments). After incubation, samples were stored on ice or at-20 ℃ for downstream applications.
Tip repair
At this stage, the tandem is subjected to final polishing.
Reagents and consumables are specified in the NEB # E6050 protocol.
The following components were mixed in a sterile microcentrifuge tube:
fragmenting DNA
Variable
NEBNext end repair reaction buffer (10X)
10μl
NEBNext end repair enzyme mixture
5μl
Sterile H at a final volume of 100. mu.l2O
Variable
General assembly
100μl
Incubate at 20 ℃ for 30 minutes in a thermal cycler.
Clearance of adaptor-ligated DNA without size selection:
vortex SPRIselect or NEBNext sample purification beads were resuspended.
To the adaptor ligation reaction 90 μ l (0.9X) of resuspended beads were added. Mix well by pipetting up and down at least 10 times. During the final mixing, care was taken to expel all liquid out of the tip. Vortex at high for 3-5 seconds may also be used. If the sample is centrifuged after mixing, it is ensured that the centrifugation is stopped before the beads start to settle.
The samples were incubated on the stage for at least 5 minutes at room temperature.
The tube/plate was placed on an appropriate magnetic rack to separate the beads from the supernatant. If desired, the sample is spun rapidly to collect liquid from the sides of the tube or plate well before being placed on the magnetic rack.
After 5 minutes (or when the solution is clear), the supernatant is carefully removed and discarded. Care was taken not to interfere with the beads containing the DNA target (warning: Do not discard beads).
While in the magnet rack, add 200 μ Ι 80% freshly prepared ethanol to the tube/plate. Incubate at room temperature for 30 seconds, and then carefully remove and discard the supernatant. Care was taken not to interfere with the beads containing the DNA target.
The washing step was repeated once for a total of two washes. Ensure that after the second wash all visible liquid is removed. The tube/plate was briefly rotated, placed back on the magnet, and the trace ethanol was removed with a p10 pipette tip, if necessary.
When the tube/plate is on the magnetic rack, the lid is open, the beads are air dried for up to 5 minutes.
The tube/plate is removed from the magnetic shelf. DNA target was eluted from the beads by adding 17. mu.l 10mM Tris-HCl or 0.1 × TE.
Mix well by pipetting up and down 10 times or on a vortex mixer. Incubate at room temperature for at least 2 minutes. If desired, the sample is spun rapidly to collect liquid from the sides of the tube or plate well before being placed back on the magnetic rack.
Place the tube/plate on the magnetic shelf. After 5 minutes (or when the solution is clear), 15. mu.l are transferred to a new PCR tube.
If an ultra-long fragment is required, proceed to the next step. Additional progress was made to Oxford nanopore technology library preparation and sequencing.
Concatemer ligation (optional step)
Clean concatemers were further ligated to prepare even longer DNA fragments.
Based on the T4 DNA ligase kit (NEB # M0202).
T4 DNA ligase kit (NEB # M0202) was used.
The following reactions from the previous step were set up in a centrifuge tube:
concatemer DNA from step 3.3.11
15μl
T4 DNA ligase buffer (10X)
2μl
T4 DNA ligase
3μl
General assembly
20μl
Mix slowly by pipetting up and down and microcentrifuge briefly.
Incubate at room temperature for 2 hours.
The inactivation heating was carried out at 65 ℃ for 10 minutes.
Cooled on ice.
Proceed to Oxford nanopore technology library preparation and sequencing.
One of the objectives of the inventive subject matter is to distinguish between errors introduced into the desired target sequence during its preparation procedure for sequencing and the sequencing itself, as well as between mutations of the target sequence that are sought for e.g. diagnostic purposes. It can be distinguished by sequencing multiple copies of the same target sequence present in the fragment 12 while the sequence or target sequence is capable of identifying copies of the same template. This is achieved by attaching an identifier 16 to the segment 12. As described above, each copy of fragment 12 is tagged with a specific identifier 16 prior to the second amplification and prior to sequencing multimer 100. Thus, the sequences of fragments 12 tagged with the same identifier are considered identical in the sequence of the original nucleic acid target, while any variation in sequence therebetween is considered to be derived from errors in the second amplification and sequencing procedure.
Another unique feature of the inventive subject matter is the sequential attachment of multiple units tagged with identifier 16 to form a long multimer 100 suitable for sequencing in a method configured for sequencing very long nucleic acid fragments, such as nanopore-based sequencing technologies. The other components of cell 1 assist in finding the boundaries of the cells in the sequence, the sequence obtained by analysis-leader 18 and blocker 19; the indexer allows for the identification of the source of the sequence of the fragment 12-thus allowing for simultaneous analysis of samples from multiple sources, and the sequence of the fragment 12 allows for the identification of the target sequence-thus allowing for the simultaneous analysis of multiple target sequences.
It is appreciated that certain features of the subject matter, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the subject matter, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.
While the subject matter has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the spirit and broad scope of the appended claims.
- 上一篇：一种医用注射器针头装配设备
- 下一篇：荧光GTP类似物和用途