阅读说明：本技术 用于心脏再生的组合物和方法 (Compositions and methods for cardiac regeneration ) 是由 E·E·莫里西 J·A·伯迪克 L·王 于 2018-04-02 设计创作，主要内容包括：本公开提供了使用水凝胶递送系统的基于微小RNA的疗法,该疗法通过靶向心肌细胞为心肌梗塞提供了再生方法。该水凝胶提供了可用于促进心肌细胞增殖的微小RNA(例如miR-302模拟物)的局部和持续的心脏递送。还提供了适合于局部和持续释放的组合物以及用于心肌内凝胶递送miRNA寡核苷酸的方法。(The present disclosure provides microrna-based therapies using hydrogel delivery systems that provide a regenerative approach to myocardial infarction by targeting cardiomyocytes. The hydrogels provide local and sustained cardiac delivery of micrornas (e.g., miR-302 mimetics) that can be used to promote cardiomyocyte proliferation. Also provided are compositions suitable for local and sustained release and methods for intramyocardial gel delivery of miRNA oligonucleotides.)

1. A host-guest hydrogel for controlled local delivery of a miR-302 mimetic to contractile tissue in vivo, comprising:

(a) a host-guest hydrogel comprising:

(i) cyclodextrin-modified HA polymers (CD-HA) and

(ii) adamantane-modified HA Polymer (AD-HA); and

(b) a cholesterol-modified miR-302 mimetic;

wherein the dose of the cholesterol-modified miR-302 mimetic does not disrupt the host-guest hydrogel interaction.

2. A host-guest hydrogel according to claim 1, wherein the cholesterol-modified miR-302 mimetic comprises a cholesterol-modified miR-302b and a cholesterol-modified miR-302 c.

3. A host-guest hydrogel according to claim 1 or claim 2, wherein about 60% of the cholesterol-modified miR-302 mimetic is released within 10 days as determined by an in vitro assay.

4. A host-guest hydrogel according to any one of claims 1 to 3, wherein about 25% of the CD-HA is modified with cyclodextrin and/or about 25% of the AD-HA is modified with adamantane.

5. A host-guest hydrogel according to any one of claims 1 to 4, wherein the cholesterol-modified miR-302b is derived from the amino acid sequence of SEQ ID NO: 10, and the cholesterol-modified miR-302c is derived from SEQ ID NO: 11.

6. a host-guest hydrogel according to any one of claims 1 to 5, wherein at least 80% of the cholesterol-modified miR-302 mimetic is released from the gel within 21 days.

7. A host-guest hydrogel according to any one of claims 1 to 6, wherein the cholesterol-modified miR-302b and cholesterol-modified miR-302c are present in equimolar amounts.

8. A host-guest hydrogel according to any one of claims 1 to 7, wherein the gel erosion in the presence of the miR-302 mimetic is within about 10% of the gel erosion in the absence of the miR-302 mimetic after 14 days as measured by the uronic acid assay that measures total HA degradation.

9. A host-guest hydrogel according to any one of claims 1 to 8, wherein,

the CD-HA polymer is present from about 20% to about 25%; and is

The AD-HA polymer is present from about 20% to about 25%.

10. The host-guest hydrogel formulation of any one of claims 1 to 9, wherein the viscoelasticity of the gel is 400-800Pa at 1Hz at a strain of 0.1-50%.

11. A method of enhancing cardiac function in vivo, comprising a single administration to a subject of a host-guest hydrogel formulation according to any one of claims 1 to 10, wherein cardiac function is enhanced.

12. The method of claim 11, wherein the administration releases a dose of the miR-302 mimetic for 7 days that is effective to stimulate cardiomyocyte proliferation, as determined by increased expression of proliferation markers in an in vitro cardiomyocyte model.

13. The method of claim 12, wherein increased proliferation is obtained when the number of cardiomyocytes expressing Ki67+ is increased about 2-fold over 1 day compared to a control miRNA.

14. The method of claim 12, wherein increased proliferation is obtained when the number of cardiomyocytes expressing Ki67+ is increased about 2-fold over 4 days compared to a control miRNA.

15. The method of claim 12, wherein increased proliferation is obtained when the number of cardiomyocytes expressing Ki67+ is increased by about 2-fold or more at 7 days compared to a control miRNA, and wherein the increased proliferation is about 10% higher than the control miRNA, when measured at 14 days.

16. The method of claim 12, wherein the subject is a human.

17. The hydrogel of claim 1, wherein the contracting tissue is cardiac tissue.

18. The hydrogel of claim 17, wherein the cardiac tissue is terminally differentiated.

19. A host-guest hydrogel for controlled local delivery of a miR-302 mimetic to contractile tissue in vivo, comprising:

(a) a host-guest hydrogel comprising:

(i) cyclodextrin-modified HA polymers (CD-HA) and

(ii) an adamantane-modified HA polymer (AD-HA),

wherein the final concentration of the polymer is about 5 wt%; and

(b) from the peptide derived from SED ID NO: 10, a cholesterol-modified miR-302 mimetic consisting of the cholesterol-modified miR-302b sequence; and

(ii) from the peptide derived from SED ID NO: 11, and a cholesterol-modified miR-302c mimetic consisting of the cholesterol-modified miR-302c sequence;

wherein the cholesterol-modified miR-302b and the cholesterol-modified miR-302c are present in equimolar amounts, and

wherein the dose of the cholesterol-modified miR-302 mimetic does not disrupt the host-guest hydrogel interaction.

20. A host-guest hydrogel according to claim 19, wherein the cholesterol-modified miR-302b and the cholesterol-modified miR-302c are each present at about 200 μ Μ to about 250 μ Μ.

Technical Field

The present disclosure relates to methods and compositions for improving cardiac function, particularly after cardiac injury such as myocardial infarction. The composition includes a host-guest hydrogel adapted to release the microrna for a sustained period of time. The microRNA stimulates cardiac cell proliferation and restores cardiac function.

Cross Reference to Related Applications

This application claims priority from U.S. provisional application No.62/479,908 filed on 31/3/2017, the entire contents of which are incorporated herein by reference.

Description of an electronically submitted text file

The contents of a text file submitted electronically are incorporated herein by reference in its entirety: a computer-readable format copy of the sequence Listing (filename: PERA-001-01 WO _ SeqList-ST25. txt, recording date: 3/27/2018, file size 5 KB).

Background

Heart disease is the leading cause of death in the united states, resulting in the death of 600,000 people each year. In the united states, Myocardial Infarction (MI) or heart attack respectively results in 370,000 deaths each year. Management of acute myocardial infarction is improved by medical and surgical innovations, enabling up to 95% of patients to survive initial hospitalization. However, many of these patients develop chronic heart failure, resulting in a mortality rate of 50% five years after the myocardial infarction.

Although various treatments have been used to prevent heart attacks, they remain a public health problem. Preventive measures can reduce the incidence of heart attacks, but after the initial heart attack, the heart tissue is damaged, the main challenge being the limited ability of cardiomyocyte renewal in the adult heart. Accordingly, there remains a need in the art for therapies for treating victims of heart attacks and other patients with cardiac damage to restore cardiac function.

In recent years, micro rna (microrna) has attracted increasing therapeutic attention. Micrornas (mirnas) are small endogenous RNA molecules (about 21-25nt) that regulate gene expression by targeting one or more mrnas for translational inhibition or cleavage. They are small inhibitory RNAs that inhibit translation of a target gene with high complementarity. By cloning or computational prediction, thousands of mirnas have been identified in organisms such as viruses, worms and primates.

A group of miRNA, namely miR-302 and 367 clusters, has higher intracellular abundance and is a cell type specific to embryonic stem cells. The miRNA-302-367 cluster was originally identified from cDNA libraries generated by directed cloning using size-graded RNA (17-26nt) of undifferentiated hESC (human embryonic stem cells). This cluster is encoded on human chromosome 4 and contains nine different mirnas that are co-transcribed in a polycistronic manner: miR-302a, miR-302b, miR-302c, miR-302d, miR-367 and miR-367. The miR-302 family contains 7 mirnas with highly conserved 5' regions. The miR-302-367 cluster was first identified as being expressed in mESC (murine ESC), hESC and its malignant counterpart hECC.

Disclosure of Invention

This application discloses host-guest hydrogel formulations for controlled release of miR-30 mimetics. The hydrogel comprises cyclodextrin-modified Hyaluronic Acid (HA) (CD-HA) and adamantane-modified HA (AD-HA) and a cholesterol-modified miR-302 mimetic. The hydrogel is suitable for contracting tissues, wherein the release property of miR-302 can last for about 7 days to effectively stimulate the proliferation of myocardial cells. Surprisingly, despite the interaction between cholesterol and cyclodextrin altering the release profile of miR-302 mimetics, inclusion of the cholesterol-modified miR-302 mimetics did not significantly disrupt the host-guest hydrogels.

Drawings

FIG. 1, gel assembly and miR-302 interaction. FIG. 1A, HA modified with AD or CD, self-assembles into shear thinning and self-healing gels. Cholesterol on miR-302-chol (chol) interacts with CD to provide sustained release from the gel. FIG. 1B, rhodamine/CD-HA interaction leads to quenching of rhodamine fluorescence, but fluorescence can be restored by titrating cholesterol-modified miR-302 into the system and replacing the rhodamine complex, indicating that there is complexation between cholesterol and CD (complexation). Figure 1C, release of cholesterol-modified miR-302b and miR-302C (210 μ M each) from the gel (5 wt%) quantified by a commercially available RNA quantification kit RiboGreen over three weeks (mean ± SD, n ═ 3).

FIG. 2, cardiomyocyte proliferation in vitro. FIG. 2A, miR-302 supernatant collection and cardiomyocyte uptake schematic. gel/miR-302 (100. mu.L) assemblies were formed in microcentrifuge tubes with cholesterol-modified miR-302 (210. mu.M miR302b and miR302c) or miR-NC. OPTI-MEM (500 μ L) was added over the gel, the supernatant collected, frozen, and replaced at D1, D4, D7, D10, and D15. Supernatants collected from each time point were added to primary neonatal cardiomyocytes cultured for 24 hours. At 48 hours, Ki67, cardiac troponin T and DAPI staining were performed on the cardiac cells to detect proliferation. Fig. 2B, quantification of Ki 67-positive, troponin T-positive proliferation of neonatal cardiomyocytes from gel supernatants of in vitro cultures of D0-D1, D1-D4, D4-D7, D7-D10 and D10-D15, demonstrates that the proliferation effect of early gel/miR-302 release lasts for 7 days (mean ± SD, n ═ 3 for each condition, p < 0.05). Figure 2C, representative images of Ki67 positive, troponin T positive neonatal cardiomyocytes (yellow arrows) show increased Ki67 for up to 7 days against gel/miR-302. Scale bar: 50 μm.

Figure 3A, preformed gel injected into water from 27Gxl/2 syringe (5 wt%, blue dye), showing rapid reassembly after injection and minimal cargo dispersion figure 3B, schematically intracardiac gel injected into non-infarcted mouse hearts, two injections were performed outside of proximal LAD below the left atrial appendage after open chest surgery on day 5, the hearts were sliced and stained for troponin T and Ki67, pH3 or Aurora B figure 3C, at low magnification, Ki67, pH3 and Aurora B positive cardiomyocytes (yellow arrows) around the injection site showed an increase in proliferation of all three markers in the gel/miR-302 treated group, the ratio of 50 μm.d, e, f) gel/miR-302 around the injection site, pH3 and Aurora B positive cardiomyocyte (yellow arrows) was found to be a mean increase in the gel/miR-67, pH3 and Aurora B positive, the ratio of the gel/miR-302 was found to be a mean increase in the two sets of mice, No. 0.05 + 0.05, No. 5 g. 0.05.

FIG. 4, gel/miR-302 induces clonal expansion in vivo. Fig. 4A, a schematic of lineage tracking strategy and experimental design. To follow clonal proliferation, mice were incubated with Myh6^MerCreMerAnd R26R^ConfettiAnd (4) hybridizing. Expression of Myh6 resulted in creloxP recombination and subsequent random activation of one of four fluorescent reporter proteins (nGFP, YFP, RFP and mCFP), each color representing a different clone than Myh6 positive cardiomyocytes. In our experimental design, mice were injected intraperitoneally with tamoxifen to induce random expression of nGFP, RFP, YFP and mCFP. After 14 days, LAD was ligated to induce ischemic injury, and gel was injected in the border zone downstream of infarction. On day 28, hearts were collected for analysis of clonal expansion. FIG. 4B, mechanism of gel/miR-302 induced clonal amplification: 1) adult cardiomyocytes do not proliferate and cannot divide after ischemic injury; 2) tamoxifen was used to randomly label a small fraction of cardiomyocytes with one of four fluorescent reporter proteins; 3) myocardial infarction, injecting gel/miR-302 into myocardial cells in the border area; 4) miR-302 stimulates differentiation, proliferation and amplification of fluorescently-labeled cardiomyocytes, thereby enabling the delivery of fluorescent protein genes onto daughter cells. Fig. 4C, fluorescence scan of total heart specimens taken immediately on day 28 post-implantation. Fluorescence was shown in the green and red channels to indicate labeling of cardiomyocytes in the gel/miR-NC and gel/miR-302 treated groups. Fluorescence enhancement was present in both channels of the gel/miR-302 treated group, indicating clonal amplification.

FIG. 5, clonal expansion of Confetti-labeled cardiomyocytes. Fig. 5A, representative sections of confocal imaging with labeled gfp-, RFP-or YFP-expressing cardiomyocytes. The gel/miR-NC sections consisted primarily of spatially separated individual cardiomyocytes. In the gel/miR-302 treated group, multiple clones were observed in all three fluorescence channels, which were in close proximity and consisted of several daughter cells from one parent cell. WGA isolates individual cardiomyocytes and allows the identification of clones, in particular to distinguish multiple cardiomyocytes from multinucleated cardiomyocytes. Scale bar 50 μm. Fig. 5B, quantification of cloned cells in the nffp, RFP and YFP channels. Clones were identified as cells within 50 μm of each other. Clones consisting of one cell are technically not clones, but randomly labelled single cells, but are still considered part of the analysis to demonstrate their ubiquitous presence in the gel miR-NC group.

FIG. 6, functional prognosis after myocardial infarction.

FIG. 6A, end diastolic volume (FIG. 6A) and end systolic volume (FIG. 6B) at 4 weeks after myocardial infarction in mice treated with PBS, gel/miR-NC or gel/miR-302 by type B echocardiography. Compared with a control group, the volume increase of the gel miR-302 treatment group is obviously reduced. Ejection fraction 4 weeks after myocardial infarction (fig. 6C) and shortening fraction (fig. 6D) were found by echocardiography. The ejection fraction or shortening fraction of gel/miR-302 treated mice was not significantly different from that of non-infarcted mice. All groups were compared by one-way anova (mean ± SD, no MI, n 10; PBS, n 13; gel/miR-NC, n 10, gel/miR-302, n 12, p < 0.05, p < 0.01, p < 0.001). Fig. 6E, representative Mason trichrome sections show improved heart volume at 28 days. Sections were aligned from ligation (ligation) to apex (apex) to visualize changes in tissue remodeling. Scale bar 2 mm. FIG. 6F, M-echocardiography of anterior and posterior left ventricular walls shows reduced anterior wall motion in gel/miR-NC treated mice, while gel/miR-302 treated mice improved.

FIG. 7, cholesterol modification of miR-302 mimetics. Proliferation of neonatal mouse cardiomyocytes was measured using unmodified (miR-302) and cholesterol-modified (miR-302-chol) miR-302B/c mimetics (200. mu.M), and quantitation of cardiac troponin T and Ki67 using FIG. 7A) co-staining and FIG. 7B) was used to indicate cardiomyocyte proliferation. Treating the myocardial cells with miR-302 for 24 hours; staining was performed after 48 hours. Scale bar 50 μm (mean + SD, n 3, p < 0.01).

FIG. 8, interaction of miR-302-chol with CD-HA. FIG. 8A, rhodamine fluorescence is quenched by CD-HA due to the interaction of rhodamine with CD. More and more CD-HA saturation was quenched at 50 ng/. mu.L. FIG. 8B, at saturating doses of CD-HA (50 ng/. mu.L), cholesterol-modified miR-302 interacts with CD-HA/Rho B to displace and eliminate rhodamine, restoring fluorescence in a dose-dependent manner. FIG. 8C, unmodified miR-302 did not result in fluorescence recovery of the CD-HA/Rho B complex. FIG. 8D, the Benesi-Hildebrand equation, can be used to determine the binding constant between cholesterol-modified mimetics and CD-HA, which approximates the binding affinity of the host and guest. At each dose of miR-302-chol, the fluorescence change (Δ Em) was calculated₅₈₀) And plotted on the Y-axis as 1/(Δ Em)₅₈₀) Plotted on the X-axis as 1/[ miR-302-chol]. FIG. 8E, Y-axis intercept of best-fit line allows calculation of Δ Em₅₈₀Maximum value (DeltaEm)₅₈₀max) for the maximum value according to the slope [1/(Ka × Δ Em)₅₈₀max)]Calculating K_aThe value is obtained.

FIG. 9 Synthesis of AD-HA and CD-HA¹H NMR spectrum. FIG. 9A, the passage of 1-adamantane acetic acid with the primary alcohol of HA through di-tert-butyl dicarbonate (Boc)₂O) esterification reaction to synthesize AD-HA. Fig. 9B, based on the integration of the ethyl multiplet of adamantane (δ ═ 1.42-1.70, 12H) with respect to the HA backbone (δ ═ 3.10-4.10, 10H), determines adamantane functionalization to about 20%. CD-HA was synthesized from aminated cyclodextrin (mono- (6-hexanediamine-6-deoxy) -P-cyclodextrin) and the carboxylic acid of HA by amidation of (benzotriazol-1-yloxy) tris (dimethylamino) phosphonium hexafluorophosphate. Figure 9C, functionalization of cyclodextrin determined by integration of methyl unimodal hexane linker (δ ═ 1.22-1.77, 12H) versus HA (δ ═ 2.1, 3H) to be about 20%

FIG. 10, release of cholesterol-modified and unmodified miR-302. The gel (100 μ L, 5 wt%) was assembled with cholesterol-modified or unmodified miR-302(210 μ M miR-302b and 210 μ M miR-302 c). PBS was added to the microcentrifuge tube above the gel and collected continuously over three weeks to quantify total miR-302 release. At 21 days, the gel was dissolved to determine the remaining miR-302, and all values were normalized to cumulative miR-302. After cholesterol modification, miR-302 is released slowly (mean ± SD, n ═ 3) due to the complex between cholesterol and CD.

FIG. 11, rheology of hydrogel with miR-302-chol. FIG. 11A, time sweep of storage (G ') and loss (G') moduli at 1Hz, gel (5 wt%) strain of 0.5% alone or with encapsulated miR-302 (210. mu.M miR-302b and 210. mu.M miR-302 c). miR-302 inclusion has minimal effect on modulus. Fig. 11B, alternating low strain (0.5%) and high strain (250%, shaded gray) at 20Hz, shows shear thinning and rapid recovery of the hydrogel using miR-302. G' drops below G "in response to high strain, indicating flow and more liquid behavior at high strain. After the strain ceases, both G' and G "quickly return to the original mechanics.

FIG. 12, hydrogel erosion. Gels (100. mu.L) with and without miR-302 (210. mu.M miR-302b and 210. mu.M miR-302c) were formed at 5% by weight in microcentrifuge tubes. PBS was added to the gel, collected over three weeks, and hyaluronic acid content was quantified by uric acid colorimetric assay, indicating minimal differences in erosion when miR-302 was included (mean ± SD, n ═ 3). Fig. 12A shows a time course. Fig. 12B provides a comparison.

FIG. 13, gel and PBS injection comparing miR-NC and miR-302. In non-infarcted heart tissue on the left lower side of the left atrial appendage and outside the LAD, mice were randomly injected with miR-302 or miR-NC 2X 5. mu.L in gel or PBS. On day 5, the heart was dissected and stained for Ki67 staining. Ki67 was quantified in HPF around two injection sites for at least three mice per group (mean ± SD, n-3 animals per group, p < 0.05 compared to all groups).

Fig. 14, Yap expression. In the case of unligated LAD, two injections were made outside the proximal LAD. FIG. 14A, sections co-stained with Yap five days after treatment with gel/miR-NC or gel/miR-302. Fig. 14B, Ki67 was quantified in HPF around two injection sites for at least three mice per group. Sections showed total Yap elevation for the gel/miR-302 treatment group; in cells with Yap (yellow arrows), it localized to the nucleus, suggesting its interaction with nuclear transcription factors to promote proliferation (mean ± SD, n ═ 3 animals per group,. x.p < 0.01).

FIG. 15, expression of miR-302 in heart and lung following injection of gel/miR-302. In the non-infarcted mouse heart, two injections were performed outside the proximal LAD. At D1, D5 and D28, the organs were enzymatically digested to harvest total RNA. qPCR was used to quantify total miR-302 relative to untreated mice to demonstrate sustained miR-302 in the heart after gel injection. The inset is the same plot drawn on a logarithmic scale, indicating that miR-302 is expressed continuously for up to 28 days, with minimal expression in the lung.

FIG. 16, clonal proximity of gel/miR-NC injected hearts compared to gel/miR-302. FIG. 16A, fluorescent-labeled cells identified in the border region of the infarct, and clones adjacent to each other in the gel/miR-302 treated sections. Adjacent nGFP, RFP and YFP cells were expanded to display clones. Scale bar: 50 μm. FIG. 16B, quantification of clones, shows that clones of all three fluorescent reporter proteins were increased in the gel/miR-302 treated group. Clones were defined as at least two adjacent cells within 50 μm of each other. FIG. 16C, nGFP cells were found in sections of gel/miR-302 that are 50 μ M apart from each other, whereas nGFP cells were more than 100 μ M apart in sections of gel/miR-NC. Measurements were taken from 3D confocal images by IMARIS. Fig. 16D, quantification of distance between nGFP cells from IMARIS measurements (mean ± SD, n-3 animals per group, p < 0.05).

Detailed Description

We have developed subject-Guest (GH) hydrogels that are able to withstand the rigors of myocardial contraction, but still provide effective doses of cholesterol-modified micrornas ("mirnas") to trigger cardiomyocyte proliferation in a manner that restores cardiac function in the absence of arrhythmia.

We previously demonstrated that members of the polycistronic miR-302-367 cluster are important for cardiomyocyte proliferation during embryonic development by targeting members of the Hippo signaling pathway, including Moblb, Lats2 and Mstl.9. The result of Hippo silencing in cardiomyocytes ultimately leads to dephosphorylation and nuclear localization of Yap, thus promoting the transcriptional pathway and thus the dedifferentiation, embryonic-like highly proliferative state.

Unfortunately, constitutive expression of miRNA of the miR-302-367 cluster may cause cardiomyopathy after myocardial infarction due to hyperproliferation and sustained dedifferentiation.

Advantageously, we have now developed a method of using a host-guest hydrogel that tolerates the contractile properties of cardiac tissue and releases mirnas in a dosing regimen suitable for restoring cardiac function following myocardial infarction. The hydrogel and dosing regimen reduces or eliminates previously acquired cardiomyopathy.

As used herein, "about" refers to plus or minus 10% of the indicated value.

The present disclosure provides engineered hydrogels designed for injection and sustained delivery of miR-302 that can promote cardiomyocyte proliferation and functional regeneration. We believe this is the first report that hydrogels were used as carriers of miRNA mimics for regeneration of damaged cardiac tissue. Our developed hydrogel system overcomes the limitations of systemic delivery and replaces the 7-day-continuous injection by sustained release from a single gel injection to the myocardium. Host-guest assembly mechanisms allow injection and self-repair to improve retention, modification of cholesterol has no expected negative impact on structure or corrosion. In addition, the gel may be delivered by minimally invasive delivery methods (e.g., catheters).

To further control release, the host-guest assembly mechanism also uses cyclodextrins, which can be used to sequester cholesterol-modified mirnas in hydrogels. Interestingly, the binding of cholesterol to cyclodextrin had minimal impact on gel erosion and mechanism, while maintaining release of miRNA mimics in three weeks in vitro, slower than when these interactions were not included. Since the release of the mimetic is faster than the eroded gel, we believe that diffusion plays a major role in the release, most likely due to dynamic interactions within the gel and anion repulsion between the negatively charged HA and RNA. Mimetic release can also be sustained, resulting in entrapment inside the network, as the modification of cholesterol increases the size of the mimetic and the ability of cholesterol to aggregate with itself due to hydrophobicity.

In vitro, the gel/miR-302 complex caused proliferation in neonatal mouse cardiomyocytes, with the time to harvest of the release being up to 7 days. The reduced proliferation of the collected outgrowths after this time (D10, D15) was probably due to RNA degradation caused by the prolonged experimental time. Notably, our gel/miR-302 complex resulted in robust proliferation of the adult heart (terminally differentiated organ) on day 5 in vivo. Expression of Aurora B kinase is of particular interest because it indicates that cardiomyocytes not only enter the cell cycle, but are actually undergoing cytokinesis. Clonal expansion of newly-generated cardiomyocytes was observed around the area of cardiac infarction treated with the gel/miR-302 complex. The use of multi-color lineage reporter genes enables us to verify the generation of new cardiomyocytes, compared to the simple observation of an increase in proliferation markers (e.g. Ki67 and pH 3). Our findings are consistent with recent data showing that the small number of newly generated cardiomyocytes observed during the life cycle or after injury in mammals is due to proliferation of existing cardiomyocytes, rather than being derived from progenitor cells³⁷. While the new cells themselves may enhance contractility after myocardial infarction, the cardiomyocytes may also signal fibroblasts through paracrine factors, thereby playing a role in limiting remodeling (remodelling). This explains the improvement in overall cardiac capacity and cardiac function observed after delivery of the gel/miR-302 complex.

The proliferative potential of the gel/miR-302 complex leading to neonatal cardiomyocytes can be attributed to the increased residence of the miR-302 mimetic after intramyocardial injection, particularly when the gel is not included, with minimal proliferation. These results are consistent with our previous data, suggesting that systemic application of miR-302 can promote cardiomyocyte proliferation within the first week. Complexing mirnas with gels can also protect double-stranded miRNA mimics from degradation by ubiquitous RNAse H mediated mechanisms, allowing for continuous and sustained release of the activity mimics. This work is also based on previous reports of simulated injection of mirnas in the myocardium, where mirnas were injected either naked or in lipid complexes with transfection reagents. Since gels allow for single use and are well tolerated in human trials, we believe that the use of gel/miRNA complexes provides significant advantages for these other approaches.

We provide a bioengineered miRNA delivery method to promote cardiomyocyte proliferation and cardiac regeneration after MI. We believe this was the first report of in vivo delivery of miRNA mimics to cardiac tissue using gel complexes. This delivery mechanism has significant advantages over current methods, including: (i) overcomes the short shelf life of the injected mimetic, (ii) uses as a single application, (iii) optimizes the release of miRNA mimetic over time to promote cardiomyocyte proliferation and cardiac regeneration, (iv) accommodates the potential for transdermal delivery via catheter. Currently, there is no approved therapeutic approach to regenerate myocardium. In this regard, our system may have unique advantages over other existing ischemic injury therapies.

Host-guest hydrogels

Disclosed herein are hydrogels that locally retain and release cholesterol-modified miR302 mimics in the heart that can improve efficiency and prevent proliferative signals from interfering with cellular homeostasis of other organs. These hydrogels can sustain release of miR302 within a week to provide transient delivery that improves function following ischemic injury and prevent cardiomyopathy from hyperproliferation and dedifferentiation.

The hydrogel delivery method combines appropriate dosing regimens and locally limited miRNA release using hydrogels to enhance miR-302 mimetic retention after intramuscular injection of the myocardium. Due to its highly constrictive nature, residence upon injection is a major challenge for various therapies delivered to the heart. The hydrogels disclosed herein increase the bioavailability of miR-302 mimetics in place while providing a dose that does not induce cardiomyopathy. In addition to localizing miR-302, the hydrogel can also function to prevent degradation, increasing its ability to interact with cells in a continuous and durable manner, thereby promoting favorable proliferation of adult cardiomyocytes.

Ha.cd and Ad are modified by host-guest chemical interactions with β -cyclodextrin (CD, host) or adamantane (Ad, guest) for the preparation of gels, where non-covalent hydrophobic interactions arrange in a defined structure with high affinity (Ka about 1 × 10)⁵M^-1) Driving the molecular recombination of the two. In a preferred aspect, the CD-HA modification is about 20% and the AD-HA modification is about 20%.

In a particular aspect, the gel is about 5% w/w. For example, the gels disclosed herein may contain 3.2mg CD-HA and 2.1mg AD-HA for 100. mu.l of gel to achieve about 5% w/w. In other aspects, the range can be about 4% or about 6%. The ratio of CD-HA to AD-HA polymer may range from about 2: 3 to about 3: 2.

In certain aspects, CD-HA and AD-HA polymers are sterilized in our cell culture hood under UV radiation for 1 hour. In an exemplary method, to prepare 100 μ L of gel, the dried polymers were resuspended in 20 μ L of miR-302b and 20 μ L of miR-302c (dissolved in deionized water), respectively, each at 525 μ M. 10 μ L of PBS was added to the CD-HA and AD-HA such that the final volume of CD-HA and AD-HA was 50 μ L. (20. mu.L miR-302b, 20. mu.L miR-302c, 10. mu.L PBS). The gel was then mixed by injecting the two components between two insulin syringes multiple times and then centrifuged at maximum speed to remove air bubbles. The volume of the gel obtained can be scaled up.

Additional general information can be found regarding the array of possible hydrogel variants. See, e.g., Rodell, C.B., et al, Shear-Thinning supra Hydrogels with discontinuous Autonomous evaluation crosslinking to modified visual Properties In Vivo, "adv.Funct.Mater.25, 636-644 (2014); rodell et al, Rational Design of Network Properties in Guest-Hostassembled and Shear-leading Hyaluronic acids, "Biomacromolecules 14, 4125-4134 (2013); rodell et al, "objectable Shear-Thinning Hydrogels for minor invasion to affected myocardial to Limit Left ventric greater modification" Circuit. Seif-Naraghi, S.B., et al, "Safety and specificity of an injectable extracellular matrix hydrogel for treating muscular information" Sci.Transl.Med.5, 173ra25 (2013); ouyang et al, 3D Printing of shear-Thinning hydrogel with Secondary Cross-Linking, "ACS biomatter. Sci. Eng. acsBiomatrials.6b00158 (2016). doi: 10.1021/acsbioformatials.6b00158; "suspended small molecular delivery of hydrolyzable hydrophilic acids hydrogel-gum mediated playback" J.Mater.chem.B 3, 8010-; gaffey et al, "implantable shear-damping polyols used to deliver end-to-end promoter cells, enhance cell attenuation, and impulse electrochemical myocenter" J.Thorac.Cardiovasc.Surg.150, 1268-77 (2015).

In short, when CD-modified HA polymers are mixed with Ad-modified HA polymers, they form hydrogels due to the reversal of guest-host bonds, exhibiting shear-thinning behavior during injection. Deployment of GH hydrogels in cardiac tissue presents challenges because the repetitive nature of the contraction causes structural deformation of the gel repeat, affecting the release of mirnas, which in turn increases the risk of cardiomyopathy due to excessive signaling to cardiomyocytes proliferation.

We also predict that cholesterol on the miR-302 mimetic will interact with cyclodextrin, causing the gel to erode at different rates, and that this interaction will alter the release of the miRNA mimetic, negatively affecting the therapeutic effect. However, we have found that gel erosion is similar whether or not cholesterol modification is performed, as long as the cyclodextrin content is sufficiently high.

Micro RNA

In one embodiment, a miR cluster is a genetic region or locus comprising a plurality of micrornas. Exemplary micrornas are disclosed in U.S. published application No. 2013/0035374, the entirety of which is incorporated herein as well as the sequences involved. In one embodiment, a miR cluster is a group of contiguous genes that are co-transcribed in a polycistronic manner in one embodiment. In one embodiment, the miR genes in a cluster are transcribed under the control of a single promoter. In another embodiment, the miR cluster is a group of adjacent and related genes. In one embodiment, the miR 302-367 cluster is a single sequence with multiple miRs, all of which correspond to the 302-367 locus.

In another embodiment, the nucleic acid sequence is a homologue of the above-described sequence. In one embodiment, the homolog is as described in PCT patent publication No. WO/2009/091659, or by the field known as another homolog by its entirety incorporated by reference.

In one embodiment, the microRNA (miR)302-367 cluster comprises nine different miRNAs that are co-transcribed in a polycistronic manner: miR-302a, miR-302b, miR-302c, miR-302d, miR-367 and miR-367. In one embodiment, the nucleic acid sequence of miR-302b is: UAAGUGCUCUCCAUGUUUUAGUAGAG (SEQ ID NO: 1; miRBase accession No.: MI 0000772; ENTREZGENE: 442894; miRBase accession No.: MIMAT 0000715). In one embodiment, the nucleic acid sequence of miR-302b is: ACUUUAACAUGGAAGUGCUUUCU (SEQ ID NO: 2; miRBase accession number: MIMAT0000714), optionally, the terminal U can be removed. In one embodiment, the nucleic acid sequence of miR-302c is: UAAGUGCUUCCAUGUUUCAGUGG (SEQID NO: 3; miRBase accession number MI 0000773; ENTREZGENE: 442895; accession number MIMAT 0000717); optionally, the 5' U may be removed. In one embodiment, the nucleic acid sequence of miR-302c is: UUUAACACGGGGGUACCUGCUG (SEQ ID NO: 4; miRBase accession number: MIMAT 0000716). In one embodiment, the nucleic acid sequence of miR-302a is: UAAGUGGUUCCAUGUUUUGGUGA (SEQ ID NO: 5; miRBase accession number: MI 0000738; ENTREZGENE: 407028). In one embodiment, the nucleic acid sequence of miR-302a is: UAAACGUGGAUGUACUUGCUUU (SEQ ID NO: 6; miRBase accession number: MIMAT 0000683). In one embodiment, the nucleic acid sequence of miR-302d is: UAAGUGCUUCCAUGUUUGAGUGU (SEQ ID NO: 7; miRBase accession number MI 0000774; ENTREZGENE: 442896; accession number MIMAT 0000718). In one embodiment, the nucleic acid sequence of miR-367 is as follows AAUUGCACUUUAGCAAUGGUGA (SEQ ID NO: 8; miRBase accession number: MIMAT 0004686; ENTREZGENE: 442912). In one embodiment, the nucleic acid sequence of miR-367 is as follows: ACUGUUGCUAAUAUGCAACUCU (SEQ ID NO: 9; miRBase accession number MI 0000772).

Thus, in particular aspects, the lead and passenger molecules (guide and passenger molecules) may be derived from the following sequences:

unless otherwise indicated, the hydrogels prepared contain equimolar amounts of miR-302b and miR-302c, collectively referred to below as miR-302 or miR-302 mimetics. The mimetic contains cholesterol at the 5' end of the passenger strand. miR-302b and miR-302c are each typically present in the gel at about 200. mu.M to 250. mu.M, e.g., about 220. mu.M or about 210. mu.M, to achieve a released dose.

Cholesterol-modified double-stranded RNA is passively taken up by cells in vitro and in vivo. However, we predict that cholesterol will bind to cyclodextrins, disrupting the interaction of CD-HA and AD-HA, affecting the integrity of GH hydrogels, and in turn, the release profile of miR-302 mimetics. To ensure that cholesterol modification improved miR-302 simulated uptake, miR-302b and miR-302c, with or without cholesterol modification, were added to cultured mouse neonatal cardiomyocytes, and the cells were stained with the proliferation marker Ki 67. Proliferation of cardiomyocytes treated with cholesterol-modified miR-302b and miR-302c mimetics (miR-302-chol) (Ki 67)⁺) Significantly higher than cardiomyocytes treated with unmodified mimetics (figure 7).

This suggests that cholesterol-modified mimetics may bind to CD-HA due to the interaction of lipophilicity with CD as the host (fig. 1A). To examine the effect of interactions on gels, we developed a fluorescence binding assay based on a similar assay to measure the interaction between cholesterol-modified miR-302 and CD-HA. Rhodamine b (Rho) fluorescence is quenched by CD-HA due to host-guest interactions between CD and Rho. However, cholesterol has a higher affinity for CD, should displace Rho and restore fluorescence. We observed that cholesterol-modified miR-302 binds to CD-HA in a dose-dependent manner, as the addition of cholesterol-modified miR-302 increasesFluorescence of the solution (FIG. 1B). In contrast, unmodified miR-302 did not change solution fluorescence (fig. 8). assuming negligible binding to Rho, the binding constant for miR-302-chol/CD-HA complex formation was approximately Ka ═ 2.0x 10 by fitting the Benesi-Hildebrand equation³M^-1. Consistent with the literature for cholesterol/CD complexes (figure 8).

To assess the effect of cholesterol, cholesterol-modified miR-302 mimics were assembled into gels with CD-HA and AD-HA (approximately 20% modification of HA with CD or AD, fig. 9). The release of cholesterol-modified miR-302 lasted for more than three weeks (fig. 1C), which was slower than the release of the mimic without cholesterol (fig. 10), confirming that the cholesterol/CD interaction is complex and that cholesterol altered the release profile of the miR-302 mimic. Thus, the cholesterol-modified miRNA-302 gels disclosed herein provide delayed release. In some aspects, the cumulative release over about 5 days is about 50% compared to greater than 60% of the non-cholesterol modified miRNA control. See fig. 10.

We also investigated various physical properties of the gels of cholesterol-modified mimetics. To confirm that cholesterol-modified miR-302 does not affect the mechanical and corrosive behavior of the gel, we performed oscillatory rheological and gel corrosion tests with and without encapsulated miR-302. The storage (G') and loss (G ") moduli of the gels with and without encapsulated cholesterol-modified miR-302 were equivalent (fig. 11A). Shear yield and recovery from alternating high and low strains were also observed, indicating that these gels have the ability to thin under shear strain and quickly reassemble after strain cessation, allowing injection and rapid recovery of the gel and miR-302 system (fig. 11B). Measurement of HA release using the uronic acid assay, gel erosion was not affected by inclusion of cholesterol-modified miR-302 in the system (fig. 12). Thus, we provide gels comprising cholesterol-modified miR-302 mimetics that provide enhanced cellular uptake and improved affinity for the gel without compromising gel mechanics, shear thinning or erosion.

The hydrogels disclosed herein induce clonal proliferation. To verify the proliferation observed in gel/miR-302 treated animalsOther new cardiomyocytes were generated following ischemic injury and we performed clonal lineage tracing analysis using a multicolor R26R-Confetti Cre-reporter system that can trace cell lineages by expressing fluorescent proteins (FIG. 4; FIG. 16). Cloned cardiomyocytes expressing nGFP, RFP and YFP were clearly identified in miR 302-injected hearts, whereas few clones were observed with control miRNA injections. In labeled cardiomyocytes, multiple clusters expressing nGFP were detected in the heart injected with gel/miR-302 and located in the border region of the infarct. In the gel/miR-302 treated group, nGFP⁺The average distance between cells was significantly lower, indicating that these cells originated from a common single cell. Further analysis with Wheat Germ Agglutinin (WGA) staining to identify cell membranes showed that fluorescent cells within 50 μm were mostly adjacent in the gel/miR-302 treated group, but not in the gel/miR-NC group (FIG. 5 a). In the gel/miR-NC group, distant cells (> 50 μm) are often interspersed with unlabeled cardiomyocytes. Using 50 μm as a standard, we quantified the cell number of each individual clone of nffp, RFP and YFP in all regions of the heart in the infarct border region. The number of cells per clone of hearts injected with gel/miR 302 increased significantly (up to 8), indicating that these cells were derived from a common parent cell that had already divided (fig. 5B). Thus, the hydrogels disclosed herein induce clonal cardiomyocyte proliferation.

Native mirs can be linked to nucleotides by phosphodiester linkages, and mirs disclosed herein can be linked to nucleotides by phosphodiester linkages. However, in other aspects, one or more phosphodiester linkages may be substituted with a different type of chemical linkage. For example, one or more of the linkages may be a phosphorothioate linkage. In another embodiment, one or more nucleotides may have a p-ethoxy bond. The reduction of phosphodiester bonds and the increase of phosphorothioate bonds will enhance nuclease resistance, thereby promoting biological effects. However, not all bonds are altered due to the structural requirements of micrornas. In certain aspects, the passenger strand comprises more modifications than the guide strand. In certain other aspects, the microrna is a Locked Nucleic Acid (LNA). Additional description of modifications described in Baumann, V and J Winkler "miRNA-Based therapeutics: strategies and delivery Platforms for Oligonucleotide and Non-Oligonucleotide reagents, ", Future media chemistry 6.17 (2014): 1967-1984.pmc.web.24mar.2018, which is incorporated for all purposes and in particular with appropriate modifications.

In particular aspects, the release profile for release of micrornas from the hydrogel delivers a transient dose for a specific time after application to the cardiomyocytes. In particular aspects, the hydrogel delivers at least 80% of the dose within 21 days, at least 85% of the dose within 21 days, at least 90% of the dose within 21 days, or at least 95% of the dose within 21 days. In certain particular aspects, the instantaneous release can be in a time less than 21 days; for example, at least 85% of the dose may be released before 7 days, 10 days, or 14 days. Thus, in particular aspects, the hydrogel transiently delivers an effective dose for up to 21 days.

Enhancement of proliferation in adult heart tissue ameliorates the effects of MI

In a particular aspect, the hydrogels used herein are applied to adult cardiac cardiomyocytes. The adult heart is a terminally differentiated organ and therefore the ability to stimulate cardiomyocyte proliferation is particularly desirable. The hydrogels disclosed herein provide robust and sustained proliferation within five days in the adult heart.

In certain embodiments, enhanced cardiomyocyte proliferation can be determined by measuring an increase in expression of a cardiac proliferation marker. Exemplary markers include Ki67, PH3, Aurora B kinase (AURKB), which is a marker of cytokinesis. The gels disclosed herein provide improved cardiomyocyte proliferation of up to about 6%, about 2% and about 1% of cells in the region surrounding the injection site (within 200 microns) where Ki67, PH3 and AURKB stained positive. In contrast, injection without the miR-302 mimetic resulted in very low (< 1%) levels of Ki67, PH3, and AURKB, confirming the very rare and limited reports previously on adult cardiomyocyte self-renewal capacity.

The hydrogels disclosed herein provide enhanced cardiac function following Myocardial Infarction (MI). Cardiac function can be analyzed by echocardiography and left ventricular end-diastolic volume (LVEDV), left ventricular end-systolic volume (LVESV), Ejection Fraction (EF), and shortening Fraction (FS) measured. LVEDV and LVESV are markers of ventricular volume at the beginning and end of the cardiac cycle, respectively, while ejection fraction and foreshortening fraction can measure the efficiency of cardiac function. The left ventricular inside diameter at systole (LVIDS) and diastole (LVIDD) can be obtained from 2D M mode imaging, where the fractional shortening (fractional shortening) is calculated according to the equation EF ═ LVIDD-LVIDS)/LVIDD.

The ejection fraction measurement is a volumetric measure of cardiac function, normalized to the change in cardiac volume in the cardiac cycle (LVEDV-LVESV) of the volume at the beginning of the cardiac cycle (LVEDV). Left Ventricular End Systolic Volume (LVESV) and Left Ventricular End Diastolic Volume (LVEDV) were obtained from type B imaging by manually tracking left ventricular intimal boundaries. The ejection fraction was calculated according to the formula EF ═ LVEDV-LVESV)/LVEDV.

The hydrogels disclosed herein restored LVEDV to the same level as non-infarcted subjects. LVEDV was reduced in gel/miR-302 compared to gel/miR-NC. Both sham-operated (PBS) and control (gel/miR-NC) treated mice had increased LVEDV compared to non-infarcted mice, whereas the LVEDV of the gel/miR-302 group was unchanged compared to non-infarcted mice.

LVESV showed similar results. Here, the LVESV of the gel/miR-302 mice was lower than that of the sham-operated group and the control group. LVESV was higher in PBS and gel/miR-NC treated mice than in non-MI mice. However, the LVESV of gel/miR-302 mice was not different from uninfarcted mice. From a functional point of view, although EF and FS were significantly reduced in PBS and gel/miR-NC treated animals, EF and FS were not significantly different in gel/miR-302 treated animals from non-infarcted mice.

Thus, the hydrogels disclosed herein have reduced LVEDV and LVESV levels compared to controls and are not statistically different from the volume of non-infarcted mice. The data indicate that the gel can improve cardiac capacity while preventing ventricular dilation and pathological remodeling.

Other measures of cardiac function provide further evidence of these beneficial effects. The measured reductions in cardiac volume at the beginning and end of a single contraction, compared to PBS or PBS/gel/miR-NC controls LVEDV and LVESV of gel/miR-302 treated animals, which were not significantly different from non-infarcted mice, can indicate a reduction in cardiac remodeling in gel/miR-302 treated mice.

The shortening score is a 1D measure of cardiac function that measures the change in the linear distance between the left anterior chamber wall and the posterior chamber wall at the beginning of and during the cardiac cycle. Our analysis of FS follows a similar trend. gel/miR-302 treated mice had higher shortening scores compared to gel/miR-NC. Furthermore, although the FS of PBS and gel/miR-NC treated mice was lower than that of non-infarcted mice, the FS of gel/miR-302 treated mice was not different from that of non-infarcted mice.

Our data support a mechanism by which hydrogels can induce cardiomyocyte proliferation in adult myocardial tissue in as little as five days after injection. At about 4 weeks, cardiomyocyte proliferation was shown as an increase in the number of cardiomyocyte clones in the infarct border zone, as established by the Confetti infarct model. As a result of the increase in cardiomyocytes, LVEDV and LVESV were significantly reduced, supporting improved ventricular dilation and remodeling. Similarly, increased EF and FS by administration of the hydrogel/miR-302 disclosed herein supports enhanced cardiac contractility and function. Thus, compared to control, gel/miR-302 injection can reduce end-diastolic volume by about 30% to about 45% (39%), reduce systolic volume by about 45 to about 55%, and increase ejection fraction by about 25% to about 35% (e.g., about 32%) and decrease fraction by about 60% to about 70% (e.g., about 64%) within 4 weeks.

Taken together, this improvement in EF and FS not only supports improved cardiac capacity, but also demonstrates that the hydrogels disclosed herein promote significant improvement in cardiac function after MI. Furthermore, the data indicate that local improvement in cardiomyocyte proliferation and cell number play a potentially major role in limiting infarct extension, minimizing wall stress, and improving cardiac contractility.

Route of administration

The hydrogel is typically administered by injection into the myocardium. In various aspects, the injection is proximal to the Left Anterior Descending (LAD) artery. In a particular aspect, the injection is performed inferior-lateral to the proximal Left Anterior Descending (LAD) artery.

The means for injecting is a syringe with sufficient flow to allow the gel to pass through. In certain aspects, the syringe can be 27-G_x1/2"U-100 insulin syringe. In other aspects, delivery may be percutaneous, e.g., via a catheter.