阅读说明：本技术 具有益生菌特性的活减毒霍乱疫苗 (Live attenuated cholera vaccine with probiotic properties ) 是由 M·K·沃尔多 T·哈巴德 G·比林斯 于 2018-07-12 设计创作，主要内容包括：本文提供基因工程化的霍乱弧菌细菌菌株,包括该细菌菌株的组合物,以及将其用于在受试者中预防霍乱弧菌感染的方法。(Provided herein are genetically engineered vibrio cholerae bacterial strains, compositions comprising the bacterial strains, and methods for using the bacterial strains to prevent infection by vibrio cholerae in a subject.)

1. A genetically engineered vibrio cholerae bacterium comprising:

(a) a deletion in a nucleic acid sequence encoding cholera toxin subunit a;

(b) a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule; and

(c) a heterologous nucleic acid sequence encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain complementary to a target nucleic acid sequence of ctxA.

2. The genetically engineered vibrio cholerae bacterium of claim 1, wherein the deletion in the nucleic acid sequence encoding subunit a of cholera toxin is in a ctxA gene integrated into the genome of the bacterium.

3. The genetically engineered vibrio cholerae bacterium of claim 1 or 2, wherein the bacterium comprises a deletion in a nucleic acid sequence of a core region of the CTX Φ genome integrated into the genome of the bacterium.

4. The genetically engineered vibrio cholerae bacterium of any one of claims 1-3, wherein the bacterium comprises a deletion in a nucleic acid sequence of the RS2 region of the CTX Φ genome integrated into the genome of the bacterium.

5. The genetically engineered Vibrio cholerae bacterium of any one of claims 1 to 4, wherein the bacterium comprises a complete deletion of the CTX Φ genome integrated into the genome of the bacterium.

6. A genetically engineered vibrio cholerae bacterium comprising:

(a) a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule; and

(b) a heterologous nucleic acid sequence encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain that is complementary to a target nucleic acid sequence of CTX Φ.

7. The genetically engineered Vibrio cholerae bacterium of claim 6, wherein the bacterium previously comprises no copies of the CTX Φ genome integrated into the bacterial genome.

8. The genetically engineered vibrio cholerae bacterium of claim 6 or 7, wherein the target nucleic acid sequence of the CTX Φ genome is located in a gene selected from the group consisting of: rstR, rstA, rstB, psh, cep, orfU, ace, zot, ctxA, and ctxB.

9. The genetically engineered vibrio cholerae bacterium of any one of claims 6-8, wherein the target nucleic acid sequence of the CTX Φ genome is located in the ctxA gene.

10. The genetically engineered Vibrio cholerae bacterium of claim 9, wherein the gRNA comprises nucleic acid sequence 5'-cctgatgaaataaagcagtcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO: 3).

11. The genetically engineered vibrio cholerae bacterium of any one of claims 1-10, wherein the bacterium comprises a deletion in a nucleic acid sequence encoding a multifunctional self-processing toxin repeat (MARTX) toxin.

12. The genetically engineered vibrio cholerae bacterium of claim 11, wherein the nucleic acid sequence encoding a MARTX toxin is selected from the group consisting of: rtxA, rtxB, rtxC, rtxD and rtxE.

13. The genetically engineered vibrio cholerae bacterium of any one of claims 1-12, wherein the bacterium further comprises a deletion in a nucleic acid sequence encoding a DNA binding protein HU- β.

14. The genetically engineered vibrio cholerae bacterium of claim 13, wherein the nucleic acid sequence encoding DNA binding protein HU- β is a hupB gene.

15. The genetically engineered vibrio cholerae bacterium of any one of claims 1-14, wherein the bacterium further comprises a deletion in a nucleic acid encoding a flagellin.

16. The genetically engineered vibrio cholerae bacterium of claim 15, wherein the nucleic acid sequence encoding a flagellin is selected from the group consisting of seq id no: flaA, flaB, flaC, flaD and flaE.

17. The genetically engineered vibrio cholerae bacterium of any one of claims 1-16, wherein the bacterium comprises a heterologous nucleic acid, wherein the heterologous nucleic acid comprises a gene encoding subunit B of cholera toxin operably linked to a promoter.

18. The genetically engineered vibrio cholerae bacterium of claim 17, wherein the gene encoding subunit B of the cholera toxin is the ctxB gene.

19. The genetically engineered vibrio cholerae bacterium of claim 17 or claim 18, wherein the promoter is an inducible promoter.

20. The genetically engineered vibrio cholerae bacterium of any one of claims 17-19, wherein the promoter is P_htpgA promoter.

21. The genetically engineered vibrio cholerae bacterium of any one of claims 1-20, wherein the bacterium comprises a deletion in a nucleic acid sequence encoding a RecA protein.

22. The genetically engineered vibrio cholerae bacterium of claim 21, wherein the nucleic acid sequence encoding a RecA protein is a RecA gene.

23. A genetically engineered vibrio cholerae bacterium comprising:

(a) a deletion in one or more nucleic acid sequences encoding a MARTX toxin selected from the group consisting of rtxA, rtxB, rtxC, rtxD, rtxE and rtxH;

(b) a deletion in one or more flagellin genes selected from the group consisting of flaA, flaB, flaC, flaD, and FlaE;

(c) a deletion in the recA gene; and

(d) a heterologous nucleic acid, wherein the heterologous nucleic acid comprises a ctxB gene operably linked to a constitutive promoter.

24. The genetically engineered vibrio cholerae bacterium of claim 23, wherein the bacterium comprises a complete deletion of the CTX Φ genome integrated into the genome of the bacterium.

25. The genetically engineered vibrio cholerae bacterium of claim 23, wherein the bacterium previously comprises no copy of the CTX Φ bacteriophage genome integrated into the genome of the bacterium.

26. The genetically engineered vibrio cholerae bacterium of claim 23, wherein the bacterium further comprises:

(a) a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule; and

(b) a heterologous nucleic acid sequence encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain complementary to a target nucleic acid sequence of ctxA.

27. The genetically engineered vibrio cholerae bacterium of claim 26, wherein the target nucleic acid sequence of CTX Φ is in a ctxA gene.

28. The genetically engineered Vibrio cholerae bacterium of claim 27, wherein the gRNA comprises nucleic acid sequence 5'-cctgatgaaataaagcagtcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO: 3).

29. The genetically engineered vibrio cholerae bacterium of any one of claims 1-28, wherein the bacterium comprises a deletion in one or more of: a nucleic acid sequence encoding a product conferring trimethoprim resistance, a nucleic acid sequence encoding a product conferring sulfamethoxazole resistance, a nucleic acid sequence encoding a product conferring streptomycin resistance and a nucleic acid sequence encoding a product conferring chloramphenicol resistance.

30. The genetically engineered vibrio cholerae bacterium of claim 29, wherein the gene encoding a product that confers trimethoprim resistance is dfrA.

31. The genetically engineered vibrio cholerae bacterium of claim 29, wherein the gene encoding a product that confers resistance to sulfamethoxazole is sul 2.

32. The genetically engineered vibrio cholerae bacterium of claim 29, wherein the gene encoding a product that confers resistance to streptomycin is strAB.

33. The genetically engineered vibrio cholerae bacterium of claim 29, wherein the gene encoding a product that confers resistance to chloramphenicol is floR.

34. The genetically engineered vibrio cholerae bacterium of any one of claims 1-33, wherein the bacterium is derived from a parent strain belonging to the eitor biotype.

35. The genetically engineered vibrio cholerae bacterium of any one of claims 1-34, wherein the bacterium is derived from a Haiti parental strain.

36. A genetically engineered vibrio cholerae bacterium, wherein the bacterium comprises a first bacterial chromosome comprising the amino acid sequence of SEQ ID NO: 7.

37. The genetically engineered vibrio cholerae bacterium of claim 36, wherein the bacterium comprises a second bacterial chromosome comprising the amino acid sequence of SEQ ID NO: 51.

38. A genetically engineered vibrio cholerae bacterium, wherein the bacterium has a mutation in the same gene as the strain with ATCC accession No. PTA-125138, relative to its parent strain.

39. A genetically engineered vibrio cholerae bacterium, wherein the bacterium is the vibrio cholerae strain having ATCC accession No. PTA-125138.

40. A pharmaceutical composition comprising the genetically engineered Vibrio cholerae bacterium of any one of claims 1-39 and a pharmaceutically acceptable excipient.

41. A method of inducing a protective response against a virulent strain of Vibrio cholerae in a subject, the method comprising administering to the subject the genetically engineered Vibrio cholerae bacterium of any one of claims 1-39 or the pharmaceutical composition of claim 40, thereby inducing a protective response against a virulent strain of Vibrio cholerae in a subject.

42. The method of claim 41, wherein the subject is a human subject.

43. The method of claim 41 or 42, wherein the protective response is induced within 24 hours of administering the genetically engineered Vibrio cholerae bacterium or the pharmaceutical composition to the subject.

44. A genetically engineered bacterium comprising:

(a) deletion of at least one virulence gene;

(b) a heterologous nucleic acid encoding a Cas9 nuclease molecule; and

(c) one or more heterologous nucleic acids encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain that is complementary to a target nucleic acid sequence of a deleted virulence gene;

wherein the Cas9 nuclease molecule is capable of binding to the gRNA to form a complex, and wherein the complex is capable of targeting and cleaving a nucleic acid sequence of the deleted virulence gene.

45. The genetically engineered bacterium of claim 44, wherein the bacterium is a species selected from the group consisting of: vibrio cholerae, Salmonella enterica, Shigella flexneri, Shigella sojae, Shigella dysenteriae, Bordetella pertussis, and Clostridium difficile.

46. The genetically engineered bacterium of claim 44 or 45, wherein said virulence gene is selected from the group consisting of: ctxA, aroA, aroQ, aroC, aroD, htrA, ssaV, cya, crp, phoP, phoQ, guaB, guaA, clpX, clpP, set, sen, virG/icsA, luc, aroA, msbB2, stxA, stxB, ampG, dnt, tcdA, and tcdB.

47. A pharmaceutical composition comprising the genetically engineered bacterium of any one of claims 44-46 and a pharmaceutically acceptable excipient.

48. The genetically engineered vibrio cholerae bacterium of any one of claims 1-39 for use in a method of inducing a protective response in a subject against a virulent strain of vibrio cholerae.

49. The genetically engineered vibrio cholerae bacterium of any one of claims 1-39 for use in a method of treating a subject having a virulent strain of vibrio cholerae.

Technical Field

Described herein are genetically engineered Vibrio cholerae (Vibrio cholerae) bacteria, pharmaceutical compositions comprising the bacteria, and methods of preventing disease caused by virulent strains of Vibrio cholerae by a combination of rapid probiotic protection (probiotic protection) and induction of an adaptive immune response using the bacteria and/or the pharmaceutical compositions comprising the bacteria.

Sequence listing

This application contains a sequence listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety, said ASCII copy was created at 10.7.2018, entitled 29618 and 0175WO1_ S L. txt, and was 5.03 megabytes in size.

Background

Cholera is a diarrheal disease caused by infection with the gram-negative bacterium Vibrio cholerae (Vibrio cholerae). The disease can be rapidly fatal and the epidemic is often transmitted in an explosive manner. Efforts to combat disease include oral rehydration and antibiotic treatment. However, the disease is a major public health hazard in developing and unstable countries (see, e.g., Bohles et al (2014) hum. vaccine. immunoher.10 (6): 1522-35). Vaccination campaigns are currently being carried out, deploying vaccines comprising inactivated strains of vibrio cholerae bacteria. However, the use of these vaccines to reduce the spread of an ongoing epidemic (so-called "reactive vaccination") depends on the time required to vaccinate a subject against cholera. The protective immune response elicited by current vaccines typically takes days or weeks to develop and often requires multiple vaccine doses. Thus, there is a need for a vaccine that can induce a rapid protection against vibrio cholerae after a single dose.

Disclosure of Invention

Described herein are attenuated strains of the bacterium Vibrio cholerae that act as probiotics in a manner not previously available to rapidly prevent cholera and as classical vaccines to elicit the long-term protective immunity to cholera observed in existing cholera vaccines. The attenuated vibrio cholerae bacterial strains described herein, such as HaitiV, are derived from recent clinical isolates, include a variety of genetic modifications, and exhibit robust, multi-day intestinal occupancy that suggests/predicts their potential for long-term immunity to cholera in humans. Surprisingly, a single dose of an attenuated bacterial strain is able to confer protection against a lethal challenge within 24 hours after administration of HaitiV in a young rabbit model of cholera. This rapid protection observed in the young infection model is not consistent with protective immunity elicited by traditional vaccines. In contrast, the ability of live HaitiV to rapidly mediate colonization resistance and disease protection against multiple challenge strains suggests that HaitiV, unlike existing vaccines, confers probiotic protection against cholera. Furthermore, mathematical modeling suggests that the unprecedented speed of HaitiV-mediated protection can greatly improve the public health impact of reactive vaccination. Thus, administration of the bacterial strains described herein can be used to reduce the risk of cholera infection, particularly during an ongoing epidemic, by producing a fast and long-term protection.

In addition, attenuated Vibrio cholerae bacterial strains can be induced to revert to a virulent strain (viral strain) by recovering the virulence gene (viral gene), and methods are provided that prevent and/or mitigate the potential for HaitiV conversion to virulence. Of particular concern is the gene encoding cholera toxin, the major diarrhea factor of the pathogen, which is missing from the live cholera vaccine. Any method of horizontal gene transfer, including reinfection or natural transformation by a phage encoding cholera toxin (CTX. phi.), is sufficient to induce vaccine transformation. Applicants have developed attenuated vibrio cholerae bacterial strains modified to include an RNA-directed endonuclease system capable of specifically targeting the ctxA gene encoding the active subunit of the cholera toxin. This strategy provides a biosafety mechanism that prevents the vibrio cholerae bacteria from regaining ctxA by any means including infection by CTX Φ phages. In addition, this strategy can be extended to other attenuated vaccine strains (e.g., Vaxchora and Peru-15) by engineering the strain to produce an anti-virulence factor (anti-virus factor) CRISPR system from plasmid-encoded or chromosomally integrated constructs.

In one aspect, the present invention provides a genetically engineered vibrio cholerae bacterium having a deletion in a nucleic acid sequence encoding subunit a of cholera toxin; a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule; and a heterologous nucleic acid sequence encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain complementary to a target nucleic acid sequence of ctxA.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have a deletion in a nucleic acid sequence encoding subunit a of the cholera toxin located in the ctxA gene integrated into the genome of the bacteria.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have a deletion in a nucleic acid sequence of the core region of the CTX Φ genome integrated into the bacterial genome.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have a deletion in the nucleic acid sequence of the RS2 region of the CTX Φ genome integrated into the genome of the bacteria.

In some embodiments, the genetically engineered vibrio cholerae provided herein has a complete deletion in the CTX Φ genome integrated into the bacterial genome.

In another aspect, the present disclosure provides a genetically engineered vibrio cholerae having a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule; and a heterologous nucleic acid sequence encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain that is complementary to a target nucleic acid sequence of CTX Φ.

In some embodiments, the target nucleic acid sequence of the CTX Φ genome is located in a gene selected from the group consisting of: rstR, rstA, rstB, psh, cep, orfU, ace, zot, ctxA, and ctxB. In some embodiments, the target nucleic acid sequence of the CTX Φ genome is located in the ctxA gene. In some embodiments, the gRNA comprises or consists of nucleic acid sequence 5'-cctgatgaaataaagcagtcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO: 3).

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have not previously integrated copies of the CTX Φ genome into the bacterial genome.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have a deletion in a nucleic acid sequence encoding a multifunctional-autonomous-repeat-in-toxin (MARTX) toxin. In some embodiments, the nucleic acid sequence encoding a MARTX toxin is selected from the group consisting of: rtxA, rtxB, rtxC, rtxD and rtxE.

In some embodiments, the genetically engineered Vibrio cholerae bacteria provided herein have a deletion in the nucleic acid sequence encoding DNA binding protein HU- β.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have a deletion in a nucleic acid encoding a flagellin. In some embodiments, the nucleic acid sequence encoding a flagellin is selected from the group consisting of seq id no: flaA, flaB, flaC, flaD and flaE.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein comprise a heterologous nucleic acid, wherein the heterologous nucleic acid comprises a gene encoding subunit B of cholera toxin operably linked to a promoter. In some embodiments, the gene encoding subunit B of cholera toxin is the ctxB gene. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is P_htpgA promoter. In some embodiments, the promoter is a constitutive promoter.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have a deletion in a nucleic acid sequence encoding a RecA protein. In some embodiments, the nucleic acid sequence encoding RecA protein is the RecA gene.

In another aspect, the present invention provides a genetically engineered vibrio cholerae bacterium having a deletion in one or more nucleic acid sequences encoding a MARTX toxin selected from the group consisting of rtxA, rtxB, rtxC, rtxD, rtxE and rtxH; a deletion in one or more flagellin genes selected from the group consisting of flaA, flaB, flaC, flaD, and FlaE; a deletion in the recA gene; and a heterologous nucleic acid, wherein the heterologous nucleic acid comprises a ctxB gene operably linked to a promoter (e.g., a constitutive promoter or an inducible promoter). In some embodiments, the bacterium comprises a complete deletion of the CTX Φ genome integrated into the genome of the bacterium. In some embodiments, the bacterium has not previously integrated a copy of the CTX Φ bacteriophage genome into the bacterial genome.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein comprise a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule; and a heterologous nucleic acid sequence encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain complementary to a target nucleic acid sequence of ctxA. In some embodiments, the target nucleic acid sequence of CTX Φ is located in the ctxA gene. In some embodiments, the gRNA comprises or consists of nucleic acid sequence 5'-cctgatgaaataaagcagtcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO: 3).

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein have deletions in one or more of: a nucleic acid sequence encoding a product conferring trimethoprim resistance, a nucleic acid sequence encoding a product conferring sulfamethoxazole resistance, a nucleic acid sequence encoding a product conferring streptomycin resistance, and a nucleic acid sequence encoding a product conferring chloramphenicol resistance. In some embodiments, the gene encoding a product that confers trimethoprim resistance is dfrA. In some embodiments, the gene encoding a product that confers resistance to sulfamethoxazole is sul 2. In some embodiments, the gene encoding a product that confers resistance to streptomycin is strAB. In some embodiments, the gene encoding a product that confers resistance to chloramphenicol is floR.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein are derived from a parent strain belonging to the elor biotype.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein are derived from a Haiti parental strain.

In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein comprise a first bacterial chromosome comprising the amino acid sequence of SEQ ID NO: 7, or consists thereof. In some embodiments, the genetically engineered vibrio cholerae bacteria provided herein comprise a second bacterial chromosome comprising the amino acid sequence of seq id NO: 51, or consists thereof.

In one aspect, the present disclosure provides a genetically engineered vibrio cholerae bacterium, wherein the bacterium has a mutation in the same gene as the strain having ATCC deposit number PTA-125138, relative to its parent strain (e.g., a virulent parent strain).

In another aspect, the present disclosure provides a genetically engineered vibrio cholerae bacterium, wherein the bacterium is the vibrio cholerae strain having ATCC accession No. PTA-125138.

The present disclosure also provides a pharmaceutical composition comprising the genetically engineered vibrio cholerae bacteria provided herein and a pharmaceutically acceptable excipient.

The present disclosure also provides a method of inducing a protective response against a virulent strain of vibrio cholerae in a subject, comprising administering to the subject a genetically engineered vibrio cholerae bacterium provided herein or a pharmaceutical composition comprising the bacterium, thereby inducing a protective response against the virulent strain of vibrio cholerae in the subject (e.g., a human subject). In some embodiments, the protective response is induced within 24 hours of administering the genetically engineered vibrio cholerae bacterium or pharmaceutical composition to a subject.

The present disclosure also provides genetically engineered vibrio cholerae provided herein for use in a method of inducing a protective response in a subject against a virulent strain of vibrio cholerae.

Also provided are genetically engineered vibrio cholerae bacteria provided herein for use in methods of treating a subject having a virulent strain of vibrio cholerae.

In another aspect, the present disclosure also provides a genetically engineered bacterium having a deletion of at least one virulence gene; a heterologous nucleic acid encoding a Cas9 nuclease molecule; and one or more heterologous nucleic acids encoding a guide rna (gRNA), wherein the gRNA comprises a targeting domain that is complementary to a target nucleic acid sequence of a deleted virulence gene; wherein the Cas9 nuclease molecule is capable of binding to the gRNA to form a complex, and wherein the complex is capable of targeting and cleaving a nucleic acid sequence of the deleted virulence gene. In some embodiments, the bacterium is a species selected from the group consisting of: vibrio cholerae, Salmonella enterica, Shigella flexneri, Shigella sojae (Shigella sonnei), Shigella dysenteriae (Shigella dysenteriae), Bordetella pertussis (Bordetella pertussis), and Clostridium difficile (Clostridium difficile). In some embodiments, the virulence gene is selected from the group consisting of: ctxA, aroA, aroQ, aroC, aroD, htrA, ssaV, cya, crp, phoP, phoQ, guaB, guaA, clpX, clpP, set, sen, virG/icsA, luc, aroA, msbB2, stxA, stxB, ampG, dnt, tcdA, and tcdB.

The present disclosure also provides a pharmaceutical composition comprising the genetically engineered bacteria provided herein and a pharmaceutically acceptable excipient.

Also provided are methods of inducing a protective response in a subject against a virulent strain of a bacterium described herein (e.g., vibrio cholerae, salmonella enterica, shigella flexneri, shigella sojae, shigella dysenteriae, bordetella pertussis, and clostridium difficile), comprising administering to the subject a genetically engineered bacterium provided herein, or a pharmaceutical composition comprising the genetically engineered bacterium, thereby inducing a protective response in the subject (e.g., a human subject) against the virulent strain of the bacterium.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims.

Drawings

FIG. 1 shows the deletion of CTX Φ bacteriophage and their adjacent sequences including satellite phage, T L C and RS1, and MARTX toxin gene (the shaded region is the deleted region).

Figure 2 shows the deletion of genes conferring resistance to trimethoprim (dfrA), sulfamethoxazole (sul2) streptomycin (strAB) and chloramphenicol (floR).

Fig. 3A, 3B and 3C show anti-ctxA CRISPR systems that provide immunity to CTX Φ infection. Fig. 3A shows Streptococcus pyogenes (Streptococcus pyogenes) Cas9 and the sequence encoding the ctxA-targeting guide RNA, integrated into the HaitiV lacZ locus. Fig. 3B is a schematic showing targeting of the CTX Φ genome by the anti-ctxACas 9-sgRNA complex. FIG. 3C is a bar graph showing transduction efficiency in HaitiV with/without CRISPR system (CRISPR +/-) with CTX Φ -IGKn (target +; intergenic Kan)^RCassette, complete ctxA) or CTX-Kn Φ (target-; replacement of ctxA by Kan^RCassette) and the number of transducers (transductants) was monitored. Undetected Kan^RThe transducer is shown as "".

FIGS. 4A, 4B, 4C, 4D and 4E show that HaitiV can colonize the intestinal tract of young rabbits (colonizes) without causing cholera-like disease. FIG. 4A is a graph showing fluid flow from littermates after vaccination with either wild type ("WT"; n-11) or HaitiV ("vaccine"; n-10)Histogram of accumulation rates (fluid accumulation rates). The figure shows the mean and standard deviation from 2 litters. P<0.001, unpaired t-test. FIG. 4B shows a cross-sectional view of about 10⁹Line graph of continuous daily body weight of CFU HaitiV (n ═ 10) vaccinated animals. FIG. 4C is a dot plot showing WT CFU (circles) or HaitiV CFU (squares) recovered from rabbit distal small intestine (dSI) on day 1 or day 4 (2 litters/group) post-inoculation. The lines represent geometric means. Open dots indicate the detection limit when no CFU is recovered. And NS: p>0.05, Kruskall-Wallis test followed by Dunn's multiple comparison test. FIG. 4D shows a 1: 1 Competitive Index (CI) of dSI bacteria 1 day after inoculation of the mixture. Open dots indicate the limit of detection when no vaccine CFU was recovered. Lines and bars (lines and bars) represent the geometric mean and geometric standard deviation of CI across 2 litters (n-6). FIG. 4E is a dot plot showing WT CFU (circles) and HaitiV CFU (squares) recovered from co-vaccinated animals; the lines represent geometric means.

FIGS. 5A, 5B, 5C, 5D, 5E, 5F and 5G show that HaitiV mediates colonization resistance associated with variable size infection bottlenecks. Figure 5A shows WTCFU recovered from dSI of animals 18 hours after inoculation with WT (circles). Littermates were pretreated 24 hours prior to WT challenge with sodium bicarbonate buffer (mock, n-8) or formalin inactivated HaitiV (inactivated vaccine, n-7); geometric means across each group in 3 litters are shown. And NS: p > 0.05, Mann-Whitney test. FIG. 5B shows WT CFU (circles) or HaitiV CFU (squares) recovered from dSI of animals after 18 hours of challenge with WT. Animals were pretreated 24 hours prior to challenge with either inactivated (n-6) or live (n-8) vaccine. Open dots represent detection limits when no CFU was recovered and lines represent geometric means across each group in 2 litters. P<0.001, Mann-Whitney test. FIG. 5C shows WT CFU (circles) or HaitiV CFU (squares) of the N16961 strain recovered from dSI of animals 18 hours after challenge with WT. Animals were pretreated 24 hours prior to challenge with either inactivated (n-6) or live (n-8) vaccine. Open dots represent detection limits when no CFU was recovered and lines represent geometric means across each group in 2 litters. P<0.05, Mann-Whitney test. FIG. 5D shows the process without pretreatmentWT CFU (circles) and unique transposon mutants (triangles) recovered from dSI of dSI (rabbits r1 to r6) of individual animals one day after inoculation of the treated transposon mutant library FIG. 5F shows WT CFU (circles), HaitiV CFU (squares) and unique transposon mutants (triangles) recovered from dSI of dSI (rabbits r1 to r7) of individual animals one day after inoculation of the transposon mutant library, animals were pretreated with HaitiV for 24 hours before challenge of the transposon mutant library FIGS. 5E and 5G show the results of Con-ARTIST (see Pritchard et al (2014) P L oS Genet.10: E1004782) analysis for samples with the greatest number of unique genotypes for single inoculation (rabbit r 4; FIG. 5E) and sequential inoculation (rabbit 6; FIG. 5G). the x axis represents the relative change of each gene's insertion mutant in vivo, the y axis represents the average abundance of each gene's insertion mutant across multiple fold value P (Mevera P)>10²) Shows more than 2-fold change (L og)₂(mean fold change)<-1 or>1) The gene of (a) is considered deleted/enriched. Enriched mutants, cqsS and hapR, are shown. Mutations in key colonization factors, including toxin co-regulation of pili biogenesis (circles), and the associated transcriptional regulators toxR and toxS (asterisks), were deleted.

Fig. 6A, 6B, 6C and 6D show that HaitiV colonization prevented disease after HaitiWT challenge, and modeling shows the benefit of rapid protection during cholera outbreaks. Fig. 6A shows survival curves following progression of the dying disease state in animals vaccinated with WT 0 hours after pretreatment with inactivated (black) or live vaccine (red) (t ═ 24 hours). P<0.001, log rank test. Figure 6B shows disease progression from diarrhea onset to moribund status in animals with visible diarrhea (from figure 6A). P<0.001, log rank test. Figure 6C shows WT CFUs (circles) recovered from dSI of animals that did not progress to the moribund disease state (from figure 6A). FIG. 6D shows a simulated outbreak (R) starting from one infection in 100,000 susceptible populations₀2.1), the effect of reactive vaccination on the number of cholera infections, as shown by the dashed line, wherein reactive vaccination is triggered once the number of symptomatic individuals reaches 1000 (1% of the total population), which is responsible forKinetic (RVC). Dose distribution was modeled at a constant rate over 7 days until 70% of the population was vaccinated, as achieved by the most recent reactive vaccination campaign. The modeling parameters are as described in fig. 10B.

FIG. 7 is a Western blot showing that HaitiV produces only the B subunit of cholera toxin. Cell-free supernatants from marine wild-type ("marine WT") and HaitiV, as well as purified cholera toxin ("purified CT") were separated by polyacrylamide gel electrophoresis. Immunoblotting with polyclonal anti-CTX antibody showed the presence of CT-B, but not CT-A in the supernatant of HaitiV.

FIGS. 8A, 8B, 8C and 8D show the results of Con-ARTIST analysis for a single inoculated sample. The x-axis represents the change in relative abundance of insertion mutants for each gene in vivo, and the y-axis represents the identity of the individual insertion mutants in each gene. In multiple mutants (mean inverse P value)>100) Shows more than 2-fold change (L og)₂(mean fold change)<-1 or>1) The gene of (a) is considered deleted/enriched. cqsS and hapR are shown. A subset of colonization factors, including the biogenic components of the toxin co-regulatory pili (circles) and the associated transcriptional regulators toxR and toxS (asterisks), are also shown.

FIGS. 9A, 9B, 9C and 9D show the results of Con-ARTIST analysis of sequentially inoculated samples the x-axis shows the variation in relative abundance of insertion mutants for each gene in vivo and the y-axis shows the identity of independent insertion mutants in each gene, showing a greater than 2-fold variation across multiple mutants (L og)₂(mean fold change)<-1 or>1) Is considered to be deleted/enriched (mean inverse P value)>10²). cqsS and hapR are shown. A subset of colonization factors, including the biogenic components of the toxin co-regulatory pili (circles) and the associated transcriptional regulators toxR and toxS (asterisks), are also shown.

FIG. 10A shows an overview of the SEIR cholera transmission model with delayed vaccine effect. Circles represent subpopulations of the model (susceptible, exposed, infected, recovered: (susceptible, exposed, infected)Susceptible,Exposed,Infections, Recovered), subscript U: unvaccinated, V: has been vaccinated but not yetProtected, P: protected) and arrows indicate transitions between subpopulations. Fig. 10B is a list of parameters used in modeling.

FIGS. 11A and 11B show the transmission potential of the vaccination campaign (R)₀) And the impact of either the dose rate (fig. 11A) or the trigger threshold (fig. 11B) on the relative protection (in some cases, fractional reduction) of a fast-acting vaccine versus a slow-acting vaccine.

FIGS. 12A, 12B, 12C and 12D are graphs showing the vibricidal activity of serum from mice vaccinated with HaitiV or CVD 103-HgR. FIG. 12A is a graph showing the vibricidal response of serum from C57B L/6 mice vaccinated with HaitiV against serotype Inaba cholera vibrio strains, FIG. 12B is a graph showing the vibricidal response of serum from Swiss-Webster mice vaccinated with either HaitiV (black circles) and CVD 103-HgR: (open squares and dashed lines) against serotype Inaba cholera vibrio strains, FIG. 12C is a graph showing the vibrio cidal response of serum from C57B L/6 mice vaccinated with HaitiV against serotype Webgawa vibrio strains, FIG. 12D is a graph showing the coarse time of vibrio response to Vibrio cholerae inoculation of a mouse with either HaitiV (black circles) and CVD103-HgR serotypes (open squares and dashed lines) against Webgawa strain, FIG. 12D is a graph showing the time taken for a coarse graph showing the vibrio cholera response to a Vibrio-cholera strain inoculated with either HaitiV (black circles) or CVD 103-HgR.

FIG. 13A, FIG. 13B, FIG. 13C and FIG. 13D are graphs showing the IgA and IgG responses to O-antigen specific polysaccharide (OSP) from the serotype of Vibrio cholerae strain in mice vaccinated with HaitiV or CVD103-HgR over time FIG. 13A is a graph showing the anti-OSP IgA response to OSP from the serotype of Vibrio cholerae strain in C57B L/6 mice vaccinated with HaitiV FIG. 13B is a graph showing the anti-OSP IgA response to OSP from the serotype of Vibrio cholerae strain in Swiss-Webster mice vaccinated with either HaitiV (black circles) and CVD103-HgR (open squares and dashed lines). FIG. 13C is a graph showing the anti-OSP IgA response to OSP from the serotype of Vibrio cholerae strain in C57B L/6 mice vaccinated with HaitiV FIG. 13C is a graph showing the anti-S-P response to OSP from the serotype of Vibrio cholerae strain of Vibrio cholerae in both HaitiV B L/6 mice vaccinated with HaitiV and the open squares and FIG. 13C HgR is a graph showing the anti-IgG responses to the open circles and the open IgG-CVD).

FIG. 14A, FIG. 14B, FIG. 14C and FIG. 14D are graphs showing the IgA and IgG responses to O-antigen specific polysaccharide (OSP) from serotype Inaba cholera strain over time in mice vaccinated with HaitiV or CVD103-HgR FIG. 14A is a graph showing the anti-OSP IgA response to OSP from serotype Inaba cholera Vibrio strain in C57B L/6 mice vaccinated with HaitiV FIG. 14B is a graph showing the anti-OSP IgA response to OSP from serotype Inaba cholera Vibrio strain in Swiss-Webster mice vaccinated with either HaitiV (black circles) and CVD103-HgR (open squares and dashed lines) FIG. 14C is a graph showing the anti-OSP IgA response to OSP from serotype Inaba cholera Vibrio strain in C57B L/6 mice vaccinated with either HaitiV or the open squares.

Detailed Description

Genetically engineered bacteria

Provided herein are genetically engineered vibrio cholerae bacteria useful for inducing protection from threat by virulent vibrio cholerae within 24 hours after administration thereof to a subject. Vaccination with a live attenuated vibrio cholerae bacterial strain is a promising strategy for inducing a protective immune response against this bacterium. Genes (ctxA and ctxB) encoding the major virulence factors Cholera Toxin (CT) in vibrio cholerae are deleted from many live attenuated vibrio cholerae vaccine candidates, but are carried by CTX Φ, a filamentous bacteriophage that infects vibrio cholerae, integrates its genome into the vibrio cholerae chromosome and/or replicates extrachromosomally in the form of a plasmid. Thus, there is a great risk that CTX Φ infection of an attenuated strain of Vibrio cholerae may induce a reversion of the strain to a virulent state; other means of gene acquisition, including natural transformation, may also mediate the reversal. Methods to prevent and/or mitigate the possibility of obtaining cholera toxin, e.g. by CTX Φ infection or transformation by an attenuated vibrio cholerae bacterial strain, are highly desirable for ensuring the biological safety of vaccines comprising attenuated vibrio cholerae strains.

In some embodiments, the bacterium is attenuated (i.e., has reduced virulence compared to the parental strain from which it is derived). The bacteria may include one or more genetic modifications described herein to achieve the attenuated state. Genetic modifications include, but are not limited to, deletions of all or part of a gene, as well as genetic modifications that alter the ability of a bacterium to express a gene (e.g., alter a promoter element to render it inoperable).

In some embodiments, the bacterium is of the genus Vibrio (Vibrio). In some embodiments, the bacterium is a cholera species. As described herein, any strain of Vibrio cholerae, including clinically isolated strains, may be used. In some embodiments, the vibrio cholerae bacterium belongs to the O1 serogroup. In some embodiments, the vibrio cholerae bacterium belongs to the O1 serogroup and is of the classical biotype. In some embodiments, the vibrio cholerae bacterium belongs to the O1 serogroup and belongs to the El Tor biotype. In some embodiments, the vibrio cholerae bacterium belongs to the O1 serogroup and belongs to the variant El Tor biotype. In some embodiments, the vibrio cholerae bacterium belongs to the O139 serogroup. In some embodiments, the vibrio cholerae bacterium is of the Inaba serotype. In some embodiments, the vibrio cholerae bacterium is of the Ogawa serotype. In some embodiments, the vibrio cholerae bacterium is of the Hikojima serotype. In some embodiments, the vibrio cholerae bacteria are derived from a marine clinical isolate. In some embodiments, the vibrio cholerae bacteria are derived from a strain selected from the group consisting of: o395, N16961, B33, IB4122, IB4642 and IB 4755. In some embodiments, the vibrio cholerae bacterium is derived from the H1 strain (also known as KW3 strain (see NCBI reference sequence GCF _000275645.1 and reference sequence GCF _ 001318185.1)). The virulent vibrio cholerae strain encodes two major virulence factors: cholera Toxin (CT) and toxin co-regulated pili (TCP), encoded by the lysogenic phage CTX Φ and the chromosomal pathogenicity island, respectively. The bacteriophage CTX Φ can convert a nonpathogenic strain of vibrio cholerae into a pathogenic strain by phage infection, a process by which the phage genome is integrated into the host genome or maintained as a plasmid, both of which provide virulence genes for the host bacterium.

The CTX Φ genome is approximately 6.9kb in size and organized into two functionally distinct regions (see, e.g., Mc L eod et al (2005) mol. Microbiol.57(2): 347-56; and Kim et al (2014) J. Microbiol. Biotechnol.24(6): 725-31). the first region, repeat 2(RS2) comprises three genes, rstR, rstA and rstB. rstA and rstB, respectively, encode proteins RstA and RstB, which are necessary for replication and integration of CTX Φ DNA into the bacterial chromosome^CTX) Ace and Zot, which are necessary for phage packaging and secretion. ctxAB is an operon comprising the ctxA and ctxB genes, which encode the protein subunits of cholera toxin, ctxA, and ctxB, respectively. Together ctxA and ctxB encode the Cholera Toxin (CT) virulence factor consisting of one CT-a subunit and five CT-B subunits.

In some embodiments, the vibrio cholerae bacteria described herein comprise one or more genetic alterations to reduce, inhibit, and/or alter expression of one or more CTX Φ genomic genes integrated into the genome of the bacterium, thereby reducing virulence of the bacterium. Genetic alterations include, but are not limited to, deletions, mutations, insertions in the open reading frame of the CTX Φ genomic gene to alter the expression and function of the gene product, or deletions, mutations, insertions in the promoter or transcriptional regulatory element to inhibit the expression of the gene. In some embodiments, the vibrio cholerae bacterium comprises an integrated CTX Φ genome and a deletion of all copies of an adjacent (and related) RS1 element, which is a satellite phage that can be packaged by CTX Φ. In some embodiments, the vibrio cholerae bacterium comprises a deletion in a nucleic acid sequence of an integrated CTX Φ genomic gene. In some embodiments, the vibrio cholerae bacterium has been genetically modified to completely delete a nucleic acid sequence comprising, or consisting of, the CTX Φ genome integrated into the chromosome of the bacterium. In some embodiments, the vibrio cholerae bacterium has been genetically modified to partially delete a nucleic acid sequence comprising a CTX Φ genome integrated into a chromosome of the bacterium. In some embodiments, the vibrio cholerae bacterium has been genetically modified to delete a nucleic acid sequence comprising, or consisting of, the RS2 region of the CTX Φ genome integrated into the chromosome of the bacterium. In some embodiments, the vibrio cholerae has been genetically modified to delete a nucleic acid sequence comprising or consisting of a core region nucleic acid sequence of the CTX Φ genome integrated into a chromosome of the bacterium. In some embodiments, the vibrio cholerae bacterium has been genetically modified to delete a nucleic acid sequence comprising, or consisting of, a gene selected from the group consisting of: rstR, rstA, rstB, psh, cep, orfU (gIII), ace, zot, ctxA, and ctxB. In some embodiments, the vibrio cholerae bacterium has been genetically modified to delete a nucleic acid sequence comprising, or consisting of, the ctxA gene. In some embodiments, the vibrio cholerae bacterium has been genetically modified to delete a nucleic acid sequence comprising, or consisting of, the ctxB gene. In some embodiments, the vibrio cholerae bacterium has been genetically modified to delete a nucleic acid sequence comprising, or consisting of, the ctxAB operon. In some embodiments, the vibrio cholerae bacterium has been genetically modified to lack an attB (attachment) site for CTX Φ phage integration.

In some embodiments, the Vibrio cholerae bacterium comprises one or more genetic alterations to reduce, inhibit, and/or alter expression of one or more RS1 satellite phage genes and/or one or more TC L satellite phage genes integrated in the bacterial genome the integrated copies of the CTX Φ phage genome generally flank copies of the RS1 satellite phage and the T L C satellite phage T L C satellite phage participate in altering the Vibrio cholerae genome to enhance integration of the CTX Φ and RS1 phage, while the RS1 phage is packaged and secreted using some proteins encoded by CTX Φ (see, e.g., Samruzzaman et al (2014) Infect. 82(9): 3636-43. in some embodiments, the Vibrio cholerae bacterium comprises a partial deletion of an entire copy of the RS1 phage genome. in some embodiments, the Vibrio cholerae bacterium comprises a complete deletion of an entire copy of RS1 genome.

In some embodiments, the Vibrio cholerae bacteria include a genetic modification that renders the bacteria incapable of promoting replication of CTX Φ, for example, the DNA binding protein HU β promotes replication of CTX Φ in Vibrio cholerae in plasmid form (see Martinez et al P L oSegenic 11(5): e1005256, the entire contents of which are expressly incorporated herein by reference.) in Vibrio cholerae, HU β is encoded by hupB (also known as VC 1919.) thus, in some embodiments, the Vibrio cholerae bacteria include a genetic alteration that alters the function and/or expression of hupB.

In some embodiments, the bacterium of Vibrio cholerae comprises a genetic modification that renders the bacterium incapable of producing and/or secreting a multifunctional self-processing toxin repeat (MARTX) toxin in Vibrio cholerae the MARTX toxin rtx gene site consists of two different transcribed operons rtxHCA and rtxBDE in Vibrio cholerae, MARTX toxin RtxA is encoded by the rtxA gene and facilitates colonization of the intestinal tract bacteria (see, e.g., Sacchell et al (2015) Microbiol. Spectr.3(3) and Fullner et al (2002) J.Exp.Med.195(11): 1455-62; and Olivier et al (2015) P L oS One 4(10): e7352, the entire contents of each of which are incorporated herein by reference.) the adjacent genes rtxC encode putative acyltransferase, while rtxH encodes a hypothetical protein having no function (see, saxin and SartexDel et al, Sarteh et al, the Sarteh operon, RTxE, RTxTX gene site, wherein the cDNA, the promoter.

In some embodiments, the vibrio cholerae bacterium comprises a genetic modification to reduce the reactogenicity of the bacterium upon administration to a subject (e.g., a human subject). Some attenuated oral vibrio cholerae vaccine strains have induced reactogenic symptoms, including non-biliary diarrhea and abdominal colic; however, it has been demonstrated that vibrio cholerae strains lacking the flagellin-encoding gene exhibit reduced reactogenicity in animal models (see, e.g., Rui et al (2010) proc.nat' l.acad.sci.usa107(9):4359-64, the entire contents of which are expressly incorporated herein by reference). Vibrio cholerae comprises two operons, flaAC and flaDBE, which include five flagellin-encoding genes. In some embodiments, the vibrio cholerae bacterium comprises a genetic alteration that alters a function of at least one gene encoding a flagellin. In some embodiments, the vibrio cholerae bacterium comprises a partial deletion of a gene encoding a flagellin protein. In some embodiments, the vibrio cholerae bacterium comprises a complete deletion of a gene encoding a flagellin protein. In some embodiments, the vibrio cholerae bacterium comprises a complete or partial deletion of a flagellin gene selected from the group consisting of: flaA, flaB, flaC, flaD and flaE. In some embodiments, the vibrio cholerae bacterium comprises a complete or partial deletion of the flaAC operon. In some embodiments, the vibrio cholerae bacterium comprises a complete or partial deletion of the flaBDE operon. In some embodiments, the vibrio cholerae bacterium comprises a deletion in whole or in part of both the flaAC operon and the flaBDE operon.

In some embodiments, the vibrio cholerae bacterium includes a deletion in an antibiotic resistance gene to prevent spread of the antibiotic resistance gene to other bacteria. In some embodiments, the vibrio cholerae bacterium comprises a partial deletion of an antibiotic resistance gene. In some embodiments, the vibrio cholerae bacterium comprises a complete deletion of an antibiotic resistance gene. In some embodiments, the antibiotic resistance gene is selected from the group consisting of: floR (which confers chloramphenicol resistance), strAB (which confers streptomycin resistance), sul2 (which confers sulfisoxazole and sulfamethoxazole resistance), and dfrA (which confers trimethoprim resistance). In some embodiments, the vibrio cholerae bacterium comprises a complete deletion of each of the following antibiotic resistance genes: floR, STRAB, dfrA and sul 2.

In some embodiments, the vibrio cholerae bacterium includes a genetic modification that renders the bacterium incapable of producing RecA. The gene recA encodes the multifunctional protein recA, which is involved in homologous recombination, DNA repair and SOS response (see, e.g., Thompson et al (2004) int.j.syst.evol.microbiol.54(pt.3):919-24, the entire contents of which are expressly incorporated herein by reference). In some embodiments, the vibrio cholerae bacterium comprises a deletion of the recA gene. In some embodiments, the deletion is a partial deletion. In some embodiments, the deletion is a complete deletion. Without wishing to be bound by any particular theory, deletion of recA prevents acquisition of the dependent gene by homologous recombination of Vibrio cholerae bacteria and its ability to resolve mutations due to environmental exposure (e.g., ultraviolet light).

In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid or a heterologous gene. The term "heterologous nucleic acid" or "heterologous gene" refers to a nucleic acid that is not normally found in a given cell in nature (e.g., a nucleic acid that is exogenously introduced into a given cell; or a nucleic acid that has been introduced into a host cell in a form different from the corresponding native nucleic acid). One skilled in the art will readily appreciate that the heterologous nucleic acid may comprise a gene that is codon optimized for use with the Vibrio cholerae bacteria described herein.

In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid encoding an antigenic polypeptide. In some embodiments, expression of the nucleic acid encoding the antigenic polypeptide is operably linked to a constitutive promoter. In some embodiments, the nucleic acid encoding the antigenic polypeptide is operably linked to an inducible promoter. In some embodiments, the heterologous nucleic acid encoding the antigenic polypeptide is integrated into the bacterial genome. In some embodiments, the heterologous nucleic acid encoding the antigenic polypeptide is present on a plasmid. In some embodiments, the antigenic polypeptide is cholera toxin subunit CtxB. Expression of the CtxB subunit of cholera toxin by vibrio cholerae bacteria described herein may be particularly advantageous because it may facilitate induction of an anti-CtxB immune response in a subject administered with the bacteria, resulting in immune protection against vibrio cholerae and enterotoxigenic e.coli (ETEC) (see, e.g., Kauffman et al (2016) mBio 7(6): e)02021-16, the entire contents of which are expressly incorporated herein by reference). Thus, in some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid comprising the ctxB gene of vibrio cholerae. In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid comprising a promoter operably linked to an inducible promoter (e.g., P_htpgPromoter) of the ctxB gene of vibrio cholerae. In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid comprising a vibrio cholerae ctxB gene operably linked to an inducible promoter. In some embodiments, the heterologous nucleic acid comprising the ctxB gene of vibrio cholerae is present on a bacterial chromosome. In some embodiments, the Vibrio cholerae bacterium comprises the mutation N900_ 11550:. Phtpg-ctxB. In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid encoding CtxB integrated into the chromosome at a locus homologous to the N900_11550 locus of HaitiWT (biological item accession number PRJNA 215281; biological sample accession number SAMN 04191514). In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid encoding CtxB integrated into the chromosome at a locus homologous to the N900_ RS07040 locus of HaitiWT. In some embodiments, the vibrio cholerae bacterium comprises a heterologous nucleic acid encoding CtxB integrated into the chromosome at a locus homologous to the N900_ RS07045 locus of HaitiWT.

In some embodiments, the vibrio cholerae bacterium comprises a bacterial chromosome, wherein the bacterial chromosome comprises the amino acid sequence of seq id NO: 7, or consists thereof. In some embodiments, the vibrio cholerae bacterium comprises a bacterial chromosome, wherein the bacterial chromosome comprises the amino acid sequence of SEQ ID NO: 51, or consists thereof. In some embodiments, the vibrio cholerae comprises a first bacterial chromosome and a second bacterial chromosome, wherein the first bacterial chromosome comprises the amino acid sequence of SEQ ID NO: 7, and the second bacterial chromosome comprises or consists of the nucleic acid sequence of SEQ ID NO: 51, or consists thereof. In some embodiments, the vibrio cholerae bacterium has a mutation in the same gene as the strain with ATCC accession No. PTA-125138, relative to its parent strain. In some embodiments, the vibrio cholerae bacterium is the vibrio cholerae strain having ATCC accession number PTA-125138 (described herein as HaitiV).

Programmable RNA-guided nuclease system

The present disclosure also provides recombinant bacterial strains comprising a programmable RNA-guided nuclease system that specifically targets genes previously deleted from the bacterial strain (e.g., virulence genes). By targeting genes deleted from a bacterial strain, reversion to a virulent phenotype by a recombinant bacterium can be prevented and/or improved (e.g., by preventing gene re-acquisition). The use of a programmable RNA-guided nuclease system as described herein is particularly useful in live attenuated vaccine bacterial strains to maintain the attenuated phenotype of the strain.

Any attenuated bacterial strain may be modified to express a programmable RNA-guided nuclease system to prevent and/or improve reversion to a virulent phenotype. For example, live attenuated bacterial strains of the species Vibrio cholerae, Salmonella enterica, Shigella flexneri, Shigella sojae, Shigella dysenteriae, Bordetella pertussis, and Clostridium difficile (formerly Clostridium difficile) can be genetically manipulated to express a programmable RNA-directed enzyme system that targets genes that are deleted in the strain (i.e., as compared to the strain from which the attenuated bacterial strain was derived). Table 1 provides a description of exemplary live attenuated bacterial strains and the virulence genes deleted in the strains. Table 2 provides exemplary sequences of virulence genes deleted in these live attenuated bacterial strains. As described herein, each of the bacterial strains provided in table 1 can be genetically modified to include an RNA-guided nuclease system that specifically targets at least one gene that has been deleted in the strain. For example, in some embodiments, the bacterial strain is a vibrio cholerae strain that includes a deletion in the ctxA gene and a programmable RNA-guided nuclease system that targets the ctxA gene (e.g., a heterologous nucleic acid sequence encoding a Cas9 nuclease molecule and a heterologous nucleic acid sequence encoding a guide RNA (grna)). In some embodiments, the bacterial strain is a salmonella enterica (s.enterica) strain comprising a deletion in at least one virulence gene selected from the group consisting of: aroC, aroD, htrA, ssaV, cya, crp, phoP, phoQ, guaB, guaA, clpX, and clpP, and programmable RNA-guided nuclease systems targeting at least one deleted virulence gene (e.g., aroC, aroD, htrA, ssaV, cya, crp, phoP, phoQ, guaB, guaA, clpX, and clpP). In some embodiments, the bacterial strain is a shigella flexneri (s.flexneri) strain comprising a deletion in at least one virulence gene selected from the group consisting of: guaB, guaA, set, sen, virG/icsA, luc, aroA, and msbB2, and a programmable RNA-guided nuclease system that targets at least one deleted virulence gene (e.g., guaB, guaA, set, sen, virG/icsA, luc, aroA, and msbB 2). In some embodiments, the bacterial strain is a shigella dysenteriae (s.dysenteriae) strain comprising a deletion in at least one virulence gene selected from the group consisting of: guaB, guaA, sen, stxA, stxB, and msbB2, and a programmable RNA-guided nuclease system that targets at least one deleted virulence gene (e.g., guaB, guaA, sen, stxA, stxB, and msbB 2). In some embodiments, the bacterial strain is a shigella sonnei (s.sonnei) strain comprising a deletion in the stxA gene and/or stxB gene, and a programmable RNA-guided nuclease system targeting the deleted virulence genes (e.g., stxA and/or stxB). In some embodiments, the bacterial strain is a bordetella pertussis (b.pertussis) strain comprising a deletion in the dnt gene, aroA gene, and/or aroQ gene, and a programmable RNA-guided nuclease system targeting the deleted virulence genes (e.g., dnt, aroA, and/or aroQ). In some embodiments, the bacterial strain is a clostridium difficile strain comprising a deletion in the tcdA gene and/or tcdB gene, and a programmable RNA-guided nuclease system targeting the deleted virulence genes (e.g., tcdA and/or tcdB).

In some embodiments, the bacterium is a vibrio cholerae bacterium having a programmable RNA-guided nuclease system that specifically targets a CTX Φ nucleic acid, thereby preventing or interrupting one or more of the following processes: inserting CTX Φ genetic material into a bacterial genome, replication of CTX Φ, assembly of CTX Φ, and/or release of CTX Φ from a bacterium; or inactivating the bacteria comprising an intact copy of the CTX Φ genome. In some embodiments, the programmable RNA-guided nuclease system targets the ctxA gene.

Related nuclease systems that may be used include, but are not limited to, zinc finger nucleases, transcription activator-like effector nucleases (TA L EN), CRISPR 1(Cpf1) nucleases of the genera prevotella and Francisella 1(Cpf1) nucleases, meganucleases and CRISPR/Cas9 nuclease systems of Francisella and RNA guide nuclease systems as used herein, the term "editing" in relation to a programmable RNA guide-directed nuclease system includes mutations at the target nucleic acid, e.g., point, insertion, deletion, frameshift or missense mutations, the RNA guided nuclease system includes guide RNAs comprising sequences complementary to the nucleic acid sequence of the nucleic acid (i.e., targeting domain) in a virulence gene (e.g., a gene not necessarily present in the CTX genome, e.g., ctxA), and sequences (e.g., vibrio sequences or direct repeats) that are available from a nuclease molecule (e.g., attenuated, attenuated domain 9 nuclease molecule), and sequences (e.g., attenuated by a nuclease molecule ("guide RNA") that includes sequences that direct nuclease molecules that direct the target RNA to the target nucleic acid (e.g., mrna) that prevent successful cleavage of the virulence genes, e.g., by any of the target RNA, mrna guide RNA, e.g., mrna, the bacterial nuclease, reducing the risk of the target RNA, reducing the virulence gene, e.g., by any of the guide RNA, crna guide, crna guide RNA guide, crna.

In some embodiments, the bacterium comprises a heterologous nucleic acid encoding a Cas9 nuclease molecule. As described below, while this example illustrates the use of a Streptococcus pyogenes Cas9 nuclease molecule (SpCas9), other Cas9 nuclease molecules from other species (e.g., Staphylococcus aureus (Staphylococcus aureus) Cas9 nuclease molecule (SaCas9)) may also be used. The sequences of a variety of Cas9 nuclease molecules, as well as their respective PAM sequences, are known in the art (see, e.g., kleintiver et al (2015) Nature 523(7561): 481-5; Hou et al (2013) proc.natl.acad.sci.u.s.a.; Fonfara et al (2014) nucleic acids res.42: 2577-90; enveltt et al (2013) nat. methods 10: 1116-21; Cong et al (2013) (2013) Science 339: 819-23; and Horvath et al (2008) j.bacteriol.190: 1401-12; PCT publication nos. WO 2016/141224, WO 2014/204578 and WO 2014/144761; U.S. patent No. 9,512,446; and U.S. patent publication No. 2014/0295557; the entire contents of each of which are incorporated herein by reference). Variants of the SpCas9 system (e.g., truncated sgRNA (Tsai et al (2015) nat. Biotechnol.33: 187-97; Fu et al (2014) nat. Biotechnol.32: 279-84), nickase mutations (Mali et al ((2013) nat. Biotechnol.31:833-8 (2013)); Ran et al (2013) Cell 154:1380-9), FokI-dCas9 fusions (Guilinger et al (2014) nat. Biotechnol.32: 577-82; Tsai et al (2014) nat. Biotechnol.32: 569-76; and PCT publication WO 2014/5; the entire contents of each of which are incorporated herein by reference) nucleases may include one or more of Sp 9D 1135 variants; SpeQeQeQnese variants; Cas9 variants; Cas × Cas 5 variants; Neisseria meningitidis 3625 variants; Cas Neisseria meningitidis 3639 variants; Cas tiens 3625 variants; Neisseria meningitidis 3639 variants; Cas 3625) or Neisseria meningitidis 3625, the variants have at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity thereto and retain the function of at least one enzyme from which they are derived, e.g., the ability to form complexes with grnas, bind to target DNA designated by grnas, and alter the sequence of the target DNA (e.g., cleave).

In some embodiments, the bacterium (e.g. vibrio cholerae bacterium) comprises a heterologous nucleic acid encoding a Cpf1 nuclease molecule Cpf1 is a Cas protein (Zetsche et al (2015) Cell 163: 759-71; Schunder et al (2013) int.j.med.microbiol.303: 51-60; and Makarova et al (2015) nat.rev.microbiol.13: 201536; Fagerlund et al (2015) Genome biol.16:251) that can be programmed to cleave a target DNA sequence, in some embodiments the Cpf1 nuclease molecule is an amino acid ball species (acidamino coccus sp.) 3L (AsCpf 1; NCBI reference sequence: 2015 021736722.1), or a variant thereof, in some embodiments the Cpf1 nuclease molecule is a helicidae (acdaminobacillus sp) bacterium (acanthospori sp) and the nucleotide sequence is derived from a wild type DNA polymerase, such as a DNA polymerase, although the Cpf 967, a copy of the Cpf DNA sequence is not identical to the target DNA sequence of the wild type, e.g 3, a DNA sequence encoding a target DNA molecule, which is modified by at least the presence of a cdna 96%, a DNA sequence encoding a wild type DNA spacer DNA sequence encoding a DNA complementary DNA sequence encoding a target DNA complementary DNA sequence encoding a target DNA molecule (e.g 3, a target DNA molecule, e.g 99, e.g 3, a DNA molecule, e.g 99, a DNA molecule encoding a DNA molecule, a DNA molecule encoding a wild type DNA molecule encoding a target DNA molecule, a target DNA molecule encoding a target DNA molecule, a target DNA molecule encoding a target DNA molecule encoding a DNA encoding a target DNA encoding.

To determine the percent identity of two sequences, the sequences are aligned for optimal comparison purposes (gaps are introduced in one or both of the first and second amino acid or nucleic acid sequences as required for optimal alignment, and non-homologous sequences may be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% (in some embodiments, about 85%, 90%, 95%, or 100% of the length of the reference sequence) of the alignment. The nucleotides or residues at the corresponding positions are then compared. When a position in the first sequence is occupied by the same nucleotide or residue as the corresponding position in the second sequence, then the molecules are identical at that position. Considering the number of gaps and the length of each gap, the percent identity between two sequences is a function of the number of identical positions shared by the sequences, which needs to be introduced to achieve optimal alignment of the two sequences.

Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (see Needleman and Wunsch (1970) J.mol.biol.48: 444-53), which has been incorporated into the GAP program in the GCG package using the Blossum62 scoring matrix with a GAP penalty of 12, a GAP extension penalty of 4, and a frameshift GAP penalty of 5.

The amino acid sequence of wild-type SpCas9 is as follows:

the amino acid sequence of wild-type SaCas9 is as follows:

in some embodiments, the bacteria include a heterologous nucleic acid sequence encoding a gRNA, wherein the gRNA includes a targeting domain that is complementary to a target nucleic acid sequence of a virulence gene (e.g., a CTX Φ genomic gene, such as ctxA.) in some embodiments, the gRNA includes a targeting domain that is complementary to a target nucleic acid sequence present on a virulence gene (e.g., ctxA, aroD, or htrA) listed in table 2 methods of designing and preparing grnas specific for a particular target are known in the art and described, for example, in Prykhozhij et al (2015) P L os One 10(3): e 0119372; doen et al (2014) nat. biotechnol.32(12): 1262-7; and Graham et al (2015) genom biol.16:260, each of which is expressly incorporated herein by reference.

Vibrio cholerae with programmable RNA-directed nuclease system

In some embodiments, the virulence gene is the CTX Φ gene and the bacterium is an attenuated vibrio cholerae bacterium. Without wishing to be bound by any particular theory, by specifically targeting the nucleic acid sequence of the CTX Φ genome, integration of the CTX Φ genome into the vibrio cholerae bacterial genome and/or maintenance of the CTX Φ genome in the form of a plasmid can be prevented, either of which can result in adaptation and/or reversion of the bacterium to a virulent state. The gRNA may comprise a targeting domain complementary to a target nucleic acid sequence present in the CTX Φ genome; preferably, however, the gRNA specifically targets nucleic acid sequences of the CTX Φ genome rather than bacterial genome nucleic acid sequences. In some embodiments, the gRNA includes a targeting domain that is complementary to a target nucleic acid sequence present in the CTX Φ gene (e.g., rstR, rstA, rstB, psh, cep, orfU (gIII), ace, zot, ctxA, and ctxB). Targeting ctxA is particularly desirable. In some embodiments, the gRNA includes a targeting domain that is complementary to a target nucleic acid sequence present in the ctxA gene. In some embodiments, the gRNA includes a nucleic acid sequence: 5'-cctgatgaaataaagcagtcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc-3' (SEQ ID NO: 3; target sequences specific for ctxA are highlighted in bold). In some embodiments, the gRNA includes nucleic acid sequence 5'-tttttgtcgattatcttgctgttctagagagcgggagctcaagttagaataaggctagtccgtattcagtgcgggagcacggcaccgattcggtgc-3' (SEQ ID NO: 4; the target sequence specific for rstA is highlighted in bold). In some embodiments, the gRNA includes nucleic acid sequence 5'-taaacaaagggagcattatagttggagaggcatgagaatgccaagttccaataaggctagtccgtacacctaggagactaggggcaccgagtcggtgc-3' (SEQ ID NO: 5; targeting sequences specific for ctxA are highlighted in bold).

As described above, in some embodiments, a genetically engineered vibrio cholerae bacterium can include a heterologous nucleic acid, wherein the heterologous nucleic acid comprises a ctxB gene. Without wishing to be bound by any particular theory, expression of CtxB may induce an anti-CtxB immune response in a subject. This anti-ctxB immune response can prevent diarrheal diseases caused by either a Vibrio cholerae bacterial strain and/or enterotoxigenic Escherichia coli (ETEC) (see, e.g., Kauffman et al (2016) MBio.7(6): e 02021-16). One skilled in the art will readily appreciate that if a bacterium includes a heterologous nucleic acid comprising a ctxB gene and a gRNA comprising a targeting domain that is complementary to a target nucleic acid sequence present in the ctxB gene, either the heterologous nucleic acid comprising the ctxB gene and the nucleic acid encoding the gRNA can be genetically engineered such that the gRNA does not target the heterologous nucleic acid comprising the ctxB gene. For example, a heterologous nucleic acid comprising a ctxB gene can be modified to replace a codon sequence with a synonymous codon sequence such that it is non-complementary to a gRNA targeting domain sequence.

TABLE 1 exemplary live vaccine strains

Application method

Another aspect encompasses methods of using the genetically engineered bacteria (e.g., genetically engineered vibrio cholerae) provided herein. For example, in some embodiments provided herein, the method is a method of modulating the immune system of a subject by administering (e.g., orally) to the subject a genetically engineered bacterium described herein. The method comprises administering to a subject (e.g., a human subject) an effective amount of a composition comprising a genetically engineered bacterium described herein. One skilled in the art will appreciate that an effective amount of a composition is an amount that will produce a desired response (e.g., a protective response, mucosal response, humoral response, or cellular response). Responses can be quantified by methods known in the art.

In some embodiments, provided herein is a method of inducing a protective response in a subject against a virulent strain of vibrio cholerae, the method comprising administering a genetically modified vibrio cholerae bacterium described herein, or a pharmaceutical composition comprising a genetically modified vibrio cholerae bacterium described herein. In some embodiments, the genetically modified bacteria of the pharmaceutical composition produce a protective response within about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, about 72 hours, or about 84 hours after administration to the subject. In some embodiments, the genetically modified bacteria of the pharmaceutical composition generate a protective immune response within about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, about 72 hours, 84 hours, or more after administration to the subject.

In another embodiment, the genetically engineered vibrio cholerae bacteria described herein can be used in a method for alleviating one or more symptoms of cholera in a host in need thereof. Symptoms of cholera include diarrhea, nausea, vomiting, and dehydration. The method comprises administering an effective amount of a composition comprising a genetically engineered vibrio cholerae bacterium described herein.

The genetically engineered bacteria described herein and compositions comprising the bacteria can be administered to any subject. Exemplary vaccine composition formulations and methods of administration comprising genetically engineered bacteria are detailed below.

Pharmaceutical composition

The pharmaceutical compositions comprising genetically engineered bacteria described herein may optionally comprise one or more possible pharmaceutically acceptable excipients, such as carriers, preservatives, cryoprotectants (e.g. sucrose and trehalose), stabilizers, adjuvants and other substances. For example, when the composition includes live, genetically engineered bacteria, the excipient is selected such that the live bacteria are not inactivated, or such that the ability of the bacteria to effectively colonize the subject is not compromised by the use of the excipient. Suitable pharmaceutical carriers are known in the art and include, for example, liquid carriers at or near physiological concentrations, such as physiological saline and other non-toxic salts, and solid carriers such as talc and sucrose. In some embodiments, the pharmaceutical composition comprises an adjuvant. In some embodiments, the pharmaceutical composition may be in a form suitable for aerosolized administration to a subject. In some embodiments, the pharmaceutical formulation is in lyophilized form (i.e., lyophilized form). In some embodiments, the pharmaceutical formulation is a gelatin capsule. The preparation of suitable Pharmaceutical carriers and adjuvants, as well as dosage forms, is described in Remington's Pharmaceutical Sciences, 17 th edition (Gennaro ed., Mack Publishing co., Easton, Pa.,1985), which is incorporated herein by reference.

Administration of the genetically engineered bacteria described herein to a subject can be by any known technique, including but not limited to oral, rectal, vaginal, or nasal administration.

For example, depending on the age of the subject to which the bacteria is to be administered, a typical dose for oral administration may be about 1 × 10⁷To 1 × 10¹⁰Colony Forming Units (CFU). Multiple doses of genetically engineered bacteria may also be administered as needed to provide the desired level of protection.

Also provided are kits comprising genetically engineered bacteria or pharmaceutical compositions described herein. In some embodiments, the kit further comprises instructions for use. In some embodiments, the pharmaceutical composition is lyophilized such that addition of a hydration agent (e.g., buffered saline) reconstitutes the composition to produce a pharmaceutical composition suitable for administration to a subject (e.g., oral).

The following examples are included to illustrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention, and it is intended that all matter contained in the accompanying drawings or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.