Cas phi-2 protein for rice gene editing and expression cassette and expression vector thereof
阅读说明:本技术 用于水稻基因编辑的CasΦ-2蛋白及其表达盒子和表达载体 (Cas phi-2 protein for rice gene editing and expression cassette and expression vector thereof ) 是由 王高华 段芳 谢先荣 刘伟智 于 2021-09-10 设计创作,主要内容包括:本发明公开了一种用于水稻基因编辑的CasΦ-2蛋白及其表达盒子和表达载体,CasΦ-2蛋白的N端增加1个核定位信号肽氨基酸序列,在C端增加3个核定位信号肽氨基酸序列。CasΦ-2蛋白的CrRNA表达盒子包括基因编辑靶点、启动子和CasΦ-2蛋白的CrRNA,CrRNA的核苷酸序列两端分别连接有1个tRNA序列;表达载体含有上述表达盒子和CasΦ-2蛋白的核苷酸序列。上述表达载体能够有效实现水稻基因的敲除编辑。(The invention discloses a Cas phi-2 protein for rice gene editing, an expression cassette and an expression vector thereof, wherein 1 nuclear localization signal peptide amino acid sequence is added at the N end of the Cas phi-2 protein, and 3 nuclear localization signal peptide amino acid sequences are added at the C end. The CrRNA expression cassette of the Cas phi-2 protein comprises a gene editing target, a promoter and CrRNA of the Cas phi-2 protein, and two ends of a nucleotide sequence of the CrRNA are respectively connected with 1 tRNA sequence; the expression vector contains the expression cassette and the nucleotide sequence of the Cas phi-2 protein. The expression vector can effectively realize the knock-out and editing of the rice gene.)
1. A Cas phi-2 protein for rice gene editing is characterized in that 1 nuclear localization signal peptide amino acid sequence is added at the N end of the amino acid sequence of the Cas phi-2 protein, and 3 nuclear localization signal peptide amino acid sequences are added at the C end.
2. The Cas Φ -2 protein for rice gene editing according to claim 1, wherein the amino acid sequence of the nuclear localization signal peptide added at the N-terminal of the amino acid sequence of the Cas Φ -2 protein is SV40 nuclear localization signal peptide amino acid sequence, and the amino acid sequences of the 3 nuclear localization signal peptides added at the C-terminal are sequentially 2 SV40 nuclear localization signal peptide amino acid sequences and 1 NLS nuclear localization signal peptide amino acid sequence.
3. The Cas Φ -2 protein for rice gene editing according to claim 2, wherein the amino acid sequence of the Cas Φ -2 protein is shown as SEQ ID No.1, and the nucleotide sequence of the Cas Φ -2 protein is shown as SEQ ID No. 2.
4. A Cas phi-2 protein expression vector for rice gene editing, which is characterized in that a blank vector contains a nucleotide sequence of the Cas phi-2 protein of any one of claims 1 to 3.
5. The Cas Φ -2 protein expression vector of claim 4, wherein the blank vector used is pCAMBIA1300 vector, and the nucleotide for transcribing the Cas Φ -2 protein uses maize UBI promoter and NOS terminator;
the nucleotide sequence of the corn UBI promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the NOS terminator is shown in SEQ ID NO. 4.
6. A CrRNA expression cassette of Cas phi-2 protein for rice gene editing is characterized by comprising a CrRNA expression cassette with no load and a gene editing target point designed aiming at a corresponding rice gene;
the CrRNA expression cassette contains CrRNA of Cas phi-2 protein as claimed in any one of claims 1-3 in an unloaded state, and also contains a promoter for transcribing a corresponding rice gene editing target, and both ends of the nucleotide sequence of the CrRNA are respectively provided with 1 tRNA sequence.
7. The CrRNA expression cassette of Cas Φ -2 protein according to claim 6, wherein the rice gene is an OsBEL gene, the nucleotide sequence of the gene editing target is shown as SEQ ID No.5, and the nucleotide sequence of OsU6a promoter which starts the OsBEL target of the rice gene is shown as SEQ ID No. 6; the nucleotide sequence of CrRNA of the Cas phi-2 protein is shown as SEQ ID NO. 7; the nucleotide sequence of the tRNA sequence is shown as SEQ ID NO. 8; the no-load nucleotide sequence of the CrRNA expression cassette is shown as SEQ ID NO. 9;
the primers used for assembling the CrRNA expression cassette of the Cas phi-2 protein are as follows:
BEL-F:ggacCATCTCCTTCTAGAAGCACA;
BEL-R:tgttTGTGCTTCTAGAAGGAGATG;
the specific assembly mode is as follows: taking 1 mul of BEL-F primer, 1 mul of BEL-R primer and 8 mul of sterile water, firstly denaturing at 95 ℃, and then annealing at 55 ℃ to obtain BEL primer mixed solution; and then taking 1 mu l of BEL primer mixed solution, forming a10 mu l mixed system with 30ng of CrRNA expression cassette no-load, 1 mu l of 10 XCutSmart Buffer, 35U T4 DNA ligase, 10U of Bsal restriction endonuclease and sterile water, and culturing at 37 ℃ for 1h to prepare the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein.
8. A complete expression vector of Cas phi-2 protein for rice gene editing is characterized in that the complete expression vector of Cas phi-2 protein is connected with the Cas phi-2 protein expression vector of claim 4 or 5, and is further connected with a CrRNA expression cassette of Cas phi-2 protein of claim 6 or 7.
9. The complete expression vector of Cas phi-2 protein of claim 8, which is formed by amplifying a CrRNA expression cassette of the Cas phi-2 protein by using primers Pps-R and Pgs-L, and then assembling and connecting the CrRNA expression cassette with the Cas phi-2 protein expression vector by BsaI and T4 DNA ligase;
the primers Pps-R and Pgs-L are as follows:
Pps-R:TAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG;
Pgs-L:AGTGggtctcGctcgACGCGTATCCATCCACTCCAAGCTC。
10. the complete expression vector of Cas Φ -2 protein according to claim 9, characterized in that its nucleotide sequence is shown in SEQ ID No. 10.
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a Cas phi-2 protein for rice gene editing, and an expression cassette and an expression vector thereof.
Background
Cas Φ (Cas12j) is evolved from a V-type CRISPR-Cas protein, a Cas protein family encoded in a phage clade comprises a C-terminal RuvC domain, has far-source homology with the domain of TnpB nuclease superfamily, and a single RuvC active site of the Cas Φ can perform crRNA processing and DNA cleavage. However, Cas Φ has < 7% amino acid homology with other V-type CRISPR-Cas proteins and is most closely related to the TnpB group, which is different from the V-type (Cas14) protein.
The molecular weight of Cas Φ is exceptionally small, about 70 to 80kDa, about half the size of Cas9 and Cas12 a. The protein has the characteristics of small molecular weight of Cas phi and wide PAM site coverage, the PAM sequence of the protein is 'TTN', the editing range of the protein on eukaryotic genome can be expanded, the operability and the selectivity of gene editing suitable for different eukaryotes are expanded, and the protein is particularly beneficial to vector-based cell delivery and wider targetable genome sequence, so that the protein can provide powerful supplement for a CRISPR-Cas toolbox.
Cas Φ -2 is derived from one of the Cas Φ orthologs in the phage. The PAM site is also the T/A-rich region "TTN". The cleavage mode of Cas phi-2 nuclease is very similar to that of Cas12a, both PAM sites are rich in T/A regions, like the PAM sites of LbCpf1 and AsCpf1 are both used for recognizing 'TTTN', and the PAM site of Cas phi-2 is used for recognizing 'TTN' and FnCpf1 similarly; in addition like LbCpf1, the cleavage site cleaves a 4 or 5 base sticky end at 19-24bp away from the PAM site, whereas Cas Φ -2 also cleaves at 12-18bp away from the PAM site; furthermore, the mutation types generated by the two are mainly multi-base deletion of more than 5 bp; both contain only CrRNA, and no tracrRNA is required. The difference between the two is the effective length of the target, the size of the protein, and the CrRNA recognized.
Existing studies have shown that the Cas Φ -2 nuclease mutation type in arabidopsis protoplasts mainly causes deletions of 8 to 10bp in the genome.
In the prior art, for example, Chinese patent application CN109306358A provides a method for creating a two-line sterile line of non-neck rice by using CRISPR/Cas9 technology, the method designs a target sequence according to an EUI gene coding sequence in the rice, and constructs a pCRISPR/Cas9-EUI-gRNA recombinant vector containing a target sequence fragment; transforming rice callus by agrobacterium to obtain transgenic seedling; and (3) carrying out positive screening, sequencing analysis and transgenic element detection on the transgenic seedling to obtain the functional deletion mutant without transgenic components.
For example, the method for performing site-directed mutagenesis on a rice BADH2 gene by using a CRISPR-CAS9 technology provided by Chinese patent application CN106676130A is to design a sgRNA sequence based on CRISPR/Cas9 for the rice BADH2 gene, connect a DNA fragment containing the sgRNA sequence to a vector carrying the CRISPR/Cas to transform rice, and realize the site-directed mutagenesis on the rice BADH2 gene. Wherein, the nucleotide sequence of the sgRNA action site is shown as SEQ ID NO. 1. According to the invention, the rice endogenous gene BADH2 is edited by a CRISPR/CAS9 technology, so that a BADH2 mutant is obtained, and the method is more convenient and efficient in creating fragrant rice germplasm resources.
Also for example, the CRISPR-Cas Φ from human genes is a supercompact genome editor (Patrick Pansch et al) discloses a CRISPR-Cas Φ system that uses a single active site for CRISPR RNA (crRNA) treatment and crRNA-guided DNA cleavage targeting foreign nucleic acids, capable of causing mainly 8 to 10bp deletions in the genome of Cas Φ -2 nuclease mutation types in arabidopsis protoplasts. However, no corresponding technical basis is provided for the successful application of the Cas phi-2 nuclease in rice gene editing.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides the Cas phi-2 protein for rice gene editing, an expression cassette and an expression vector thereof, and the application effect of the Cas phi-2 nuclease in rice gene editing is explored, so that the range of gene editing is widened; specifically, the following technique is used.
A Cas phi-2 protein for rice gene editing is characterized in that 1 nuclear localization signal peptide amino acid sequence is added at the N end of the amino acid sequence of the Cas phi-2 protein, and 3 nuclear localization signal peptide amino acid sequences are added at the C end.
The position of the cut DNA of the Cas phi-2 protein is 12-18bp of a target point, most of the generated mutations are base deletion mutations, the defects of small insertion base and deletion mutation range of the Cas9 can be effectively avoided, and the requirement of small-range fragment deletion can be met according to the experimental purpose. Although the way of cutting DNA of Cas phi-2 protein is similar to that of Cpf1 nuclease, the target sequence of Cas phi-2 is shorter (18-20bp), and the target of Cpf1 is longer, which are obviously different.
The Cas phi-2 protein provided by the invention is optimized in sequence based on the traditional nucleotide (or amino acid) sequence according to the preference of rice codons, 1 nuclear localization sequence is added at the N end, and 3 nuclear localization sequences are added at the C end. Through the optimization, the rice gene editing by the Cas phi-2 protein is realized.
Preferably, in the Cas Φ -2 protein, the amino acid sequence of the nuclear localization signal peptide added at the N-terminal of the amino acid sequence of the Cas Φ -2 protein is SV40 nuclear localization signal peptide amino acid sequence, and the amino acid sequences of the 3 nuclear localization signal peptides added at the C-terminal are sequentially 2 SV40 nuclear localization signal peptide amino acid sequences and 1 NLS nuclear localization signal peptide amino acid sequence.
Preferably, the amino acid sequence of the Cas Φ -2 protein is shown as SEQ ID No.1, and the nucleotide sequence of the Cas Φ -2 protein is shown as SEQ ID No. 2.
The invention also provides a Cas phi-2 protein expression vector for rice gene editing, which contains the nucleotide sequence of any Cas phi-2 protein on a blank vector. The Cas phi-2 protein expression vector can be assembled together with a CrRNA expression cassette of the Cas phi-2 protein to obtain a corresponding complete expression vector of the Cas phi-2 protein.
Preferably, in the above Cas Φ -2 protein expression vector, the blank vector used is pCAMBIA1300 vector, and the nucleotide for transcribing Cas Φ -2 protein uses maize UBI promoter and NOS terminator; the nucleotide sequence of the corn UBI promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the NOS terminator is shown in SEQ ID NO. 4.
As a preferable mode, the Cas phi-2 protein expression vector can be formed by transcribing the nucleotide sequence of the Cas phi-2 protein by using a corn UBI promoter (the nucleotide sequence is shown as SEQ NO. 4) and finally cloning the nucleotide sequence to a blank vector by using an NOS terminator (the nucleotide sequence is shown as SEQ NO. 5).
The invention also provides a CrRNA expression cassette of the Cas phi-2 protein for rice gene editing, which comprises no load of the CrRNA expression cassette and a gene editing target point designed aiming at the corresponding rice gene;
the CrRNA expression cassette comprises the CrRNA of the Cas phi-2 protein in an empty load manner, and also comprises a promoter for transcribing a corresponding rice gene editing target, wherein two ends of a nucleotide sequence of the CrRNA are respectively provided with 1 tRNA sequence.
The CrRNA expression cassette of the Cas phi-2 protein is formed by designing a gene editing target sequence aiming at a specific rice gene, assembling a promoter, CrRNA and tRNA of a transcription gene editing target into a CrRNA expression cassette with no load, and then assembling and connecting the gene editing target and the CrRNA expression cassette with no load. The gene editing target point can be designed according to the selected rice gene segment. A tRNA sequence is added at each of two ends of CrRNA of the Cas phi-2 protein, so that the generation efficiency of the CrRNA in rice cells is improved; in addition, the rice OsU6a promoter can be selected to transcribe the CrRNA of the Cas phi-2.
Preferably, in the CrRNA expression cassette for Cas Φ -2 protein, the targeted rice gene is the OsBEL gene, the nucleotide sequence of the gene editing target is shown in SEQ ID No.5, and the nucleotide sequence of the OsU6a promoter which initiates the target of the rice gene OsBEL is shown in SEQ ID No. 6; the nucleotide sequence of CrRNA of the Cas phi-2 protein is shown as SEQ ID NO. 7; the nucleotide sequence of the tRNA sequence is shown as SEQ ID NO. 8; the no-load nucleotide sequence of the CrRNA expression cassette is shown as SEQ ID NO. 9;
the primers used for assembling the CrRNA expression cassette of the Cas phi-2 protein are as follows:
BEL-F:ggacCATCTCCTTCTAGAAGCACA;
BEL-R:tgttTGTGCTTCTAGAAGGAGATG;
the specific assembly mode is as follows: taking 1 mul BEL-F, 1 mul BEL-R and 8 mul sterile water (putting into an EP tube), denaturing at 95 ℃ on a PCR amplification instrument, and annealing at 55 ℃ to obtain BEL primer mixed solution; and then taking 1 mu l of BEL primer mixed solution, forming a10 mu l mixed system with 30ng of CrRNA expression cassette no-load, 1 mu l of 10 XCutSmart Buffer, 35U T4 DNA ligase, 10U of Bsal restriction endonuclease and sterile water, and culturing at 37 ℃ for 1h to prepare the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein.
The expression cassette OsU6a-CrRNA-BEL was verified in the following manner: and (3) converting the product mixed solution into escherichia coli receptive peptide cells, and then carrying out bacteria detection and sequencing confirmation.
The invention also provides a complete expression vector of the Cas phi-2 protein for rice gene editing, wherein the complete expression vector of the Cas phi-2 protein is connected with the Cas phi-2 protein expression vector of claim 4 or 5, and is also connected with a CrRNA expression cassette of the Cas phi-2 protein of claim 6 or 7.
Preferably, the complete expression vector of the Cas phi-2 protein is formed by amplifying a CrRNA expression cassette of the Cas phi-2 protein by using primers Pps-R and Pgs-L, and then assembling and connecting BsaI and T4 DNA ligase with the Cas phi-2 protein expression vector;
the primers Pps-R and Pgs-L are as follows:
Pps-R:TAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG;
Pgs-L:AGTGggtctcGctcgACGCGTATCCATCCACTCCAAGCTC。
the complete expression vector of the Cas phi-2 protein prepared by the method can be transformed into rice callus to be expressed by virtue of the engineered agrobacterium EHA 105.
Preferably, the nucleotide sequence of the complete expression vector of the Cas phi-2 protein is shown as SEQ ID No. 10.
Compared with the prior art, the invention has the advantages that: the invention provides a Cas phi-2 protein for rice gene editing, a Cas phi-2 protein expression vector and a CrRNA expression cassette are obtained based on the Cas phi-2 protein, and a complete expression vector of the Cas phi-2 protein is obtained after the Cas phi-2 protein expression vector and the CrRNA expression cassette are assembled, the complete expression vector is transformed into EHA105 agrobacterium and then infects rice callus, the expression of the complete expression vector in the rice callus can be realized, and the rice gene knock-out editing is realized.
Drawings
FIG. 1 is the structure of an example CrRNA expression cassette OsU6a-CrRNA-BEL vector for Cas Φ -2 protein;
fig. 2 is a structure of an example Cas Φ -2 protein expression vector;
FIG. 3 is a schematic diagram of an unloaded structure of a CrRNA expression cassette of an example Cas Φ -2 protein;
FIG. 4 is a schematic structural diagram of an example target-free expression vector pEGCas Φ -2Pubi-H-OsU6a-CrRNA for Cas Φ -2 protein;
FIG. 5 is a schematic structural diagram of an example complete expression vector for Cas Φ -2 protein pEGCas Φ -2Pubi-H-OsU6 a-CrRNA-BEL;
FIG. 6 is a schematic diagram of the BEL-11 and BEL-31 amplification band electrophoresis of the examples;
FIG. 7 is a graph showing the results of sequencing analysis of the BEL-11 sample according to the example;
FIG. 8 is a diagram showing the results of sequencing analysis of the BEL-31 sample of the example.
Detailed Description
The technical solutions of the present invention will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Examples
In this example, the rice OsBEL gene (LOC _ Os03g55240) was selected as a research subject for testing, and the specific test steps are as follows:
1. designing an OsBEL gene editing target: TTTCATCTCCTTCTAGAAGCACA, PAM site is TTT, as shown in SEQ ID NO. 5.
2. Target spot assembly to obtain CrRNA expression cassette of Cas phi-2 protein
Assembling the OsBEL gene editing target, OsU6a promoter (nucleotide sequence is shown as SEQ ID NO. 6) and CrRNA (nucleotide sequence is shown as SEQ ID NO. 7);
primers used for OsBEL gene editing target assembly were as follows:
BEL-F:ggacCATCTCCTTCTAGAAGCACA;
BEL-R:tgttTGTGCTTCTAGAAGGAGATG;
the specific assembly mode is as follows: taking 1 mul BEL-F, 1 mul BEL-R and 8 mul sterile water (putting into an EP tube), denaturing at 95 ℃ on a PCR amplification instrument, and annealing at 55 ℃ to obtain BEL primer mixed solution; then 1 mul BEL primer mixed solution is taken to be combined with 30ng CrRNA expression cassette no-load, 1 mul 10 XCutSmart Buffer, 35U T4 DNA ligase, 10U Bsal restriction enzyme and sterile water to form a10 mul mixed system, and the mixed system is cultured for 1h at 37 ℃;
and transforming the connected mixed solution into an escherichia coli receptive peptide cell, and finally forming the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein through bacterial detection and sequencing confirmation.
The CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein consists of a CrRNA expression cassette no-load and a gene editing target point of a rice gene OsBEL; the CrRNA expression cassette comprises CrRNA of Cas phi-2 protein on no load and also comprises OsU6a promoter for transcribing rice gene OsBEL target, and two ends of the nucleotide sequence of the CrRNA are respectively provided with 1 tRNA sequence, as shown in figure 3; the specific structure diagram of the expression cassette is shown in FIG. 1, two segments of CrRNA are respectively provided with 1 tRNA sequence, and the T position is used for assembling and connecting a target point sequence BEL;
the nucleotide sequence of the tRNA sequence is shown as SEQ ID NO. 8; the nucleotide sequence of the CrRNA expression cassette in no-load is shown as SEQ ID NO. 9;
3. construction of Cas phi-2 protein expression vector
Selecting a blank vector pCAMBIA1300, transcribing a nucleotide sequence of a Cas phi-2 protein by using a corn UBI promoter (shown as SEQ ID NO. 3), and cloning a nucleic acid sequence (shown as SEQ ID NO. 4) to the pCAMBIA1300 to construct a Cas phi-2 rice expression vector; assembling a nucleotide sequence of the Cas phi-2 protein on a blank vector to obtain a Cas phi-2 protein expression vector for rice gene OsBEL gene editing; the amino acid sequence of the Cas phi-2 protein is shown as SEQ ID NO.1, the nucleotide sequence is shown as SEQ ID NO.2, and the nucleotide contains a terminator TAG; the specific structure diagram of the expression vector is shown in figure 2, the left side (N end) of the nucleotide sequence of the Cas phi-2 protein is provided with 1 nucleotide sequence of SV40 nuclear localization signal peptide, and the right side (C end) is provided with 2 nucleotide sequences of SV40 nuclear localization signal peptide and 1 nucleotide sequence of NLS nuclear localization signal peptide;
the assembly mode of the Cas phi-2 protein expression vector is as follows:
(1) modified pCAMBIA1300 vector
CCDB-F:GctatgaccatgattacgaattcCTCGAGAGACCTCTGAAGTG
CCDB-R:AcgacggccagtgccaagcttACCGCGAGACCCACGCTCACC
Firstly, carrying out double enzyme digestion on a pCAMBIA1300 vector by using EcoRI/HindIII;
the enzyme cutting system is as follows: adding sterile water to 50 mu.l of 2 mu.g of pCAMBIA1300 vector, 1 mu.l of EcoRI restriction endonuclease, 1 mu.l of HindIII restriction endonuclease and 5 mu.l of 10 XFastdigest Green Buffer, then reacting in an incubator at 37 ℃ for 1 hour, and recovering the pCAMBIA1300 vector after enzyme digestion by using a gel recovery kit;
the ccdB structure containing BsaI enzyme cutting sites is amplified by using primers CCDB-F and CCDB-R, and the amplification system is as follows:
PCR reaction parameters:
then recovering the amplified CCDB fragment by using a gel recovery kit;
(2) construction of pEG-ccdB intermediate vector
Constructing pEG-ccdB empty load by using a Gibson assembly mode;
the reaction system is as follows: 5 mul of Gibson assembly mix, 50ng of digested pCAMBIA1300 vector and 50ng of CCDB recovered fragment, adding water to 10 mul, reacting on a PCR instrument for 30min, then converting the reaction solution into DB3.1 escherichia coli sensory peptide cells, and then performing bacteria detection and sequencing confirmation to finally form the pEG-ccdB intermediate vector;
(3) construction of empty Cas Φ -2 expression vector
UBI-F:AGTGggtctcGctcgCGGCCATGCGGCCGCAAGCTGGGT
UBI-R:TAGAggtctcTGGTGGCTGCAGAAGTAACACCAAACAACA
CasF2-F:AGTGggtctcGCACCATGCCGAAGAAGAAGCGCAAGGTGTCC CasF2-R:TAGAggtctcTTCACCGCTACTTCTTTTTCTTAGCCTGTCCGGCC TTTTTGG
NOS-F:AGTGggtctcGGTGATCCTCCCGATCGTTCAAACA
NOS-R:TAGAggtctcTaccgGGCGCGCCTGCTCCCGATCTAGTAAC
Respectively amplifying UBI promoter fragments and NOS sequences by using the three pairs of primers, wherein templates of the two sequences are pYLCRISPR/Cas9Pubi-H vector (from laboratory of Liu dazzling academy of Siamese, university of southern China), and a Cas phi-2 sequence template is synthesized according to a whole gene of SEQ ID NO. 2; the amplification system and the reaction conditions were determined in accordance with the above step (1);
and (3) recovering the 3 fragments by using a gel recovery kit, and performing enzyme digestion and connection by using a Golden Gate mode: an enzyme linked system 100ng UBI fragment, 20ng NOS fragment, 100ng Cas phi-2 fragment, 50ng pEG-ccdB, 1 mul 10 xCutSmart Buffer, 35U T4 DNA ligase, 10U BsaI restriction endonuclease and sterile water form a mixed system 10 mul, the mixed system reacts for 1h in a 37 ℃ incubator, the mixed solution after connection is transformed into DH5 alpha escherichia coli receptive peptide cells, and then the cells are subjected to bacteria detection and sequencing confirmation to finally form the Cas phi-2 protein expression vector.
4. Construction of complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL for editing rice gene OsBEL
Primers for assembling the complete expression vector of the Cas Φ -2 protein were as follows:
Pps-R:TAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG;
Pgs-L:AGTGggtctcGctcgACGCGTATCCATCCACTCCAAGCTC;
firstly, the primers Pps-R and Pgs-L are used for carrying out PCR amplification on the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein, and the amplification system of the CrRNA expression cassette of the Cas phi-2 protein is as follows:
PCR reaction parameters:
then BsaI and T4 DNA ligase are used for assembling and connecting a CrRNA expression box OsU6a-CrRNA-BEL and the Cas phi-2 protein expression vector in a Golden Gate mode to construct and obtain a complete Cas phi-2 protein complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL, the nucleotide sequence is shown as SEQ ID NO.10, the T position in figure 4 is the assembling position of the BEL target point in the Cas phi-2 protein complete expression vector, and figure 5 is a schematic diagram of the Cas phi-2 protein complete expression vector for completing the assembling of the BEL target point.
5. Genetic transformation of Cas phi-2 protein complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL
Transforming the complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL obtained by construction into EHA105 agrobacterium, infecting rice callus, screening the rice callus for 2 times by hygromycin B antibiotic, differentiating and rooting to form complete rice seedlings, and carrying out molecular level detection and identification.
6. Detection of mutation type of rice gene OsBEL
(1) Design of detection primer (amplification band 544bp)
BEL(det+):GGAGTGAGTAGAAGTAATCGCC
BEL(det-):AGGTCACGTCGTGCTCGGTGAA
(2) PCR amplification conditions
PCR amplification was carried out using the primers BEL (det +) and BEL (det-):
the PCR reaction parameters were as follows:
the PCR products were analyzed by electrophoresis on a 1.5% agarose gel. As can be seen from FIG. 6, the BEL-11 and BEL-31 samples are two bright bands on the right side, around 544 bp.
(3) Sequencing analysis of PCR product sanger
The PCR products of the above 81 samples were sent to sanger sequencing, and the results of the sequencing were analyzed by using DSDecode software, wherein the results of 2 samples were compiled as shown in FIGS. 7 and 8. As can be seen from FIGS. 7 and 8, the present experiment showed a total of 81 sequencing samples, of which only two samples BEL-11 and BEL-31 were edited with an editing efficiency of 2.5%, and Sanger sequencing data of the BEL-11 and BEL-31 samples analyzed by decoding with DSDecode software showed that 11 bases were deleted from the BEL-11 sample and 18 bases were deleted from the BEL-31 sample. Therefore, the complete expression vector pEGCas phi-2 Pubi-H-OsU 6-6 a-CrRNA-BEL of the Cas phi-2 protein obtained by the method can play a role in gene knockout and editing of the rice gene OsBEL.
Sequence listing
<110> Wuhan Aidi crystal Biotech Co., Ltd
<120> Cas phi-2 protein for rice gene editing and expression cassette and expression vector thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 810
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Pro Lys Lys Lys Arg Lys Val Ser Gly Gly Ser Pro Lys Pro Ala
1 5 10 15
Val Glu Ser Glu Phe Ser Lys Val Leu Lys Lys His Phe Pro Gly Glu
20 25 30
Arg Phe Arg Ser Ser Tyr Met Lys Arg Gly Gly Lys Ile Leu Ala Ala
35 40 45
Gln Gly Glu Glu Ala Val Val Ala Tyr Leu Gln Gly Lys Ser Glu Glu
50 55 60
Glu Pro Pro Asn Phe Gln Pro Pro Ala Lys Cys His Val Val Thr Lys
65 70 75 80
Ser Arg Asp Phe Ala Glu Trp Pro Ile Met Lys Ala Ser Glu Ala Ile
85 90 95
Gln Arg Tyr Ile Tyr Ala Leu Ser Thr Thr Glu Arg Ala Ala Cys Lys
100 105 110
Pro Gly Lys Ser Ser Glu Ser His Ala Ala Trp Phe Ala Ala Thr Gly
115 120 125
Val Ser Asn His Gly Tyr Ser His Val Gln Gly Leu Asn Leu Ile Phe
130 135 140
Asp His Thr Leu Gly Arg Tyr Asp Gly Val Leu Lys Lys Val Gln Leu
145 150 155 160
Arg Asn Glu Lys Ala Arg Ala Arg Leu Glu Ser Ile Asn Ala Ser Arg
165 170 175
Ala Asp Glu Gly Leu Pro Glu Ile Lys Ala Glu Glu Glu Glu Val Ala
180 185 190
Thr Asn Glu Thr Gly His Leu Leu Gln Pro Pro Gly Ile Asn Pro Ser
195 200 205
Phe Tyr Val Tyr Gln Thr Ile Ser Pro Gln Ala Tyr Arg Pro Arg Asp
210 215 220
Glu Ile Val Leu Pro Pro Glu Tyr Ala Gly Tyr Val Arg Asp Pro Asn
225 230 235 240
Ala Pro Ile Pro Leu Gly Val Val Arg Asn Arg Cys Asp Ile Gln Lys
245 250 255
Gly Cys Pro Gly Tyr Ile Pro Glu Trp Gln Arg Glu Ala Gly Thr Ala
260 265 270
Ile Ser Pro Lys Thr Gly Lys Ala Val Thr Val Pro Gly Leu Ser Pro
275 280 285
Lys Lys Asn Lys Arg Met Arg Arg Tyr Trp Arg Ser Glu Lys Glu Lys
290 295 300
Ala Gln Asp Ala Leu Leu Val Thr Val Arg Ile Gly Thr Asp Trp Val
305 310 315 320
Val Ile Asp Val Arg Gly Leu Leu Arg Asn Ala Arg Trp Arg Thr Ile
325 330 335
Ala Pro Lys Asp Ile Ser Leu Asn Ala Leu Leu Asp Leu Phe Thr Gly
340 345 350
Asp Pro Val Ile Asp Val Arg Arg Asn Ile Val Thr Phe Thr Tyr Thr
355 360 365
Leu Asp Ala Cys Gly Thr Tyr Ala Arg Lys Trp Thr Leu Lys Gly Lys
370 375 380
Gln Thr Lys Ala Thr Leu Asp Lys Leu Thr Ala Thr Gln Thr Val Ala
385 390 395 400
Leu Val Ala Ile Asp Leu Gly Gln Thr Asn Pro Ile Ser Ala Gly Ile
405 410 415
Ser Arg Val Thr Gln Glu Asn Gly Ala Leu Gln Cys Glu Pro Leu Asp
420 425 430
Arg Phe Thr Leu Pro Asp Asp Leu Leu Lys Asp Ile Ser Ala Tyr Arg
435 440 445
Ile Ala Trp Asp Arg Asn Glu Glu Glu Leu Arg Ala Arg Ser Val Glu
450 455 460
Ala Leu Pro Glu Ala Gln Gln Ala Glu Val Arg Ala Leu Asp Gly Val
465 470 475 480
Ser Lys Glu Thr Ala Arg Thr Gln Leu Cys Ala Asp Phe Gly Leu Asp
485 490 495
Pro Lys Arg Leu Pro Trp Asp Lys Met Ser Ser Asn Thr Thr Phe Ile
500 505 510
Ser Glu Ala Leu Leu Ser Asn Ser Val Ser Arg Asp Gln Val Phe Phe
515 520 525
Thr Pro Ala Pro Lys Lys Gly Ala Lys Lys Lys Ala Pro Val Glu Val
530 535 540
Met Arg Lys Asp Arg Thr Trp Ala Arg Ala Tyr Lys Pro Arg Leu Ser
545 550 555 560
Val Glu Ala Gln Lys Leu Lys Asn Glu Ala Leu Trp Ala Leu Lys Arg
565 570 575
Thr Ser Pro Glu Tyr Leu Lys Leu Ser Arg Arg Lys Glu Glu Leu Cys
580 585 590
Arg Arg Ser Ile Asn Tyr Val Ile Glu Lys Thr Arg Arg Arg Thr Gln
595 600 605
Cys Gln Ile Val Ile Pro Val Ile Glu Asp Leu Asn Val Arg Phe Phe
610 615 620
His Gly Ser Gly Lys Arg Leu Pro Gly Trp Asp Asn Phe Phe Thr Ala
625 630 635 640
Lys Lys Glu Asn Arg Trp Phe Ile Gln Gly Leu His Lys Ala Phe Ser
645 650 655
Asp Leu Arg Thr His Arg Ser Phe Tyr Val Phe Glu Val Arg Pro Glu
660 665 670
Arg Thr Ser Ile Thr Cys Pro Lys Cys Gly His Cys Glu Val Gly Asn
675 680 685
Arg Asp Gly Glu Ala Phe Gln Cys Leu Ser Cys Gly Lys Thr Cys Asn
690 695 700
Ala Asp Leu Asp Val Ala Thr His Asn Leu Thr Gln Val Ala Leu Thr
705 710 715 720
Gly Lys Thr Met Pro Lys Arg Glu Glu Pro Arg Asp Ala Gln Gly Thr
725 730 735
Ala Pro Ala Arg Lys Thr Lys Lys Ala Ser Lys Ser Lys Ala Pro Pro
740 745 750
Ala Glu Arg Glu Asp Gln Thr Pro Ala Gln Glu Pro Ser Gln Thr Ser
755 760 765
Ser Gly Gly Ser Pro Lys Lys Lys Arg Lys Val Ser Gly Gly Ser Pro
770 775 780
Lys Lys Lys Arg Lys Val Ser Gly Gly Ser Lys Arg Pro Ala Ala Thr
785 790 795 800
Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys
805 810
<210> 2
<211> 2433
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgccgaaga agaagcgcaa ggtgtccggc ggctccccga agccagccgt ggagagcgag 60
ttctccaagg tgctcaagaa gcacttccca ggcgagcgct tccgcagcag ctacatgaag 120
cgcggcggca agatcctcgc cgcccagggc gaggaggccg tggtcgccta cctccagggc 180
aagtccgagg aggagccgcc gaacttccag ccgccagcga agtgccacgt cgtgaccaag 240
tcccgcgact tcgccgagtg gccgatcatg aaggcgtccg aggcgatcca gcgctacatc 300
tacgccctca gcaccacaga gcgggccgcg tgcaagccgg gcaagtcctc tgagtcccac 360
gcggcctggt tcgccgccac cggcgtgagc aaccacggct actcccacgt gcagggcctc 420
aacctgatct tcgaccacac actcggcagg tacgatggcg tgctgaagaa ggtccagctt 480
aggaacgaga aggctagggc tcgcctggaa tcgattaacg cctcgcgggc tgatgagggt 540
cttcctgaaa ttaaggctga agaggaagag gtcgcaacca atgaaaccgg tcatcttttg 600
cagcctccgg gcataaaccc gtccttctac gtctaccaaa ctatatctcc tcaggcctat 660
agacctcgcg acgaaatagt cctcccccct gagtatgccg gttatgtgag ggacccgaat 720
gcccccattc cgttgggcgt cgtccgtaat cgttgcgaca tacaaaaggg ctgcccagga 780
tacatcccag agtggcagcg cgaagccgga acagcaataa gccccaagac cgggaaggcg 840
gttacggttc caggactttc tcctaagaag aataagcgca tgaggagata ttggcggtca 900
gagaaggaaa aggcccagga tgcgctgttg gtcacagtta ggattggcac ggactgggtc 960
gtaattgacg ttagaggcct gcttagaaat gccagatgga ggacgattgc ccccaaggac 1020
atctccttga acgctctcct ggatctcttt actggcgatc cggtgatcga tgttagaagg 1080
aatatagtga cgtttactta cacacttgac gcgtgcggta catacgctcg caagtggacg 1140
cttaagggaa agcaaaccaa ggcgacgttg gataagctga cggcaaccca aaccgtggca 1200
ttggtagcta ttgacttggg ccagacaaat ccgatttcag ccggaatctc gagggtcaca 1260
caggaaaatg gagcactcca gtgcgaaccc ttggaccggt tcaccctccc agacgacctg 1320
ctcaaggata tcagcgccta caggattgca tgggaccgca atgaggagga gttgagagcg 1380
cggagcgttg aggcactccc agaagctcaa caagcggagg tcagggcatt ggacggtgta 1440
tcaaaggaaa ccgcccgtac ccagctctgt gcggatttcg gccttgaccc gaaacgcctc 1500
ccttgggaca agatgagctc gaatacgacc ttcatctcag aggcgcttct gtcgaattcc 1560
gtgtcccgtg atcaggtgtt ctttacaccg gctccgaaga aaggggccaa gaagaaggcc 1620
ccggttgagg taatgcgcaa agataggacg tgggctaggg cgtacaaacc acgcctctct 1680
gtggaggcgc agaaactcaa gaacgaagcc ttgtgggctt tgaaaaggac ctccccggaa 1740
tatctgaagc tgtctcgccg taaagaggaa ctctgtcgcc gttcgatcaa ttacgtcatc 1800
gagaagaccc gtaggagaac tcagtgccag attgtgattc cggtaatcga ggacctgaac 1860
gtccggtttt ttcacggctc cggcaaaaga cttcccggtt gggataactt ctttaccgca 1920
aagaaggaaa ataggtggtt catacagggc cttcataagg ccttctctga tctgagaacg 1980
catcgttcct tttacgtgtt cgaggtgcgg ccggaacgca cctctattac ttgccccaaa 2040
tgtggccact gtgaagtcgg caatcgcgat ggggaggcat tccaatgtct gtcgtgtgga 2100
aagacttgta atgctgatct cgacgtagcg acccacaatc ttacccaggt tgcgctgacg 2160
ggcaagacca tgccaaagag ggaggaacca cgtgacgcac aaggaaccgc accggctagg 2220
aagacaaaga aagcctcgaa atcaaaagct cctccggccg aaagagagga tcagactccg 2280
gctcaggagc catcccagac gtcttccggc ggcagcccta agaagaagcg gaaggtttct 2340
ggaggttctc cgaagaagaa gcgcaaggtg tccggcggct ccaagcgtcc tgctgccacc 2400
aaaaaggccg gacaggctaa gaaaaagaag tag 2433
<210> 3
<211> 1987
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat gtctaagtta 60
taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt atctatcttt 120
atacatatat ttaaacttta ctctacgaat aatataatct atagtactac aataatatca 180
gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca attgagtatt 240
ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg 300
caaatagctt cacctatata atacttcatc cattttatta gtacatccat ttagggttta 360
gggttaatgg tttttataga ctaatttttt tagtacatct attttattct attttagcct 420
ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaataattt agatataaaa 480
tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 540
aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt 600
ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 660
cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc gttggacttg 720
ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 780
gcggcctcct cctcctctca cggcacggca gctacggggg attcctttcc caccgctcct 840
tcgctttccc ttcctcgccc gccgtaataa atagacaccc cctccacacc ctctttcccc 900
aacctcgtgt tgttcggagc gcacacacac acaaccagat ctcccccaaa tccacccgtc 960
ggcacctccg cttcaaggta cgccgctcgt cctccccccc cccccctctc taccttctct 1020
agatcggcgt tccggtccat ggttagggcc cggtagttct acttctgttc atgtttgtgt 1080
tagatccgtg tttgtgttag atccgtgctg ctagcgttcg tacacggatg cgacctgtac 1140
gtcagacacg ttctgattgc taacttgcca gtgtttctct ttggggaatc ctgggatggc 1200
tctagccgtt ccgcagacgg gatcgatttc atgatttttt ttgtttcgtt gcatagggtt 1260
tggtttgccc ttttccttta tttcaatata tgccgtgcac ttgtttgtcg ggtcatcttt 1320
tcatgctttt ttttgtcttg gttgtgatga tgtggtctgg ttgggcggtc gttctagatc 1380
ggagtagaat tctgtttcaa actacctggt ggatttatta attttggatc tgtatgtgtg 1440
tgccatacat attcatagtt acgaattgaa gatgatggat ggaaatatcg atctaggata 1500
ggtatacatg ttgatgcggg ttttactgat gcatatacag agatgctttt tgttcgcttg 1560
gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt tctagatcgg agtagaatac 1620
tgtttcaaac tacctggtgt atttattaat tttggaactg tatgtgtgtg tcatacatct 1680
tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat acatgttgat 1740
gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat atgctctaac 1800
cttgagtacc tatctattat aataaacaag tatgttttat aattattttg atcttgatat 1860
acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg ccttcatacg 1920
ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt tggtgttact 1980
tctgcag 1987
<210> 4
<211> 253
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60
atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120
atgacgttat ttatgaggtg ggtttttatg attagagtcc cgcaattata catttaatac 180
gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240
atgttactag atc 253
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tttcatctcc ttctagaagc aca 23
<210> 6
<211> 448
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
attttttcct gtagttttcc cacaaccatt ttttaccatc cgaatgatag gataggaaaa 60
atatccaagt gaacagtatt cctataaaat tcccgtaaaa agcctgcaat ccgaatgagc 120
cctgaagtct gaactagccg gtcacctgta caggctatcg agatgccata caagagacgg 180
tagtaggaac taggaagacg atggttgatt cgtcaggcga aatcgtcgtc ctgcagtcgc 240
atctatgggc ctggacggaa taggggaaaa agttggccgg ataggaggga aaggcccagg 300
tgcttacgtg cgaggtaggc ctgggctctc agcacttcga ttcgttggca ccggggtagg 360
atgcaataga gagcaacgtt tagtaccacc tcgcttagct agagcaaact ggactgcctt 420
atatgcgcgg gtgctggctt ggctgccg 448
<210> 7
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
caacgattgc ccctcacgag gggac 25
<210> 8
<211> 77
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttc 60
gattcccggc tggtgca 77
<210> 9
<211> 2534
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cacatttcgt aaaacgacgg ccagtgaatt cggatccaag cttactagta tggaatcggc 60
agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg aatgatagga 120
taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag cctgcaatcc 180
gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag atgccataca 240
agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa tcgtcgtcct 300
gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat aggagggaaa 360
ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt cgttggcacc 420
ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag agcaaactgg 480
actgccttat atgcgcgggt gctggcttgg ctgccgaaca aagcaccagt ggtctagtgg 540
tagaatagta ccctgccacg gtacagaccc gggttcgatt cccggctggt gcacaacgat 600
tgcccctcac gaggggacag agaccactgt ccgtcagatg ggtctcgaac aaagcaccag 660
tggtctagtg gtagaatagt accctgccac ggtacagacc cgggttcgat tcccggctgg 720
tgcatttttt tcaagagctt ggagtggatg gaacgcgtct gcaggagctc ctcgagggtc 780
atagctgttt cctgcgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 840
cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 900
gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 960
tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 1020
tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt 1080
cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 1140
gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 1200
ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt 1260
ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 1320
ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 1380
agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 1440
aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 1500
atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg 1560
tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 1620
tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca 1680
tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 1740
gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 1800
tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt 1860
ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg 1920
gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc 1980
aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 2040
ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga 2100
tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga 2160
ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta 2220
aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg 2280
ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact 2340
ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata 2400
agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt 2460
tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa 2520
ataggggttc cgcg 2534
<210> 10
<211> 14363
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 60
aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc 120
tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacat 180
gattacgaat tccggccatg cggccgcaag ctgggtgcag cgtgacccgg tcgtgcccct 240
ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 300
tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 360
gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 420
cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 480
ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 540
catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 600
tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 660
tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 720
taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 780
gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 840
cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 900
ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 960
gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 1020
ggcagctacg ggggattcct ttcccaccgc tccttcgctt tcccttcctc gcccgccgta 1080
ataaatagac accccctcca caccctcttt ccccaacctc gtgttgttcg gagcgcacac 1140
acacacaacc agatctcccc caaatccacc cgtcggcacc tccgcttcaa ggtacgccgc 1200
tcgtcctccc cccccccccc tctctacctt ctctagatcg gcgttccggt ccatggttag 1260
ggcccggtag ttctacttct gttcatgttt gtgttagatc cgtgtttgtg ttagatccgt 1320
gctgctagcg ttcgtacacg gatgcgacct gtacgtcaga cacgttctga ttgctaactt 1380
gccagtgttt ctctttgggg aatcctggga tggctctagc cgttccgcag acgggatcga 1440
tttcatgatt ttttttgttt cgttgcatag ggtttggttt gcccttttcc tttatttcaa 1500
tatatgccgt gcacttgttt gtcgggtcat cttttcatgc ttttttttgt cttggttgtg 1560
atgatgtggt ctggttgggc ggtcgttcta gatcggagta gaattctgtt tcaaactacc 1620
tggtggattt attaattttg gatctgtatg tgtgtgccat acatattcat agttacgaat 1680
tgaagatgat ggatggaaat atcgatctag gataggtata catgttgatg cgggttttac 1740
tgatgcatat acagagatgc tttttgttcg cttggttgtg atgatgtggt gtggttgggc 1800
ggtcgttcat tcgttctaga tcggagtaga atactgtttc aaactacctg gtgtatttat 1860
taattttgga actgtatgtg tgtgtcatac atcttcatag ttacgagttt aagatggatg 1920
gaaatatcga tctaggatag gtatacatgt tgatgtgggt tttactgatg catatacatg 1980
atggcatatg cagcatctat tcatatgctc taaccttgag tacctatcta ttataataaa 2040
caagtatgtt ttataattat tttgatcttg atatacttgg atgatggcat atgcagcagc 2100
tatatgtgga tttttttagc cctgccttca tacgctattt atttgcttgg tactgtttct 2160
tttgtcgatg ctcaccctgt tgtttggtgt tacttctgca gccaccatgc cgaagaagaa 2220
gcgcaaggtg tccggcggct ccccgaagcc agccgtggag agcgagttct ccaaggtgct 2280
caagaagcac ttcccaggcg agcgcttccg cagcagctac atgaagcgcg gcggcaagat 2340
cctcgccgcc cagggcgagg aggccgtggt cgcctacctc cagggcaagt ccgaggagga 2400
gccgccgaac ttccagccgc cagcgaagtg ccacgtcgtg accaagtccc gcgacttcgc 2460
cgagtggccg atcatgaagg cgtccgaggc gatccagcgc tacatctacg ccctcagcac 2520
cacagagcgg gccgcgtgca agccgggcaa gtcctctgag tcccacgcgg cctggttcgc 2580
cgccaccggc gtgagcaacc acggctactc ccacgtgcag ggcctcaacc tgatcttcga 2640
ccacacactc ggcaggtacg atggcgtgct gaagaaggtc cagcttagga acgagaaggc 2700
tagggctcgc ctggaatcga ttaacgcctc gcgggctgat gagggtcttc ctgaaattaa 2760
ggctgaagag gaagaggtcg caaccaatga aaccggtcat cttttgcagc ctccgggcat 2820
aaacccgtcc ttctacgtct accaaactat atctcctcag gcctatagac ctcgcgacga 2880
aatagtcctc ccccctgagt atgccggtta tgtgagggac ccgaatgccc ccattccgtt 2940
gggcgtcgtc cgtaatcgtt gcgacataca aaagggctgc ccaggataca tcccagagtg 3000
gcagcgcgaa gccggaacag caataagccc caagaccggg aaggcggtta cggttccagg 3060
actttctcct aagaagaata agcgcatgag gagatattgg cggtcagaga aggaaaaggc 3120
ccaggatgcg ctgttggtca cagttaggat tggcacggac tgggtcgtaa ttgacgttag 3180
aggcctgctt agaaatgcca gatggaggac gattgccccc aaggacatct ccttgaacgc 3240
tctcctggat ctctttactg gcgatccggt gatcgatgtt agaaggaata tagtgacgtt 3300
tacttacaca cttgacgcgt gcggtacata cgctcgcaag tggacgctta agggaaagca 3360
aaccaaggcg acgttggata agctgacggc aacccaaacc gtggcattgg tagctattga 3420
cttgggccag acaaatccga tttcagccgg aatctcgagg gtcacacagg aaaatggagc 3480
actccagtgc gaacccttgg accggttcac cctcccagac gacctgctca aggatatcag 3540
cgcctacagg attgcatggg accgcaatga ggaggagttg agagcgcgga gcgttgaggc 3600
actcccagaa gctcaacaag cggaggtcag ggcattggac ggtgtatcaa aggaaaccgc 3660
ccgtacccag ctctgtgcgg atttcggcct tgacccgaaa cgcctccctt gggacaagat 3720
gagctcgaat acgaccttca tctcagaggc gcttctgtcg aattccgtgt cccgtgatca 3780
ggtgttcttt acaccggctc cgaagaaagg ggccaagaag aaggccccgg ttgaggtaat 3840
gcgcaaagat aggacgtggg ctagggcgta caaaccacgc ctctctgtgg aggcgcagaa 3900
actcaagaac gaagccttgt gggctttgaa aaggacctcc ccggaatatc tgaagctgtc 3960
tcgccgtaaa gaggaactct gtcgccgttc gatcaattac gtcatcgaga agacccgtag 4020
gagaactcag tgccagattg tgattccggt aatcgaggac ctgaacgtcc ggttttttca 4080
cggctccggc aaaagacttc ccggttggga taacttcttt accgcaaaga aggaaaatag 4140
gtggttcata cagggccttc ataaggcctt ctctgatctg agaacgcatc gttcctttta 4200
cgtgttcgag gtgcggccgg aacgcacctc tattacttgc cccaaatgtg gccactgtga 4260
agtcggcaat cgcgatgggg aggcattcca atgtctgtcg tgtggaaaga cttgtaatgc 4320
tgatctcgac gtagcgaccc acaatcttac ccaggttgcg ctgacgggca agaccatgcc 4380
aaagagggag gaaccacgtg acgcacaagg aaccgcaccg gctaggaaga caaagaaagc 4440
ctcgaaatca aaagctcctc cggccgaaag agaggatcag actccggctc aggagccatc 4500
ccagacgtct tccggcggca gccctaagaa gaagcggaag gtttctggag gttctccgaa 4560
gaagaagcgc aaggtgtccg gcggctccaa gcgtcctgct gccaccaaaa aggccggaca 4620
ggctaagaaa aagaagtagc ggtgatcctc ccgatcgttc aaacatttgg caataaagtt 4680
tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt 4740
acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgagg tgggttttta 4800
tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa 4860
actaggataa attatcgcgc gcggtgtcat ctatgttact agatcgggag caccggtaag 4920
gctcgacgcg ttccatccac tccaagctct tgaaaaaaat gcaccagccg ggaatcgaac 4980
ccgggtctgt accgtggcag ggtactattc taccactaga ccactggtgc tttgtttgtg 5040
cttctagaag gagatggtcc cctcgtgagg ggcaatcgtt gtgcaccagc cgggaatcga 5100
acccgggtct gtaccgtggc agggtactat tctaccacta gaccactggt gctttgttcg 5160
gcagccaagc cagcacccgc gcatataagg cagtccagtt tgctctagct aagcgaggtg 5220
gtactaaacg ttgctctcta ttgcatccta ccccggtgcc aacgaatcga agtgctgaga 5280
gcccaggcct acctcgcacg taagcacctg ggcctttccc tcctatccgg ccaacttttt 5340
cccctattcc gtccaggccc atagatgcga ctgcaggacg acgatttcgc ctgacgaatc 5400
aaccatcgtc ttcctagttc ctactaccgt ctcttgtatg gcatctcgat agcctgtaca 5460
ggtgaccggc tagttcagac ttcagggctc attcggattg caggcttttt acgggaattt 5520
tataggaata ctgttcactt ggatattttt cctatcctat cattcggatg gtaaaaaatg 5580
gttgtgggaa aactacagga aaaaatcctt tgctgccgat tccatactag tcggtccgta 5640
gtgaagcttg gcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac 5700
ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc 5760
ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatgct agagcagctt 5820
gagcttggat cagattgtcg tttcccgcct tcagtttaaa ctatcagtgt ttgacaggat 5880
atattggcgg gtaaacctaa gagaaaagag cgtttattag aataacggat atttaaaagg 5940
gcgtgaaaag gtttatccgt tcgtccattt gtatgtgcat gccaaccaca gggttcccct 6000
cgggatcaaa gtactttgat ccaacccctc cgctgctata gtgcagtcgg cttctgacgt 6060
tcagtgcagc cgtcttctga aaacgacatg tcgcacaagt cctaagttac gcgacaggct 6120
gccgccctgc ccttttcctg gcgttttctt gtcgcgtgtt ttagtcgcat aaagtagaat 6180
acttgcgact agaaccggag acattacgcc atgaacaaga gcgccgccgc tggcctgctg 6240
ggctatgccc gcgtcagcac cgacgaccag gacttgacca accaacgggc cgaactgcac 6300
gcggccggct gcaccaagct gttttccgag aagatcaccg gcaccaggcg cgaccgcccg 6360
gagctggcca ggatgcttga ccacctacgc cctggcgacg ttgtgacagt gaccaggcta 6420
gaccgcctgg cccgcagcac ccgcgaccta ctggacattg ccgagcgcat ccaggaggcc 6480
ggcgcgggcc tgcgtagcct ggcagagccg tgggccgaca ccaccacgcc ggccggccgc 6540
atggtgttga ccgtgttcgc cggcattgcc gagttcgagc gttccctaat catcgaccgc 6600
acccggagcg ggcgcgaggc cgccaaggcc cgaggcgtga agtttggccc ccgccctacc 6660
ctcaccccgg cacagatcgc gcacgcccgc gagctgatcg accaggaagg ccgcaccgtg 6720
aaagaggcgg ctgcactgct tggcgtgcat cgctcgaccc tgtaccgcgc acttgagcgc 6780
agcgaggaag tgacgcccac cgaggccagg cggcgcggtg ccttccgtga ggacgcattg 6840
accgaggccg acgccctggc ggccgccgag aatgaacgcc aagaggaaca agcatgaaac 6900
cgcaccagga cggccaggac gaaccgtttt tcattaccga agagatcgag gcggagatga 6960
tcgcggccgg gtacgtgttc gagccgcccg cgcacgtctc aaccgtgcgg ctgcatgaaa 7020
tcctggccgg tttgtctgat gccaagctgg cggcctggcc ggccagcttg gccgctgaag 7080
aaaccgagcg ccgccgtcta aaaaggtgat gtgtatttga gtaaaacagc ttgcgtcatg 7140
cggtcgctgc gtatatgatg cgatgagtaa ataaacaaat acgcaagggg aacgcatgaa 7200
ggttatcgct gtacttaacc agaaaggcgg gtcaggcaag acgaccatcg caacccatct 7260
agcccgcgcc ctgcaactcg ccggggccga tgttctgtta gtcgattccg atccccaggg 7320
cagtgcccgc gattgggcgg ccgtgcggga agatcaaccg ctaaccgttg tcggcatcga 7380
ccgcccgacg attgaccgcg acgtgaaggc catcggccgg cgcgacttcg tagtgatcga 7440
cggagcgccc caggcggcgg acttggctgt gtccgcgatc aaggcagccg acttcgtgct 7500
gattccggtg cagccaagcc cttacgacat atgggccacc gccgacctgg tggagctggt 7560
taagcagcgc attgaggtca cggatggaag gctacaagcg gcctttgtcg tgtcgcgggc 7620
gatcaaaggc acgcgcatcg gcggtgaggt tgccgaggcg ctggccgggt acgagctgcc 7680
cattcttgag tcccgtatca cgcagcgcgt gagctaccca ggcactgccg ccgccggcac 7740
aaccgttctt gaatcagaac ccgagggcga cgctgcccgc gaggtccagg cgctggccgc 7800
tgaaattaaa tcaaaactca tttgagttaa tgaggtaaag agaaaatgag caaaagcaca 7860
aacacgctaa gtgccggccg tccgagcgca cgcagcagca aggctgcaac gttggccagc 7920
ctggcagaca cgccagccat gaagcgggtc aactttcagt tgccggcgga ggatcacacc 7980
aagctgaaga tgtacgcggt acgccaaggc aagaccatta ccgagctgct atctgaatac 8040
atcgcgcagc taccagagta aatgagcaaa tgaataaatg agtagatgaa ttttagcggc 8100
taaaggaggc ggcatggaaa atcaagaaca accaggcacc gacgccgtgg aatgccccat 8160
gtgtggagga acgggcggtt ggccaggcgt aagcggctgg gttgtctgcc ggccctgcaa 8220
tggcactgga acccccaagc ccgaggaatc ggcgtgacgg tcgcaaacca tccggcccgg 8280
tacaaatcgg cgcggcgctg ggtgatgacc tggtggagaa gttgaaggcc gcgcaggccg 8340
cccagcggca acgcatcgag gcagaagcac gccccggtga atcgtggcaa gcggccgctg 8400
atcgaatccg caaagaatcc cggcaaccgc cggcagccgg tgcgccgtcg attaggaagc 8460
cgcccaaggg cgacgagcaa ccagattttt tcgttccgat gctctatgac gtgggcaccc 8520
gcgatagtcg cagcatcatg gacgtggccg ttttccgtct gtcgaagcgt gaccgacgag 8580
ctggcgaggt gatccgctac gagcttccag acgggcacgt agaggtttcc gcagggccgg 8640
ccggcatggc cagtgtgtgg gattacgacc tggtactgat ggcggtttcc catctaaccg 8700
aatccatgaa ccgataccgg gaagggaagg gagacaagcc cggccgcgtg ttccgtccac 8760
acgttgcgga cgtactcaag ttctgccggc gagccgatgg cggaaagcag aaagacgacc 8820
tggtagaaac ctgcattcgg ttaaacacca cgcacgttgc catgcagcgt acgaagaagg 8880
ccaagaacgg ccgcctggtg acggtatccg agggtgaagc cttgattagc cgctacaaga 8940
tcgtaaagag cgaaaccggg cggccggagt acatcgagat cgagctagct gattggatgt 9000
accgcgagat cacagaaggc aagaacccgg acgtgctgac ggttcacccc gattactttt 9060
tgatcgatcc cggcatcggc cgttttctct accgcctggc acgccgcgcc gcaggcaagg 9120
cagaagccag atggttgttc aagacgatct acgaacgcag tggcagcgcc ggagagttca 9180
agaagttctg tttcaccgtg cgcaagctga tcgggtcaaa tgacctgccg gagtacgatt 9240
tgaaggagga ggcggggcag gctggcccga tcctagtcat gcgctaccgc aacctgatcg 9300
agggcgaagc atccgccggt tcctaatgta cggagcagat gctagggcaa attgccctag 9360
caggggaaaa aggtcgaaaa gctgtctttc ctgtggatag cacgtacatt gggaacccaa 9420
agccgtacat tgggaaccgg aacccgtaca ttgggaaccc aaagccgtac attgggaacc 9480
ggtcacacat gtaagtgact gatataaaag agaaaaaagg cgatttttcc gcctaaaact 9540
ctttaaaact tattaaaact cttaaaaccc gcctggcctg tgcataactg tctggccagc 9600
gcacagccga agagctgcaa aaagcgccta cccttcggtc gctgcgctcc ctacgccccg 9660
ccgcttcgcg tcggcctatc gcggccgctg gccgctcaaa aatggctggc ctacggccag 9720
gcaatctacc agggcgcgga caagccgcgc cgtcgccact cgaccgccgg cgcccacatc 9780
aaggcaccct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc 9840
ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc 9900
gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg tagcgatagc 9960
ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata 10020
tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg 10080
cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc 10140
actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt 10200
gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc 10260
ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa 10320
acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc 10380
ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg 10440
cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc 10500
tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc 10560
gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca 10620
ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 10680
acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg 10740
gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt 10800
ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 10860
tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatgc 10920
attctaggta ctaaaacaat tcatccagta aaatataata ttttattttc tcccaatcag 10980
gcttgatccc cagtaagtca aaaaatagct cgacatactg ttcttccccg atatcctccc 11040
tgatcgaccg gacgcagaag gcaatgtcat accacttgtc cgccctgccg cttctcccaa 11100
gatcaataaa gccacttact ttgccatctt tcacaaagat gttgctgtct cccaggtcgc 11160
cgtgggaaaa gacaagttcc tcttcgggct tttccgtctt taaaaaatca tacagctcgc 11220
gcggatcttt aaatggagtg tcttcttccc agttttcgca atccacatcg gccagatcgt 11280
tattcagtaa gtaatccaat tcggctaagc ggctgtctaa gctattcgta tagggacaat 11340
ccgatatgtc gatggagtga aagagcctga tgcactccgc atacagctcg ataatctttt 11400
cagggctttg ttcatcttca tactcttccg agcaaaggac gccatcggcc tcactcatga 11460
gcagattgct ccagccatca tgccgttcaa agtgcaggac ctttggaaca ggcagctttc 11520
cttccagcca tagcatcatg tccttttccc gttccacatc ataggtggtc cctttatacc 11580
ggctgtccgt catttttaaa tataggtttt cattttctcc caccagctta tataccttag 11640
caggagacat tccttccgta tcttttacgc agcggtattt ttcgatcagt tttttcaatt 11700
ccggtgatat tctcatttta gccatttatt atttccttcc tcttttctac agtatttaaa 11760
gataccccaa gaagctaatt ataacaagac gaactccaat tcactgttcc ttgcattcta 11820
aaaccttaaa taccagaaaa cagctttttc aaagttgttt tcaaagttgg cgtataacat 11880
agtatcgacg gagccgattt tgaaaccgcg gtgatcacag gcagcaacgc tctgtcatcg 11940
ttacaatcaa catgctaccc tccgcgagat catccgtgtt tcaaacccgg cagcttagtt 12000
gccgttcttc cgaatagcat cggtaacatg agcaaagtct gccgccttac aacggctctc 12060
ccgctgacgc cgtcccggac tgatgggctg cctgtatcga gtggtgattt tgtgccgagc 12120
tgccggtcgg ggagctgttg gctggctggt ggcaggatat attgtggtgt aaacaaattg 12180
acgcttagac aacttaataa cacattgcgg acgtttttaa tgtactgaat taacgccgaa 12240
ttaattcggg ggatctggat tttagtactg gattttggtt ttaggaatta gaaattttat 12300
tgatagaagt attttacaaa tacaaataca tactaagggt ttcttatatg ctcaacacat 12360
gagcgaaacc ctataggaac cctaattccc ttatctggga actactcaca cattattatg 12420
gagaaactcg agcttgtcga tcgacagatc cggtcggcat ctactctatt tctttgccct 12480
cggacgagtg ctggggcgtc ggtttccact atcggcgagt acttctacac agccatcggt 12540
ccagacggcc gcgcttctgc gggcgatttg tgtacgcccg acagtcccgg ctccggatcg 12600
gacgattgcg tcgcatcgac cctgcgccca agctgcatca tcgaaattgc cgtcaaccaa 12660
gctctgatag agttggtcaa gaccaatgcg gagcatatac gcccggagtc gtggcgatcc 12720
tgcaagctcc ggatgcctcc gctcgaagta gcgcgtctgc tgctccatac aagccaacca 12780
cggcctccag aagaagatgt tggcgacctc gtattgggaa tccccgaaca tcgcctcgct 12840
ccagtcaatg accgctgtta tgcggccatt gtccgtcagg acattgttgg agccgaaatc 12900
cgcgtgcacg aggtgccgga cttcggggca gtcctcggcc caaagcatca gctcatcgag 12960
agcctgcgcg acggacgcac tgacggtgtc gtccatcaca gtttgccagt gatacacatg 13020
gggatcagca atcgcgcata tgaaatcacg ccatgtagtg tattgaccga ttccttgcgg 13080
tccgaatggg ccgaacccgc tcgtctggct aagatcggcc gcagcgatcg catccatagc 13140
ctccgcgacc ggttgtagaa cagcgggcag ttcggtttca ggcaggtctt gcaacgtgac 13200
accctgtgca cggcgggaga tgcaataggt caggctctcg ctaaactccc caatgtcaag 13260
cacttccgga atcgggagcg cggccgatgc aaagtgccga taaacataac gatctttgta 13320
gaaaccatcg gcgcagctat ttacccgcag gacatatcca cgccctccta catcgaagct 13380
gaaagcacga gattcttcgc cctccgagag ctgcatcagg tcggagacgc tgtcgaactt 13440
ttcgatcaga aacttctcga cagacgtcgc ggtgagttca ggctttttca tatctcattg 13500
ccccccggga tctgcgaaag ctcgagagag atagatttgt agagagagac tggtgatttc 13560
agcgtgtcct ctccaaatga aatgaacttc cttatataga ggaaggtctt gcgaaggata 13620
gtgggattgt gcgtcatccc ttacgtcagt ggagatatca catcaatcca cttgctttga 13680
agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt 13740
gggaccactg tcggcagagg catcttgaac gatagccttt cctttatcgc aatgatggca 13800
tttgtaggtg ccaccttcct tttctactgt ccttttgatg aagtgacaga tagctgggca 13860
atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa tagccctttg 13920
gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt gctccaccat 13980
gttatcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat 14040
gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttgaacgat 14100
agcctttcct ttatcgcaat gatggcattt gtaggtgcca ccttcctttt ctactgtcct 14160
tttgatgaag tgacagatag ctgggcaatg gaatccgagg aggtttcccg atattaccct 14220
ttgttgaaaa gtctcaatag ccctttggtc ttctgagact gtatctttga tattcttgga 14280
gtagacgaga gtgtcgtgct ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg 14340
cctctccccg cgcgttggcc gat 14363