阅读说明：本技术 用于水稻基因编辑的CasΦ-2蛋白及其表达盒子和表达载体 (Cas phi-2 protein for rice gene editing and expression cassette and expression vector thereof ) 是由 王高华 段芳 谢先荣 刘伟智 于 2021-09-10 设计创作，主要内容包括：本发明公开了一种用于水稻基因编辑的CasΦ-2蛋白及其表达盒子和表达载体,CasΦ-2蛋白的N端增加1个核定位信号肽氨基酸序列,在C端增加3个核定位信号肽氨基酸序列。CasΦ-2蛋白的CrRNA表达盒子包括基因编辑靶点、启动子和CasΦ-2蛋白的CrRNA,CrRNA的核苷酸序列两端分别连接有1个tRNA序列；表达载体含有上述表达盒子和CasΦ-2蛋白的核苷酸序列。上述表达载体能够有效实现水稻基因的敲除编辑。(The invention discloses a Cas phi-2 protein for rice gene editing, an expression cassette and an expression vector thereof, wherein 1 nuclear localization signal peptide amino acid sequence is added at the N end of the Cas phi-2 protein, and 3 nuclear localization signal peptide amino acid sequences are added at the C end. The CrRNA expression cassette of the Cas phi-2 protein comprises a gene editing target, a promoter and CrRNA of the Cas phi-2 protein, and two ends of a nucleotide sequence of the CrRNA are respectively connected with 1 tRNA sequence; the expression vector contains the expression cassette and the nucleotide sequence of the Cas phi-2 protein. The expression vector can effectively realize the knock-out and editing of the rice gene.)

1. A Cas phi-2 protein for rice gene editing is characterized in that 1 nuclear localization signal peptide amino acid sequence is added at the N end of the amino acid sequence of the Cas phi-2 protein, and 3 nuclear localization signal peptide amino acid sequences are added at the C end.

2. The Cas Φ -2 protein for rice gene editing according to claim 1, wherein the amino acid sequence of the nuclear localization signal peptide added at the N-terminal of the amino acid sequence of the Cas Φ -2 protein is SV40 nuclear localization signal peptide amino acid sequence, and the amino acid sequences of the 3 nuclear localization signal peptides added at the C-terminal are sequentially 2 SV40 nuclear localization signal peptide amino acid sequences and 1 NLS nuclear localization signal peptide amino acid sequence.

3. The Cas Φ -2 protein for rice gene editing according to claim 2, wherein the amino acid sequence of the Cas Φ -2 protein is shown as SEQ ID No.1, and the nucleotide sequence of the Cas Φ -2 protein is shown as SEQ ID No. 2.

4. A Cas phi-2 protein expression vector for rice gene editing, which is characterized in that a blank vector contains a nucleotide sequence of the Cas phi-2 protein of any one of claims 1 to 3.

5. The Cas Φ -2 protein expression vector of claim 4, wherein the blank vector used is pCAMBIA1300 vector, and the nucleotide for transcribing the Cas Φ -2 protein uses maize UBI promoter and NOS terminator;

the nucleotide sequence of the corn UBI promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the NOS terminator is shown in SEQ ID NO. 4.

6. A CrRNA expression cassette of Cas phi-2 protein for rice gene editing is characterized by comprising a CrRNA expression cassette with no load and a gene editing target point designed aiming at a corresponding rice gene;

the CrRNA expression cassette contains CrRNA of Cas phi-2 protein as claimed in any one of claims 1-3 in an unloaded state, and also contains a promoter for transcribing a corresponding rice gene editing target, and both ends of the nucleotide sequence of the CrRNA are respectively provided with 1 tRNA sequence.

7. The CrRNA expression cassette of Cas Φ -2 protein according to claim 6, wherein the rice gene is an OsBEL gene, the nucleotide sequence of the gene editing target is shown as SEQ ID No.5, and the nucleotide sequence of OsU6a promoter which starts the OsBEL target of the rice gene is shown as SEQ ID No. 6; the nucleotide sequence of CrRNA of the Cas phi-2 protein is shown as SEQ ID NO. 7; the nucleotide sequence of the tRNA sequence is shown as SEQ ID NO. 8; the no-load nucleotide sequence of the CrRNA expression cassette is shown as SEQ ID NO. 9;

the primers used for assembling the CrRNA expression cassette of the Cas phi-2 protein are as follows:

BEL-F：ggacCATCTCCTTCTAGAAGCACA；

BEL-R：tgttTGTGCTTCTAGAAGGAGATG；

the specific assembly mode is as follows: taking 1 mul of BEL-F primer, 1 mul of BEL-R primer and 8 mul of sterile water, firstly denaturing at 95 ℃, and then annealing at 55 ℃ to obtain BEL primer mixed solution; and then taking 1 mu l of BEL primer mixed solution, forming a10 mu l mixed system with 30ng of CrRNA expression cassette no-load, 1 mu l of 10 XCutSmart Buffer, 35U T4 DNA ligase, 10U of Bsal restriction endonuclease and sterile water, and culturing at 37 ℃ for 1h to prepare the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein.

8. A complete expression vector of Cas phi-2 protein for rice gene editing is characterized in that the complete expression vector of Cas phi-2 protein is connected with the Cas phi-2 protein expression vector of claim 4 or 5, and is further connected with a CrRNA expression cassette of Cas phi-2 protein of claim 6 or 7.

9. The complete expression vector of Cas phi-2 protein of claim 8, which is formed by amplifying a CrRNA expression cassette of the Cas phi-2 protein by using primers Pps-R and Pgs-L, and then assembling and connecting the CrRNA expression cassette with the Cas phi-2 protein expression vector by BsaI and T4 DNA ligase;

the primers Pps-R and Pgs-L are as follows:

Pps-R：TAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG；

Pgs-L：AGTGggtctcGctcgACGCGTATCCATCCACTCCAAGCTC。

10. the complete expression vector of Cas Φ -2 protein according to claim 9, characterized in that its nucleotide sequence is shown in SEQ ID No. 10.

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a Cas phi-2 protein for rice gene editing, and an expression cassette and an expression vector thereof.

Background

Cas Φ (Cas12j) is evolved from a V-type CRISPR-Cas protein, a Cas protein family encoded in a phage clade comprises a C-terminal RuvC domain, has far-source homology with the domain of TnpB nuclease superfamily, and a single RuvC active site of the Cas Φ can perform crRNA processing and DNA cleavage. However, Cas Φ has < 7% amino acid homology with other V-type CRISPR-Cas proteins and is most closely related to the TnpB group, which is different from the V-type (Cas14) protein.

The molecular weight of Cas Φ is exceptionally small, about 70 to 80kDa, about half the size of Cas9 and Cas12 a. The protein has the characteristics of small molecular weight of Cas phi and wide PAM site coverage, the PAM sequence of the protein is 'TTN', the editing range of the protein on eukaryotic genome can be expanded, the operability and the selectivity of gene editing suitable for different eukaryotes are expanded, and the protein is particularly beneficial to vector-based cell delivery and wider targetable genome sequence, so that the protein can provide powerful supplement for a CRISPR-Cas toolbox.

Cas Φ -2 is derived from one of the Cas Φ orthologs in the phage. The PAM site is also the T/A-rich region "TTN". The cleavage mode of Cas phi-2 nuclease is very similar to that of Cas12a, both PAM sites are rich in T/A regions, like the PAM sites of LbCpf1 and AsCpf1 are both used for recognizing 'TTTN', and the PAM site of Cas phi-2 is used for recognizing 'TTN' and FnCpf1 similarly; in addition like LbCpf1, the cleavage site cleaves a 4 or 5 base sticky end at 19-24bp away from the PAM site, whereas Cas Φ -2 also cleaves at 12-18bp away from the PAM site; furthermore, the mutation types generated by the two are mainly multi-base deletion of more than 5 bp; both contain only CrRNA, and no tracrRNA is required. The difference between the two is the effective length of the target, the size of the protein, and the CrRNA recognized.

Existing studies have shown that the Cas Φ -2 nuclease mutation type in arabidopsis protoplasts mainly causes deletions of 8 to 10bp in the genome.

In the prior art, for example, Chinese patent application CN109306358A provides a method for creating a two-line sterile line of non-neck rice by using CRISPR/Cas9 technology, the method designs a target sequence according to an EUI gene coding sequence in the rice, and constructs a pCRISPR/Cas9-EUI-gRNA recombinant vector containing a target sequence fragment; transforming rice callus by agrobacterium to obtain transgenic seedling; and (3) carrying out positive screening, sequencing analysis and transgenic element detection on the transgenic seedling to obtain the functional deletion mutant without transgenic components.

For example, the method for performing site-directed mutagenesis on a rice BADH2 gene by using a CRISPR-CAS9 technology provided by Chinese patent application CN106676130A is to design a sgRNA sequence based on CRISPR/Cas9 for the rice BADH2 gene, connect a DNA fragment containing the sgRNA sequence to a vector carrying the CRISPR/Cas to transform rice, and realize the site-directed mutagenesis on the rice BADH2 gene. Wherein, the nucleotide sequence of the sgRNA action site is shown as SEQ ID NO. 1. According to the invention, the rice endogenous gene BADH2 is edited by a CRISPR/CAS9 technology, so that a BADH2 mutant is obtained, and the method is more convenient and efficient in creating fragrant rice germplasm resources.

Also for example, the CRISPR-Cas Φ from human genes is a supercompact genome editor (Patrick Pansch et al) discloses a CRISPR-Cas Φ system that uses a single active site for CRISPR RNA (crRNA) treatment and crRNA-guided DNA cleavage targeting foreign nucleic acids, capable of causing mainly 8 to 10bp deletions in the genome of Cas Φ -2 nuclease mutation types in arabidopsis protoplasts. However, no corresponding technical basis is provided for the successful application of the Cas phi-2 nuclease in rice gene editing.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the Cas phi-2 protein for rice gene editing, an expression cassette and an expression vector thereof, and the application effect of the Cas phi-2 nuclease in rice gene editing is explored, so that the range of gene editing is widened; specifically, the following technique is used.

A Cas phi-2 protein for rice gene editing is characterized in that 1 nuclear localization signal peptide amino acid sequence is added at the N end of the amino acid sequence of the Cas phi-2 protein, and 3 nuclear localization signal peptide amino acid sequences are added at the C end.

The position of the cut DNA of the Cas phi-2 protein is 12-18bp of a target point, most of the generated mutations are base deletion mutations, the defects of small insertion base and deletion mutation range of the Cas9 can be effectively avoided, and the requirement of small-range fragment deletion can be met according to the experimental purpose. Although the way of cutting DNA of Cas phi-2 protein is similar to that of Cpf1 nuclease, the target sequence of Cas phi-2 is shorter (18-20bp), and the target of Cpf1 is longer, which are obviously different.

The Cas phi-2 protein provided by the invention is optimized in sequence based on the traditional nucleotide (or amino acid) sequence according to the preference of rice codons, 1 nuclear localization sequence is added at the N end, and 3 nuclear localization sequences are added at the C end. Through the optimization, the rice gene editing by the Cas phi-2 protein is realized.

Preferably, in the Cas Φ -2 protein, the amino acid sequence of the nuclear localization signal peptide added at the N-terminal of the amino acid sequence of the Cas Φ -2 protein is SV40 nuclear localization signal peptide amino acid sequence, and the amino acid sequences of the 3 nuclear localization signal peptides added at the C-terminal are sequentially 2 SV40 nuclear localization signal peptide amino acid sequences and 1 NLS nuclear localization signal peptide amino acid sequence.

Preferably, the amino acid sequence of the Cas Φ -2 protein is shown as SEQ ID No.1, and the nucleotide sequence of the Cas Φ -2 protein is shown as SEQ ID No. 2.

The invention also provides a Cas phi-2 protein expression vector for rice gene editing, which contains the nucleotide sequence of any Cas phi-2 protein on a blank vector. The Cas phi-2 protein expression vector can be assembled together with a CrRNA expression cassette of the Cas phi-2 protein to obtain a corresponding complete expression vector of the Cas phi-2 protein.

Preferably, in the above Cas Φ -2 protein expression vector, the blank vector used is pCAMBIA1300 vector, and the nucleotide for transcribing Cas Φ -2 protein uses maize UBI promoter and NOS terminator; the nucleotide sequence of the corn UBI promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the NOS terminator is shown in SEQ ID NO. 4.

As a preferable mode, the Cas phi-2 protein expression vector can be formed by transcribing the nucleotide sequence of the Cas phi-2 protein by using a corn UBI promoter (the nucleotide sequence is shown as SEQ NO. 4) and finally cloning the nucleotide sequence to a blank vector by using an NOS terminator (the nucleotide sequence is shown as SEQ NO. 5).

The invention also provides a CrRNA expression cassette of the Cas phi-2 protein for rice gene editing, which comprises no load of the CrRNA expression cassette and a gene editing target point designed aiming at the corresponding rice gene;

the CrRNA expression cassette comprises the CrRNA of the Cas phi-2 protein in an empty load manner, and also comprises a promoter for transcribing a corresponding rice gene editing target, wherein two ends of a nucleotide sequence of the CrRNA are respectively provided with 1 tRNA sequence.

The CrRNA expression cassette of the Cas phi-2 protein is formed by designing a gene editing target sequence aiming at a specific rice gene, assembling a promoter, CrRNA and tRNA of a transcription gene editing target into a CrRNA expression cassette with no load, and then assembling and connecting the gene editing target and the CrRNA expression cassette with no load. The gene editing target point can be designed according to the selected rice gene segment. A tRNA sequence is added at each of two ends of CrRNA of the Cas phi-2 protein, so that the generation efficiency of the CrRNA in rice cells is improved; in addition, the rice OsU6a promoter can be selected to transcribe the CrRNA of the Cas phi-2.

Preferably, in the CrRNA expression cassette for Cas Φ -2 protein, the targeted rice gene is the OsBEL gene, the nucleotide sequence of the gene editing target is shown in SEQ ID No.5, and the nucleotide sequence of the OsU6a promoter which initiates the target of the rice gene OsBEL is shown in SEQ ID No. 6; the nucleotide sequence of CrRNA of the Cas phi-2 protein is shown as SEQ ID NO. 7; the nucleotide sequence of the tRNA sequence is shown as SEQ ID NO. 8; the no-load nucleotide sequence of the CrRNA expression cassette is shown as SEQ ID NO. 9;

the primers used for assembling the CrRNA expression cassette of the Cas phi-2 protein are as follows:

BEL-F：ggacCATCTCCTTCTAGAAGCACA；

BEL-R：tgttTGTGCTTCTAGAAGGAGATG；

the specific assembly mode is as follows: taking 1 mul BEL-F, 1 mul BEL-R and 8 mul sterile water (putting into an EP tube), denaturing at 95 ℃ on a PCR amplification instrument, and annealing at 55 ℃ to obtain BEL primer mixed solution; and then taking 1 mu l of BEL primer mixed solution, forming a10 mu l mixed system with 30ng of CrRNA expression cassette no-load, 1 mu l of 10 XCutSmart Buffer, 35U T4 DNA ligase, 10U of Bsal restriction endonuclease and sterile water, and culturing at 37 ℃ for 1h to prepare the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein.

The expression cassette OsU6a-CrRNA-BEL was verified in the following manner: and (3) converting the product mixed solution into escherichia coli receptive peptide cells, and then carrying out bacteria detection and sequencing confirmation.

The invention also provides a complete expression vector of the Cas phi-2 protein for rice gene editing, wherein the complete expression vector of the Cas phi-2 protein is connected with the Cas phi-2 protein expression vector of claim 4 or 5, and is also connected with a CrRNA expression cassette of the Cas phi-2 protein of claim 6 or 7.

Preferably, the complete expression vector of the Cas phi-2 protein is formed by amplifying a CrRNA expression cassette of the Cas phi-2 protein by using primers Pps-R and Pgs-L, and then assembling and connecting BsaI and T4 DNA ligase with the Cas phi-2 protein expression vector;

the primers Pps-R and Pgs-L are as follows:

Pps-R：TAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG；

Pgs-L：AGTGggtctcGctcgACGCGTATCCATCCACTCCAAGCTC。

the complete expression vector of the Cas phi-2 protein prepared by the method can be transformed into rice callus to be expressed by virtue of the engineered agrobacterium EHA 105.

Preferably, the nucleotide sequence of the complete expression vector of the Cas phi-2 protein is shown as SEQ ID No. 10.

Compared with the prior art, the invention has the advantages that: the invention provides a Cas phi-2 protein for rice gene editing, a Cas phi-2 protein expression vector and a CrRNA expression cassette are obtained based on the Cas phi-2 protein, and a complete expression vector of the Cas phi-2 protein is obtained after the Cas phi-2 protein expression vector and the CrRNA expression cassette are assembled, the complete expression vector is transformed into EHA105 agrobacterium and then infects rice callus, the expression of the complete expression vector in the rice callus can be realized, and the rice gene knock-out editing is realized.

Drawings

FIG. 1 is the structure of an example CrRNA expression cassette OsU6a-CrRNA-BEL vector for Cas Φ -2 protein;

fig. 2 is a structure of an example Cas Φ -2 protein expression vector;

FIG. 3 is a schematic diagram of an unloaded structure of a CrRNA expression cassette of an example Cas Φ -2 protein;

FIG. 4 is a schematic structural diagram of an example target-free expression vector pEGCas Φ -2Pubi-H-OsU6a-CrRNA for Cas Φ -2 protein;

FIG. 5 is a schematic structural diagram of an example complete expression vector for Cas Φ -2 protein pEGCas Φ -2Pubi-H-OsU6 a-CrRNA-BEL;

FIG. 6 is a schematic diagram of the BEL-11 and BEL-31 amplification band electrophoresis of the examples;

FIG. 7 is a graph showing the results of sequencing analysis of the BEL-11 sample according to the example;

FIG. 8 is a diagram showing the results of sequencing analysis of the BEL-31 sample of the example.

Detailed Description

The technical solutions of the present invention will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Examples

In this example, the rice OsBEL gene (LOC _ Os03g55240) was selected as a research subject for testing, and the specific test steps are as follows:

1. designing an OsBEL gene editing target: TTTCATCTCCTTCTAGAAGCACA, PAM site is TTT, as shown in SEQ ID NO. 5.

2. Target spot assembly to obtain CrRNA expression cassette of Cas phi-2 protein

Assembling the OsBEL gene editing target, OsU6a promoter (nucleotide sequence is shown as SEQ ID NO. 6) and CrRNA (nucleotide sequence is shown as SEQ ID NO. 7);

primers used for OsBEL gene editing target assembly were as follows:

BEL-F：ggacCATCTCCTTCTAGAAGCACA；

BEL-R：tgttTGTGCTTCTAGAAGGAGATG；

the specific assembly mode is as follows: taking 1 mul BEL-F, 1 mul BEL-R and 8 mul sterile water (putting into an EP tube), denaturing at 95 ℃ on a PCR amplification instrument, and annealing at 55 ℃ to obtain BEL primer mixed solution; then 1 mul BEL primer mixed solution is taken to be combined with 30ng CrRNA expression cassette no-load, 1 mul 10 XCutSmart Buffer, 35U T4 DNA ligase, 10U Bsal restriction enzyme and sterile water to form a10 mul mixed system, and the mixed system is cultured for 1h at 37 ℃;

and transforming the connected mixed solution into an escherichia coli receptive peptide cell, and finally forming the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein through bacterial detection and sequencing confirmation.

The CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein consists of a CrRNA expression cassette no-load and a gene editing target point of a rice gene OsBEL; the CrRNA expression cassette comprises CrRNA of Cas phi-2 protein on no load and also comprises OsU6a promoter for transcribing rice gene OsBEL target, and two ends of the nucleotide sequence of the CrRNA are respectively provided with 1 tRNA sequence, as shown in figure 3; the specific structure diagram of the expression cassette is shown in FIG. 1, two segments of CrRNA are respectively provided with 1 tRNA sequence, and the T position is used for assembling and connecting a target point sequence BEL;

the nucleotide sequence of the tRNA sequence is shown as SEQ ID NO. 8; the nucleotide sequence of the CrRNA expression cassette in no-load is shown as SEQ ID NO. 9;

3. construction of Cas phi-2 protein expression vector

Selecting a blank vector pCAMBIA1300, transcribing a nucleotide sequence of a Cas phi-2 protein by using a corn UBI promoter (shown as SEQ ID NO. 3), and cloning a nucleic acid sequence (shown as SEQ ID NO. 4) to the pCAMBIA1300 to construct a Cas phi-2 rice expression vector; assembling a nucleotide sequence of the Cas phi-2 protein on a blank vector to obtain a Cas phi-2 protein expression vector for rice gene OsBEL gene editing; the amino acid sequence of the Cas phi-2 protein is shown as SEQ ID NO.1, the nucleotide sequence is shown as SEQ ID NO.2, and the nucleotide contains a terminator TAG; the specific structure diagram of the expression vector is shown in figure 2, the left side (N end) of the nucleotide sequence of the Cas phi-2 protein is provided with 1 nucleotide sequence of SV40 nuclear localization signal peptide, and the right side (C end) is provided with 2 nucleotide sequences of SV40 nuclear localization signal peptide and 1 nucleotide sequence of NLS nuclear localization signal peptide;

the assembly mode of the Cas phi-2 protein expression vector is as follows:

(1) modified pCAMBIA1300 vector

CCDB-F：GctatgaccatgattacgaattcCTCGAGAGACCTCTGAAGTG

CCDB-R：AcgacggccagtgccaagcttACCGCGAGACCCACGCTCACC

Firstly, carrying out double enzyme digestion on a pCAMBIA1300 vector by using EcoRI/HindIII;

the enzyme cutting system is as follows: adding sterile water to 50 mu.l of 2 mu.g of pCAMBIA1300 vector, 1 mu.l of EcoRI restriction endonuclease, 1 mu.l of HindIII restriction endonuclease and 5 mu.l of 10 XFastdigest Green Buffer, then reacting in an incubator at 37 ℃ for 1 hour, and recovering the pCAMBIA1300 vector after enzyme digestion by using a gel recovery kit;

the ccdB structure containing BsaI enzyme cutting sites is amplified by using primers CCDB-F and CCDB-R, and the amplification system is as follows:

PCR reaction parameters:

then recovering the amplified CCDB fragment by using a gel recovery kit;

(2) construction of pEG-ccdB intermediate vector

Constructing pEG-ccdB empty load by using a Gibson assembly mode;

the reaction system is as follows: 5 mul of Gibson assembly mix, 50ng of digested pCAMBIA1300 vector and 50ng of CCDB recovered fragment, adding water to 10 mul, reacting on a PCR instrument for 30min, then converting the reaction solution into DB3.1 escherichia coli sensory peptide cells, and then performing bacteria detection and sequencing confirmation to finally form the pEG-ccdB intermediate vector;

(3) construction of empty Cas Φ -2 expression vector

UBI-F：AGTGggtctcGctcgCGGCCATGCGGCCGCAAGCTGGGT

UBI-R：TAGAggtctcTGGTGGCTGCAGAAGTAACACCAAACAACA

CasF2-F：AGTGggtctcGCACCATGCCGAAGAAGAAGCGCAAGGTGTCC CasF2-R:TAGAggtctcTTCACCGCTACTTCTTTTTCTTAGCCTGTCCGGCC TTTTTGG

NOS-F：AGTGggtctcGGTGATCCTCCCGATCGTTCAAACA

NOS-R：TAGAggtctcTaccgGGCGCGCCTGCTCCCGATCTAGTAAC

Respectively amplifying UBI promoter fragments and NOS sequences by using the three pairs of primers, wherein templates of the two sequences are pYLCRISPR/Cas9Pubi-H vector (from laboratory of Liu dazzling academy of Siamese, university of southern China), and a Cas phi-2 sequence template is synthesized according to a whole gene of SEQ ID NO. 2; the amplification system and the reaction conditions were determined in accordance with the above step (1);

and (3) recovering the 3 fragments by using a gel recovery kit, and performing enzyme digestion and connection by using a Golden Gate mode: an enzyme linked system 100ng UBI fragment, 20ng NOS fragment, 100ng Cas phi-2 fragment, 50ng pEG-ccdB, 1 mul 10 xCutSmart Buffer, 35U T4 DNA ligase, 10U BsaI restriction endonuclease and sterile water form a mixed system 10 mul, the mixed system reacts for 1h in a 37 ℃ incubator, the mixed solution after connection is transformed into DH5 alpha escherichia coli receptive peptide cells, and then the cells are subjected to bacteria detection and sequencing confirmation to finally form the Cas phi-2 protein expression vector.

4. Construction of complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL for editing rice gene OsBEL

Primers for assembling the complete expression vector of the Cas Φ -2 protein were as follows:

Pps-R：TAGAggtctcTaccgACTAGTATGGAATCGGCAGCAAAGG；

Pgs-L：AGTGggtctcGctcgACGCGTATCCATCCACTCCAAGCTC；

firstly, the primers Pps-R and Pgs-L are used for carrying out PCR amplification on the CrRNA expression cassette OsU6a-CrRNA-BEL of the Cas phi-2 protein, and the amplification system of the CrRNA expression cassette of the Cas phi-2 protein is as follows:

PCR reaction parameters:

then BsaI and T4 DNA ligase are used for assembling and connecting a CrRNA expression box OsU6a-CrRNA-BEL and the Cas phi-2 protein expression vector in a Golden Gate mode to construct and obtain a complete Cas phi-2 protein complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL, the nucleotide sequence is shown as SEQ ID NO.10, the T position in figure 4 is the assembling position of the BEL target point in the Cas phi-2 protein complete expression vector, and figure 5 is a schematic diagram of the Cas phi-2 protein complete expression vector for completing the assembling of the BEL target point.

5. Genetic transformation of Cas phi-2 protein complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL

Transforming the complete expression vector pEGCas phi-2 Pubi-H-OsU6a-CrRNA-BEL obtained by construction into EHA105 agrobacterium, infecting rice callus, screening the rice callus for 2 times by hygromycin B antibiotic, differentiating and rooting to form complete rice seedlings, and carrying out molecular level detection and identification.

6. Detection of mutation type of rice gene OsBEL

(1) Design of detection primer (amplification band 544bp)

BEL(det+)：GGAGTGAGTAGAAGTAATCGCC

BEL(det-)：AGGTCACGTCGTGCTCGGTGAA

(2) PCR amplification conditions

PCR amplification was carried out using the primers BEL (det +) and BEL (det-):

the PCR reaction parameters were as follows:

the PCR products were analyzed by electrophoresis on a 1.5% agarose gel. As can be seen from FIG. 6, the BEL-11 and BEL-31 samples are two bright bands on the right side, around 544 bp.

(3) Sequencing analysis of PCR product sanger

The PCR products of the above 81 samples were sent to sanger sequencing, and the results of the sequencing were analyzed by using DSDecode software, wherein the results of 2 samples were compiled as shown in FIGS. 7 and 8. As can be seen from FIGS. 7 and 8, the present experiment showed a total of 81 sequencing samples, of which only two samples BEL-11 and BEL-31 were edited with an editing efficiency of 2.5%, and Sanger sequencing data of the BEL-11 and BEL-31 samples analyzed by decoding with DSDecode software showed that 11 bases were deleted from the BEL-11 sample and 18 bases were deleted from the BEL-31 sample. Therefore, the complete expression vector pEGCas phi-2 Pubi-H-OsU 6-6 a-CrRNA-BEL of the Cas phi-2 protein obtained by the method can play a role in gene knockout and editing of the rice gene OsBEL.

Sequence listing

<110> Wuhan Aidi crystal Biotech Co., Ltd

<120> Cas phi-2 protein for rice gene editing and expression cassette and expression vector thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 810

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Pro Lys Lys Lys Arg Lys Val Ser Gly Gly Ser Pro Lys Pro Ala

1 5 10 15

Val Glu Ser Glu Phe Ser Lys Val Leu Lys Lys His Phe Pro Gly Glu

20 25 30

Arg Phe Arg Ser Ser Tyr Met Lys Arg Gly Gly Lys Ile Leu Ala Ala

35 40 45

Gln Gly Glu Glu Ala Val Val Ala Tyr Leu Gln Gly Lys Ser Glu Glu

50 55 60

Glu Pro Pro Asn Phe Gln Pro Pro Ala Lys Cys His Val Val Thr Lys

65 70 75 80

Ser Arg Asp Phe Ala Glu Trp Pro Ile Met Lys Ala Ser Glu Ala Ile

85 90 95

Gln Arg Tyr Ile Tyr Ala Leu Ser Thr Thr Glu Arg Ala Ala Cys Lys

100 105 110

Pro Gly Lys Ser Ser Glu Ser His Ala Ala Trp Phe Ala Ala Thr Gly

115 120 125

Val Ser Asn His Gly Tyr Ser His Val Gln Gly Leu Asn Leu Ile Phe

130 135 140

Asp His Thr Leu Gly Arg Tyr Asp Gly Val Leu Lys Lys Val Gln Leu

145 150 155 160

Arg Asn Glu Lys Ala Arg Ala Arg Leu Glu Ser Ile Asn Ala Ser Arg

165 170 175

Ala Asp Glu Gly Leu Pro Glu Ile Lys Ala Glu Glu Glu Glu Val Ala

180 185 190

Thr Asn Glu Thr Gly His Leu Leu Gln Pro Pro Gly Ile Asn Pro Ser

195 200 205

Phe Tyr Val Tyr Gln Thr Ile Ser Pro Gln Ala Tyr Arg Pro Arg Asp

210 215 220

Glu Ile Val Leu Pro Pro Glu Tyr Ala Gly Tyr Val Arg Asp Pro Asn

225 230 235 240

Ala Pro Ile Pro Leu Gly Val Val Arg Asn Arg Cys Asp Ile Gln Lys

245 250 255

Gly Cys Pro Gly Tyr Ile Pro Glu Trp Gln Arg Glu Ala Gly Thr Ala

260 265 270

Ile Ser Pro Lys Thr Gly Lys Ala Val Thr Val Pro Gly Leu Ser Pro

275 280 285

Lys Lys Asn Lys Arg Met Arg Arg Tyr Trp Arg Ser Glu Lys Glu Lys

290 295 300

Ala Gln Asp Ala Leu Leu Val Thr Val Arg Ile Gly Thr Asp Trp Val

305 310 315 320

Val Ile Asp Val Arg Gly Leu Leu Arg Asn Ala Arg Trp Arg Thr Ile

325 330 335

Ala Pro Lys Asp Ile Ser Leu Asn Ala Leu Leu Asp Leu Phe Thr Gly

340 345 350

Asp Pro Val Ile Asp Val Arg Arg Asn Ile Val Thr Phe Thr Tyr Thr

355 360 365

Leu Asp Ala Cys Gly Thr Tyr Ala Arg Lys Trp Thr Leu Lys Gly Lys

370 375 380

Gln Thr Lys Ala Thr Leu Asp Lys Leu Thr Ala Thr Gln Thr Val Ala

385 390 395 400

Leu Val Ala Ile Asp Leu Gly Gln Thr Asn Pro Ile Ser Ala Gly Ile

405 410 415

Ser Arg Val Thr Gln Glu Asn Gly Ala Leu Gln Cys Glu Pro Leu Asp

420 425 430

Arg Phe Thr Leu Pro Asp Asp Leu Leu Lys Asp Ile Ser Ala Tyr Arg

435 440 445

Ile Ala Trp Asp Arg Asn Glu Glu Glu Leu Arg Ala Arg Ser Val Glu

450 455 460

Ala Leu Pro Glu Ala Gln Gln Ala Glu Val Arg Ala Leu Asp Gly Val

465 470 475 480

Ser Lys Glu Thr Ala Arg Thr Gln Leu Cys Ala Asp Phe Gly Leu Asp

485 490 495

Pro Lys Arg Leu Pro Trp Asp Lys Met Ser Ser Asn Thr Thr Phe Ile

500 505 510

Ser Glu Ala Leu Leu Ser Asn Ser Val Ser Arg Asp Gln Val Phe Phe

515 520 525

Thr Pro Ala Pro Lys Lys Gly Ala Lys Lys Lys Ala Pro Val Glu Val

530 535 540

Met Arg Lys Asp Arg Thr Trp Ala Arg Ala Tyr Lys Pro Arg Leu Ser

545 550 555 560

Val Glu Ala Gln Lys Leu Lys Asn Glu Ala Leu Trp Ala Leu Lys Arg

565 570 575

Thr Ser Pro Glu Tyr Leu Lys Leu Ser Arg Arg Lys Glu Glu Leu Cys

580 585 590

Arg Arg Ser Ile Asn Tyr Val Ile Glu Lys Thr Arg Arg Arg Thr Gln

595 600 605

Cys Gln Ile Val Ile Pro Val Ile Glu Asp Leu Asn Val Arg Phe Phe

610 615 620

His Gly Ser Gly Lys Arg Leu Pro Gly Trp Asp Asn Phe Phe Thr Ala

625 630 635 640

Lys Lys Glu Asn Arg Trp Phe Ile Gln Gly Leu His Lys Ala Phe Ser

645 650 655

Asp Leu Arg Thr His Arg Ser Phe Tyr Val Phe Glu Val Arg Pro Glu

660 665 670

Arg Thr Ser Ile Thr Cys Pro Lys Cys Gly His Cys Glu Val Gly Asn

675 680 685

Arg Asp Gly Glu Ala Phe Gln Cys Leu Ser Cys Gly Lys Thr Cys Asn

690 695 700

Ala Asp Leu Asp Val Ala Thr His Asn Leu Thr Gln Val Ala Leu Thr

705 710 715 720

Gly Lys Thr Met Pro Lys Arg Glu Glu Pro Arg Asp Ala Gln Gly Thr

725 730 735

Ala Pro Ala Arg Lys Thr Lys Lys Ala Ser Lys Ser Lys Ala Pro Pro

740 745 750

Ala Glu Arg Glu Asp Gln Thr Pro Ala Gln Glu Pro Ser Gln Thr Ser

755 760 765

Ser Gly Gly Ser Pro Lys Lys Lys Arg Lys Val Ser Gly Gly Ser Pro

770 775 780

Lys Lys Lys Arg Lys Val Ser Gly Gly Ser Lys Arg Pro Ala Ala Thr

785 790 795 800

Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys

805 810

<210> 2

<211> 2433

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgccgaaga agaagcgcaa ggtgtccggc ggctccccga agccagccgt ggagagcgag 60

ttctccaagg tgctcaagaa gcacttccca ggcgagcgct tccgcagcag ctacatgaag 120

cgcggcggca agatcctcgc cgcccagggc gaggaggccg tggtcgccta cctccagggc 180

aagtccgagg aggagccgcc gaacttccag ccgccagcga agtgccacgt cgtgaccaag 240

tcccgcgact tcgccgagtg gccgatcatg aaggcgtccg aggcgatcca gcgctacatc 300

tacgccctca gcaccacaga gcgggccgcg tgcaagccgg gcaagtcctc tgagtcccac 360

gcggcctggt tcgccgccac cggcgtgagc aaccacggct actcccacgt gcagggcctc 420

aacctgatct tcgaccacac actcggcagg tacgatggcg tgctgaagaa ggtccagctt 480

aggaacgaga aggctagggc tcgcctggaa tcgattaacg cctcgcgggc tgatgagggt 540

cttcctgaaa ttaaggctga agaggaagag gtcgcaacca atgaaaccgg tcatcttttg 600

cagcctccgg gcataaaccc gtccttctac gtctaccaaa ctatatctcc tcaggcctat 660

agacctcgcg acgaaatagt cctcccccct gagtatgccg gttatgtgag ggacccgaat 720

gcccccattc cgttgggcgt cgtccgtaat cgttgcgaca tacaaaaggg ctgcccagga 780

tacatcccag agtggcagcg cgaagccgga acagcaataa gccccaagac cgggaaggcg 840

gttacggttc caggactttc tcctaagaag aataagcgca tgaggagata ttggcggtca 900

gagaaggaaa aggcccagga tgcgctgttg gtcacagtta ggattggcac ggactgggtc 960

gtaattgacg ttagaggcct gcttagaaat gccagatgga ggacgattgc ccccaaggac 1020

atctccttga acgctctcct ggatctcttt actggcgatc cggtgatcga tgttagaagg 1080

aatatagtga cgtttactta cacacttgac gcgtgcggta catacgctcg caagtggacg 1140

cttaagggaa agcaaaccaa ggcgacgttg gataagctga cggcaaccca aaccgtggca 1200

ttggtagcta ttgacttggg ccagacaaat ccgatttcag ccggaatctc gagggtcaca 1260

caggaaaatg gagcactcca gtgcgaaccc ttggaccggt tcaccctccc agacgacctg 1320

ctcaaggata tcagcgccta caggattgca tgggaccgca atgaggagga gttgagagcg 1380

cggagcgttg aggcactccc agaagctcaa caagcggagg tcagggcatt ggacggtgta 1440

tcaaaggaaa ccgcccgtac ccagctctgt gcggatttcg gccttgaccc gaaacgcctc 1500

ccttgggaca agatgagctc gaatacgacc ttcatctcag aggcgcttct gtcgaattcc 1560

gtgtcccgtg atcaggtgtt ctttacaccg gctccgaaga aaggggccaa gaagaaggcc 1620

ccggttgagg taatgcgcaa agataggacg tgggctaggg cgtacaaacc acgcctctct 1680

gtggaggcgc agaaactcaa gaacgaagcc ttgtgggctt tgaaaaggac ctccccggaa 1740

tatctgaagc tgtctcgccg taaagaggaa ctctgtcgcc gttcgatcaa ttacgtcatc 1800

gagaagaccc gtaggagaac tcagtgccag attgtgattc cggtaatcga ggacctgaac 1860

gtccggtttt ttcacggctc cggcaaaaga cttcccggtt gggataactt ctttaccgca 1920

aagaaggaaa ataggtggtt catacagggc cttcataagg ccttctctga tctgagaacg 1980

catcgttcct tttacgtgtt cgaggtgcgg ccggaacgca cctctattac ttgccccaaa 2040

tgtggccact gtgaagtcgg caatcgcgat ggggaggcat tccaatgtct gtcgtgtgga 2100

aagacttgta atgctgatct cgacgtagcg acccacaatc ttacccaggt tgcgctgacg 2160

ggcaagacca tgccaaagag ggaggaacca cgtgacgcac aaggaaccgc accggctagg 2220

aagacaaaga aagcctcgaa atcaaaagct cctccggccg aaagagagga tcagactccg 2280

gctcaggagc catcccagac gtcttccggc ggcagcccta agaagaagcg gaaggtttct 2340

ggaggttctc cgaagaagaa gcgcaaggtg tccggcggct ccaagcgtcc tgctgccacc 2400

aaaaaggccg gacaggctaa gaaaaagaag tag 2433

<210> 3

<211> 1987

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat gtctaagtta 60

taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt atctatcttt 120

atacatatat ttaaacttta ctctacgaat aatataatct atagtactac aataatatca 180

gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca attgagtatt 240

ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg 300

caaatagctt cacctatata atacttcatc cattttatta gtacatccat ttagggttta 360

gggttaatgg tttttataga ctaatttttt tagtacatct attttattct attttagcct 420

ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaataattt agatataaaa 480

tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 540

aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt 600

ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 660

cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc gttggacttg 720

ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 780

gcggcctcct cctcctctca cggcacggca gctacggggg attcctttcc caccgctcct 840

tcgctttccc ttcctcgccc gccgtaataa atagacaccc cctccacacc ctctttcccc 900

aacctcgtgt tgttcggagc gcacacacac acaaccagat ctcccccaaa tccacccgtc 960

ggcacctccg cttcaaggta cgccgctcgt cctccccccc cccccctctc taccttctct 1020

agatcggcgt tccggtccat ggttagggcc cggtagttct acttctgttc atgtttgtgt 1080

tagatccgtg tttgtgttag atccgtgctg ctagcgttcg tacacggatg cgacctgtac 1140

gtcagacacg ttctgattgc taacttgcca gtgtttctct ttggggaatc ctgggatggc 1200

tctagccgtt ccgcagacgg gatcgatttc atgatttttt ttgtttcgtt gcatagggtt 1260

tggtttgccc ttttccttta tttcaatata tgccgtgcac ttgtttgtcg ggtcatcttt 1320

tcatgctttt ttttgtcttg gttgtgatga tgtggtctgg ttgggcggtc gttctagatc 1380

ggagtagaat tctgtttcaa actacctggt ggatttatta attttggatc tgtatgtgtg 1440

tgccatacat attcatagtt acgaattgaa gatgatggat ggaaatatcg atctaggata 1500

ggtatacatg ttgatgcggg ttttactgat gcatatacag agatgctttt tgttcgcttg 1560

gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt tctagatcgg agtagaatac 1620

tgtttcaaac tacctggtgt atttattaat tttggaactg tatgtgtgtg tcatacatct 1680

tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat acatgttgat 1740

gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat atgctctaac 1800

cttgagtacc tatctattat aataaacaag tatgttttat aattattttg atcttgatat 1860

acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg ccttcatacg 1920

ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt tggtgttact 1980

tctgcag 1987

<210> 4

<211> 253

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 120

atgacgttat ttatgaggtg ggtttttatg attagagtcc cgcaattata catttaatac 180

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240

atgttactag atc 253

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tttcatctcc ttctagaagc aca 23

<210> 6

<211> 448

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

attttttcct gtagttttcc cacaaccatt ttttaccatc cgaatgatag gataggaaaa 60

atatccaagt gaacagtatt cctataaaat tcccgtaaaa agcctgcaat ccgaatgagc 120

cctgaagtct gaactagccg gtcacctgta caggctatcg agatgccata caagagacgg 180

tagtaggaac taggaagacg atggttgatt cgtcaggcga aatcgtcgtc ctgcagtcgc 240

atctatgggc ctggacggaa taggggaaaa agttggccgg ataggaggga aaggcccagg 300

tgcttacgtg cgaggtaggc ctgggctctc agcacttcga ttcgttggca ccggggtagg 360

atgcaataga gagcaacgtt tagtaccacc tcgcttagct agagcaaact ggactgcctt 420

atatgcgcgg gtgctggctt ggctgccg 448

<210> 7

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caacgattgc ccctcacgag gggac 25

<210> 8

<211> 77

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttc 60

gattcccggc tggtgca 77

<210> 9

<211> 2534

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cacatttcgt aaaacgacgg ccagtgaatt cggatccaag cttactagta tggaatcggc 60

agcaaaggat tttttcctgt agttttccca caaccatttt ttaccatccg aatgatagga 120

taggaaaaat atccaagtga acagtattcc tataaaattc ccgtaaaaag cctgcaatcc 180

gaatgagccc tgaagtctga actagccggt cacctgtaca ggctatcgag atgccataca 240

agagacggta gtaggaacta ggaagacgat ggttgattcg tcaggcgaaa tcgtcgtcct 300

gcagtcgcat ctatgggcct ggacggaata ggggaaaaag ttggccggat aggagggaaa 360

ggcccaggtg cttacgtgcg aggtaggcct gggctctcag cacttcgatt cgttggcacc 420

ggggtaggat gcaatagaga gcaacgttta gtaccacctc gcttagctag agcaaactgg 480

actgccttat atgcgcgggt gctggcttgg ctgccgaaca aagcaccagt ggtctagtgg 540

tagaatagta ccctgccacg gtacagaccc gggttcgatt cccggctggt gcacaacgat 600

tgcccctcac gaggggacag agaccactgt ccgtcagatg ggtctcgaac aaagcaccag 660

tggtctagtg gtagaatagt accctgccac ggtacagacc cgggttcgat tcccggctgg 720

tgcatttttt tcaagagctt ggagtggatg gaacgcgtct gcaggagctc ctcgagggtc 780

atagctgttt cctgcgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 840

cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 900

gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 960

tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 1020

tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt 1080

cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 1140

gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 1200

ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt 1260

ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 1320

ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 1380

agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 1440

aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 1500

atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg 1560

tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 1620

tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca 1680

tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 1740

gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 1800

tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt 1860

ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg 1920

gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc 1980

aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 2040

ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga 2100

tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga 2160

ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta 2220

aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg 2280

ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact 2340

ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata 2400

agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt 2460

tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa 2520

ataggggttc cgcg 2534

<210> 10

<211> 14363

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcattaatgc agctggcacg acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc 60

aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta tgcttccggc 120

tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca gctatgacat 180

gattacgaat tccggccatg cggccgcaag ctgggtgcag cgtgacccgg tcgtgcccct 240

ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 300

tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 360

gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 420

cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 480

ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 540

catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 600

tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 660

tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 720

taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 780

gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 840

cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 900

ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 960

gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 1020

ggcagctacg ggggattcct ttcccaccgc tccttcgctt tcccttcctc gcccgccgta 1080

ataaatagac accccctcca caccctcttt ccccaacctc gtgttgttcg gagcgcacac 1140

acacacaacc agatctcccc caaatccacc cgtcggcacc tccgcttcaa ggtacgccgc 1200

tcgtcctccc cccccccccc tctctacctt ctctagatcg gcgttccggt ccatggttag 1260

ggcccggtag ttctacttct gttcatgttt gtgttagatc cgtgtttgtg ttagatccgt 1320

gctgctagcg ttcgtacacg gatgcgacct gtacgtcaga cacgttctga ttgctaactt 1380

gccagtgttt ctctttgggg aatcctggga tggctctagc cgttccgcag acgggatcga 1440

tttcatgatt ttttttgttt cgttgcatag ggtttggttt gcccttttcc tttatttcaa 1500

tatatgccgt gcacttgttt gtcgggtcat cttttcatgc ttttttttgt cttggttgtg 1560

atgatgtggt ctggttgggc ggtcgttcta gatcggagta gaattctgtt tcaaactacc 1620

tggtggattt attaattttg gatctgtatg tgtgtgccat acatattcat agttacgaat 1680

tgaagatgat ggatggaaat atcgatctag gataggtata catgttgatg cgggttttac 1740

tgatgcatat acagagatgc tttttgttcg cttggttgtg atgatgtggt gtggttgggc 1800

ggtcgttcat tcgttctaga tcggagtaga atactgtttc aaactacctg gtgtatttat 1860

taattttgga actgtatgtg tgtgtcatac atcttcatag ttacgagttt aagatggatg 1920

gaaatatcga tctaggatag gtatacatgt tgatgtgggt tttactgatg catatacatg 1980

atggcatatg cagcatctat tcatatgctc taaccttgag tacctatcta ttataataaa 2040

caagtatgtt ttataattat tttgatcttg atatacttgg atgatggcat atgcagcagc 2100

tatatgtgga tttttttagc cctgccttca tacgctattt atttgcttgg tactgtttct 2160

tttgtcgatg ctcaccctgt tgtttggtgt tacttctgca gccaccatgc cgaagaagaa 2220

gcgcaaggtg tccggcggct ccccgaagcc agccgtggag agcgagttct ccaaggtgct 2280

caagaagcac ttcccaggcg agcgcttccg cagcagctac atgaagcgcg gcggcaagat 2340

cctcgccgcc cagggcgagg aggccgtggt cgcctacctc cagggcaagt ccgaggagga 2400

gccgccgaac ttccagccgc cagcgaagtg ccacgtcgtg accaagtccc gcgacttcgc 2460

cgagtggccg atcatgaagg cgtccgaggc gatccagcgc tacatctacg ccctcagcac 2520

cacagagcgg gccgcgtgca agccgggcaa gtcctctgag tcccacgcgg cctggttcgc 2580

cgccaccggc gtgagcaacc acggctactc ccacgtgcag ggcctcaacc tgatcttcga 2640

ccacacactc ggcaggtacg atggcgtgct gaagaaggtc cagcttagga acgagaaggc 2700

tagggctcgc ctggaatcga ttaacgcctc gcgggctgat gagggtcttc ctgaaattaa 2760

ggctgaagag gaagaggtcg caaccaatga aaccggtcat cttttgcagc ctccgggcat 2820

aaacccgtcc ttctacgtct accaaactat atctcctcag gcctatagac ctcgcgacga 2880

aatagtcctc ccccctgagt atgccggtta tgtgagggac ccgaatgccc ccattccgtt 2940

gggcgtcgtc cgtaatcgtt gcgacataca aaagggctgc ccaggataca tcccagagtg 3000

gcagcgcgaa gccggaacag caataagccc caagaccggg aaggcggtta cggttccagg 3060

actttctcct aagaagaata agcgcatgag gagatattgg cggtcagaga aggaaaaggc 3120

ccaggatgcg ctgttggtca cagttaggat tggcacggac tgggtcgtaa ttgacgttag 3180

aggcctgctt agaaatgcca gatggaggac gattgccccc aaggacatct ccttgaacgc 3240

tctcctggat ctctttactg gcgatccggt gatcgatgtt agaaggaata tagtgacgtt 3300

tacttacaca cttgacgcgt gcggtacata cgctcgcaag tggacgctta agggaaagca 3360

aaccaaggcg acgttggata agctgacggc aacccaaacc gtggcattgg tagctattga 3420

cttgggccag acaaatccga tttcagccgg aatctcgagg gtcacacagg aaaatggagc 3480

actccagtgc gaacccttgg accggttcac cctcccagac gacctgctca aggatatcag 3540

cgcctacagg attgcatggg accgcaatga ggaggagttg agagcgcgga gcgttgaggc 3600

actcccagaa gctcaacaag cggaggtcag ggcattggac ggtgtatcaa aggaaaccgc 3660

ccgtacccag ctctgtgcgg atttcggcct tgacccgaaa cgcctccctt gggacaagat 3720

gagctcgaat acgaccttca tctcagaggc gcttctgtcg aattccgtgt cccgtgatca 3780

ggtgttcttt acaccggctc cgaagaaagg ggccaagaag aaggccccgg ttgaggtaat 3840

gcgcaaagat aggacgtggg ctagggcgta caaaccacgc ctctctgtgg aggcgcagaa 3900

actcaagaac gaagccttgt gggctttgaa aaggacctcc ccggaatatc tgaagctgtc 3960

tcgccgtaaa gaggaactct gtcgccgttc gatcaattac gtcatcgaga agacccgtag 4020

gagaactcag tgccagattg tgattccggt aatcgaggac ctgaacgtcc ggttttttca 4080

cggctccggc aaaagacttc ccggttggga taacttcttt accgcaaaga aggaaaatag 4140

gtggttcata cagggccttc ataaggcctt ctctgatctg agaacgcatc gttcctttta 4200

cgtgttcgag gtgcggccgg aacgcacctc tattacttgc cccaaatgtg gccactgtga 4260

agtcggcaat cgcgatgggg aggcattcca atgtctgtcg tgtggaaaga cttgtaatgc 4320

tgatctcgac gtagcgaccc acaatcttac ccaggttgcg ctgacgggca agaccatgcc 4380

aaagagggag gaaccacgtg acgcacaagg aaccgcaccg gctaggaaga caaagaaagc 4440

ctcgaaatca aaagctcctc cggccgaaag agaggatcag actccggctc aggagccatc 4500

ccagacgtct tccggcggca gccctaagaa gaagcggaag gtttctggag gttctccgaa 4560

gaagaagcgc aaggtgtccg gcggctccaa gcgtcctgct gccaccaaaa aggccggaca 4620

ggctaagaaa aagaagtagc ggtgatcctc ccgatcgttc aaacatttgg caataaagtt 4680

tcttaagatt gaatcctgtt gccggtcttg cgatgattat catataattt ctgttgaatt 4740

acgttaagca tgtaataatt aacatgtaat gcatgacgtt atttatgagg tgggttttta 4800

tgattagagt cccgcaatta tacatttaat acgcgataga aaacaaaata tagcgcgcaa 4860

actaggataa attatcgcgc gcggtgtcat ctatgttact agatcgggag caccggtaag 4920

gctcgacgcg ttccatccac tccaagctct tgaaaaaaat gcaccagccg ggaatcgaac 4980

ccgggtctgt accgtggcag ggtactattc taccactaga ccactggtgc tttgtttgtg 5040

cttctagaag gagatggtcc cctcgtgagg ggcaatcgtt gtgcaccagc cgggaatcga 5100

acccgggtct gtaccgtggc agggtactat tctaccacta gaccactggt gctttgttcg 5160

gcagccaagc cagcacccgc gcatataagg cagtccagtt tgctctagct aagcgaggtg 5220

gtactaaacg ttgctctcta ttgcatccta ccccggtgcc aacgaatcga agtgctgaga 5280

gcccaggcct acctcgcacg taagcacctg ggcctttccc tcctatccgg ccaacttttt 5340

cccctattcc gtccaggccc atagatgcga ctgcaggacg acgatttcgc ctgacgaatc 5400

aaccatcgtc ttcctagttc ctactaccgt ctcttgtatg gcatctcgat agcctgtaca 5460

ggtgaccggc tagttcagac ttcagggctc attcggattg caggcttttt acgggaattt 5520

tataggaata ctgttcactt ggatattttt cctatcctat cattcggatg gtaaaaaatg 5580

gttgtgggaa aactacagga aaaaatcctt tgctgccgat tccatactag tcggtccgta 5640

gtgaagcttg gcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac 5700

ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc 5760

ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgaatgct agagcagctt 5820

gagcttggat cagattgtcg tttcccgcct tcagtttaaa ctatcagtgt ttgacaggat 5880

atattggcgg gtaaacctaa gagaaaagag cgtttattag aataacggat atttaaaagg 5940

gcgtgaaaag gtttatccgt tcgtccattt gtatgtgcat gccaaccaca gggttcccct 6000

cgggatcaaa gtactttgat ccaacccctc cgctgctata gtgcagtcgg cttctgacgt 6060

tcagtgcagc cgtcttctga aaacgacatg tcgcacaagt cctaagttac gcgacaggct 6120

gccgccctgc ccttttcctg gcgttttctt gtcgcgtgtt ttagtcgcat aaagtagaat 6180

acttgcgact agaaccggag acattacgcc atgaacaaga gcgccgccgc tggcctgctg 6240

ggctatgccc gcgtcagcac cgacgaccag gacttgacca accaacgggc cgaactgcac 6300

gcggccggct gcaccaagct gttttccgag aagatcaccg gcaccaggcg cgaccgcccg 6360

gagctggcca ggatgcttga ccacctacgc cctggcgacg ttgtgacagt gaccaggcta 6420

gaccgcctgg cccgcagcac ccgcgaccta ctggacattg ccgagcgcat ccaggaggcc 6480

ggcgcgggcc tgcgtagcct ggcagagccg tgggccgaca ccaccacgcc ggccggccgc 6540

atggtgttga ccgtgttcgc cggcattgcc gagttcgagc gttccctaat catcgaccgc 6600

acccggagcg ggcgcgaggc cgccaaggcc cgaggcgtga agtttggccc ccgccctacc 6660

ctcaccccgg cacagatcgc gcacgcccgc gagctgatcg accaggaagg ccgcaccgtg 6720

aaagaggcgg ctgcactgct tggcgtgcat cgctcgaccc tgtaccgcgc acttgagcgc 6780

agcgaggaag tgacgcccac cgaggccagg cggcgcggtg ccttccgtga ggacgcattg 6840

accgaggccg acgccctggc ggccgccgag aatgaacgcc aagaggaaca agcatgaaac 6900

cgcaccagga cggccaggac gaaccgtttt tcattaccga agagatcgag gcggagatga 6960

tcgcggccgg gtacgtgttc gagccgcccg cgcacgtctc aaccgtgcgg ctgcatgaaa 7020

tcctggccgg tttgtctgat gccaagctgg cggcctggcc ggccagcttg gccgctgaag 7080

aaaccgagcg ccgccgtcta aaaaggtgat gtgtatttga gtaaaacagc ttgcgtcatg 7140

cggtcgctgc gtatatgatg cgatgagtaa ataaacaaat acgcaagggg aacgcatgaa 7200

ggttatcgct gtacttaacc agaaaggcgg gtcaggcaag acgaccatcg caacccatct 7260

agcccgcgcc ctgcaactcg ccggggccga tgttctgtta gtcgattccg atccccaggg 7320

cagtgcccgc gattgggcgg ccgtgcggga agatcaaccg ctaaccgttg tcggcatcga 7380

ccgcccgacg attgaccgcg acgtgaaggc catcggccgg cgcgacttcg tagtgatcga 7440

cggagcgccc caggcggcgg acttggctgt gtccgcgatc aaggcagccg acttcgtgct 7500

gattccggtg cagccaagcc cttacgacat atgggccacc gccgacctgg tggagctggt 7560

taagcagcgc attgaggtca cggatggaag gctacaagcg gcctttgtcg tgtcgcgggc 7620

gatcaaaggc acgcgcatcg gcggtgaggt tgccgaggcg ctggccgggt acgagctgcc 7680

cattcttgag tcccgtatca cgcagcgcgt gagctaccca ggcactgccg ccgccggcac 7740

aaccgttctt gaatcagaac ccgagggcga cgctgcccgc gaggtccagg cgctggccgc 7800

tgaaattaaa tcaaaactca tttgagttaa tgaggtaaag agaaaatgag caaaagcaca 7860

aacacgctaa gtgccggccg tccgagcgca cgcagcagca aggctgcaac gttggccagc 7920

ctggcagaca cgccagccat gaagcgggtc aactttcagt tgccggcgga ggatcacacc 7980

aagctgaaga tgtacgcggt acgccaaggc aagaccatta ccgagctgct atctgaatac 8040

atcgcgcagc taccagagta aatgagcaaa tgaataaatg agtagatgaa ttttagcggc 8100

taaaggaggc ggcatggaaa atcaagaaca accaggcacc gacgccgtgg aatgccccat 8160

gtgtggagga acgggcggtt ggccaggcgt aagcggctgg gttgtctgcc ggccctgcaa 8220

tggcactgga acccccaagc ccgaggaatc ggcgtgacgg tcgcaaacca tccggcccgg 8280

tacaaatcgg cgcggcgctg ggtgatgacc tggtggagaa gttgaaggcc gcgcaggccg 8340

cccagcggca acgcatcgag gcagaagcac gccccggtga atcgtggcaa gcggccgctg 8400

atcgaatccg caaagaatcc cggcaaccgc cggcagccgg tgcgccgtcg attaggaagc 8460

cgcccaaggg cgacgagcaa ccagattttt tcgttccgat gctctatgac gtgggcaccc 8520

gcgatagtcg cagcatcatg gacgtggccg ttttccgtct gtcgaagcgt gaccgacgag 8580

ctggcgaggt gatccgctac gagcttccag acgggcacgt agaggtttcc gcagggccgg 8640

ccggcatggc cagtgtgtgg gattacgacc tggtactgat ggcggtttcc catctaaccg 8700

aatccatgaa ccgataccgg gaagggaagg gagacaagcc cggccgcgtg ttccgtccac 8760

acgttgcgga cgtactcaag ttctgccggc gagccgatgg cggaaagcag aaagacgacc 8820

tggtagaaac ctgcattcgg ttaaacacca cgcacgttgc catgcagcgt acgaagaagg 8880

ccaagaacgg ccgcctggtg acggtatccg agggtgaagc cttgattagc cgctacaaga 8940

tcgtaaagag cgaaaccggg cggccggagt acatcgagat cgagctagct gattggatgt 9000

accgcgagat cacagaaggc aagaacccgg acgtgctgac ggttcacccc gattactttt 9060

tgatcgatcc cggcatcggc cgttttctct accgcctggc acgccgcgcc gcaggcaagg 9120

cagaagccag atggttgttc aagacgatct acgaacgcag tggcagcgcc ggagagttca 9180

agaagttctg tttcaccgtg cgcaagctga tcgggtcaaa tgacctgccg gagtacgatt 9240

tgaaggagga ggcggggcag gctggcccga tcctagtcat gcgctaccgc aacctgatcg 9300

agggcgaagc atccgccggt tcctaatgta cggagcagat gctagggcaa attgccctag 9360

caggggaaaa aggtcgaaaa gctgtctttc ctgtggatag cacgtacatt gggaacccaa 9420

agccgtacat tgggaaccgg aacccgtaca ttgggaaccc aaagccgtac attgggaacc 9480

ggtcacacat gtaagtgact gatataaaag agaaaaaagg cgatttttcc gcctaaaact 9540

ctttaaaact tattaaaact cttaaaaccc gcctggcctg tgcataactg tctggccagc 9600

gcacagccga agagctgcaa aaagcgccta cccttcggtc gctgcgctcc ctacgccccg 9660

ccgcttcgcg tcggcctatc gcggccgctg gccgctcaaa aatggctggc ctacggccag 9720

gcaatctacc agggcgcgga caagccgcgc cgtcgccact cgaccgccgg cgcccacatc 9780

aaggcaccct gcctcgcgcg tttcggtgat gacggtgaaa acctctgaca catgcagctc 9840

ccggagacgg tcacagcttg tctgtaagcg gatgccggga gcagacaagc ccgtcagggc 9900

gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga cccagtcacg tagcgatagc 9960

ggagtgtata ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata 10020

tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg 10080

cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc 10140

actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt 10200

gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc 10260

ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa 10320

acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc 10380

ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg 10440

cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc 10500

tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc 10560

gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca 10620

ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact 10680

acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg 10740

gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt 10800

ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct 10860

tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatgc 10920

attctaggta ctaaaacaat tcatccagta aaatataata ttttattttc tcccaatcag 10980

gcttgatccc cagtaagtca aaaaatagct cgacatactg ttcttccccg atatcctccc 11040

tgatcgaccg gacgcagaag gcaatgtcat accacttgtc cgccctgccg cttctcccaa 11100

gatcaataaa gccacttact ttgccatctt tcacaaagat gttgctgtct cccaggtcgc 11160

cgtgggaaaa gacaagttcc tcttcgggct tttccgtctt taaaaaatca tacagctcgc 11220

gcggatcttt aaatggagtg tcttcttccc agttttcgca atccacatcg gccagatcgt 11280

tattcagtaa gtaatccaat tcggctaagc ggctgtctaa gctattcgta tagggacaat 11340

ccgatatgtc gatggagtga aagagcctga tgcactccgc atacagctcg ataatctttt 11400

cagggctttg ttcatcttca tactcttccg agcaaaggac gccatcggcc tcactcatga 11460

gcagattgct ccagccatca tgccgttcaa agtgcaggac ctttggaaca ggcagctttc 11520

cttccagcca tagcatcatg tccttttccc gttccacatc ataggtggtc cctttatacc 11580

ggctgtccgt catttttaaa tataggtttt cattttctcc caccagctta tataccttag 11640

caggagacat tccttccgta tcttttacgc agcggtattt ttcgatcagt tttttcaatt 11700

ccggtgatat tctcatttta gccatttatt atttccttcc tcttttctac agtatttaaa 11760

gataccccaa gaagctaatt ataacaagac gaactccaat tcactgttcc ttgcattcta 11820

aaaccttaaa taccagaaaa cagctttttc aaagttgttt tcaaagttgg cgtataacat 11880

agtatcgacg gagccgattt tgaaaccgcg gtgatcacag gcagcaacgc tctgtcatcg 11940

ttacaatcaa catgctaccc tccgcgagat catccgtgtt tcaaacccgg cagcttagtt 12000

gccgttcttc cgaatagcat cggtaacatg agcaaagtct gccgccttac aacggctctc 12060

ccgctgacgc cgtcccggac tgatgggctg cctgtatcga gtggtgattt tgtgccgagc 12120

tgccggtcgg ggagctgttg gctggctggt ggcaggatat attgtggtgt aaacaaattg 12180

acgcttagac aacttaataa cacattgcgg acgtttttaa tgtactgaat taacgccgaa 12240

ttaattcggg ggatctggat tttagtactg gattttggtt ttaggaatta gaaattttat 12300

tgatagaagt attttacaaa tacaaataca tactaagggt ttcttatatg ctcaacacat 12360

gagcgaaacc ctataggaac cctaattccc ttatctggga actactcaca cattattatg 12420

gagaaactcg agcttgtcga tcgacagatc cggtcggcat ctactctatt tctttgccct 12480

cggacgagtg ctggggcgtc ggtttccact atcggcgagt acttctacac agccatcggt 12540

ccagacggcc gcgcttctgc gggcgatttg tgtacgcccg acagtcccgg ctccggatcg 12600

gacgattgcg tcgcatcgac cctgcgccca agctgcatca tcgaaattgc cgtcaaccaa 12660

gctctgatag agttggtcaa gaccaatgcg gagcatatac gcccggagtc gtggcgatcc 12720

tgcaagctcc ggatgcctcc gctcgaagta gcgcgtctgc tgctccatac aagccaacca 12780

cggcctccag aagaagatgt tggcgacctc gtattgggaa tccccgaaca tcgcctcgct 12840

ccagtcaatg accgctgtta tgcggccatt gtccgtcagg acattgttgg agccgaaatc 12900

cgcgtgcacg aggtgccgga cttcggggca gtcctcggcc caaagcatca gctcatcgag 12960

agcctgcgcg acggacgcac tgacggtgtc gtccatcaca gtttgccagt gatacacatg 13020

gggatcagca atcgcgcata tgaaatcacg ccatgtagtg tattgaccga ttccttgcgg 13080

tccgaatggg ccgaacccgc tcgtctggct aagatcggcc gcagcgatcg catccatagc 13140

ctccgcgacc ggttgtagaa cagcgggcag ttcggtttca ggcaggtctt gcaacgtgac 13200

accctgtgca cggcgggaga tgcaataggt caggctctcg ctaaactccc caatgtcaag 13260

cacttccgga atcgggagcg cggccgatgc aaagtgccga taaacataac gatctttgta 13320

gaaaccatcg gcgcagctat ttacccgcag gacatatcca cgccctccta catcgaagct 13380

gaaagcacga gattcttcgc cctccgagag ctgcatcagg tcggagacgc tgtcgaactt 13440

ttcgatcaga aacttctcga cagacgtcgc ggtgagttca ggctttttca tatctcattg 13500

ccccccggga tctgcgaaag ctcgagagag atagatttgt agagagagac tggtgatttc 13560

agcgtgtcct ctccaaatga aatgaacttc cttatataga ggaaggtctt gcgaaggata 13620

gtgggattgt gcgtcatccc ttacgtcagt ggagatatca catcaatcca cttgctttga 13680

agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt 13740

gggaccactg tcggcagagg catcttgaac gatagccttt cctttatcgc aatgatggca 13800

tttgtaggtg ccaccttcct tttctactgt ccttttgatg aagtgacaga tagctgggca 13860

atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa tagccctttg 13920

gtcttctgag actgtatctt tgatattctt ggagtagacg agagtgtcgt gctccaccat 13980

gttatcacat caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat 14040

gctcctcgtg ggtgggggtc catctttggg accactgtcg gcagaggcat cttgaacgat 14100

agcctttcct ttatcgcaat gatggcattt gtaggtgcca ccttcctttt ctactgtcct 14160

tttgatgaag tgacagatag ctgggcaatg gaatccgagg aggtttcccg atattaccct 14220

ttgttgaaaa gtctcaatag ccctttggtc ttctgagact gtatctttga tattcttgga 14280

gtagacgaga gtgtcgtgct ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg 14340

cctctccccg cgcgttggcc gat 14363