阅读说明：本技术 CXorf67在判断肿瘤对DNA损伤药物的敏感性中的应用 (Application of CXorf67 in judging sensitivity of tumor to DNA damage medicine ) 是由 李林 韩记昌 于 2020-04-28 设计创作，主要内容包括：本发明涉及CXorf67在判断肿瘤对DNA损伤药物的敏感性中的应用。具体地,本发明提供了一种CXorf67基因、mRNA、cDNA、或蛋白或其检测试剂在检测肿瘤细胞对DNA损伤修复抑制剂药物的敏感性中的用途。(The invention relates to application of CXorf67 in judging sensitivity of tumors to DNA damage drugs. Specifically, the invention provides application of CXorf67 gene, mRNA, cDNA or protein or a detection reagent thereof in detecting sensitivity of tumor cells to DNA damage repair inhibitor drugs.)

1. Use of CXorf67 gene, mRNA, cDNA, or protein or a detection reagent thereof as (i) a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs; and/or (ii) for the preparation of a diagnostic reagent or kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

2. The use of claim 1, wherein the DNA damage repair inhibitor medicament comprises a PARP inhibitor.

3. The use of claim 1, wherein said tumor cells comprise tumor cells deficient in the HR repair pathway.

4. The use according to claim 3, wherein the HR repair pathway deficient tumour is selected from the group consisting of: ependomyma fistulosa (ependomoma spatial fossa group a), renal clear cell carcinoma (KIRC), renal papillary cell carcinoma (KIRP), or a combination thereof.

5. The use of claim 4, wherein said ependymoma comprises PFA.

6. A diagnostic kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs, comprising a container containing a detection reagent for CXorf67 gene, mRNA, cDNA, or protein; and a label or instructions for use of the kit for detecting sensitivity of a tumor cell to a DNA damage repair inhibitor drug.

7. A method of determining sensitivity to a DNA damage repair inhibitor drug, the method comprising:

a) providing a test sample from a subject;

b) detecting the expression amount of CXorf67 protein in the test sample; and

c) determining the sensitivity to the DNA damage repair inhibitor drug based on the amount of CXorf67 protein expression determined in step b).

8. The method of claim 7, wherein the test sample is judged to be sensitive to a DNA damage repair inhibitor drug when CXorf67 protein is present in the test sample.

9. The method of claim 7, wherein the test sample is a tumor cell or tissue expressing or highly expressing CXorf 67.

10. A method of determining a treatment plan, comprising:

a) providing a test sample from a subject;

b) detecting the expression level of CXorf67 protein in the test sample; and

c) determining a treatment regimen based on the expression level of CXorf67 protein in the sample.

Technical Field

The present invention relates to the fields of oncology and diagnostics. More specifically, the invention relates to the use of CXorf67 for determining the sensitivity of a tumor to DNA damaging drugs.

Background

Double Strand Breaks (DSBs) in DNA in cells are one of the most serious DNA damages faced by cells, and DNA double strand break repair is generally divided into two types according to the presence or absence of homologous sequences. One is the classical non-homologous end joining (cNHEJ), which is independent of homologous sequences and functions mainly in G0/G1 of the cell cycle. The other is the recombination (HR) repair pathway, which is a fault-free repair that uses homologous DNA inside the cell as a template to repair fragmented DNA, mainly during S/G2 phase of the cell cycle. Such homologous DNA may be a sister chromatid, a sequence on a homologous chromosome or an ectopic chromosome.

Poly (ADP-ribose) polymerase inhibitors (PARPi) are a recently discovered drug that can kill cancer cells using synthetic lethality. Poly (ADP-ribose) polymerase (PARP) has 17 family members, which are a class of nuclear proteins, of which PARP1 and PARP2 are the major proteins involved in DNA damage response. PARP inhibitors were reported to specifically kill BRCA1 or BRCA2 mutated tumors as early as 2005. There are currently 5 PARP inhibitors, but their capacity on PARP-bridging varies greatly.

CXorf67(chromosome X open reading frame 67) is located at chromosome Xp11.22 with only one exon, no intron, and encodes 503 amino acids. CXorf67 is a protein of unknown function, primarily localized in the nucleus, predicted by the website to have no known domains, and mostly disordered.

A tumor with defects in the HR repair pathway is a tumor that is very sensitive to PARP inhibitors. PARP inhibitors block the repair of DNA single strand breaks, DNA replication results in double strands that can lead to cell death if the tumor cells are deficient in HR repair; normal cells have intact HR repair and are therefore not killed.

Ependymoma (EPN) is a neuroepithelial malignancy that occurs in the Central Nervous System (CNS), both in children and adults. EPN occurs mainly at three positions: supratentorial (ST), Posterior Fossa (PF), and Spinal (SP). The study in 2015 further classified the molecular subtypes of ependymomas at these three locations by analysis of DNA methylation, ST including ST-SE, ST-EPN-YAP1 and ST-EPN-RELA; PF includes PF-SE, PFA and PFB; SP includes SP-SE, SP-MPE and SP-EPN. PFA occurs mainly in infants and young children (average age 3 years, range 0-51 years), with poor recovery; PFB occurs mainly in adolescents (average age 30 years, range 10-65 years) and better after recovery.

PFA subtype in ependymoma mainly occurs in the hindbrain part of children, is poor after recovery, mainly adopts operation and radiotherapy at present and lacks effective drug treatment.

Therefore, there is an urgent need in the art to develop new targets that enhance the sensitivity of HR repair pathway deficient tumors to DNA damaging drugs, thereby more effectively treating HR repair pathway deficient tumors.

Disclosure of Invention

The invention aims to provide a new target for enhancing the sensitivity of the HR repair pathway-deficient tumor to DNA damage medicaments, thereby more effectively treating the HR repair pathway-deficient tumor.

The invention provides in a first aspect the use of a CXorf67 gene, mRNA, cDNA, or protein or a detection reagent therefor, (i) as a marker for detecting the sensitivity of a tumor cell to a DNA damage repair inhibitor drug; and/or (ii) for the preparation of a diagnostic reagent or kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

In another preferred embodiment, the DNA damage repair inhibitor drug comprises a PARP inhibitor.

In another preferred embodiment, the PARP inhibitor is selected from the group consisting of: talazoparib, olaparib, Veliparib, Rucaparib, Niraparib.

In another preferred embodiment, the diagnostic reagent comprises an antibody, a primer, a probe, a sequencing library, a nucleic acid chip (e.g., a DNA chip), or a protein chip.

In another preferred embodiment, the protein comprises a full-length protein or a protein fragment.

In another preferred embodiment, the protein contains a PALB2 binding motif (PALB2-binding motif).

In another preferred embodiment, the PALB2 binding motif is located at position 420-432 of the CXorf67 protein.

In another preferred embodiment, the CXorf67 gene, mRNA, cDNA, or protein is of mammalian origin, preferably rodent (e.g., mouse, rat), primate, and human, more preferably, a patient diagnosed with a tumor having a defect in the HR repair pathway.

In another preferred embodiment, the HR repair pathway deficient tumor is selected from the group consisting of: ependomyma fistulosa (ependomoma spatial fossa group a), renal clear cell carcinoma (KIRC), renal papillary cell carcinoma (KIRP), or a combination thereof.

In another preferred embodiment, the ependymoma comprises PFA.

In another preferred example, the tumor cell is a CXorf 67-expressing or high-expressing tumor cell.

In another preferred embodiment, the tumor cells comprise tumor cells deficient in the HR repair pathway.

In another preferred embodiment, the tumor cells are selected from one or more tumors of the group consisting of: ependymoma, renal clear cell carcinoma (KIRC), renal papillary cell carcinoma.

In another preferred example, the accession number of the CXorf67 Gene is Gene ID: 340602.

In another preferred example, the CXorf67 mRNA has accession number NM — 203407.3.

In another preferred example, the CXorf67 protein has accession number NP _ 981952.1.

In another preferred embodiment, the test is a tissue sample test.

In another preferred embodiment, the detection comprises immunohistochemistry, immunoblotting and fluorescent quantitative PCR detection.

In another preferred embodiment, the detection is the determination of tumor tissue.

In another preferred example, the detection reagent comprises an antibody specific for CXorf67, a specific binding molecule specific for CXorf67, a specific amplification primer, a probe or a chip.

In another preferred embodiment, the CXorf67 protein or specific antibody or specific binding molecule thereof is coupled to or carries a detectable label.

In another preferred embodiment, the detectable label is selected from the group consisting of: a chromophore, a chemiluminescent group, a fluorophore, an isotope, or an enzyme.

In another preferred example, the antibody specific for CXorf67 is a monoclonal antibody or a polyclonal antibody.

In a second aspect, the present invention provides a diagnostic kit for detecting the sensitivity of a tumor cell to a DNA damage repair inhibitor drug, said kit comprising a container containing a detection reagent for detecting CXorf67 gene, mRNA, cDNA, or protein; and a label or instructions for use of the kit for detecting sensitivity of a tumor cell to a DNA damage repair inhibitor drug.

In another preferred embodiment, the detection reagent for detecting CXorf67 gene, mRNA, cDNA, or protein comprises:

(a) an antibody specific for an anti-CXorf 67 protein; and/or

(b) A specific primer that specifically amplifies mRNA or cDNA of CXorf 67.

In another preferred embodiment, the test is a tissue sample test.

In a third aspect, the present invention provides a method for determining sensitivity to a DNA damage repair inhibitor drug, the method comprising:

a) providing a test sample from a subject;

b) detecting the expression amount of CXorf67 protein in the test sample; and

c) determining the sensitivity to the DNA damage repair inhibitor drug based on the amount of CXorf67 protein expression determined in step b).

In another preferred example, when CXorf67 protein is present in the test sample, sensitivity to a DNA damage repair inhibitor drug can be judged.

In another preferred embodiment, sensitivity to a DNA damage repair inhibitor drug is judged when CXorf67 protein is expressed in the test sample in an amount > 0.5, preferably > 1.5, more preferably > 2.

In another preferred embodiment, the subject is a human or non-human mammal.

In another preferred example, the test sample is a tumor cell or tissue expressing CXorf67 or high expression.

In another preferred embodiment, the test sample is a tumor cell or tissue deficient in the HR repair pathway.

In another preferred example, the detecting step (b) comprises detecting the amount of CXorf67 mRNA, or the amount of CXorf67 cDNA; and/or detecting the amount of CXorf67 protein.

In another preferred example, the expression level of CXorf67 protein in the sample is detected by fluorescent quantitative PCR or immunohistochemistry.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

A fourth aspect of the invention provides a method of determining a treatment regimen comprising:

a) providing a test sample from a subject;

b) detecting the expression level of CXorf67 protein in the test sample; and

c) determining a treatment regimen based on the expression level of CXorf67 protein in the sample.

In another preferred embodiment, the subject is a human or non-human mammal.

In another preferred example, when CXorf67 protein is present in the sample (preferably expressed in an amount > 0.5, preferably > 1.5, more preferably > 2 of CXorf67 protein), the treatment regimen comprises CXorf67 inhibitor therapy, DNA damage repair inhibitor drug therapy, therapy in which a CXorf67 inhibitor is combined with a DNA damage repair inhibitor drug.

In another preferred embodiment, the CXorf67 inhibitor therapy, DNA damage repair inhibitor drug therapy is selected from the group consisting of:

CXorf67 inhibitor therapy: an antibody, a small molecule compound, microRNA, siRNA, shRNA, or a combination thereof;

DNA damage repair inhibitor drug therapy: PARP inhibitors.

In another preferred example, when the subject is more sensitive to a DNA damage repair inhibitor drug than the general population (control population), the treatment regimen further comprises a CXorf67 inhibitor therapy, a DNA damage repair inhibitor drug therapy, a therapy in which a CXorf67 inhibitor is combined with a DNA damage repair inhibitor drug.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

Fig. 1 shows CXorf67 expression amount and drug sensitivity. (a) The relationship between the amount of CXorf67 expression and drug activity in brain cell lines in GDSC database was analyzed. 93 medicines are screened out according to the correlation coefficient of more than 0.1 and the p value of less than 0.05. (b) The targeted pathway analysis was performed for 60 drugs with classification information among the 93 drugs.

Figure 2 shows that CXorf67 is a DNA damage response protein. (a) U2OS cells were plated into glass-bottomed dishes and 24 hours later were transfected with the EGFP-CXorf67 plasmid. After 24 hours Hoechst dye was added for 15 minutes and then washed three times with the broth. One picture per 20 seconds was taken with a 405nm laser injury on a live cell workstation. (b) U2OS was stimulated with 0.1 μ M CPT, cells were then harvested at different time points and chromatin separation was performed. (c) U2OS cells were plated on 24-Well slides and then stimulated with IR or with 0.1. mu.M CPT, fixed with 4% paraformaldehyde after 1 hour, washed with PBST overnight with CXorf67 antibody, blocked with fluorescent secondary antibody and DAPI the next day for 1 hour, and then photographed.

Figure 3 shows that CXorf67 can inhibit DNA damage repair. (a) CXorf67 WT and KO U2OS cells were seeded in 24-wells and then stimulated with IR (10Gy) and samples were collected at different time points and WB detected the level of r-H2 AX. (b) CXorf67 was back expressed in U2OS of CXorf67 KO, and then IR stimulated, WB detected the level of r-H2 AX. (c) In CXorf67 WT, KO and U2OS reverted to CXorf67 expression, stimulation with IR (10Gy) was performed, and then 0.5H and 24H samples were collected, immunofluorescent staining was performed, and r-H2AX foci formation was detected. (d) CXorf67 WT and KO U2OS following IR (10Gy) stimulation, cells were collected and subjected to comet electrophoresis to detect tailing of nuclear DNA. Figure 4 shows that CXorf67 inhibits HR without affecting NHEJ. (a) Two concentrations of CXorf67 plasmid (0.1. mu.g and 0.5. mu.g) and I-SceI plasmid (3. mu.g) were transfected into 6-well U2OS DR-GFP cells, and cells were collected after 48 hours for flow analysis of the number of GFP and RFP positive cells. the p-value was analyzed by t-test detection. (b) CXorf67 plasmid (0.5. mu.g) and I-SceI plasmid (3. mu.g) were transfected into 6-well U2OS EJ5-GFP cells, and cells were collected for flow analysis of the number of GFP and RFP positive cells after 48 hours.

Fig. 5 shows that CXorf67 affected Rad51 foci, but not RPA2 and BRCA1 foci. (a) U2OS CXorf67-WT, KO and KO cells of gyratory CXorf67 were subjected to CPT for 0.1. mu.M for 4 hours, fixed, and subjected to immunofluorescence using Rad51 antibody to observe Rad51 foci. And the number of foci per cell was counted using Image-pro plus software. the p-value was analyzed by t-test detection. (b, c) after subjecting U2OS CXorf67-WT and KO cells to CPT for 0.1. mu.M for 4 hours, the cells were fixed, immunofluorescence assay was performed using RPA2, BRCA1 antibody, and the corresponding foci were observed. (d) After 0.1. mu.M CPT treatment for 4 hours on Daoy CXorf67-WT, KO and KO cells of gyratory CXorf67, the cells were fixed and observed for Rad51 foci using Rad51 antibody for immunofluorescence experiments. (e, f) after subjecting the Daoy CXorf67-WT and KO cells to CPT for 0.1. mu.M for 4 hours, the cells were fixed, subjected to immunofluorescence assay using RPA2 and BRCA1 antibodies, and observed for the corresponding foci.

Figure 6 shows CXorf67 binding to PALB 2. (a) In Daoy cells, CXorf67 was immunoprecipitated and then tested for binding to PALB2, BRCA1, RPA2, and Rad 51. (b) CXorf67-HA, PALB2-Flag or BRCA1-Flag was transfected in 293T cells, and CXorf67 was immunoprecipitated with HA antibody, followed by Western blot analysis of PALB2 and BRCA 1. (c) The PALB2-HA plasmid was transfected in U2OS cells, and co-localization of endogenous CXorf67 with PALB2 was observed.

Figure 7 shows CXorf67 binding to the WD40 domain of PALB 2. (a) Based on the reported PALB2 domain, three fragment plasmids of PALB2 were constructed. (b) In 293T cells, different forms of fragments of PALB2 plasmid and CXorf67 plasmid were transfected and Flag immunoprecipitation was performed, followed by detection of CXorf 67. (c) His-tagged CXorf67 protein and GST-tagged WD40 protein were purified separately in E.coli, followed by GST pull-down experiment.

FIG. 8 shows that CXorf67 shows that the 420-432 amino acid sequence of CXorf67 is highly similar to the 26-38 amino acid sequence of BRCA2 by the sequence alignment of PALB2-binding motif in conjunction with PALB2 (a). The Biotin-modified CXorf67 WT and W425C mutant polypeptides (420-432) were synthesized and then subjected to streptavidin pull-down experiments with GST-WD40 protein. (b) CXorf67 WT and W425C mutant plasmids were transfected in 293T and co-immunoprecipitated to detect the binding of PALB 2. (c) The I-SceI and WT CXorf67 or W425C mutants were transfected into U2OS DR-GFP cells, and 48h later, the cells were harvested for FACS analysis of the proportion of positive cells occupied by GFP and RFP. P-values were analyzed using a t-test assay. (d) WT CXorf67 or W425C mutants were recruited in Daoy CXorf67-KO cells, respectively, and then fixed stained Rad51 foci after CPT stimulation, and p-values were analyzed by t-test assay.

Figure 9 shows that CXorf67 competes with BRCA2 for binding to PALB 2. (a) PALB2-Myc, BRCA2-N-GFP (1-200 amino acids) and a gradient of CXorf67-HA plasmid were transfected into 293T cells, followed by immunoprecipitation of PALB 2. (b) PALB2-GFP, BRCA2-N-Myc were transfected into U2OS cells, while co-localization of PALB2 and BRCA2 was observed in the presence and absence of CXorf 67. (c) CXorf67-GFP and Myc-LacR or Myc-LacR-PALB2 plasmids were transfected into U2OS-LacO cells, and immunofluorescence experiments were performed. (d) GFP-LacR, GFP-LacR-PALB2, Myc-BRCA2-N (1-200) or CXorf67-HA plasmids were transfected into U2OS-LacO cells, and then immunofluorescence experiments were performed. ImageJ software was used for quantitative fluorescence analysis.

Figure 10 shows that Daoy cells highly expressing CXorf67 were more sensitive to PARP inhibitors. (a) Daoy CXorf67 WT and KO cells were plated in 96-well, treated with different concentrations of Talazoparib for 5 days, and then the cells were tested for survival using CellTiter-Glo kit, and analyzed for p-value by Two-way ANOVA. (b) CXorf67 was back expressed in Daoy CXorf67 KO cells, the cells were plated in 96-wells and treated with different concentrations of Talazoparib or Olaparib for 5 days, and then the survival rate of the cells was measured. (c) Daoy CXorf67-KO cells and cells reverting CXorf67 expression in KO were mixed with Matrigel 1:1 and injected subcutaneously into 5-week-old BALB/c nude mice, 5 in each group, when the tumor volume reached 100mm³In time, Talazoparib (0.33mg/kg) was given as a gastric lavage and tumor volume was measured twice a week. (d) CXorf67 was overexpressed in U251 and U87 cells, followed by treatment with different concentrations of Talazoparib for 5 days, and cell survival was measured using CellTiter-Glo kit.

FIG. 11 shows CXorf67 was highly expressed in PFA subtypes of ependymoma (a) mRNA levels of CXorf67 were analyzed in data of GSE64415(PFA, 72 cases; non-PFA, 137 cases) and GSE94349(PFA, 12 cases; non-PFA, 179 cases). (b) Proteins were extracted from 28 collected (numbered 1-28) ependymoma samples, protein expression levels of CXorf67 and levels of γ -H2AX were measured using western blotting, and then measured using Pearson correlation analysis.

Figure 12 shows that PFA tumors highly expressing CXorf67 are more sensitive to PARP inhibitors. (a) Fresh specimens of PFA 1-4 and MB-1 of 5 hindbrain tumors of children were collected, and then the expression levels of CXorf67 and gamma-H2 AX were examined by Western blotting. (b) PFA-1 and PFA-2 tumor-derived primary cells were established, treated with different concentrations of Talazoparib for 5 days, and then the survival rate of the cells was tested using CellTiter-Glo kit. Two-way ANOVA analysis of p-values. (c) PFA-3, PFA-4 and MB-1 tumor-derived PDXs were established. Each group of PDX was inoculated with 10 nude mice, and then divided into two groups of drug-treated and drug-free groups. When the tumor volume reaches 50mm³In time, Talazoparib (0.33mg/kg) was gavaged for 5 days per week and tumor volume was measured. When the tumor volume reaches 1000mm³Then, a mouse survival curve was plotted. The p-value was analyzed by Log rank (Mantel-Cox) detection. (d) Tumor volumes were measured for PFA-3, PFA-4 and MB-1 dosing and non-dosing, and p-values were analyzed by Two-way ANOVA.

Figure 13 shows expression analysis of CXorf67 in other cancers. (a) mRNA expression levels of CXorf67 were analyzed in the TCGA database for 16 cancers. (b) P-values were analyzed by log-rank test for the expression level of CXorf67 in two cancers, KIRC (higher, n-55; lower, n-53), KIRP (higher, n-59; lower, n-57).

Detailed Description

The present inventors have conducted extensive and intensive studies and, for the first time, have unexpectedly found that a tumor cell line or tumor tissue highly expressing CXorf67 is more sensitive to DNA damage repair inhibitor drugs (such as PARP inhibitors). Thus, the CXorf67 gene or its protein can be used as a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs. On this basis, the present inventors have completed the present invention.

HR repair pathway deficient tumors

The Homologous Recombination (HR) repair pathway is a fault-free repair that uses homologous DNA inside cells as a template to repair fragmented DNA, mainly during S/G2 phase of the cell cycle. Defects or deficiencies in HR can lead to genomic instability, which is accompanied by tumor development and progression, and mutations in genes such as BRCA1, PLAB2, and BRCA2 in the HR pathway are found in many tumors. Mutations in these genes can cause DNA double strand breaks to be ineffectively repaired, resulting in alterations, rearrangements and mutations in the copy number of cellular genes, which in turn can cause the development of tumors and diseases, such as breast, pancreatic and prostate cancers.

In a preferred embodiment, the tumor deficient in the HR repair pathway is a CXorf67 high expressing tumor selected from the group consisting of: ependomyma spatial fossa group a renal clear cell carcinoma (KIRC), renal papillary cell carcinoma (KIRP) ventricular cytoma, renal clear cell carcinoma (KIRC), renal papillary cell carcinoma, KIRC, or a combination thereof.

Sample (I)

The term "sample" or "specimen" as used herein refers to a material that is specifically associated with a subject from which specific information about the subject can be determined, calculated, or inferred. The sample may be composed in whole or in part of biological material from the subject. The sample may also be a material that has been contacted with the subject in a manner such that the test performed on the sample provides information about the subject. The sample may also be a material that has been contacted with other materials that are not the subject, but that enable the first material to be subsequently tested to determine information about the subject, e.g., the sample may be a probe or scalpel wash. The sample can be a source of biological material other than that contacted with the subject, so long as one of skill in the art is still able to determine information about the subject from the sample.

Expression of

As used herein, the term "expression" includes the production of mRNA from a gene or portion of a gene, and includes the production of protein encoded by an RNA or gene or portion of a gene, as well as the presence of a test substance associated with expression. For example, cDNA, binding of a binding partner (e.g., an antibody) to a gene or other oligonucleotide, protein or protein fragment, and chromogenic moieties of the binding partner are included within the scope of the term "expression". Thus, an increase in the density of half-spots on immunoblots such as western blots is also within the scope of the term "expression" based on biological molecules.

Reference value

As used herein, the term "reference value" refers to a value that is statistically correlated with a particular result when compared to the results of an analysis. In a preferred embodiment, the reference value is determined from a statistical analysis of studies comparing CXorf67 expression with known clinical outcomes. Some of these studies are shown in the examples section herein. However, studies from the literature and user experience with the methods disclosed herein can also be used to produce or adjust the reference values. The reference value may also be determined by considering conditions and outcomes particularly relevant to the patient's medical history, genetics, age, and other factors.

In the present invention, the reference value refers to a cut-off value (cut-off value) and refers to the expression level of CXorf67, preferably with an expression level of CXorf67 > 0.5, preferably > 1.5, more preferably > 2, in tumor cells or tissues deficient in the HR repair pathway.

Samples of non-tumor cells

As used herein, the term "sample of non-tumor cells" includes, but is not limited to, a population of tumors that do not have a defect in the HR repair pathway.

CXorf67 proteins and polynucleotides

In the present invention, the terms "protein of the invention", "CXorf 67 protein", "CXorf 67 polypeptide" are used interchangeably and all refer to a protein or polypeptide having the amino acid sequence CXorf 67. They include CXorf67 protein with or without the starting methionine. In addition, the term also includes full-length CXorf67 and fragments thereof. The CXorf67 protein referred to herein includes its complete amino acid sequence, its secreted protein, its mutants, and functionally active fragments thereof.

CXorf67(chromosome X open reading frame 67) is located at chromosome Xp11.22 with only one exon, no intron, and encodes 503 amino acids. CXorf67 is a protein of unknown function, primarily localized in the nucleus, predicted by the website to have no known domains, and mostly disordered.

The human CXorf67 protein is 503 amino acids in length (accession No. NP _ 981952.1). The murine CXorf67 protein was 589 amino acids full length (accession NP _ 001159905.1).

In the present invention, the terms "CXorf 67 gene" and "CXorf 67 polynucleotide" are used interchangeably and all refer to a nucleic acid sequence having a CXorf67 nucleotide sequence.

The genome of the human CXorf67 Gene is 1896bp in total length (NCBI GenBank accession number is Gene ID:340602), and the mRNA sequence of the transcription product thereof is 1512bp in total length (NCBI GenBank accession number is NM-203407.3).

The genome of the murine CXorf67 Gene has a full length of 2203bp (NCBI GenBank accession number Gene ID:102991), and the mRNA sequence of its transcription product has a full length of 1770bp (NCBI GenBank accession number NM-001166433.1).

Human and murine CXorf67, with 39% similarity at the DNA level and 39% protein sequence similarity.

It is understood that nucleotide substitutions in codons are acceptable when encoding the same amino acid. It is also understood that nucleotide changes are also acceptable when conservative amino acid substitutions are made by nucleotide substitutions.

When an amino acid fragment of CXorf67 is obtained, a nucleic acid sequence encoding it can be constructed therefrom, and a specific probe can be designed from the nucleotide sequence. The full-length nucleotide sequence or a fragment thereof can be obtained by PCR amplification, recombination, or artificial synthesis. For the PCR amplification method, primers can be designed based on the CXorf67 nucleotide sequence disclosed herein, particularly the open reading frame sequence, and the relevant sequence can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, DNA sequences encoding the proteins of the present invention (or fragments, derivatives thereof) can be obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (e.g., vectors) and cells known in the art.

The polynucleotide sequences of the invention can be used to express or produce recombinant CXorf67 polypeptides by conventional recombinant DNA techniques. Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding a human CXorf67 polypeptide, or with a recombinant expression vector containing the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

In the present invention, the CXorf67 polynucleotide sequence may be inserted into a recombinant expression vector. In general, any plasmid or vector can be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing CXorf67 encoding DNA sequences and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, bacterial cells of the genus streptomyces; fungal cells such as yeast; a plant cell; an insect cell; animal cells, and the like.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Specific antibodies

In the present invention, the terms "antibody of the invention" and "anti-CXorf 67-specific antibody" are used interchangeably.

The invention also includes polyclonal and monoclonal antibodies, particularly monoclonal antibodies, specific for the human CXorf67 polypeptide. Here, "specific" means that the antibody is capable of binding to the human CXorf67 gene product or fragment. Preferably, these are those antibodies that bind to the human CXorf67 gene product or fragment, but do not recognize and bind to other non-related antigenic molecules. Antibodies of the invention include those molecules that are capable of binding to and inhibiting human CXorf67 protein, as well as those antibodies that do not affect the function of human CXorf67 protein. The invention also includes those antibodies which bind to the human CXorf67 gene product in modified or unmodified form.

The invention encompasses not only intact monoclonal or polyclonal antibodies, but also immunologically active antibody fragments, such as Fab' or (Fab)₂A fragment; an antibody heavy chain; an antibody light chain; genetically engineered single chain Fv molecules (Ladner et al, U.S. Pat. No.4,946,778); or chimeric antibodies, such as antibodies that have murine antibody binding specificity but retain portions of the antibody from a human.

The antibodies of the invention can be prepared by a variety of techniques known to those skilled in the art. For example, a purified human CXorf67 gene product, or antigenic fragment thereof, can be administered to an animal to induce the production of polyclonal antibodies. Similarly, cells expressing human CXorf67 protein or an antigenic fragment thereof can be used to immunize animals to produce antibodies. The antibody of the present invention may also be a monoclonal antibody. Such monoclonal antibodies can be prepared using hybridoma technology (see Kohler et al,Nature256 of; 495, 1975; the result of Kohler et al,Eur.J.Immunol.6: 511,1976, respectively; the result of Kohler et al,Eur.J.Immunol.6: 292,1976, respectively; the Hammerling et al, in the name of,In Monoclonal Antibodies and T Cell Hybridomaselsevier, n.y., 1981). Antibodies of the invention include antibodies that block the function of human CXorf67 protein as well as antibodies that do not affect the function of human CXorf67 protein. Each class of antibodies of the invention can be obtained by conventional immunological techniques using fragments or functional regions of the human CXorf67 gene product. These fragments or functional regions can be prepared by recombinant methods or synthesized using a polypeptide synthesizer. Antibodies that bind to an unmodified form of the human CXorf67 gene product can be produced by immunizing an animal with a gene product produced in a prokaryotic cell (e.g., e.coli); antibodies that bind to post-translationally modified forms (e.g., glycosylated or phosphorylated proteins or polypeptides) can be obtained by immunizing an animal with a gene product produced in a eukaryotic cell (e.g., a yeast or insect cell).

Antibodies against human CXorf67 protein can be used in immunohistochemical techniques to detect human CXorf67 protein in a sample, particularly a tissue sample or a serum sample. Due to the presence of the extracellular region of the CXorf67 protein, these soluble CXorf67 extracellular regions can be targeted for serum detection in the event that the extracellular region is shed and enters the blood.

Detection method

The present invention also provides a method for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs by taking advantage of the fact that CXorf67 is present in tumor (e.g., HR repair pathway deficient tumors, preferably ependymomas) cells or tissues and is closely related to the sensitivity of DNA damage repair inhibitor drugs.

In a preferred embodiment of the invention, the invention provides a high-throughput next generation sequencing method for detecting CXorf67, Sanger sequencing, quantitative fluorescence pcr (qpcr), in situ immunofluorescence (FISH), immunohistochemistry, and the like.

Detection kit

Based on the correlation between the CXorf67 highly expressed tumor cells and the sensitivity of the DNA damage repair inhibitor drug, i.e., the CXorf67 highly expressed tumor cells are more sensitive to the DNA damage repair inhibitor drug, CXorf67 can be used as a biomarker for guiding the use of the DNA damage repair inhibitor drug.

The invention also provides a diagnostic kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs, which contains a detection reagent for detecting CXorf67 gene, mRNA, cDNA or protein; and a label or instructions for use of the kit for detecting sensitivity of a tumor cell to a DNA damage repair inhibitor drug.

Detection method and kit

The present invention relates to diagnostic assays for quantitative and in situ measurement of human CXorf67 protein levels or mRNA levels. These assays are well known in the art. Human CXorf67 protein levels detected in the assay can be used to detect the sensitivity of tumor cells to DNA damaging drugs.

One method for detecting the presence of CXorf67 protein in a sample is by using an antibody specific for CXorf67 protein, which comprises: contacting the sample with an antibody specific for CXorf67 protein; observing whether an antibody complex is formed, the formation of an antibody complex indicates the presence of CXorf67 protein in the sample.

The CXorf67 protein or its polynucleotide can be used for diagnosis and treatment of CXorf67 protein related diseases. A part or all of the polynucleotides of the present invention can be immobilized as probes on a microarray or DNA chip for analysis of differential expression of genes in tissues and gene diagnosis. An anti-CXorf 67 antibody can be immobilized on a protein chip for detecting CXorf67 protein in a sample.

The main advantages of the invention include:

(1) the invention has found for the first time that CXorf67 is a DNA damage response protein that can be recruited to a DNA break site. CXorf67 and can inhibit DNA Homologous Recombination (HR) repair.

(2) The invention discovers for the first time that CXorf67 highly expressed tumor cells are more sensitive to DNA damage repair inhibitor drugs (such as PARP inhibitors).

(3) The invention discovers for the first time that CXorf67 can be used as a biomarker for guiding DNA damage repair inhibitor drugs (such as PARP inhibitors).

(4) The invention discovers for the first time that CXorf67 can be used as a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

(5) The invention discovers for the first time that the expression level of CXorf67 is related to the sensitivity of DNA damage repair inhibitor drugs.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Unless otherwise specified, materials and reagents used in examples of the present invention are commercially available products.

General procedure

1. Cell culture

Human U2OS cells and HEK293T cells were purchased from ATCC; daoy cells were purchased from stem cell banks of the chinese academy of sciences; u2OS DR-GFP cells and U2OS EJ5-GFP cells were donated by Proc. Huangjun professor, university of Zhejiang; u2OS LacO cells were donated by professor wangwei, university of zhejiang. All cell lines were cultured at 37 ℃ in a 5% carbon dioxide incubator. All media were purchased from Gibco, plus 10% fbs (total bone serum). The HEK293T used DMEM medium, the U2OS used 1640 medium, and the Daoy used MEM medium.

Ependymoma primary cell cultures Neurobasal medium plus B27, N2, GlutaMAX, EGF, FGF, heparin were used. Poly-D (100mg, 10mg/ml) was added, and filtered. 10. mu.l was added to 10cm dish.

FGF was formulated with PBS containing 0.1% BSA (0.22 μm filtration) to make 5 μ g/ml. EGF was formulated in PBS containing 0.1% BSA (0.22 μm filtration) to make 10 μ g/ml. The Heparin was made up to 250. mu.g/ml with PBS and filtered. DNase I was prepared at 1mg/ml (10X) in FBS-free DMEM medium, filtered, aliquoted at-20 degrees and stored at a working concentration of 0.1 mg/ml.

2. Antibodies

A first antibody:

rad51(ab88572,1:500IF), PALB2(ab220861,1:1000WB), H2A.X (ab11175,1:5000WB) were purchased from abcam. Phor-H2A. X (Ser139) (05-636,1:1000IF,1:2000WB) was purchased from Merck Millipore. HA-tag (3724,1:1000IF), Flag-tag (2368,1:1000WB), Myc-tag (2276,1:1000WB), H3(4620,1:5000WB) were purchased from CST corporation. BRCA1(sc-6954,1:500IF), LOC340602(CXorf67) (sc-515296,1:500IF,1:1000WB), Ig-G (sc-2025), β -actin (sc47778,1:2000WB) were purchased from Santa Cruz. Flag-tag (F1804,1:1000IF), GST-tag (G1166,1:1000WB), His-tag (H10294,1:1000WB) were purchased from Sigma. HA-tag (901515,1:1000WB) was purchased from Biolegend. GFP-tag (11814460001,1:1000WB) was purchased from Roche.

Secondary antibody:

alexa Fluor 488-conjugated donkey anti-rabbit IgG, Alexa Fluor 647-conjugated goat anti-rabbit IgG, HRP-conjugated goat anti-mouse IgG, and HRP-conjugated goat anti-rabbit IgG were purchased from Invitrogen. Goat anti-mouse IgG coupled to Cy3 was purchased from Jackson ImmunoResearch.

3. Reagent

CXorf67 Biotin peptide WT: BIOTIN-GGPIPQQWDESSSSS (SEQ ID NO: 1); mut: BIOTIN-GGPIPQQCDESSSSS (SEQ ID NO.:2) (purity > 90%) was synthesized by Abclonal. Olaparib, Talazoparib, DMAC (dimethylacetamide) and Solutol (polyethylene glycol-15 hydroxystearate) were purchased from MCE. DAPI (D8417) and Paraformelhyde (P6148) were purchased from Sigma. Mounting agent VECTASHIELD (H-1400) was purchased from Vector Laboratories. Hoechst 33343 was purchased from Thermo Scientific. Lipofectamine 3000 transfection reagent and Lipofectamine RNAiMAX transfection reagent were purchased from Invitrogen.

4. Chromatin separation

First, U2OS cells, 60mm dish (. about.2X 10) were prepared⁶cells). Trypsinize the 15ml centrifuge tube and centrifuge, transfer to the 1.5ml centrifuge tube, centrifuge at 5000rpm/5min/4 ℃. Washed once with PBS and 200. mu.l SA buffer (10mM HEPES pH 7.9, 10mM KCl, 1.5mM MgCl)₂，0.34M Sucrose，10％glycerol，1mM DTT，10mM NaF，1mM Na₂VO₃1mM PPi, 1 XPI). Mu.l of 10% Triton-X100 was added to give a final concentration of 0.1%. Place on ice for 5min (at which time Total retests were taken). Then, 1300g/5 min/4I of the suspension was centrifuged, and the supernatant was used as a cytoplasmic fraction and the precipitate was used as a nuclear fraction. (Cyto was taken as a sample at this time). The nuclear fraction was washed once with SA buffer, followed by addition of 200. mu.l SB buffer (3mM EDTA, 0.2mM EGTA, 1mM DTT, 10mM NaF, 1mM Na)₂VO₃1mM PPi, 1 XPI), placed on ice for 10 min. Then, the mixture was centrifuged at 1700g/5min/4 ℃ to obtain supernatant as a soluble core fraction and precipitated as chromatin. (Nuc can be retained at this point and loaded with 6 XSDS). The Chromatin fraction was washed once with SB buffer and then centrifuged at 13500rpm/5min/4 ℃ this time the supernatant was removed with a spearhead and was too viscous. The Chromatin was resuspended with 2X SDS loading and sonicated for 10min (on:20s, off:40 s).

5. Comet electrophoresis

Tabletting: soaking in 0.7% of common agarose (TAE buffer) in advance, and air drying. Preparing glue: dissolving 1% low melting point agarose gel in 100 deg.C water bath, and cooling to 37 deg.C. Cells were trypsinized, centrifuged at 3000rpm/5min and washed once with PBS. Mu.l of the cell suspension was mixed with 200. mu.l of glue and spread on Comet slide and pressed flat with a coverslip. Standing at 4 deg.C for 30min to solidify. The coverslip was removed and the cells were lysed overnight at 4 deg.C (lysate formulation: 2.5M NaCl, 100mM Na)₂EDTA, 1% sarcosyl, 10mM Tris, pH 7.5). (1% Triton/10% DMSO was added before use) neutral electrophoresis solution (1X neutral electrophoresis solution pH 7.5: Tris, 89mM boric acid, 2mM EDTA) was placed for 30min, 25V, electrophoresis for 30 min. DAPI (2.5mg/ml)1:100 was diluted with water, 40. mu.l was dropped on a slide, and the slide was covered with a cover slip and observed. Adding the above extract 5min before observation.

6. Preparation of CXorf67 knockout cell lines using CRISPR/Cas9

2 sgrnas for CXorf67 gene were designed using CRISPR online design website (http:// criprpr. mit. edu). CXorf67#1: ACGGCTCAGGCGGTGTTGCG (SEQ ID No.: 3); CXorf67#2: ATCTTGATTCCCGGTCCCGC (SEQ ID No.: 4). Annealing the positive strand and the negative strand of the sgRNA to form a double strand, and adding phosphoric acid (using T4 ligation buffer, T4 PNK to prepare a system, and gradually reducing the temperature to 25 ℃ in a PCR instrument at 37 ℃ for 30min and at 95 ℃ for 5 min). After diluting the sgRNA 1:200, a PCR reaction was carried out in a ligation system (pSpCas9(BB) -2A-GFP (PX458) all-in-one plasmid, diluted oligo, Tango buffer, 100mM DTT, 10mM ATP, Fastdigest BbSI, T4 ligase) (program: 37 ℃,5 min; 21 ℃,5 min; 8 cycles). The constructed expression plasmid was transferred into U2OS or Daoy cells, and single cells with GFP were flow-sorted 24 hours later. The resulting single cells were plated in 96-well plates and finally, single clones derived from one cell growth were identified.

7. HR and NHEJ reporting system

Day 1, shop U2OS DR-GFP or U2OS EJ5-GFP cells, and 6 wells 20-30 million cells per well. Day 2, I-SceI plasmid (3. mu.g/well) and CXorf67 plasmid were transfected with lipo 3000. (I-SceI plasmid fused with an RFP, which can be used to analyze transfection efficiency) Day 4, cells were trypsinized and flow analyzed (at least 5 ten thousand cells were analyzed).

8. Protein purification

Transfer 100 μ L of glycerol bacteria to 10ml LB (K +/Amp +), transfer to 1L TB culture medium after 12h, about 3h, measure OD value-0.6-0.8. Simultaneously, cooling, and taking 1ml of bacteria for sample detection. IPTG (1M, 1:1000 use) was added. Inducing expression at 18 deg.c for 24 hr and detecting 1ml of bacteria. The rest is collected by centrifugation and stored at-80 ℃. Precooling by a bacteria breaker, washing with water for 3 times, and washing with buffer for 2 times. And (4) precooling by using a centrifuge. 500ml of the bacteria were resuspended in 20ml of buffer, and sufficient volume was not available. PMSF (final concentration 0.15mM) may be added simultaneously. Pouring into a bacteria breaker, slowly pressurizing to 800Pa, clarifying for about 3min, and reducing pressure to obtain the final product. 13000rpm/1h/4 ℃. Meanwhile, prepare beads, wash with single distilled water for three times, and wash with buffer for two times. 500 μ l of each sample. 1750rpm/2min, the deceleration was set to 2. HIS: the supernatant was poured into a 50ml tube + glycerol (5% final) + imidazole (10mM final) + beads (28ml supernatant +1.4g glycerol +70ul 4M imidazole + 500. mu.l beads) and spun for 2h four times. GST: the supernatant was poured into a 50ml tube and 500. mu.l of beads were added directly. The supernatant was directly applied to the column and washed three times with 5-fold volumes of beads, followed by elution (20, 30, 40mM imidazole concentration for His-tag protein wash, 400mM imidazole elution, 500. mu.l in 6-7 tubes, added and collected in portions; GST eluted with GSH).

9、GST Pull Down

NETN buffer (100mM NaCl, 20mM Tris-HCl, 0.5mM EDTA and 0.5% NP-40) was prepared. To 500. mu.l of the reaction system were added 0.25. mu.g of His-CXorf67 protein and GST-WD40 protein or GST protein, and the mixture was rotated at 4 ℃ for 20 min. Then 25. mu.l of GST beads were added and spun at 4 ℃ for 30 min. The beads were then washed 3 times with NETN buffer. Add 25. mu.l of 2XSDS loading to cook the sample.

10、Biotin-Peptide Pull Down

Mu.l of streptavidin agar beads were washed 3 times with Binding buffer (20mM HEPES pH 7.5, 100mM NaCl, 1mM DTT, 1mM EDTA, 0.01% IGEPAL CA-630). The beads were divided into 3 portions, one portion was not added, and the other two portions were added with 10. mu. g C67-WT, C67-Mut peptide, respectively. Rotate at 4 ℃ for 1 h. The beads were washed 3 times with the buffer and 1. mu.g of GST-WD40 protein was added thereto. Rotate at 4 ℃ for 2 h. The beads were washed 3 times with buffer and cooked with 30ul of 2XSDS loading.

11. Immunofluorescence

The coverslip was soaked in alcohol, quickly baked several times on an alcohol burner flame, and then spread onto a 24-well plate. Adding culture solution, soaking, and washing. After counting the cell digestions, they were dispensed into 24-well plates. On the third day, the culture was aspirated and fixed for 15min with 200. mu.l of 4% PFA. Washed 3 times with PBST (0.1% Triton-X100) and blocked for 1h with 5% BSA. Washed 3 times with PBST and added primary antibody solution and left overnight at 4 ℃. After washing the primary antibody with PBST every other day, adding the corresponding fluorescent secondary antibody and DAPI, and sealing for 1h in dark. The secondary antibody was washed off with PBST, and then coverslips were mounted on slides using mounting medium and stored at 4 ℃ in the dark.

12. Co-immunoprecipitation

Cells were plated in 6-well plates (exogenous) or 10cm dish (endogenous). Lyses buffer (1XTriton lyses (1% Triton, 5mM EDTA, 150mM NaCl, 50mM Tris-HCl, pH7.4), 10m NaF, 1XPI, 1mM PPi, 2mM Na were prepared₃VO₄). After the cell culture solution was aspirated, it was placed on ice, and lysis buffer was added. Placing on shaking table for 10 min. The cell lysate was pipetted into a 1.5ml EP tube which was chilled and centrifuged at 13000rpm/15min/4 ℃. The supernatant was pipetted into a new EP tube and 30. mu.l of the supernatant was cooked by adding 30ul of 2XSDS loading as input. The remainder was added with 0.25% BSA and corresponding antibody. Rotate at 4 ℃ for 2h or overnight. Sharp removing gun headAdd 30. mu.l protein A/G agar beads. Rotate at 4 ℃ for 2 h. After centrifugation to remove the supernatant, the column was washed 3 times with lysis buffer. Add 30. mu.l of 2XSDS loading to cook the sample.

13. Primary cell culture of ependymoma

The freshly excised tumor tissue in the hospital was placed in a 50ml centrifuge tube containing Neurobasal culture medium and sent to the laboratory within 1 h. Tumor tissues were sent to a laboratory clean bench and washed once with PBS (plus Penicilin-Streptomyces) to wash blood. The samples were cut into small pieces (handled in 60mm dish) in PBS using sterile forceps and scissors (pre-sterilization). Also minced in digestive juices, but some blood impurities, preferably in PBS, can be washed once. The minced samples and PBS were transferred to 15ml centrifuge tubes at 1000rpm/3 min. Add Accutase digestive enzymes and place the centrifuge tubes in a shaker at 37 ℃. Then treated with DNaseI (0.1mg/ml) for 10 min. After digesting the tissue into single cells, the single cells were filtered into 50ml centrifuge tubes using a 70 μm cell strainer and then transferred to 15ml centrifuge tubes for centrifugation (1700rpm/5 min). The cell count was reselected and 60mm or 10cm dishes were selected according to density (the dishes were coated with lamin in advance).

14. Mouse transplantation tumor experiment

BALB/c Nude immunodeficient male mice, 5 weeks old, were ordered and acclimated for one week in SPF grade mouse rooms. Mixing 3X10⁶The Daoy cells were mixed with Matrigel 1:1 and then injected into the right abdomen of the nude mice. PDX-derived cells: firstly, taking out the tumor from the PDX successfully modeled, then cutting into pieces, adding Accutase digestive enzyme, digesting into single cells, counting 3X10⁶The individual cells were mixed with Matrigel 1:1 and then injected into the right flank of the nude mouse. Waiting until the tumor volume reaches 50-100mm³On the left and right, administration can be started. Talazoparib was dissolved in 10% DMAC, 6% Solutol and 84% PBS (stock solution was in DMSO, 10 mg/ml). Then the medicine is administrated by gavage according to 0.33 mg/kg. The administration is carried out for 5 days in a week. Mice were observed daily and mouse body weight and tumor size were recorded twice a week. (tumor volume ═ length × width)/2). When the maximum tumor volume reaches 1000mm³Mice were euthanized at time.

Example 1 the expression level of CXorf67 correlates with the sensitivity of DNA damaging drugs

Since CXorf67 is a protein of unknown function, it was found in the laboratory by analysis of GDSC database that the expression level of CXorf67 correlates with the sensitivity of DNA damaging drugs. Cell lines from the central nervous system were analyzed in the GDSC database and screened for drugs with sensitivity correlated with CXorf67 expression (p <0.05, Pearson synergy > 0.1). 93 drugs were found, marked red in FIG. 1 a. After enrichment of the target pathway, the most DNA damage-associated drugs were found, such as camptothecin, etoposide, doxorubicin, bleomycin, etc. (FIG. 1b)

Example 2 CXorf67 is a DNA Damage responsive protein

To investigate whether CXorf67 plays a role in DNA damage repair. First we constructed a plasmid of pEGFP-CXorf67, transfected into U2OS cells and observed that CXorf67 protein recruited at the site of DNA damage using laser micro-injury (fig. 2 a). To further verify, chromatin separation experiments were followed to find that CXorf67 increased in chromatin content after 0.1 μ M treatment with CPT (fig. 2 b). Later discovered using immunofluorescence experiments: after treatment with IR or CPT, the formation of Foci was seen with CXorf67 in a fraction of the cells (fig. 2 c).

Example 3 CXorf67 inhibits DNA damage repair

Based on previous experiments and bioinformatic analyses, it was speculated that CXorf67 may be involved in DNA damage repair. Both IR and CPT can cause DNA double strand breaks and then cause rapid phosphorylation at position S139 of histone H2AX (in this case phosphorylated H2AX is referred to as γ -H2AX), with the signal of γ -H2AX gradually decreasing to local levels as DNA repairs. The cells were first IR stimulated with U2OS WT and KO cells and then collected at various time points for Western blot and immunofluorescence analysis of γ -H2 AX. In the WB experiment it was found that: there was no difference in the initial γ -H2AX 15min and 1H signals, but the γ -H2AX signal in KO cells declined more rapidly after 4H (FIG. 3 a). At the same time we found an increase in the duration of γ -H2AX levels in U2OS KO by retropleting CXorf67, suggesting a slowing of DNA damage repair (fig. 3 b). The initial 0.5H γ -H2AX was also found to be no difference in immunofluorescence experiments, but the signal dropped faster in 24H KO and WT as well as being reverted to this phenomenon by replenishing CXorf67 in KO cells (FIG. 3 c). To further determine, we performed comet electrophoresis experiments, also called single cell gel electrophoresis analysis, whose basic principle is undamaged cells, and the more complete the nuclear DNA, the no tailing in electrophoresis. After the cells are damaged, the DNA is broken to generate fragments, and migration is generated in electrophoresis to form a tail. Our experimental results show that at 0.5h after IR treatment there was no significant difference in the tailing produced by WT and KO, but at 4h we found that KO cells had a shorter tailing than WT (fig. 3 d). The results of these experiments above show that: CXorf67 may be a factor that inhibits DNA damage repair, and the ability of cells to repair DNA damage is increased following the deletion of CXorf 67.

Example 4 CXorf67 inhibits HR without affecting NHEJ

In previous experiments IR and CPT treatments were used, both forms of DNA damage mainly resulting in DNA double strand break damage. There are two main repair modes for double-strand breaks: one is homologous recombination repair (HR), which is a faultless repair, using homologous sister chromatids as templates for repair at S and G2; another repair is non-homologous end joining (NHEJ), which is a mismatch repair in which DNA ends can be directly joined using a ligase to create DNA insertion or deletion mutations.

To explore in which repair pathway CXorf67 plays a role, U2OS DR-GFP and EJ5-GFP reporter cell lines were used (Lou et al, 2017). The cleavage of plasmid I-SceI was introduced in both reporter lines and later used by flow analysis to indicate the efficiency of HR or NHEJ repair in the cells. Overexpression of CXorf67 in the cell line was found to inhibit HR only, without affecting NHEJ (fig. 4a and 4 b).

Example 5 CXorf67 affected Rad51 foci formation

One key protein in HR repair is Rad51, which can be recruited to the site of DNA damage repair through the BRCA1-PALB2-BRCA2 complex. The effect on HR can be judged by observing the DNA damage induced Rad51 foci. It was found that U2OS KO cells formed more Rad51 foci than WT under CPT treatment and this phenomenon could be reverted to CXorf67 transfection (fig. 5 a). Looking at RPA2 and BRCA1 upstream of Rad51, RPA2, BRCA1 foci were found to be unchanged (fig. 5b and 5 c). To verify whether the same phenomenon occurred in different cell lines, we performed the same experiment in Daoy cells later, and also found that KO increased Rad51 foci compared to WT in the case of CPT treatment (fig. 5 d). RPA2, BRCA1 foci did not change (fig. 5e and 5 f). These results indicate that CXorf67 may play a role between BRCA1 and Rad 51.

Example 6 CXorf67 binding to PALB2

According to the previous experimental results: CXorf67 affected Rad51 foci without affecting BRCA1 foci, presumably CXorf67 might play a role between the two. In Daoy cells IP CXorf67, PALB2, BRCA1 could be detected in immunoprecipitates, while RPA2 and Rad51 were not detected (fig. 6 a). In 293T cells transfected with CXorf67-HA, PALB2-Flag or BRCA1-Flag, immunoprecipitated CXorf67, it can be seen that CXorf67 binds predominantly to PALB2, but weakly to BRCA 1. In the presence of PALB2, CXorf67 bound more strongly to BRCA1, and it is likely that both bound indirectly via PALB2 (fig. 6 b). Later we used immunofluorescence to find that CXorf67 co-localized with PALB2 in the presence of non-invasive stimulation (fig. 6 c). We speculate that CXorf67 might play a role by binding PALB 2.

Example 7 CXorf67 binds to the WD40 domain of PALB2

In order to find the region of CXorf67 binding to PALB2, it was later divided into 3 fragments according to the known PALB2 domain (fig. 7 a). CXorf67 was found to bind predominantly to the WD40 domain of PALB2 by exogenous co-immunoprecipitation (fig. 7 b). To verify whether binding of CXorf67 to the WD40 domain was a direct interaction, we purified the full-length His-CXorf67 protein and the GST-WD40(853-1186aa) protein. It was found by GST pul l-down experiments that WD40 did interact directly with CXorf67 (FIG. 7 c).

Example 8 CXorf67 binding PALB2 by PALB2-binding motif

WD40 is known to be critical to the function of PALB2, and BRCA2 also binds primarily to WD40 of PALB2, thereby recruiting Rad 51. Very interestingly, by protein sequence alignment we found that CXorf67(420-432aa) has strong homology to PALB2-binding motif (26-38aa) of BRCA2 (FIG. 8 a). This small peptide of BRCA2 has been reported to bind to the WD40 domain of PALB2 and in which tryptophan at position 31 plays a critical role, with tryptophan at position 425 of CXorf 67. To verify that amino acids 420-432 of CXorf67 did bind directly to the WD40 domain, a biotin-labeled peptide fragment was synthesized. This small peptide was found to bind well to the WD40 domain in streptavidin pull-down experiments. However, the W425C mutant peptide fragment was not able to bind (FIG. 8 a). In the CO-IP experiments, it was also found that after mutating W425 of full-length CXorf67 to cysteine, binding of CXorf67 to PALB2 was reduced (fig. 8 b).

To examine whether there was any function of inhibiting HR after mutation of CXorf 67W 425, using the U2OS DR-GFP reporter system, it was found that HR inhibition was significantly reduced after transfection of W425C mutated CXorf67 (fig. 8 c). Meanwhile, we found that the ability of the W425 mutant to inhibit Rad51 foci was significantly reduced in the case of supplementing WT or W425C mutant in Daoy cells of CXorf67 KO and then adding CPT for stimulation (FIG. 8d)

Example 9 CXorf67 inhibits PALB2-BRCA2 binding

It is speculated that CXorf67 functions most likely to mimic the PALB2-binding motif of BRCA2, competing for binding to PALB2 to disrupt BRCA2-PALB2 binding. It was found by CO-IP experiments that the binding of PALB2 and BRCA2 decreased with increasing amount of CXorf67 transfected (FIG. 9 a). In addition, fluorescence co-localization experiments also found that in the case of CXorf67 transfection, the co-localization of PALB2 and BRCA2 was reduced (fig. 9b) to further verify our guess, a U2OS-LacO cell line was used. This cell line was generated by stably transferring LacO-containing plasmids into U2OS cells, and LacR-tagged proteins were able to bind to the LacO sequence (Wang et al, 2010), which allowed the co-localization of proteins to be observed at the single cell molecular level. The Myc-LacR-PALB2 plasmid was first constructed and after transfection into a cell line, it was observed to have specific co-localization at PALB2 by co-transformation with GFP-CXorf67 (FIG. 9 c). In order to verify the relationship among CXorf67, PALB2 and BRCA2, GFP-LacR-PALB2, Myc-BRCA2-N (1-200) and HA-CXorf67 plasmids were constructed. It was found that in the presence of CXorf67, the fluorescence signal enrichment of BRCA2 on PALB2 was reduced (fig. 9 d). The previous experimental results were further verified by this single-molecule level co-localization experiment: firstly, CXorf67 and PALB2 are combined with each other, and secondly, the combination of the CXorf67 and the PALB2 can inhibit the combination of BRCA2 and PALB 2.

Example 10 cancer cells with high expression of CXorf67 are more sensitive to PARP inhibitors

Cell survival experiments were performed in Daoy cells highly expressing CXorf67, comparing the differences in sensitivity of Daoy cells to PARP inhibitors for C67-WT and KO, and finding that Daoy cells lacking CXorf67 were less sensitive to inhibitors (fig. 10 a). Reversion of CXorf67 expression in KO cells significantly increased the sensitivity of the cells to PARP inhibitors (talazoparib and olaparib) compared to KO cells (10 b). Meanwhile, the constructed stable cell line is injected to 6-week BALB/c nude mice to construct a transplantation tumor model subcutaneously until the tumor grows to 100mm³Mice were gavaged with talazoparib (0.33mg/kg, 5 days/week), secondary tumor volumes were measured a week, and the experiment was terminated after 28 days. The experimental results found that transplanted tumors reverted to CXorf67 expression were more sensitive to the drug and tumor volume was significantly reduced after mouse treatment (fig. 10 c). Taken together, it can be found that Daoy cells highly expressing CXorf67 are very sensitive to PARP inhibitors. Then, is there the same phenomenon of overexpression of CXorf67 in tumor cells that do not express CXorf 67? Two human glioblastoma cells U251 and U87 were collected which did not express CXorf67 and we found that overexpression of CXorf67 in these two cells made the tumor cells more sensitive to PARP inhibitors (fig. 10 d).

Example 11 CXorf67 is highly expressed in PFA and causes accumulation of DNA damage

It was also confirmed by GEO data analysis that CXorf67 was indeed highly expressed in PFA (fig. 11a), and in cooperation with the subsidiary children hospital at the university of compound denier, 28 ependymomas samples (and numbered sequentially) cryopreserved at the hospital in 2013-2018 were collected, these tumor samples being from children, the average age of 3 years. CXorf67 expression was found in most tumor samples after Western blot analysis of the cryopreserved samples, and expression varied widely between samples. In addition, protein levels reflecting the DNA injury repair index γ -H2AX were also determined. Interestingly, there was a positive correlation between CXorf67 expression and γ -H2AX protein levels (R ═ 0.698, P ═ 0.0075), which also demonstrated our previous findings at the tissue level of ependymomas, that high expression of CXorf67 could inhibit DNA damage repair (fig. 11 b).

Example 12 high expression of CXorf67 ependymomas are more sensitive to PARP inhibitors

Samples of surgically excised fresh ependymomas were collected to establish several study systems. 5 samples of fresh ependymal membranes (4 ependymal tumor samples, PFA 1-4 and 1 medulloblastoma, MB-1) were collected, and the expression level of CXorf67 in the 5 tumor samples was examined, and it was found that CXorf67 was expressed more highly in PFA-1 and PFA-4 than in PFA-2 and PFA-3, and CXorf67 was not detected in MB-1 (FIG. 12 a). We performed primary cell culture and drug testing on PFA-1 and PFA-2 and found that PFA-1, which highly expresses CXorf67, is more sensitive to talazoparib drugs than PFA-2, which less expresses CXorf67 (12 b). Later it was found that the number of passages of primary cells was limited and that in vitro culture may have altered the original state of the tumor. Therefore, we constructed a human-Derived tumor Xenograft model (PDX) from later collected fresh tumor samples. Compared with a tumor cell line, the PDX model better reserves a tumor microenvironment, is closer to an original tumor in histopathological morphology and can be better evaluated by using a medicament. We implanted fresh tumor samples of PFA-3, PFA-4 and MB-1 subcutaneously in NOD-SCID mice, grown to first generation PDX over a period of 3-6 months, after which we removed PDX and digested it to single cells, and then 3X10⁶Injecting the cells into nude mice subcutaneously until the tumor grows to 50mm³At that time, mice were gavaged with talazoparib (0.33mg/kg, 5 days/week) while tumor volume was measured a week. At 1000mm³Survival curves were plotted for the death endpoints of mice and the experimental results showed that both the PFA-3 and PFA-4 dosed groups had an extended survival time compared to the non-dosed group, but the extended survival time of PFA-4 with high CXorf67 expression was more significant, whereas MB-1 without CXorf67 was dosed and dosed with MB-1 without CXorf67There was essentially no difference in survival time (fig. 12 c). It was also found that the tumor volume of mice in the PFA-4-administered group became significantly smaller (12 d). These results indicate that PARP inhibitors are also sensitive to ependymomas that highly express CXorf 67.

Example 13 expression of CXorf67 in other cancers

Further analysis of TCGA data revealed that CXorf67 was highly expressed in cancers such as renal clear cell carcinoma (KIRC) and renal papillary cell carcinoma (KIRP) (fig. 13 a). And survival analysis of KIRC and KIRP patients found that patients with high CXorf67 expression were worse after recovery (fig. 13 b). These results indicate that CXorf67 may play a role in the development of tumorigenesis as an oncogene.

Discussion of the related Art

CXorf67 was not expressed in the vast majority of tumor cell lines, but it was very interesting that CXorf67 was highly expressed specifically in the PFA subtype of ependymoma. PFA occurs mainly in the hindbrain region of children, and little progress has been made in its treatment modality in the past few tens. At present, surgical resection is mainly used, radiotherapy is used as assistance, and no consistent conclusion is reached on chemotherapy. The invention shows that CXorf67 with higher expression amount is more sensitive to the inhibitor of PAPR through Daoy cell line and established PFA patient-derived primary cells and PDX model. The above studies have shown that CXorf67 is a biomarker for guiding drug administration to patients with PFA. In addition, CXorf67 specific expression in PFA patients can also be used as an indicator of one molecular classification of ependymomas.

Reference to the literature

1.Lou,J.,Chen,H.,Han,J.,He,H.,Huen,M.S.Y.,Feng,X.H.,Liu,T.,and Huang,J.(2017).AUNIP/C1orf135 directs DNA double-strand breaks towards the homologous recombination repair pathway.Nat Commun 8,985.

2.Wang,F.,Dai,J.,Daum,J.R.,Niedzialkowska,E.,Banerjee,B.,Stukenberg,P.T.,Gorbsky,G.J.,and Higgins,J.M.(2010).Histone H3 Thr-3phosphorylation by Haspin positions Aurora B at centromeres in mitosis.Science 330,231-235.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> center of outstanding innovation in molecular cell science of Chinese academy of sciences

Application of <120> CXorf67 in judging sensitivity of tumor to DNA damage medicine

<130> P2020-0077

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 15

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 1

Gly Gly Pro Ile Pro Gln Gln Trp Asp Glu Ser Ser Ser Ser Ser

1 5 10 15

<210> 2

<211> 15

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 2

Gly Gly Pro Ile Pro Gln Gln Cys Asp Glu Ser Ser Ser Ser Ser

1 5 10 15

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

acggctcagg cggtgttgcg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

atcttgattc ccggtcccgc 20