Application of rape nucleotide triphosphate transporter gene BnNTT1 in regulation of oil content of crops
阅读说明：本技术 油菜三磷酸核苷酸转运蛋白基因BnNTT1在调控作物含油量中的应用 (Application of rape nucleotide triphosphate transporter gene BnNTT1 in regulation of oil content of crops ) 是由 郭亮 鲁少平 洪越 夏慧 于 2021-08-11 设计创作，主要内容包括：本发明公开了油菜三磷酸核苷酸转运蛋白基因BnNTT1在调控作物含油量和脂肪酸组成中的应用,所述油菜三磷酸核苷酸转运蛋白基因BnNTT1的核苷酸序列如SEQID NO:1或SEQ ID NO:2或SEQ ID NO:3或SEQ ID NO:4所示。通过获得过表达和突变体材料分析转化材料的含油量,发现BnNTT1基因促进甘蓝型油菜种子含油量的积累,同时还调控脂肪酸组成。因此可使用农杆菌介导的遗传转化方法将含有BnNTT1基因的过表达载体转化到作物中,获得BnNTT1基因过表达的作物品种。(The invention discloses application of a rape nucleotide triphosphate transporter gene BnNTT1 in regulation and control of oil content and fatty acid composition of crops, wherein the nucleotide sequence of the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4. Through the analysis of the oil content of the transformation material by obtaining over-expression and mutant materials, the BnNTT1 gene is found to promote the accumulation of the oil content of the brassica napus seeds and simultaneously regulate and control the fatty acid composition. Therefore, an overexpression vector containing the BnNTT1 gene can be transformed into crops by using an agrobacterium-mediated genetic transformation method to obtain a crop variety with the over-expressed BnNTT1 gene.)
1. The application of the rape nucleotide triphosphate transporter gene BnNTT1 in regulating and controlling the oil content and the fatty acid composition of crops is disclosed, wherein the nucleotide sequence of the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
2. The application of the protein coded by the rape nucleotide triphosphate transporter gene BnNTT1 in regulating and controlling the oil content and the fatty acid composition of crops is characterized in that the nucleotide sequence of the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 1 or SEQ ID NO 2 or SEQ ID NO 3 or SEQ ID NO 4, and the amino acid sequence of the protein coded by the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 5 or SEQ ID NO 6 or SEQ ID NO 7 or SEQ ID NO 8.
3. The application of the expression vector containing the rape nucleotide triphosphate transporter gene BnNTT1 in regulating and controlling the oil content and the fatty acid composition of crops is disclosed, wherein the nucleotide sequence of the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
4. The application of the recombinant bacteria containing the rape nucleotide triphosphate transporter gene BnNTT1 in regulating and controlling the oil content and the fatty acid composition of crops is disclosed, wherein the nucleotide sequence of the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 or SEQ ID NO 4.
5. The use of claim 4, wherein: the recombinant bacterium is recombinant agrobacterium.
6. A method of increasing oil content in a crop, comprising: the rape nucleotide triphosphate transporter gene BnNTT1 overexpression crop varieties are obtained by transforming an overexpression vector which contains the rape nucleotide triphosphate transporter gene BnNTT1 and is started by a constitutive promoter into the genome of crops by using an agrobacterium-mediated genetic transformation method, wherein the nucleotide sequence of the rape nucleotide triphosphate transporter gene BnNTT1 is shown as SEQ ID NO 1 or SEQ ID NO 2 or SEQ ID NO 3 or SEQ ID NO 4.
7. The method of increasing oil content in a crop as defined in claim 6, wherein: the constitutive promoter is CaMV 35S.
8. The method of increasing oil content in a crop as defined in claim 6, wherein: the crop is rape.
Technical Field
The invention belongs to the technical field of genetic engineering and crop breeding, and particularly relates to application of a rape nucleotide triphosphate transporter gene BnNTT1 in regulation and control of oil content and fatty acid composition of crops.
Background
The edible vegetable oil provides most of fatty acid needed by human body, wherein saturated fatty acid is the main energy source in human life activity; in addition, vegetable oils and fats are important raw materials for the manufacture of chemical products such as cosmetics, paints, soaps, lubricants, etc. Rape is one of three major oil crops in the world, and rapeseed oil consumption is third in the world and is second only to palm oil and soybean oil. According to research, the oil yield of the rape per unit area can be improved by about 2.3-2.5 percent when the oil content of the rape seeds is improved by 1 percent, so that the improvement of the oil content of the seeds is one of key measures for improving the oil yield of the rape per unit area. In addition, high oil breeding has also been one of the major goals of oilseed rape breeding.
The oil is a general term for oil and fat, the oil is unsaturated higher fatty acid glyceride, and the fat is saturated higher fatty acid glyceride. The biosynthesis of fatty acids is regulated by a variety of enzymes, substrates and transcription factors, and is a complex physiological and biochemical reaction. The ACCase is a key action enzyme for the de-novo synthesis of fatty acid, and researches show that the heterogeneous ACCase can regulate and control the synthesis and accumulation of grease in the prophase of the development of the flax seeds; in addition, some transcription factors play a key role in the synthesis process of fatty acid, including LEC1, LEC2, FUS3, WRI1, Dof and the like, and the transcription factors related to the synthesis of fatty acid form a complex network system to jointly regulate and control the synthesis and accumulation of oil and fat in the process of seed development.
The invention clones the conserved nucleotide triphosphate transporter gene BnNTT1 from rape. Research shows that the oil content of seeds can be obviously improved by overexpressing the gene in rape under the action of a constitutive promoter 35S; and the oil content of the mutant rape seeds created by the CRISPR/Cas9 gene editing technology is obviously reduced. The results show that the BnNTT1 gene plays an important role in regulating and controlling the oil content of rape seeds, can provide a theoretical reference basis for rape high-oil breeding, and simultaneously provides a new idea for the research of oil synthesis.
Disclosure of Invention
The invention aims to provide application of a rape nucleotide triphosphate transporter gene BnNTT1 in regulating oil content and fatty acid composition of crops, wherein the gene can be combined with ATP/ADP to transport ATP in cytoplasm to chloroplast and exchange ADP into cytoplasm. The gene has two copies on rape C6 and A7 chromosomes, namely BnaC06.NTT1a (BnaC06g19090D), BnaC06.NTT1b (BnaC06g40660D), BnaA07.NTT1a (BnaA07g38360D) and BnaA07.NTT1b (BnaA07g35740D), and the nucleotide sequences of the gene are respectively shown as sequence tables SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4, wherein BnaC06.NTT1a consists of 1851bp, BnaC06.NTT1b consists of 1848bp, BnaA07.NTT1a consists of 1851bp, and BnaA07. NT1Tb consists of 1845 bp; the protein sequences coded by the gene are respectively shown in sequence tables SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8, wherein BnaC06 NTT1a codes 616 amino acids, BnaC06 NTT1b codes 615 amino acids, BnaA07 NTT1a codes 616 amino acids, and BnaA07 NTT1b codes 614 amino acids. The gene of the present invention can be amplified from plant genome, mRNA and cDNA by PCR technique.
When constructing recombinant plant expression vector, adding a constitutive promoter cauliflower mosaic virus CaMV 35S before the transcription initiation nucleotide to construct recombinant expression vector containing nucleotide triphosphate transporter gene BnNTT1, and adding antibiotic marker to the expression vector for screening transgenic plant.
The invention provides a method for improving oil content of crops, which comprises the following steps: an overexpression vector containing the nucleotide triphosphate transporter gene BnNTT1 is transformed into the genome of the crop by using an agrobacterium-mediated genetic transformation method to obtain a crop variety with the gene BnNTT1 overexpression.
According to the invention, the oil content of the transformation material is analyzed by obtaining an overexpression and mutant material, and the accumulation of the oil content under the positive regulation of BnNTT1 is found, and the fatty acid composition is also regulated.
The expression vector of the present invention refers to any vector known in the art and capable of expressing in plants, and examples of suitable vectors for constructing the expression vector of the present invention include, but are not limited to, p35S-FAST, PHSE401 (provided by Chen Jun project group of China university of agriculture), and the like.
The high oil content over-expression rape plant obtained by the invention has better development than normal plants in the vegetative growth and reproductive growth periods, so the genetic resource has potential application value in rape high oil breeding.
The technical scheme is shown in the specific embodiment in more detail.
Drawings
FIG. 1: and (3) agarose gel electrophoresis detection results of amplification products of BnaC06.NTT1b and BnaA07.NTT1a genes.
FIG. 2: plasmid maps of the constructed plant expression vectors p35S-FAST-BnaC06.NTT1b (FIG. 2a) and p35S-FAST-BnaA07.NTT1 (FIG. 2 b).
FIG. 3: and (3) qRT-PCR detection of the rape transformed single plant. OE13 and OE14 are overexpression strains of the gene bnac06.ntt1b (fig. 3a), OE22 and OE23 are overexpression strains of the gene bnaa07.ntt1a (fig. 3 b). There were 3 different individual strains per strain, representing P <0.01 in Student's t test.
FIG. 4: obtaining and identifying rape BnNTT1 mutant. sgRNA is located in the first exonic region of genes bnac06.ntt1a, bnac06.ntt1b, bnaa07.ntt1a and bnaa07.ntt1b, and the editing of the target sites of the 2 mutants obtained: m55 and M56 are double-noses edited by bnac06.ntt1b and bnaa07.ntt1 a.
FIG. 5: phenotype characterization of oilseed rape by bnac06.ntt1b and bnaa07.ntt1 a. Oil content of rape seeds is analyzed by GC-MS, and M55 and M56 are CRISPR double mutants of BnaC06.NTT1b and BnaA07. NTT1a. OE13 and OE14 are overexpression strains of the gene bnac06.ntt1b, OE22 and OE23 are overexpression strains of the gene bnaa07.ntt 1a. There were 5 different individuals per line, and different letters indicated a significant difference of P <0.05 according to analysis of variance.
Detailed Description
The present invention will be described in further detail with reference to specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental methods not specified in the following examples, generally followed by conventional methods or the tool book molecular cloning: the method described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory,1989), or the method suggested in the manufacturer's manual.
Example 1 cloning of BnaC06.NTT1b and BnaA07.NTT1a genes
The NTT1 gene has two copies on the C6 and A7 chromosomes of rape respectively, and is named BnaC06.NTT1a (BnaC06g19090D), BnaC06.NTT1b (BnaC06g40660D), BnaA07.NTT1a (BnaA07g38360D) and BnaA07.NTT1b (BnaA07g 35740D). CDS sequences are shown in sequence tables SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3 and SEQ ID NO 4 respectively, contain complete ORF reading frame and initiation codon ATG, and respectively code 616, 615, 616 and 614 amino acids (shown in SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 8). During seed development, we found that the expression level of BnaC06.NTT1b and BnaA07.NTT1a was higher than that of BnaC06.NTT1a and BnaA07. NTT1b. In addition, bnac06.ntt1a and bnaa07.ntt1b have conserved amino acid sequences and highly similar protein structures. For ease of manipulation, we selected genes BnaC06.NTT1b and BnaA07.NTT1a as candidate genes for cloning.
(1) Extraction of RNA
Total RNA was extracted using TransZol (catalog number ET101) from general gold, according to the protocol of kit instructions. The reagents to be prepared in advance were RNase-free water, chloroform, isopropanol and 75% ethanol (prepared from DEPC-treated water). The reagents and experimental articles are all treated by DEPC inactivated RNA enzyme. The method comprises the following specific steps:
a. fully grinding leaves of the cabbage type rape in liquid nitrogen until the leaves are powdery, transferring 100mg of the ground sample to a 1.5ml centrifuge tube, adding 1ml of TransZol, then violently shaking up and down to fully mix the leaves uniformly, homogenizing, and then standing for 5 minutes at room temperature;
b. adding 0.2ml of chloroform into the centrifuge tube, violently shaking for 15 seconds, and incubating for 3 minutes at room temperature;
c.10, 000 Xg at 4 ℃ for 15 minutes;
d. transferring the upper colorless aqueous phase into a new centrifuge tube (with the volume of about 0.6ml), adding 0.5ml of precooled isopropanol, reversing, mixing uniformly, and incubating for 10 minutes at room temperature;
e.10, centrifuging at 4 ℃ at 000 Xg for 10 minutes, pouring out the supernatant, and forming precipitates on the side wall and the bottom of a centrifugal tube; add 1ml of 75% ethanol (DEPC water) to the centrifuge tube and vortex vigorously;
f.7, centrifuging at 500 Xg and 4 ℃ for 5 minutes, removing supernatant, and airing and precipitating at room temperature for about 15 minutes;
g. the pellet was dissolved in 50. mu.l to 100. mu.l of RNA lysis solution, incubated at 55 to 60 ℃ for 10 minutes, and the sample was stored in a refrigerator at-80 ℃ for further use.
h. Taking 1 μ l of extracted total RNA to determine RNA concentration and quality under Nanodrop, and identifying RNA purity according to 1.8< OD260/OD280< 2.0. At the same time, 2. mu.l of the suspension was subjected to 1% agarose gel electrophoresis to examine integrity and quality.
(2) Reverse transcription of RNA
The reverse transcription kit used in the experiment is full-scale goldOne-Step gDNA Removal and cDNA Synthesis SuperMix (Cat. No. AE 311-03). The specific experimental procedures followed the instructions:
mu.l of adsorbed Oligo (dT)18Primer, 10. mu.l of 2 × ES Reaction Mix, and 1. mu.l of the same were added in this order using 5. mu.g of total RNA as a templateRT/RI Enzyme Mix, 1. mu.l gDNA Remover, finally supplemented to 20. mu.l with RNase-free Water. Gently mixing the reaction systems uniformly, then placing the mixture at 42 ℃ for incubation for 30min, and synthesizing first chain cDNA and removing gDNA; then, the mixture was heated at 85 ℃ for 5 seconds to deactivateRT/RI and gDNA Remover. Finally, 180. mu.l of RNase-free Water was added to dissolve the synthesized cDNA.
(3) Amplification of BnaC06.NTT1b and BnaA07.NTT1a genes
Using the above cDNA as a template, a forward primer 5'-GCGGGTACCATGGCAACCGTGATACAAAC-3' and a reverse primer were used5'-GCGGGATCCGTATGTTGGTGGGAGCTG-3' amplifying to obtain a fragment containing BnaC06.NTT1b full-length CDS; the fragment containing the full-length CDS of BnaA07.NTT1a was amplified using forward primer 5'-GCGGGTACCATGGAAGCGGCGATACAAAC-3' and reverse primer 5'-GCGGGATCCGTATGTTGGTGGGAGCTG-3'. By using I-5TM2 × High-Fidelity Master Mix (TSINGKE Biologica technology) was subjected to PCR amplification. The PCR amplification reaction system is as follows:
preparing a reaction solution in a PCR tube according to the reaction system, and carrying out amplification on a Bio-Rad PCR instrument, wherein the PCR amplification program comprises the following steps:
the amplified products were detected by 1% agarose gel electrophoresis (FIG. 1), 1848bp of the full length BnaC06.NTT1b and 1851bp of the full length BnaA07.NTT1a were obtained by amplification, and the Tiangen agarose gel DNA recovery kit (DP130227) was used for gel excavation and recovery of the PCR amplified products.
Example 2 construction of BnaC06.NTT1b and BnaA07.NTT1a Gene overexpression transformation vectors
(1) The fragments BnaC06.NTT1b and BnaA07.NTT1a obtained above were digested simultaneously with KpnI and BamHI, which were the products of Shanghai Saimer Feishel science and technology (China) Co., Ltd. The double enzyme digestion system is as follows:
the cleavage reaction was carried out in a 37 ℃ water bath for 1.5 hours. The enzyme digestion product was recovered by using a general-purpose DNA purification recovery kit (DP130227) from Beijing Tiangen bioengineering Co.
(2) The enzyme digestion product is connected to the vector p35S-FAST, and the connection reaction system is as follows:
the connection reaction conditions are as follows: 3 hours at 22 ℃.
(3) Transforming Escherichia coli DH5 alpha, screening positive clones, carrying out enzyme cutting identification on the quality-improved grains, selecting 3 positive clones, sending samples and sequencing, and analyzing results show that CDS sequences of BnaC06.NTT1b and BnaA07.NTT1a genes are successfully connected with vectors, namely plant expression vectors p35S-FAST-BnaC06.NTT1b and p35S-FAST-BnaA07.NTT1a of successfully constructed and transformed plants (as shown in figure 2).
(4) Introducing the correctly constructed recombinant plasmid vector into agrobacterium strain GV3101, and selecting positive monoclone for preservation in a refrigerator at-80 deg.c. Agrobacterium GV3101 competence was transformed using an electric shock method, the specific experimental steps were as follows:
a. respectively cleaning the electric revolving cups with pure water, ultrapure water and absolute ethyl alcohol, and placing the electric revolving cups on a super clean bench for airing;
b. thawing the recombinant plasmid and agrobacterium GV3101 competence on ice;
c. adding 1 mul of correctly constructed recombinant plasmid into 25 mul of agrobacterium GV3101 competence, and slightly sucking, beating and uniformly mixing to avoid generating bubbles;
d. quickly transferring the mixed solution into a pre-cooled electric rotary cup along the cup wall;
e. adjusting the electric rotating instrument to 1800V, then wiping the outer wall of the electric rotating cup by using absorbent paper, and electrically shocking under the condition of 1800V voltage;
f. after the electric shock is successful, adding 200 mul of non-resistance LB liquid culture medium into the electric rotating cup, slightly sucking and beating for several times, then transferring the solution into a 1.5ml sterile centrifuge tube, and activating for about 2 hours at the temperature of 28 ℃ at 150 r/min;
g. coating the recovered strain on an LB solid culture medium containing antibiotics, and performing inverted culture in an incubator at 28 ℃ for 48 hours;
h. single colonies were picked on the plate, PCR amplified with the pre-vector primer and the post-target gene primer, and positive clones were detected by 1% agarose gel electrophoresis.
i. Adding the positive bacterial liquid into a resistant LB liquid culture medium, carrying out amplification culture in a shaking table at the temperature of 28 ℃ and at the speed of 150r/min until the OD value reaches 0.8, adding equal volume of 50% (v/v) glycerol, mixing uniformly, and storing in a refrigerator at the temperature of-80 ℃.
Example 3 construction of BnanNTT 1-CRISPR vector
Mutants were created using the sgRNA-Cas9 system of the chengjun laboratory, university of chinese agriculture. The experimental procedure was as follows:
(1) logging in a website http:// www.cbi.hzau.edu.cn/cgi-bin/CRISPR, and screening the target. Constructing a vector for simultaneously editing four genes of BnaC06.NTT1a (BnaC06g19090D), BnaC06.NTT1b (BnaC06g40660D), BnaA07.NTT1a (BnaA07g38360D) and BnaA07.NTT1b (BnaA07g35740D), wherein two targets are both designed on a first exon of the four genes, the base sequence of sgRNA1 is 5'-CCTTACCCGCCAAACCCATCGG-3', the 5 'end is 34bp away from an initiation codon ATG, the base motif of sgRNA2 is 5'-GTGAATATAGTTGCTGAGAGG G-3', and the 5' end is 159bp away from the end of the first exon. The distance between two target points of BnaC06.NTT1b gene is 578bp, and the distance between two target points of BnaA07.NTT1a gene is 572 bp.
(2) Designing a primer:
DT1-BsF:ATATATGGTCTCGATTGCCTTACCCGCCAAACCCATGTT
DT1-F0:TGCCTTACCCGCCAAACCCATGTTTTAGAGCTAGAAATAGC
DT2-R0:AACTCTCAGCAACTATATTCACCAATCTCTTAGTCGACTCTAC
DT2-BsR:ATTATTGGTCTCGAAACTCTCAGCAACTATATTCACCAA
(3) and (3) PCR amplification: four-primer PCR amplification was performed using 100-fold diluted pCBC-DT1T2 as a template. DT1-BsF and DT2-Bsr are normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20-fold. The PCR amplification system is as follows:
the PCR amplification procedure was:
(4) purifying and recovering PCR products, and establishing an enzyme digestion-connection system as follows:
(5) coli competence was transformed with 5. mu.l of the ligation product, and positive clones were selected on Kana-resistant LB medium. And performing PCR identification on the colony of 726bp U626-IDF + U629-IDR, sequencing U626-IDF and U629-IDF, and determining the vector with the correct sequencing, namely the CRISPR vector which is successfully constructed.
(6) Introducing the correctly constructed recombinant plasmid vector into the competence of the agrobacterium strain GV3101, selecting positive monoclone, storing in a refrigerator at-80 ℃, and continuing the development of rape genetic transformation.
Example 4 genetic transformation experiments
(1) Genetic transformation of oilseed rape
Adopting hypocotyl dark light culture to carry out genetic transformation on the constructed overexpression vector and CRISPR vector, wherein a receptor for rape transformation is Brassica napus Westar, and the specific method is as follows:
a. and (3) sterilizing the seeds:
pouring the selected mature and plump cabbage type rape 'Westar' seeds into a culture box, and soaking the seeds in 75% alcohol for about 1min for no more than 5 min; washing the soaked seeds with sterile water for 1-2 times; adding 0.15% -0.2% mercuric chloride solution (preserved in laboratory brown bottle, and diluted with laboratory 5% mother liquor) capable of submerging seeds, and sterilizing for 15 min; washing the seeds with sterile water for 5-6 times.
b. Sowing:
sowing seeds in an M0 culture medium by using sterilized tweezers, and uniformly sowing 40-50 seeds in each culture dish; after seeding, the culture dish is placed under the dark light condition for about 7 days at the temperature of 25 ℃.
c. And (3) culturing agrobacterium:
inoculating bacteria on the resistant plate five days after sowing, dipping agrobacterium liquid containing target genes by using a sterilized inoculating loop, and scribing on a resistant LB plate; after 2 days, sucking positive single colonies on the resistant plate by using a toothpick or a gun head, placing the positive single colonies in a resistant LB liquid culture medium for blow beating, and shaking the bacteria at the temperature of 28 ℃ and at the speed of 150 r/min.
d. Preparation and infection of explants:
detecting the concentration of the bacterial liquid under the condition of light absorption at 600nm (spectrophotometer), measuring the OD value of the bacterial liquid, wherein the OD value is optimal between 0.6 and 0.8, centrifuging the bacterial liquid at 6000rpm for 10min, and discarding the supernatant; resuspending with DM (dilution Medium) liquid equal in volume to the bacteria liquid, centrifuging at 6000rpm for 10min, and discarding the supernatant; the suspension was suspended with the same volume of DM solution as the inoculum solution. Then 2ml of the bacterial liquid is taken out and put into a sterilized culture dish, and 20ml of DM solution is used for diluting the bacterial liquid (1: 10); cutting off hypocotyl of seedling after culturing in dark light for 7 days with sterile scalpel and tweezers, cutting to length of 0.8-1.0cm, cutting off explant once as much as possible, and keeping the cut neat; placing the cut explant into the prepared bacterial liquid with the concentration, infecting for 30min (the time cannot be too long), and sucking and beating once at intervals by using a liquid moving machine to ensure that the cut is fully contacted with the bacterial liquid.
e. Culturing callus tissues:
absorbing bacteria liquid on explants by using sterilized absorbent paper, transferring the explants to M1 culture medium, culturing 50-60 explants per dish under the condition of dark light for about 2 days at the temperature of 25 ℃; two days later, the explants were transferred to M2 medium inducing callus, cultured under light conditions (16 h/8 h at day/night) at 22 ℃, and then cultured under light conditions; after three weeks, transferring the explants which grow normally and have two expanded ends into a differentiation medium M3, and subculturing once every 2-3 weeks until green buds grow; cutting off green buds with obvious basal nodes, transferring the green buds into a culture medium M4 for rooting, taking 2-4 weeks, transplanting the green buds into an outdoor field after rooting, and observing the field growth phenotype of the plants (the formula of the culture medium is shown in table 1).
TABLE 1 formulation of Medium for dark light culture of hypocotyls
(2) Identification of overexpressing transformants
Extracting the genome DNA of the obtained rape over-expression transformation individual, detecting the insertion of the exogenous gene segment by PCR, wherein the over-expression skeleton vector is p35S-FAST, primers FAST-F (5'-AAAGGCCATCGTTGAAGATG-3') and FAST-R (5'-TCGAACTCAGTAGGATTCTG-3') are designed on the framework vector, PCR reactions (FAST-F and BnaC06.NTT1b-R/BnaA07.NTT1a-R or BnaC06.NTT1b-F/BnaA07.NTT1a-F and FAST-R), exogenous fragment primers BnaC06.NTT1b-F (5'-GCGggtaccATGGCAACCGTGATACAAAC-3'), BnaC06.NTT1b-R (5'-GCGggatccGTATGTTGGTGGGAGCTG-3'), BnaA07.NTT1a-F (5'-GCGggtaccATGGAAGCGGCGATACAAAC-3') and BnaA07.NTT1a-R (5'-GCGggatccGTATGTTGGTGGGAGCTG-3') were carried out by matching vector backbone primers with exogenous fragment primers, and transgenic seedlings were detected at the PCR level.
The PCR reaction system is as follows:
the PCR reaction program is:
and (3) carrying out qRT-PCR on the rape transgenic positive seedlings obtained by the PCR to detect the gene expression quantity. The RNA of the transformed individual seed was extracted using the transZol kit and subjected to reverse transcription to synthesize cDNA (Square DNA)The same as example 1) and finally PerfectStart with gold OldhamTMGreen qPCR SuperMix reagent was used to perform fluorescent quantitative PCR analysis on the samples.
Quantitative primers are designed by using Primer 5 software, the size of a product is between 100bp and 200bp, and BLAST comparison is carried out by using a reference sequence after the quantitative primers are designed, so that the specificity of the primers RT-BnaC06.NTT1b-F (5'-TCCTCTTGCTATCCTGAGGA-3'), RT-BnaC06.NTT1b-R (5'-GAGAAAATGAGCGCAACGTT-3'), RT-BnaA07.NTT1a-F (5'-GCTTTGGGGTAGTGTGGTTAT-3') and RT-BnaA07.NTT1a-R (5'-ATTGGCTCCGAGTCCAAACAA-3') is ensured. BnACTN 7-L (5'-CGCGCCTAGCAGCATGAA-3') and BnACTN 7-R (5'-GTTGGAAAGTGCTGAGAGATGCA-3') are used as internal reference primers of rape qRT-PCR. The qRT-PCR reaction system is as follows:
the qRT-PCR reaction program was:
the qRT-PCR reaction was performed in the Bio-Rad CFX96 Real-Time System.
The quantification of the variation between the different replicates was calculated by the delta-delta threshold cycle relative quantification (2-. DELTA.CT) method, using internal reference primers for normalization. Finally the two individuals OE13 and OE14 overexpressing bnac06.ntt1b and two individuals OE22 and OE23 overexpressing bnaa07.ntt1a were selected for further analysis (fig. 3).
(3) Identification of CRISPR transformed Individual
Sequencing the obtained CRISPR transformed single strain of the rape to screen rape mutants. Firstly, primers Cas9-F (5'-CGCACAATCCCACTATCCT-3') and Cas9-R (5'-CCAGGTCATCGTCGTATGTG-3') are used for identifying Cas9 protein, and a Cas9 protein positive single strain is subjected to specific amplification and sequencing identification of a target gene. The specific amplification method of the target gene comprises the following steps: BnaC06.NTT1b is specifically amplified by primers NTT1b-C6-F (5'-ATGGCAACCGTGATACAAAC-3') and NTT1b-C6-R (5'-GGCTTCATCCACAGTTGTTATC-3') respectively; NTT1a-A7-F (5'-ATGGAAGCGGCGATACAAAC-3') and NTT1a-A7-R (5'-CAAGAGCCTCCGGG-3') specifically amplify BnaA07. NTT1a. The amplification method was the same as that described in example 4 (2).
And (3) sequencing the PCR product of the amplified target fragment, and analyzing the editing condition of the target site. Sequencing results showed that double mutant strains M55 and M56 were obtained in which bnac06.ntt1b and bnaa07.ntt1a were edited simultaneously, the editing causing different degrees of base insertions and deletions at the target (fig. 4).
(4) Analysis of oil content in transgenic plants obtained by genetic transformation
Determining the oil content of rape seeds by adopting a gas chromatography-flame ionization detector method:
a. weighing 4 mature rape seeds with consistent shapes and sizes, ensuring the total mass to be within the range of 15mg-18mg, recording the weighed mass, and repeating the steps for 5 times for each plant.
b. The weighed rape seeds are put into a clean grease extracting tube, and 4.5ml of methanol extracting solution (95% methanol, 5% concentrated sulfuric acid, 0.01% BHT) is added.
c. And (4) grinding the seed coat of the seeds in the grease extracting tube by using a glass rod and exposing the seeds out of the embryo.
d. 100 μ l (C17: 0, 16.2 μmol/ml, molecular weight 270.45) of the prepared heptadecanoic acid was weighed into a grease extracting tube with a glass needle (100 μ l), and the tube cap was screwed tightly and the mixture was inverted upside down.
e. And (3) putting the grease extracting tube in a water bath kettle at 85 ℃ for water bath for 2h to allow the grease extracting tube to react fully.
After f.2h, the tube was removed and cooled to room temperature, after which 3ml of ddH was added2O and 3ml of n-hexane, and adding liquid slowly to prevent liquid from splashing, and mixing by vortex.
g.1000r/min centrifugation at 25 deg.C for 10min, sucking about 1ml of supernatant with rubber dropper into sampling bottle for subsequent GC-MS analysis, and temporarily storing in refrigerator at-20 deg.C.
(all organic reagents used in the above processes for extracting fatty acids are of the chromatographically pure grade.)
h. Setting parameters of a high performance gas chromatography-mass spectrometry analyzer (GC-MS): the split ratio was set to 10: 1, selecting Rtx-Wax (0.25mm multiplied by 30m) chromatographic column, setting the GC injection inlet temperature at 230 ℃, the initial temperature of the column box at 170 ℃ and keeping for 2min, and then raising the temperature to 230 ℃ at the speed of 5 ℃/min and keeping for 5 min. The MS injection port temperature is set to 230 ℃, and the tuning voltage is 0.2 kV. GC-MS was then performed with automatic injection for analysis.
i. The substance was qualitatively analyzed using the peak pattern results of GC-MS. Quantitative analysis of material was performed using peak plot results of GC-MS: the fatty acid composition and oil content were calculated from the internal standard in conjunction with the molecular weight and mass of the material.
The oil content results show that compared with WT (39.25 +/-0.51), the oil content of the overexpression material of Bnac06.NTT1b gene is OE13(42.97 +/-0.33) and OE14(41.77 +/-0.26), which are obviously increased by 2.5-3.7 percentage points (FIG. 5 a); the oil content of over-expression materials of the gene BnaA07.NTT1a is OE22(41.96 +/-0.37) and OE23(42.80 +/-0.85), and the oil content is obviously increased by 2.7-3.5 percent (figure 5 a); the oil content of the mutant material was M55(36.44 + -0.33) and M56(37.56 + -0.55), which was significantly reduced by 1.7-2.8 percentage points (FIG. 5 a). In addition, the fatty acid composition results showed that the C16:0, C18:0, C18:1, C18:2 and C18:3 contents of the over-expressed material were all significantly increased compared to WT (fig. 5 b).
These results indicate that bnac06.ntt1b and bnaa07.ntt1a do play an important role in regulating oil content and fatty acid composition in brassica napus seeds.
Sequence listing
<110> university of agriculture in Huazhong
Application of rape nucleotide triphosphate transporter gene BnNTT1 in regulation of oil content of crops
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1851
<212> DNA
<213> Brassica napus (Brassica napus L.)
<400> 1
atggaagcgg cgatacaaac cagaggaatc ctctccttac ccgccaaacc catcggagcg 60
agaagaagcc ttctccaccc atcccacggc ttaaagcata gacttttctc ctccaagcca 120
agaactccac ccgccttgtc tctctccttc aagaaagctc aatcctttga cccaaagatt 180
tccatttccc acaaggagag aaccaccgag ttcatatgca aggcggaggc agacggagga 240
gctctgctca acgaaggcga cacggcagcg attgtaccat caccaaagat cttcggcgtg 300
gaggtcacaa cgttgaaaaa gattatacct ttaggtttaa tgttcttttg cattctattc 360
aactacacga tcctgaggga cacgaaggac gtcttggtcg taacggctaa aggaagttcg 420
gcagagatta tacctttctt gaagacgtgg gtcaatctcc ctatggctat tgggttcatg 480
ctcctctaca ccaagctctc caatgttctc tccaagaagg ctctctttta caccgttatt 540
atccctttca tcatctactt tggggccttt ggtttcgtta tgtaccctct cagcaactat 600
attcacccgg atgctcttgc tgataagctc cttgctgctc tcggtccaag gttcatgggt 660
cctcttgcta tcttgaggat ttggagtttc tgtttgtttt atgtcatggc tgagctttgg 720
ggtagtgtgg ttatttcagt tctcttctgg ggctttgcta atcagatcac aactgtggat 780
gaagccaaga aattctatcc cttgttcgga cttggagcca atgttgcgct gattttctcc 840
ggaagaacgg tgaaatactt ttctaacttg agaaagaatc ttggtcctgg agttgatggc 900
tgggcagttt cattgaaagc catgatgagc attgtggtgg gaatggggct tgccatctgt 960
ttcctctatt ggtgggttaa tagatacgtt cctcttccaa ctcgtagcct gaagaagaag 1020
aacaaaccaa agatgggaac gatggagagc ttgaagttct tggtgtcatc accatacatt 1080
agggatcttg ctactttagt ggtagcgtat ggtattagta tcaaccttgt ggaagtcaca 1140
tggaaatcaa agcttaaagc tcagtttcct agcccgaacg agtactcggc gtttatgggt 1200
gacttctcaa cctgcactgg tattgcaaca ttcacaatga tgcttctcag tcaatacgta 1260
tttgataagt atggttgggg agtagctgca aagatcactc caactgttct cttattgact 1320
ggcgttgcct tcttctctct gatactgttt ggtggcccat tcgcaccact tgttgccaag 1380
cttggtatga ctccgctgct tgcagctgtt tatgttggtg ctctccagaa tatcttcagc 1440
aagagtgcca agtacagctt gttcgatcct tgtaaagaaa tggcttacat ccccttggat 1500
gaggatacca aggttaaagg gaaagctgca attgatgtgg tttgcaaccc gttagggaaa 1560
tcagggggtg ctctaataca gcagttcatg atcttatcct ttggatcact agccaattca 1620
acaccatacc taggaatgat actgttggtc attgtcactg catggttagc tgcagctaag 1680
tcactggagg gacagttcaa tgccttgagg tctgaagaag agctggagaa ggaaatggag 1740
agagcttcat cggtgaagat acctgttgtg tctcaagagg aaggtggaaa cggttccctt 1800
ggagaatcta caagcagttg gcctgagaaa tcagctccca ccaacatata a 1851
<210> 2
<211> 1848
<212> DNA
<213> Brassica napus (Brassica napus L.)
<400> 2
atggcaaccg tgatacaaac cagaggactt ctctccttac ccgccaaacc catcggagtg 60
aggagccttc tccagccatc ccacggctta aagcacagac ttttcgcctc caaaccgaga 120
aatccacctg ccttgtctct atcctctaac ggccaccaga aatttcaatc ctttgagcca 180
acccttcccg ggatttccat ttcccacaag gcgagaagca ccgagttcat atgcaaagcg 240
gaggcagcgt ccgccggcga aggcgacacg gcggcgattt cagcgtcgcc gaagatcttc 300
ggcgtggagg tcacgacctt gaaaaagata atacctttag ggttgatgtt cttttgcatt 360
ctgttcaact acacaatcct gagggacacg aaggacgtct tggtggtgac tgcgaaaggg 420
agctcagctg agattatacc tttcttgaag acgtgggtca atctccctat ggccattggc 480
ttcatgctcc tctacaccaa gctctccaat gttctctcca aaagggctct cttttacacc 540
gttatcatcc ctttcatcct ctactttggg gccttcggtt tcgtcatgta ccctctcagc 600
aactatattc accccgaagc tcttgctgat aagctcctcg ccactctcgg cccaaggttc 660
atgggtcctc ttgctatcct gaggatttgg agtttctgtt tgttttatgt catggctgag 720
ctttggggta gtgtcgtcat ttctgttctc ttctggggct ttgctaatca gataacaact 780
gtggatgaag ccaagaaatt ctatccttta ttcggacttg gagccaacgt tgcgctcatt 840
ttctctggaa gaacggtgaa atacttctct aacttgagaa agaatcttgg tcctggagtt 900
gacggatggg cagtttcact gaaagccatg atgagcattg tggttgggat gggacttgcc 960
atctgtttcc tctattggtg ggttaataca tatgttccgc ttcctgcccg tagccagaag 1020
aagaagaaca aaccgaagat gggaacgata gagagcttga agttcttggt gtcatcacca 1080
tacataaggg atcttgctac tttagtggtg gcgtatggta ttagtatcaa ccttgtggaa 1140
gtcacttgga aatcaaagct taaagctcag tttcctagcc cgaacgagta ctcagcattt 1200
atgggggact tctcaacctg caccggtatt gcaacattca cgatgatgct tctcagccaa 1260
tacgtatttg ataaatatgg ctggggagta gcagcaaaga tcaccccaac tgttctgcta 1320
ttgactggcg ttgccttctt ctccctgata ctgtttggcg gcccattcgc accacttgtt 1380
gccaagcttg gtatgactcc gctacttgca gctgtctatg ttggtgccct tcagaatata 1440
ttcagcaaga gtgccaagta cagcttgttc gatccctgta aagagatggc ctatatcccc 1500
ttggatgagg ataccaaggt taaagggaaa gctgcgattg acgtggtatg caacccgttg 1560
gggaaatcag ggggtgctct aatacagcag ttcatgatct tatcatttgg atcactagcc 1620
aattcaacgc cctacctagg aatgatattg ttggtcattg tcactgcctg gttagctgca 1680
gctaagtcgc tggagggaca gttcaacgct ttgaggtctg aggaagagct ggagaaggaa 1740
atggagagag cttcgtcggt gaagatccct gttgtgtctc aagatgaagg ttcccttgga 1800
gaatcttcaa gcagttcacc tgagaaatca gctcccacca acatatag 1848
<210> 3
<211> 1851
<212> DNA
<213> Brassica napus (Brassica napus L.)
<400> 3
atggaagcgg cgatacaaac cagaggaatc ctctccttac ccgccaaacc catcggagcg 60
agaagaagcc ttctccaccc atcccacggc ttaaagcata gacttttctc ctccaagcca 120
agaactccac ccgccttgtc cctctccttc aagaaagctc aatcctttga gccaacgatt 180
tccatttccc acaaggagag aagccacgag ttcatatgca aggcggaggc agacggagga 240
gctctcctca acgaaggcga caccgccgca gtcgtaccat caccaaagat cttcggcgtg 300
gaagtcacaa cgttgaaaaa gatcatacct ttaggcttaa tgttcttttg cattctgttc 360
aactacacga tcctgaggga cacgaaggat gttttggtgg tgacggcgaa aggaagttca 420
gctgagatta ttcccttttt gaagacgtgg gtcaatctcc ctatggctat tgggttcatg 480
ctcctctaca ccaagctctc caacgttctg tccaaaaagg ctctctttta caccgttatt 540
atccctttca tcatctactt tggggccttt ggtttcgtta tgtaccctct cagcaactat 600
attcacccgg aggctcttgc tgataagctc cttgctgctc tcggtccaag gttcatgggt 660
cctcttgcta tcttgaggat ttggagtttc tgtttgtttt atgtcatggc tgagctttgg 720
ggtagtgtgg ttatttcagt tctcttctgg ggctttgcta atcagatcac aactgtggat 780
gaagccaaga aattctaccc cttgtttgga ctcggagcca atgttgcgct gattttctct 840
ggaagaacgg tgaagtattt ttctaacttg agaaaaaatc ttggtcctgg agttgacggc 900
tgggcagttt cattgaaagc tatgatgagc attgttgtgg gaatgggact tgccatttgt 960
tttctatatt ggtgggttaa tagatacgtt cctcttccaa ctcgtagcct gaagaagaag 1020
aacaaaccta agatgggaac gatggagagc ttgaagttct tggtgtcatc accatacatt 1080
agagatcttg ctactttagt tgtggcgtat ggtattagta tcaaccttgt ggaagtcaca 1140
tggaaatcaa agcttaaagc tcagtttcct agcccaaacg actactcagc cttcatgggt 1200
gacttctcaa catgcactgg tattgcaaca ttcacaatga tgcttctcag tcaatacgta 1260
tttgataagt atggctgggg agtagctgcg aagatcactc caactgttct gttattgact 1320
ggtgtcgcct tcttctcttt gatattgttt ggtggcccat ttgcaccact tgttgccaag 1380
cttggtatga ctccgctact ggcagctgtt tatgttggtg ctctccagaa tatcttcagc 1440
aagagtgcca agtacagctt gttcgatcct tgtaaagaaa tggcttacat ccccttggat 1500
gaggatacca aggtcaaagg gaaagctgca attgacgtgg tttgcaaccc gttggggaaa 1560
tcagggggtg ctctaatcca acagttcatg atcttatcat ttggatcact agccaattca 1620
acaccatacc taggaatgat actgttggtc attgtcactg catggttagc tgcggctaag 1680
tcactggagg gacagttcaa tgcgttgagg tctgaagaag agctagagaa ggaaatggag 1740
agagcttcgt ctgtgaagat acctgttgtg tctcaagagg aaggtggaaa cggttctctt 1800
ggagaatcaa ctagcagttg gcctgagaaa tcagctccca ccaacatata a 1851
<210> 4
<211> 1845
<212> DNA
<213> Brassica napus (Brassica napus L.)
<400> 4
atggcaaccg cgattcaaac cagaggactt ctctccttac ccgccaaacc catcggagtg 60
aggagccttc tccagccctc ccacggctta aagcaccgcc ttttcgcctc caagccgaga 120
aatccacctg ccttgtctct atcctctaag aaatttcaat cctttgagcc aacccttccc 180
gggatttcca tttcccacaa gctgaggagc accgagttca tatgcaaggc ggagggagca 240
gcgtcctccg gcgacggaga cacggcggcg attgcagcgt cgccgaagat cttcggcgtg 300
gaggtcacga ccttgaaaaa gattatacct ttagggttga tgttcttttg cattctgttc 360
aattacacaa tcctgaggga cacgaaggac gtcttggtgg tgactgcgaa agggagctca 420
gctgagatta tacctttcct gaagacgtgg gtcaatctcc ctatggccat tggcttcatg 480
ctcctctaca ccaagctctc caatgttctc tccaaaaagg ctctctttta caccgttatc 540
atccctttca tcctctactt tggggccttc ggtttcgtca tgtaccctct cagcaactat 600
attcaccccg aagctcttgc tgataagctc cttgccactc tcggcccaag gttcatgggt 660
cctcttgcta tcctgaggat ttggagtttc tgtttgtttt atgtcatggc tgagctttgg 720
ggtagtgtgg tcatttctgt tctcttctgg ggctttgcta atcagatcac aactgtggat 780
gaagccaaga aattctatcc tttattcgga cttggagcca atgttgcgct cattttctct 840
ggaagaacgg tgaaatactt ctctaacttg agaaagaatc ttggtcctgg agttgacgga 900
tgggcagttt cactgaaagc catgatgagc attgtggttg ggatgggact tgccatctgt 960
ttcctctatt ggtgggtcaa tacatacgtt ccgcttccag cacgtagcca gaagaagaag 1020
aacaaaccga agatgggaac gatggagagc ttgaagttct tggtgtcatc accatacatt 1080
agagatcttg ctactttagt ggtggcgtat ggtattagta tcaacctcgt ggaagtcact 1140
tggaaatcaa agctcaaagc tcagttccct agcccgaacg agtactcagc atttatgggg 1200
gacttctcaa cctgcactgg tattgcaaca ttcacgatga tgcttctcag ccaatacgta 1260
tttgataagt atggttgggg agtagcagca aagatcaccc caactgttct gctattgact 1320
ggcgttgcct tcttctctct gatactgttt ggcggcccat tcgcaccact tgttgccaag 1380
cttggtatga ctccgttact cgcagctgtc tatgttggtg cccttcagaa tatattcagc 1440
aagagtgcca agtacagctt gttcgatcct tgtaaagaaa tggcctatat ccctttggat 1500
gaggacacca aggtcaaagg gaaagctgcg attgacgtgg tatgcaaccc gttggggaaa 1560
tcagggggtg ctctgataca gcagttcatg atcttatcat ttggatcact agccaattca 1620
acgccctacc taggaatgat cttgttggtc attgtcactg cgtggttagc tgcagctaag 1680
tcgctggagg gacagttcaa cgcgttgagg tctgaggaag agctggagaa ggaaatggag 1740
agagcttcgt cggtgaagat ccctgttgtg tctcaagatg aagaaggttc cctgggagaa 1800
tcttcaagca gttcacctga gaaatcagct cccaccaaca tttag 1845
<210> 5
<211> 616
<212> PRT
<213> Brassica napus (Brassica napus L.)
<400> 5
Met Glu Ala Ala Ile Gln Thr Arg Gly Ile Leu Ser Leu Pro Ala Lys
1 5 10 15
Pro Ile Gly Ala Arg Arg Ser Leu Leu His Pro Ser His Gly Leu Lys
20 25 30
His Arg Leu Phe Ser Ser Lys Pro Arg Thr Pro Pro Ala Leu Ser Leu
35 40 45
Ser Phe Lys Lys Ala Gln Ser Phe Asp Pro Lys Ile Ser Ile Ser His
50 55 60
Lys Glu Arg Thr Thr Glu Phe Ile Cys Lys Ala Glu Ala Asp Gly Gly
65 70 75 80
Ala Leu Leu Asn Glu Gly Asp Thr Ala Ala Ile Val Pro Ser Pro Lys
85 90 95
Ile Phe Gly Val Glu Val Thr Thr Leu Lys Lys Ile Ile Pro Leu Gly
100 105 110
Leu Met Phe Phe Cys Ile Leu Phe Asn Tyr Thr Ile Leu Arg Asp Thr
115 120 125
Lys Asp Val Leu Val Val Thr Ala Lys Gly Ser Ser Ala Glu Ile Ile
130 135 140
Pro Phe Leu Lys Thr Trp Val Asn Leu Pro Met Ala Ile Gly Phe Met
145 150 155 160
Leu Leu Tyr Thr Lys Leu Ser Asn Val Leu Ser Lys Lys Ala Leu Phe
165 170 175
Tyr Thr Val Ile Ile Pro Phe Ile Ile Tyr Phe Gly Ala Phe Gly Phe
180 185 190
Val Met Tyr Pro Leu Ser Asn Tyr Ile His Pro Asp Ala Leu Ala Asp
195 200 205
Lys Leu Leu Ala Ala Leu Gly Pro Arg Phe Met Gly Pro Leu Ala Ile
210 215 220
Leu Arg Ile Trp Ser Phe Cys Leu Phe Tyr Val Met Ala Glu Leu Trp
225 230 235 240
Gly Ser Val Val Ile Ser Val Leu Phe Trp Gly Phe Ala Asn Gln Ile
245 250 255
Thr Thr Val Asp Glu Ala Lys Lys Phe Tyr Pro Leu Phe Gly Leu Gly
260 265 270
Ala Asn Val Ala Leu Ile Phe Ser Gly Arg Thr Val Lys Tyr Phe Ser
275 280 285
Asn Leu Arg Lys Asn Leu Gly Pro Gly Val Asp Gly Trp Ala Val Ser
290 295 300
Leu Lys Ala Met Met Ser Ile Val Val Gly Met Gly Leu Ala Ile Cys
305 310 315 320
Phe Leu Tyr Trp Trp Val Asn Arg Tyr Val Pro Leu Pro Thr Arg Ser
325 330 335
Leu Lys Lys Lys Asn Lys Pro Lys Met Gly Thr Met Glu Ser Leu Lys
340 345 350
Phe Leu Val Ser Ser Pro Tyr Ile Arg Asp Leu Ala Thr Leu Val Val
355 360 365
Ala Tyr Gly Ile Ser Ile Asn Leu Val Glu Val Thr Trp Lys Ser Lys
370 375 380
Leu Lys Ala Gln Phe Pro Ser Pro Asn Glu Tyr Ser Ala Phe Met Gly
385 390 395 400
Asp Phe Ser Thr Cys Thr Gly Ile Ala Thr Phe Thr Met Met Leu Leu
405 410 415
Ser Gln Tyr Val Phe Asp Lys Tyr Gly Trp Gly Val Ala Ala Lys Ile
420 425 430
Thr Pro Thr Val Leu Leu Leu Thr Gly Val Ala Phe Phe Ser Leu Ile
435 440 445
Leu Phe Gly Gly Pro Phe Ala Pro Leu Val Ala Lys Leu Gly Met Thr
450 455 460
Pro Leu Leu Ala Ala Val Tyr Val Gly Ala Leu Gln Asn Ile Phe Ser
465 470 475 480
Lys Ser Ala Lys Tyr Ser Leu Phe Asp Pro Cys Lys Glu Met Ala Tyr
485 490 495
Ile Pro Leu Asp Glu Asp Thr Lys Val Lys Gly Lys Ala Ala Ile Asp
500 505 510
Val Val Cys Asn Pro Leu Gly Lys Ser Gly Gly Ala Leu Ile Gln Gln
515 520 525
Phe Met Ile Leu Ser Phe Gly Ser Leu Ala Asn Ser Thr Pro Tyr Leu
530 535 540
Gly Met Ile Leu Leu Val Ile Val Thr Ala Trp Leu Ala Ala Ala Lys
545 550 555 560
Ser Leu Glu Gly Gln Phe Asn Ala Leu Arg Ser Glu Glu Glu Leu Glu
565 570 575
Lys Glu Met Glu Arg Ala Ser Ser Val Lys Ile Pro Val Val Ser Gln
580 585 590
Glu Glu Gly Gly Asn Gly Ser Leu Gly Glu Ser Thr Ser Ser Trp Pro
595 600 605
Glu Lys Ser Ala Pro Thr Asn Ile
610 615
<210> 6
<211> 615
<212> PRT
<213> Brassica napus (Brassica napus L.)
<400> 6
Met Ala Thr Val Ile Gln Thr Arg Gly Leu Leu Ser Leu Pro Ala Lys
1 5 10 15
Pro Ile Gly Val Arg Ser Leu Leu Gln Pro Ser His Gly Leu Lys His
20 25 30
Arg Leu Phe Ala Ser Lys Pro Arg Asn Pro Pro Ala Leu Ser Leu Ser
35 40 45
Ser Asn Gly His Gln Lys Phe Gln Ser Phe Glu Pro Thr Leu Pro Gly
50 55 60
Ile Ser Ile Ser His Lys Ala Arg Ser Thr Glu Phe Ile Cys Lys Ala
65 70 75 80
Glu Ala Ala Ser Ala Gly Glu Gly Asp Thr Ala Ala Ile Ser Ala Ser
85 90 95
Pro Lys Ile Phe Gly Val Glu Val Thr Thr Leu Lys Lys Ile Ile Pro
100 105 110
Leu Gly Leu Met Phe Phe Cys Ile Leu Phe Asn Tyr Thr Ile Leu Arg
115 120 125
Asp Thr Lys Asp Val Leu Val Val Thr Ala Lys Gly Ser Ser Ala Glu
130 135 140
Ile Ile Pro Phe Leu Lys Thr Trp Val Asn Leu Pro Met Ala Ile Gly
145 150 155 160
Phe Met Leu Leu Tyr Thr Lys Leu Ser Asn Val Leu Ser Lys Arg Ala
165 170 175
Leu Phe Tyr Thr Val Ile Ile Pro Phe Ile Leu Tyr Phe Gly Ala Phe
180 185 190
Gly Phe Val Met Tyr Pro Leu Ser Asn Tyr Ile His Pro Glu Ala Leu
195 200 205
Ala Asp Lys Leu Leu Ala Thr Leu Gly Pro Arg Phe Met Gly Pro Leu
210 215 220
Ala Ile Leu Arg Ile Trp Ser Phe Cys Leu Phe Tyr Val Met Ala Glu
225 230 235 240
Leu Trp Gly Ser Val Val Ile Ser Val Leu Phe Trp Gly Phe Ala Asn
245 250 255
Gln Ile Thr Thr Val Asp Glu Ala Lys Lys Phe Tyr Pro Leu Phe Gly
260 265 270
Leu Gly Ala Asn Val Ala Leu Ile Phe Ser Gly Arg Thr Val Lys Tyr
275 280 285
Phe Ser Asn Leu Arg Lys Asn Leu Gly Pro Gly Val Asp Gly Trp Ala
290 295 300
Val Ser Leu Lys Ala Met Met Ser Ile Val Val Gly Met Gly Leu Ala
305 310 315 320
Ile Cys Phe Leu Tyr Trp Trp Val Asn Thr Tyr Val Pro Leu Pro Ala
325 330 335
Arg Ser Gln Lys Lys Lys Asn Lys Pro Lys Met Gly Thr Ile Glu Ser
340 345 350
Leu Lys Phe Leu Val Ser Ser Pro Tyr Ile Arg Asp Leu Ala Thr Leu
355 360 365
Val Val Ala Tyr Gly Ile Ser Ile Asn Leu Val Glu Val Thr Trp Lys
370 375 380
Ser Lys Leu Lys Ala Gln Phe Pro Ser Pro Asn Glu Tyr Ser Ala Phe
385 390 395 400
Met Gly Asp Phe Ser Thr Cys Thr Gly Ile Ala Thr Phe Thr Met Met
405 410 415
Leu Leu Ser Gln Tyr Val Phe Asp Lys Tyr Gly Trp Gly Val Ala Ala
420 425 430
Lys Ile Thr Pro Thr Val Leu Leu Leu Thr Gly Val Ala Phe Phe Ser
435 440 445
Leu Ile Leu Phe Gly Gly Pro Phe Ala Pro Leu Val Ala Lys Leu Gly
450 455 460
Met Thr Pro Leu Leu Ala Ala Val Tyr Val Gly Ala Leu Gln Asn Ile
465 470 475 480
Phe Ser Lys Ser Ala Lys Tyr Ser Leu Phe Asp Pro Cys Lys Glu Met
485 490 495
Ala Tyr Ile Pro Leu Asp Glu Asp Thr Lys Val Lys Gly Lys Ala Ala
500 505 510
Ile Asp Val Val Cys Asn Pro Leu Gly Lys Ser Gly Gly Ala Leu Ile
515 520 525
Gln Gln Phe Met Ile Leu Ser Phe Gly Ser Leu Ala Asn Ser Thr Pro
530 535 540
Tyr Leu Gly Met Ile Leu Leu Val Ile Val Thr Ala Trp Leu Ala Ala
545 550 555 560
Ala Lys Ser Leu Glu Gly Gln Phe Asn Ala Leu Arg Ser Glu Glu Glu
565 570 575
Leu Glu Lys Glu Met Glu Arg Ala Ser Ser Val Lys Ile Pro Val Val
580 585 590
Ser Gln Asp Glu Gly Ser Leu Gly Glu Ser Ser Ser Ser Ser Pro Glu
595 600 605
Lys Ser Ala Pro Thr Asn Ile
610 615
<210> 7
<211> 616
<212> PRT
<213> Brassica napus (Brassica napus L.)
<400> 7
Met Glu Ala Ala Ile Gln Thr Arg Gly Ile Leu Ser Leu Pro Ala Lys
1 5 10 15
Pro Ile Gly Ala Arg Arg Ser Leu Leu His Pro Ser His Gly Leu Lys
20 25 30
His Arg Leu Phe Ser Ser Lys Pro Arg Thr Pro Pro Ala Leu Ser Leu
35 40 45
Ser Phe Lys Lys Ala Gln Ser Phe Glu Pro Thr Ile Ser Ile Ser His
50 55 60
Lys Glu Arg Ser His Glu Phe Ile Cys Lys Ala Glu Ala Asp Gly Gly
65 70 75 80
Ala Leu Leu Asn Glu Gly Asp Thr Ala Ala Val Val Pro Ser Pro Lys
85 90 95
Ile Phe Gly Val Glu Val Thr Thr Leu Lys Lys Ile Ile Pro Leu Gly
100 105 110
Leu Met Phe Phe Cys Ile Leu Phe Asn Tyr Thr Ile Leu Arg Asp Thr
115 120 125
Lys Asp Val Leu Val Val Thr Ala Lys Gly Ser Ser Ala Glu Ile Ile
130 135 140
Pro Phe Leu Lys Thr Trp Val Asn Leu Pro Met Ala Ile Gly Phe Met
145 150 155 160
Leu Leu Tyr Thr Lys Leu Ser Asn Val Leu Ser Lys Lys Ala Leu Phe
165 170 175
Tyr Thr Val Ile Ile Pro Phe Ile Ile Tyr Phe Gly Ala Phe Gly Phe
180 185 190
Val Met Tyr Pro Leu Ser Asn Tyr Ile His Pro Glu Ala Leu Ala Asp
195 200 205
Lys Leu Leu Ala Asp Leu Gly Pro Arg Phe Met Gly Pro Leu Ala Ile
210 215 220
Leu Arg Ile Trp Ser Phe Cys Leu Phe Tyr Val Met Ala Glu Leu Trp
225 230 235 240
Gly Ser Val Val Ile Ser Val Leu Phe Trp Gly Phe Ala Asn Gln Ile
245 250 255
Thr Thr Val Asp Glu Ala Lys Lys Phe Tyr Pro Leu Phe Gly Leu Gly
260 265 270
Ala Asn Val Ala Leu Ile Phe Ser Gly Arg Thr Val Lys Tyr Phe Ser
275 280 285
Asn Leu Arg Lys Asn Leu Gly Pro Gly Val Asp Gly Trp Ala Val Ser
290 295 300
Leu Lys Ala Met Met Ser Ile Val Val Gly Met Gly Leu Ala Ile Cys
305 310 315 320
Phe Leu Tyr Trp Trp Val Asn Arg Tyr Val Pro Leu Pro Thr Arg Ser
325 330 335
Leu Lys Lys Lys Asn Lys Pro Lys Met Gly Thr Met Glu Ser Leu Lys
340 345 350
Phe Leu Val Ser Ser Pro Tyr Ile Arg Asp Leu Ala Thr Leu Val Val
355 360 365
Ala Tyr Gly Ile Ser Ile Asn Leu Val Glu Val Thr Trp Lys Ser Lys
370 375 380
Leu Lys Ala Gln Phe Pro Ser Pro Asn Glu Tyr Ser Ala Phe Met Gly
385 390 395 400
Asp Phe Ser Thr Cys Thr Gly Ile Ala Thr Phe Thr Met Met Leu Leu
405 410 415
Ser Gln Tyr Val Phe Asp Lys Tyr Gly Trp Gly Val Ala Ala Lys Ile
420 425 430
Thr Pro Thr Val Leu Leu Leu Thr Gly Val Ala Phe Phe Ser Leu Ile
435 440 445
Leu Phe Gly Gly Pro Phe Ala Pro Leu Val Ala Lys Leu Gly Met Thr
450 455 460
Pro Leu Leu Ala Ala Val Tyr Val Gly Ala Leu Gln Asn Ile Phe Ser
465 470 475 480
Lys Ser Ala Lys Tyr Ser Leu Phe Asp Pro Cys Lys Glu Met Ala Tyr
485 490 495
Ile Pro Leu Asp Glu Asp Thr Lys Val Lys Gly Lys Ala Ala Ile Asp
500 505 510
Val Val Cys Asn Pro Leu Gly Lys Ser Gly Gly Ala Leu Ile Gln Gln
515 520 525
Phe Met Ile Leu Ser Phe Gly Ser Leu Ala Asn Ser Thr Pro Tyr Leu
530 535 540
Gly Met Ile Leu Leu Val Ile Val Thr Ala Trp Leu Ala Ala Ala Lys
545 550 555 560
Ser Leu Glu Gly Gln Phe Asn Ala Leu Arg Ser Glu Glu Glu Leu Glu
565 570 575
Lys Glu Met Glu Arg Ala Ser Ser Val Lys Ile Pro Val Val Ser Gln
580 585 590
Glu Glu Gly Gly Asn Gly Ser Leu Gly Glu Ser Thr Ser Ser Trp Pro
595 600 605
Glu Lys Ser Ala Pro Thr Asn Ile
610 615
<210> 8
<211> 614
<212> PRT
<213> Brassica napus (Brassica napus L.)
<400> 8
Met Ala Thr Ala Ile Gln Thr Arg Gly Leu Leu Ser Leu Pro Ala Lys
1 5 10 15
Pro Ile Gly Val Arg Ser Leu Leu Gln Pro Ser His Gly Leu Lys His
20 25 30
Arg Leu Phe Ala Ser Lys Pro Arg Asn Pro Pro Ala Leu Ser Leu Ser
35 40 45
Ser Lys Lys Phe Gln Ser Phe Glu Pro Thr Leu Pro Gly Ile Ser Ile
50 55 60
Ser His Lys Leu Arg Ser Thr Glu Phe Ile Cys Lys Ala Glu Gly Ala
65 70 75 80
Ala Ser Ser Gly Asp Gly Asp Thr Ala Ala Ile Ala Ala Ser Pro Lys
85 90 95
Ile Phe Gly Val Glu Val Thr Thr Leu Lys Lys Ile Ile Pro Leu Gly
100 105 110
Leu Met Phe Phe Cys Ile Leu Phe Asn Tyr Thr Ile Leu Arg Asp Thr
115 120 125
Lys Asp Val Leu Val Val Thr Ala Lys Gly Ser Ser Ala Glu Ile Ile
130 135 140
Pro Phe Leu Lys Thr Trp Val Asn Leu Pro Met Ala Ile Gly Phe Met
145 150 155 160
Leu Leu Tyr Thr Lys Leu Ser Asn Val Leu Ser Lys Lys Ala Leu Phe
165 170 175
Tyr Thr Val Ile Ile Pro Phe Ile Leu Tyr Phe Gly Ala Phe Gly Phe
180 185 190
Val Met Tyr Pro Leu Ser Asn Tyr Ile His Pro Glu Ala Leu Ala Asp
195 200 205
Lys Leu Leu Ala Thr Leu Gly Pro Arg Phe Met Gly Pro Leu Ala Ile
210 215 220
Leu Arg Ile Trp Ser Phe Cys Leu Phe Tyr Val Met Ala Glu Leu Trp
225 230 235 240
Gly Ser Val Val Ile Ser Val Leu Phe Trp Gly Phe Ala Asn Gln Ile
245 250 255
Thr Thr Val Asp Glu Ala Lys Lys Phe Tyr Pro Leu Phe Gly Leu Gly
260 265 270
Ala Asn Val Ala Leu Ile Phe Ser Gly Arg Thr Val Lys Tyr Phe Ser
275 280 285
Asn Leu Arg Lys Asn Leu Gly Pro Gly Val Asp Gly Trp Ala Val Ser
290 295 300
Leu Lys Ala Met Met Ser Ile Val Val Gly Met Gly Leu Ala Ile Cys
305 310 315 320
Phe Leu Tyr Trp Trp Val Asn Thr Tyr Val Pro Leu Pro Ala Arg Ser
325 330 335
Gln Lys Lys Lys Asn Lys Pro Lys Met Gly Thr Met Glu Ser Leu Lys
340 345 350
Phe Leu Val Ser Ser Pro Tyr Ile Arg Asp Leu Ala Thr Leu Val Val
355 360 365
Ala Tyr Gly Ile Ser Ile Asn Leu Val Glu Val Thr Trp Lys Ser Lys
370 375 380
Leu Lys Ala Gln Phe Pro Ser Pro Asn Glu Tyr Ser Ala Phe Met Gly
385 390 395 400
Asp Phe Ser Thr Cys Thr Gly Ile Ala Thr Phe Thr Met Met Leu Leu
405 410 415
Ser Gln Tyr Val Phe Asp Lys Tyr Gly Trp Gly Val Ala Ala Lys Ile
420 425 430
Thr Pro Thr Val Leu Leu Leu Thr Gly Val Ala Phe Phe Ser Leu Ile
435 440 445
Leu Phe Gly Gly Pro Phe Ala Pro Leu Val Ala Lys Leu Gly Met Thr
450 455 460
Pro Leu Leu Ala Ala Val Tyr Val Gly Ala Leu Gln Asn Ile Phe Ser
465 470 475 480
Lys Ser Ala Lys Tyr Ser Leu Phe Asp Pro Cys Lys Glu Met Ala Tyr
485 490 495
Ile Pro Leu Asp Glu Asp Thr Lys Val Lys Gly Lys Ala Ala Ile Asp
500 505 510
Val Val Cys Asn Pro Leu Gly Lys Ser Gly Gly Ala Leu Ile Gln Gln
515 520 525
Phe Met Ile Leu Ser Phe Gly Ser Leu Ala Asn Ser Thr Pro Tyr Leu
530 535 540
Gly Met Ile Leu Leu Val Ile Val Thr Ala Trp Leu Ala Ala Ala Lys
545 550 555 560
Ser Leu Glu Gly Gln Phe Asn Ala Leu Arg Ser Glu Glu Glu Leu Glu
565 570 575
Lys Glu Met Glu Arg Ala Ser Ser Val Lys Ile Pro Val Val Ser Gln
580 585 590
Asp Glu Glu Gly Ser Leu Gly Glu Ser Ser Ser Ser Ser Pro Glu Lys
595 600 605
Ser Ala Pro Thr Asn Ile
610