Compound and composition for Intracellular delivery therapeutic agent
阅读说明：本技术 用于细胞内递送治疗剂的化合物和组合物 (Compound and composition for Intracellular delivery therapeutic agent ) 是由 K.E.贝内纳托 E.S.库马拉辛赫 M.科内比斯 于 2018-03-15 设计创作，主要内容包括：本公开的特征在于新型脂质和包含这些脂质的组合物。纳米粒子组合物包含新型脂质以及其它脂质,如磷脂、结构性脂质和PEG脂质。另外包含治疗剂和/或预防剂如RNA的纳米粒子组合物可用于将治疗剂和/或预防剂递送至哺乳动物细胞或器官,以例如调控多肽、蛋白质或基因表达。(The disclosure is characterized in that novel lipid and the composition comprising these lipids.Nanoparticle compositions include novel lipid and other lipids, such as phosphatide, structural lipid and PEG lipid.The nanoparticle compositions for additionally comprising therapeutic agent and/or prophylactic such as RNA can be used for therapeutic agent and/or prophylactic being delivered to mammalian cell or organ, for example to regulate and control polypeptide, protein or gene expression.)
1. a kind of formula (I) compound,
Or its N- oxide,
Or its salt or isomers, wherein
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R*OR " or R2 And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2(CH2)n-oQ、- CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring, heterocycle ,-OR ,-O (CH2)nN(R)2、-C(O)OR、- OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N (R)2、-N(R)C(S)N(R)2、N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (= CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N (OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (= NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o independently selected from 1,2,3 and 4, and Each n is independently selected from 1,2,3,4 and 5；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-,- C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl group and miscellaneous Aryl group, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbon Ring and heterocycle；
R10Selected from by H, C1-3Alkyl and C2-3The group of alkenyl composition；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13；And wherein work as R4It is-(CH2)nQ、-(CH2)nCHQR ,-CHQR or-CQ (R)2 When, then (i) when n is 1,2,3,4 or 5, Q is not-N (R)2；Or (ii), when n is 1 or 2, Q is not 5,6 or 7 circle heterocyclic ring alkane Base.
2. a kind of formula (III) compound,
Or its N- oxide,
Or its salt or isomers, wherein
Or its salt or isomers, wherein
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R*OR " or R2 And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2(CH2)n-oQ ,- CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring, heterocycle ,-OR ,-O (CH2)nN(R)2、-C(O)OR、- OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N (R)2、-N(R)C(S)N(R)2、N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (= CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N (OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (= NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o independently selected from 1,2,3 and 4, and Each n is independently selected from 1,2,3,4 and 5；
RxSelected from by C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2The group of composition,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-,- C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl group and miscellaneous Aryl group, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbon Ring and heterocycle；
R10Selected from by H, C1-3Alkyl and C2-3The group of alkenyl composition；
Each R is independently selected from by C1-3Alkyl, C2-3Alkenyl, (CH2)qThe group of OR* and H composition；
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13.
3. compound according to claim 2, wherein RxIt is methyl.
4. compound according to claim 2 or 3, wherein the compound also includes anion.
5. compound according to claim 3, wherein the anion be selected from chloride ion, bromide ion, iodide ion, fluorine from Son, acetate, formate, trifluoroacetic acid root, difluoroacetic acid root, trichloroacetic acid root and phosphate radical.
6. compound according to any one of the preceding claims, wherein at least one of M and M ' they are-OC (O)-M "-C (O)O-。
7. compound according to any one of the preceding claims, wherein at least one of M and M ' are-OC (O)-.
8. compound according to any one of the preceding claims, wherein M is-OC (O)-and M ' is-C (O) O-.
9. compound according to any one of the preceding claims, wherein M is-C (O) O- and M ' is-OC (O)-.
10. compound according to any one of the preceding claims, wherein M and M ' is individually-OC (O)-.
11. compound according to any one of the preceding claims, wherein M and M ' is individually-C (O) O-.
12. compound according to any one of the preceding claims, wherein the compound has formula (IA):
Or its N- oxide or its salt or isomers, wherein
L is selected from 1,2,3,4 and 5；
M is selected from 5,6,7,8 and 9；
M1It is key or M '；
R4It is hydrogen, unsubstituted C1-3Alkyl ,-(CH2)oC(R10)2(CH2)n-oQ, or-(CH2)nQ, wherein Q is OH ,-NHC (S) N(R)2、-NHC(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)R8、-N(R)S(O)2R8,-NHC (=NR9)N (R)2,-NHC (=CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C (O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2、 Heteroaryl or Heterocyclylalkyl；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl group and heteroaryl groups；And
R2And R3Independently selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.
13. compound according to claim 1, wherein the compound has formula (IB):
Or its N- oxide,
Or its salt or isomers.
14. compound according to any one of the preceding claims, wherein m is 5,7 or 9.
15. compound according to any one of the preceding claims, wherein the compound has formula (II):
Or its N- oxide or its salt or isomers, wherein
L is selected from 1,2,3,4 and 5；
M1It is key or M '；
R4It is hydrogen, unsubstituted C1-3Alkyl ,-(CH2)oC(R10)2(CH2)n-oQ or-(CH2)nQ, wherein n is 2,3 or 4 and Q It is OH ,-NHC (S) N (R)2、-NHC(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、N(R)R8、-N(R)S(O)2R8、-NHC (=NR9)N(R)2,-NHC (=CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (= CHR9)N(R)2, heteroaryl or Heterocyclylalkyl；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl group and heteroaryl groups；And
R2And R3Independently selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.
16. compound according to any one of the preceding claims, wherein R4It is hydrogen.
17. compound according to any one of the preceding claims, wherein R4It is not hydrogen.
18. compound according to any one of the preceding claims, wherein Q is OH ,-NHC (S) N (R)2、-NHC(O)N (R)2,-N (R) C (O) R or-N (R) S (O)2R。
19. compound according to any one of the preceding claims, wherein Q is-N (R) R8,-NHC (=NR9)N(R)2、- NHC (=CHR9)N(R)2、-OC(O)N(R)2Or-N (R) C (O) OR.
20. compound according to any one of the preceding claims, wherein Q is-N (OR) C (O) R ,-N (OR) S (O)2R、-N (OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2Or-N (OR) C (=CHR9) N(R)2。
21. compound according to any one of the preceding claims, wherein Q is-N (R) C (O) R, wherein R is optional quilt C1-3The C that alkoxy replaces1-3Alkyl or S (O)tC1-3Alkyl, wherein t is 0,1 or 2.
22. compound according to any one of the preceding claims, wherein Q is heteroaryl.
23. compound according to any one of the preceding claims, wherein Q is Heterocyclylalkyl and n is 3,4 or 5.
24. compound according to any one of the preceding claims, wherein R is by one or more selected from by C1-3Alcoxyl Base, amino and C1-C3The C that the substituent group of the group of dialkyl amido composition replaces1-6Alkyl.
25. compound according to any one of the preceding claims, wherein R8It is 4 yuan of carbocyclic rings.
26. compound according to any one of the preceding claims, wherein R8It is 4 yuan of carbocyclic rings.
27. compound according to any one of the preceding claims, wherein R8It is 4 yuan of carbocyclic rings, wherein the carbocyclic ring is by one Or multiple substituent groups selected from the group being made up of replace: oxo, thio, amino, C1-C3Alkyl amino, C1-C3Dialkyl group Amino, C1-C3Alkoxyalkylamino, C1-C3Dialkoxyalkyl amino, C1-C3Alkoxyalkyl and 5 or 6 membered heterocycloalkyls.
28. compound according to any one of the preceding claims, wherein M1It is M '.
29. compound according to any one of the preceding claims, wherein M and M ' is independently-C (O) O- or-OC (O)-。
30. compound according to any one of the preceding claims, wherein at least one of M and M ' are-S-S-.
31. compound according to any one of the preceding claims, wherein M's and M ' first is that-S-S-, and another It is-C (O) O- or-OC (O)-.
32. compound according to any one of the preceding claims, wherein l is 1,3 or 5.
33. compound according to any one of the preceding claims, wherein R4It is unsubstituted methyl or-(CH2)nQ, Wherein Q is OH ,-NHC (S) N (CH3)2Or-NHC (O) N (CH3)2。
34. compound according to any one of the preceding claims, wherein M1It is not present.
35. compound according to any one of the preceding claims, wherein R ' is C1-18Alkyl, C2-18Alkenyl ,-R*YR " Or-YR ".
36. compound according to any one of the preceding claims, wherein R2And R3It is independently C3-14Alkyl or C3-14Alkene Base.
37. compound according to any one of the preceding claims, wherein R1Selected from by C5-20Alkyl and C5-20Alkenyl composition Group.
38. compound according to any one of the preceding claims, wherein R1Selected from by-R*YR " ,-YR " and-R " M ' R ' group At group.
39. compound according to any one of the preceding claims, wherein R1It is C5-20Alkyl.
40. compound according to any one of the preceding claims, wherein R1It is C6Alkyl, C8Alkyl, C9Alkyl, C14Alkane Base or C18Alkyl.
41. compound according to any one of the preceding claims, wherein R1It is C5-20Alkenyl.
42. compound according to any one of the preceding claims, wherein R1It is C18Alkenyl.
43. compound according to any one of the preceding claims, wherein R1It is sub- oil base.
44. compound according to any one of the preceding claims, wherein R1It is-R " M ' R '.
45. compound according to any one of the preceding claims, wherein R1Different from-(CHR5R6)m–M–CR2R3R7。
46. compound according to any one of the preceding claims, wherein R ' is selected from-R*YR " and-YR ".
47. compound according to any one of the preceding claims, wherein Y is cyclopropyl group.
48. compound according to any one of the preceding claims, wherein being C adjacent to the R " of Y1Alkyl.
49. compound according to any one of the preceding claims, wherein R ' is selected from C4Alkyl, C4Alkenyl, C5Alkyl, C5Alkene Base, C6Alkyl, C6Alkenyl, C7Alkyl, C7Alkenyl, C9Alkyl, C9Alkenyl, C11Alkyl, C11Alkenyl, C17Alkyl, C17Alkenyl, C18Alkane Base and C18Alkenyl is individually straight chain or branch.
50. compound according to any one of the preceding claims, wherein R " is C3Alkyl.
51. compound according to any one of the preceding claims, wherein R " is C5Alkyl.
52. compound according to any one of the preceding claims, wherein R " is C7Alkyl.
53. compound according to any one of the preceding claims, wherein R1It is the C being optionally substituted by a hydroxyl group5-20Alkyl.
54. compound according to any one of the preceding claims, wherein M ' is-C (O) O- ,-OC (O)-or-OC (O)- M "-C (O) O-, wherein M " is C1-4Alkyl or C2-4Alkenyl.
55. compound according to any one of the preceding claims, wherein M ' is aryl group or heteroaryl groups.
56. compound according to any one of the preceding claims, wherein M ' selects free phenyl, oxazole and thiazole composition Group.
57. compound according to any one of the preceding claims, wherein R1Selected from-R*YR " and-YR ".
58. compound according to any one of the preceding claims, wherein Y is cyclopropyl group.
59. compound according to any one of the preceding claims, wherein R* is C8Alkyl.
60. compound according to any one of the preceding claims, wherein R* is by one or more selected from by amino, C1- C6Alkyl amino and C1-C6The C that the substituent group of the group of dialkyl amido composition replaces1-12Alkyl.
61. compound according to any one of the preceding claims, wherein R " is C3-12Alkyl.
62. compound according to any one of the preceding claims, wherein R " is C8Alkyl
63. compound according to any one of the preceding claims, wherein each R5It is H.
64. compound according to any one of the preceding claims, wherein at least one R5It is hydroxyl.
65. compound according to any one of the preceding claims, wherein each R6It is H.
66. compound according to any one of the preceding claims, wherein at least one R6It is hydroxyl.
67. compound according to any one of the preceding claims, wherein R2And R3Independently selected from what is be made up of Group: C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R*OR " or R2And R3The atom connected together with it is formed together miscellaneous Ring or carbocyclic ring.
68. compound according to any one of the preceding claims, wherein R2With R3It is identical.
69. compound according to any one of the preceding claims, wherein R2And R3It is C8Alkyl.
70. compound according to any one of the preceding claims, wherein R2And R3It is C2Alkyl.
71. compound according to any one of the preceding claims, wherein R2And R3It is C3Alkyl.
72. compound according to any one of the preceding claims, wherein R2And R3It is C4Alkyl.
73. compound according to any one of the preceding claims, wherein R2And R3It is C5Alkyl.
74. compound according to any one of the preceding claims, wherein R2And R3It is C6Alkyl.
75. compound according to any one of the preceding claims, wherein R2And R3It is C7Alkyl.
76. compound according to any one of the preceding claims, wherein R2With R3It is different.
77. compound according to any one of the preceding claims, wherein R2It is C8Alkyl.
78. compound according to any one of the preceding claims, wherein R3It is C1Alkyl.
79. compound according to any one of the preceding claims, wherein R3It is C2Alkyl.
80. compound according to any one of the preceding claims, wherein R3It is C3Alkyl.
81. compound according to any one of the preceding claims, wherein R3It is C4Alkyl.
82. compound according to any one of the preceding claims, wherein R3It is C5Alkyl.
83. compound according to any one of the preceding claims, wherein R3It is C6Alkyl.
84. compound according to any one of the preceding claims, wherein R3It is C7Alkyl.
85. compound according to any one of the preceding claims, wherein R3It is C9Alkyl.
86. compound according to any one of the preceding claims, wherein R2And R3The atom shape connected together with it At heterocycle.
87. compound according to any one of the preceding claims, wherein R2And R3The atom shape connected together with it At carbocyclic ring.
88. compound according to any one of the preceding claims, wherein the carbocyclic ring is C6Carbocyclic ring.
89. compound according to any one of the preceding claims, wherein the carbocyclic ring is phenyl group.
90. compound according to any one of the preceding claims, wherein the carbocyclic ring is cyclohexyl groups.
91. compound according to any one of the preceding claims, wherein by R2And R3The atom connected together with it The heterocycle or carbocyclic ring of formation are optionally substituted with one or more alkyl groups.
92. compound according to any one of the preceding claims, wherein M is-C (O) O-.
93. compound according to any one of the preceding claims, wherein M is-OC (O)-.
94. compound according to any one of the preceding claims, wherein M is-OC (O)-M "-C (O) O-, wherein M " be C1-6Alkyl or C2-6Alkenyl.
95. compound according to any one of the preceding claims, wherein M is-OC (O)-M "-C (O) O-, wherein M " be C1-4Alkyl or C2-4Alkenyl.
96. compound according to any one of the preceding claims, wherein M is aryl group or heteroaryl groups.
97. compound according to any one of the preceding claims, wherein M selects free phenyl, oxazole and thiazole composition Group.
98. compound according to any one of the preceding claims, wherein m is 5.
99. compound according to any one of the preceding claims, wherein m is 7.
100. compound according to any one of the preceding claims, wherein m is 9.
101. compound according to any one of the preceding claims, wherein R4It is unsubstituted C1-4Alkyl.
102. compound according to any one of the preceding claims, wherein R4It is unsubstituted methyl.
103. compound according to any one of the preceding claims, wherein R4Selected from the group being made up of: C3-6Carbon Ring ,-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6There is carbocyclic ring one or more to be selected from N, O, S With heteroatomic 5 to 14 yuan of aromatic series or non-aromatic heterocyclic ,-OR, the-O (CH of P2)nN(R)2,-C (O) OR ,-OC (O) R ,- CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)S(O)2R8、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C (O)N(R)2、-N(R)C(S)N(R)2With-C (R) N (R)2C (O) OR, and each n is independently selected from 1,2,3,4 and 5.
104. compound according to any one of the preceding claims, wherein R4Selected from the group being made up of: C3-6Carbon Ring ,-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6Carbocyclic ring, have it is one or more selected from N, O and Heteroatomic 5 to 14 unit's heteroaryl of S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、- CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)S(O)2R8、-N(R)C(O)N(R)2、-N(R)C(S)N (R)2、-C(R)N(R)2C (O) OR and heteroatomic 5 to 14 membered heterocycloalkyls that N, O and S are selected from one or more, By one or more selected from oxo (=O), OH, amino and C1-3The substituent group of alkyl replaces, and each n is independently selected from 1,2, 3,4 and 5.
105. compound according to any one of the preceding claims, wherein R4Selected from the group being made up of: C3-6Carbon Ring ,-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6Carbocyclic ring, have it is one or more selected from N, O and Heteroatomic 5 to 14 circle heterocyclic ring of S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、- C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)S(O)2R8、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-C (R)N(R)2C (O) OR, and each n is independently selected from 1,2,3,4 and 5；And when Q is 5 to 14 circle heterocyclic rings and (i) R4Be- (CH2)nQ, wherein n is 1 or 2, or (ii) R4It is-(CH2)nCHQR, wherein n is 1, or (iii) R4It is-CHQR and-CQ (R)2When, Then Q is 5 to 14 unit's heteroaryls or 8 to 14 membered heterocycloalkyls.
106. compound according to any one of the preceding claims, wherein R4Selected from the group being made up of: C3-6Carbon Ring ,-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6Carbocyclic ring, have it is one or more selected from N, O and Heteroatomic 5 to 14 unit's heteroaryl of S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、- CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)S(O)2R8、-N(R)C(O)N(R)2、-N(R)C(S)N (R)2、-C(R)N(R)2C (O) OR, and each n is independently selected from 1,2,3,4 and 5.
107. compound according to any one of the preceding claims, wherein R4Selected from-(CH2)nQ and-(CH2)nCHQR。
108. compound according to any one of the preceding claims, wherein Q is-OR.
109. compound according to any one of the preceding claims, wherein Q is-OH.
110. compound according to any one of the preceding claims, wherein Q is-O (CH2)nN(R)2。
111. compound according to any one of the preceding claims, wherein Q is-OC (O) R.
112. compound according to any one of the preceding claims, wherein Q is-CX3。
113. compound according to any one of the preceding claims, wherein Q is-CN.
114. compound according to any one of the preceding claims, wherein Q is-N (R) C (O) R or-N (R) S (O)2R。
115. compound according to any one of the preceding claims, wherein Q is-N (H) C (O) R or-N (H) S (O)2R。
116. compound according to any one of the preceding claims, wherein Q is-N (R) C (O) N (R)2。
117. compound according to any one of the preceding claims, wherein Q is-N (H) C (O) N (R)2。
118. compound according to any one of the preceding claims, wherein Q is-N (H) C (O) N (H) (R).
119. compound according to any one of the preceding claims, wherein Q is-N (R) C (S) N (R)2。
120. compound according to any one of the preceding claims, wherein Q is-N (H) C (S) N (R)2。
121. compound according to any one of the preceding claims, wherein Q is-N (H) C (S) N (H) (R).
122. compound according to any one of the preceding claims, wherein Q is-C (R) N (R)2C(O)OR。
123. compound according to any one of the preceding claims, wherein Q is-N (R) S (O)2R8。
124. compound according to any one of the preceding claims, wherein Q is-NHR8, wherein R8It is C3-6Naphthenic base, Optionally replaced by one or more from the following substituent group: oxo (=O), amino (NH2), monoalkyl or dialkyl amido, C1-3Alkyl and halogenated.
125. compound according to any one of the preceding claims, wherein Q is-NHC (=NR9)N(R)2, wherein R9It is CN、C1-6Alkyl or H.
126. compound according to any one of the preceding claims, wherein Q is-NHC (=CHR9)N(R)2, wherein R9It is NO2、C1-6Alkyl or H.
127. compound according to any one of the preceding claims, wherein Q is-OC (O) N (R)2Or-N (R) C (O) OR.
128. compound according to any one of the preceding claims, wherein Q is selected from by triazole, imidazoles, pyrimidine and purine The group of composition.
129. compound according to any one of the preceding claims, wherein Q be containing at least one nitrogen ring atom 5 or 6 membered heterocycloalkyls and optionally replaced by one or more from the following substituent group: oxo (=O), amino (NH2), single alkane Base or dialkyl amido, halogenated and C1-3Alkyl.
130. compound according to any one of the preceding claims, wherein n is 1.
131. compound according to any one of the preceding claims, wherein n is 2.
132. compound according to any one of the preceding claims, wherein n is 3.
133. compound according to any one of the preceding claims, wherein n is 4.
134. compound according to any one of the preceding claims, wherein R7It is H.
135. compound according to any one of the preceding claims, wherein R7Selected from C1-3Alkyl.
136. compound according to any one of the preceding claims, wherein R3And R7It is H.
137. compound according to any one of the preceding claims, wherein R2It is H.
138. compound according to any one of the preceding claims, R existing for wherein at least one5And R6It is methyl.
139. compound according to any one of the preceding claims, wherein the compound select free compound 1-8 and 31 and its salt and isomers composition group.
140. compound according to any one of the preceding claims, wherein the compound is selected from and to be made up of Group: compound 9-30,32-36 and 47-61 and its salt and isomers.
141. compounds according to any one of the preceding claims are made up of wherein the compound is selected from Group: compound 65-75,79-81,94,101,103,108-116 and 118-135 and its salt and isomers.
142. compounds according to any one of the preceding claims, wherein the compound is selected from compound 136-232 And its salt and isomers.
143. compounds according to any one of the preceding claims, wherein the compound be selected from compound 233-235, 236,238-244,246-252,254,259-261 and 263-280 and its salt and isomers.
144. compounds according to any one of the preceding claims, wherein the compound is selected from compound 256 and 257 And its salt and isomers.
145. compounds according to any one of the preceding claims, wherein the compound is selected from compound 281-339 And its salt and isomers.
146. compounds according to any one of the preceding claims, wherein the compound has formula (IIa),
Or its N- oxide or its salt or isomery Body.
147. compounds according to any one of the preceding claims, wherein the compound has formula (IIb),
Or its N- oxide or its salt or isomers.
148. compounds according to any one of the preceding claims, wherein the compound have formula (IIc) or (IIe),
Or its N- oxide or its salt or isomers.
149. compounds according to any one of the preceding claims, wherein R4Selected from-(CH2)nQ and-(CH2)nCHQR。
150. compounds according to any one of the preceding claims, wherein Q is selected from the group being made up of :-OR ,- OH、-O(CH2)nN(R)2、-OC(O)R、-CX3、-CN、-N(R)C(O)R、-N(H)C(O)R、-N(R)S(O)2R、-N(H)S(O)2R、-N(R)C(O)N(R)2、-N(H)C(O)N(R)2、-N(H)C(O)N(H)(R)、-N(R)C(S)N(R)2、-N(H)C(S)N (R)2、-N(H)C(S)N(H)(R)、-N(R)S(O)2R8And heterocycle.
151. compounds according to any one of the preceding claims, wherein n is 1,2 or 3.
152. compounds according to any one of the preceding claims, wherein the compound has formula (IId),
Or its N- oxide or its salt or isomers,
Wherein R2And R3Independently selected from by C5-14Alkyl and C5-14The group of alkenyl composition, and n is selected from 2,3 and 4.
153. compounds according to any one of the preceding claims, wherein the compound has formula (IIf),
Or its N- oxide or its salt or isomers,
It is C that wherein M, which is-C (O) O- or-OC (O)-, M ",1-6Alkyl or C2-6Alkenyl, R2And R3Independently selected from by C5-14Alkyl and C5-14The group and n of alkenyl composition are selected from 2,3 and 4.
154. compounds 1 according to claim, wherein the compound has formula (IIg):
Or its N- oxide or its salt or isomers, wherein
L is selected from 1,2,3,4 and 5；
M is selected from 5,6,7,8 and 9；
M1It is key or M '；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl group and heteroaryl groups；
And R2And R3Independently selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.
155. compounds according to any one of the preceding claims, wherein R2It is C8Alkyl.
156. compounds according to any one of the preceding claims, wherein R3It is C5Alkyl, C6Alkyl or C7Alkyl.
157. compounds according to any one of the preceding claims, wherein R3It is C8Alkyl.
158. compounds according to any one of the preceding claims, wherein R3It is C9Alkyl.
159. compounds according to any one of the preceding claims, wherein m is 5.
160. compounds according to any one of the preceding claims, wherein m is 7.
161. compounds according to any one of the preceding claims, wherein m is 9.
162. compounds according to any one of the preceding claims, wherein each R5It is H.
163. compounds according to any one of the preceding claims, wherein each R6It is H.
164. any one of according to claim 1 described in compound, wherein the compound is compound 18:
A kind of 165. nanoparticle compositions, it includes the lipids containing compound according to any one of the preceding claims Component.
166. nanoparticle compositions described in 65 according to claim 1, wherein the lipid composition also includes phosphatide.
167. nanoparticle compositions according to any one of the preceding claims, wherein the phosphatide is selected from by with the following group At group: bis- sub-oleoyl-sn- glycerol-3-phosphocholine (DLPC) of 1,2-, bis- myristoyl-sn- glycerol-3-phosphate of 1,2- Choline (DMPC), 1,2- dioleoyl-sn- glycerol-3-phosphocholine (DOPC), bis- palmityl-sn- glycerol -3- phosphorus of 1,2- Sour choline (DPPC), 1,2- distearyl acyl group-sn- glycerol-3-phosphocholine (DSPC), the bis- hendecyl-sn- of 1,2- are sweet Oil-phosphocholine (DUPC), 1- palmityl -2- oleoyl-sn- glycerol-3-phosphocholine (POPC), bis--O- 18 of 1,2- Carbene base-sn- glycerol-3-phosphocholine (18:0 Diether PC), half succinyl group-sn- of 1- oleoyl -2- cholesteryl Glycerol-3-phosphocholine (OChemsPC), 1- cetyl-sn- glycerol-3-phosphocholine (C16 Lyso PC), 1,2- bis- are sub- Numb acyl group-sn- glycerol-3-phosphocholine, bis- arachidonic acyl group-sn- glycerol-3-phosphocholine of 1,2-, 1,2- bis- 22 Six enoyl--sn- glycerol-3-phosphocholine of carbon, 1,2- dioleoyl-sn- glycerol-3-phosphate ethanol amine (DOPE), 1,2- bis- Phytane acyl group-sn- glycerol-3-phosphate ethanol amine (16.0 PE of ME), 1,2- distearyl acyl group-sn- glycerol-3-phosphate ethyl alcohol Amine, bis- sub-oleoyl-sn- glycerol-3-phosphate ethanol amine of 1,2-, bis- linolenyl-sn- glycerol-3-phosphate ethanol amine of 1,2-, 1, Bis- arachidonic acyl group-sn- glycerol-3-phosphate ethanol amine of 2-, the bis- two dodecahexaenes acyl group-sn- glycerol-3-phosphate second of 1,2- Hydramine, 1,2- dioleoyl-sn- glycerol-3-phosphate-rac- (1- glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidyl-ethanolamine (POPE), distearyl acyl group-phosphatidyl-ethanol amine (DSPE), two palms Acylphosphatidyl ethanolamine (DPPE), two myristoyl phosphoethanolamines (DMPE), 1- stearyl -2- oleoyl-tristearin Acyl ethanol amine (SOPE), 1- stearyl -2- oleoyl-phosphatidyl choline (SOPC), sphingomyelins, phosphatidyl choline, phosphatidyl Ethanol amine, phosphatidylserine, phosphatidylinositols, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, hemolytic phosphatidyl gallbladder Alkali, lysophosphatidyl ethanolamine (LPE) and its mixture.
168. nanoparticle compositions according to any one of the preceding claims, wherein the phosphatide is DOPE.
169. nanoparticle compositions according to any one of the preceding claims, wherein the phosphatide is DSPC.
170. nanoparticle compositions according to any one of the preceding claims, wherein the phospholipid fraction also includes knot Structure lipid.
171. nanoparticle compositions according to any one of the preceding claims, wherein the structural lipid be selected from by Group consisting of: cholesterol, stercorin, sitosterol, ergosterol, campesterol, stigmasterol, vegetable seed sterol, tomatidine, bear Tartaric acid, alpha-tocopherol and its mixture.
172. nanoparticle compositions according to any one of the preceding claims, wherein the structural lipid is that gallbladder is solid Alcohol.
173. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition also includes PEG lipid.
174. nanoparticle compositions according to any one of the preceding claims, wherein the PEG lipid be selected from by with The group of lower composition: ceramide, the PEG of phosphatidyl-ethanolamine, the PEG of PEG modification modified phosphatidic acid, PEG modification are modified Dialkylamine, the diacylglycerol of PEG modification, PEG modified dialkyl glycerol and its mixture.
175. nanoparticle compositions according to any one of the preceding claims, wherein the PEG lipid includes size It is peg moiety of the about 1000Da to about 20kDa.
176. nanoparticle compositions according to any one of the preceding claims, wherein the PEG lipid is selected from
Wherein p is 1 to 40.
177. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition also includes sun Ionic and/or ionizable lipid, selected from the group being made up of: 3- (double dodecylaminos)-N1, N1,4- tri--ten Dialkyl group -1- piperazine ethanamine (KL10), N1- [2- (double dodecylaminos) ethyl]-N1, N4, tri--dodecyl of N4- -1,4- Piperazine diethylamine (KL22),-three octadecane (KL25) of four azepine of 14,25- double tridecyl -15,18,21,24-, 1,2- bis- are sub- Oil base oxygroup-N, N- dimethylaminopropanecompounds (DLin-DMA), bis- Asia oil base -4- dimethylaminomethyl-[1,3]-two of 2,2- Tetrahydrofuran (DLin-K-DMA), 37 carbon -6,9,28,31- tetraene -19- base ester of 4- (dimethylamino) butyric acid (DLin-MC3-DMA), bis- Asia oil base -4- (2- dimethyl aminoethyl) of 2,2--[1,3]-dioxolane (DLin-KC2- DMA), oily oxygroup-N, the N- dimethylaminopropanecompounds (DODMA) of 1,2- bis-, ({ 8- [solid -5- alkene -3- base oxygroup of (3 β)-gallbladder] is pungent by 2- Base } oxygroup)-N, N- dimethyl -3- [(9Z, 12Z)-Linolenic Acid, 12- diene -1- base oxygroup] propyl- 1- amine (Octyl- CLinDMA), (2R) -2- ({ 8- [solid -5- alkene -3- base oxygroup of (3 β)-gallbladder] octyl } oxygroup)-N, N- dimethyl -3- [(9Z, 12Z)-Linolenic Acid, 12- diene -1- base oxygroup] propyl- 1- amine (Octyl-CLinDMA (2R)) and (2S) -2- ({ 8- [(3 Solid -5- alkene -3- base the oxygroup of β)-gallbladder] octyl } oxygroup)-N, N- dimethyl -3- [(9Z, 12Z)-Linolenic Acid, 12- diene -1- base Oxygroup] propyl- 1- amine (Octyl-CLinDMA (2S)).
178. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition also includes phosphorus Rouge, structural lipid and PEG lipid.
179. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition includes about Compound described in 30mol% to about 60mol%, about 0mol% are to about 30mol% phosphatide, about 18.5mol% to about 48.5mol% Structural lipid and about 0mol% are to about 10mol%PEG lipid.
180. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition includes about Compound described in 50mol%, about 10mol% phosphatide, about 38.5mol% structural lipid and about 1.5mol%PEG lipid.
181. nanoparticle compositions according to any one of the preceding claims also include therapeutic agent and/or prevention Agent.
182. nanoparticle compositions according to any one of the preceding claims, wherein the therapeutic agent and/or prevention Agent is the vaccine or compound that can cause immune response.
183. nanoparticle compositions according to any one of the preceding claims, wherein the therapeutic agent and/or prevention Agent is nucleic acid.
184. nanoparticle compositions according to any one of the preceding claims, wherein the therapeutic agent and/or prevention Agent is ribonucleic acid (RNA).
185. nanoparticle compositions according to any one of the preceding claims, wherein the RNA is selected from by with the following group At group: siRNA (siRNA), asymmetric aiRNA (aiRNA), microRNA (miRNA), Dicer- substrate RNA (dsRNA), children purpura nephritis (shRNA), mRNA (mRNA) and its mixture.
186. nanoparticle compositions according to any one of the preceding claims, wherein the RNA is mRNA.
187. nanoparticle compositions according to any one of the preceding claims, wherein the mRNA includes following one kind It is or a variety of: stem ring, chain termination nucleosides, polyadenylic acid sequence, polyadenylation signal and/or 5 ' cap structures.
188. nanoparticle compositions according to any one of the preceding claims, wherein the therapeutic agent and/or prevention The encapsulation efficiency of agent is at least 50%.
189. nanoparticle compositions according to any one of the preceding claims, wherein the therapeutic agent and/or prevention The encapsulation efficiency of agent is at least 80%.
190. nanoparticle compositions according to any one of the preceding claims, wherein the therapeutic agent and/or prevention The encapsulation efficiency of agent is at least 90%.
191. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition is controlled with described The wt/wt ratio for treating agent and/or prophylactic is about 10:1 to about 60:1.
192. nanoparticle compositions according to any one of the preceding claims, wherein the lipid composition is controlled with described The wt/wt ratio for treating agent and/or prophylactic is about 20:1.
193. nanoparticle compositions according to any one of the preceding claims, wherein the N:P ratio be about 2:1 extremely About 30:1.
194. nanoparticle compositions according to any one of the preceding claims, wherein the N:P ratio is about 5.67: 1。
195. nanoparticle compositions according to any one of the preceding claims, wherein the nanoparticle compositions Mean size is about 70nm to about 100nm.
196. nanoparticle compositions according to any one of the preceding claims, wherein the nanoparticle compositions Polydispersity index is about 0.10 to about 0.20.
197. nanoparticle compositions according to any one of the preceding claims, wherein the nanoparticle compositions Zeta potential is about -10mV to about+20mV.
198. nanoparticle compositions according to any one of the preceding claims, wherein the surface of the nanoparticle PKa is about 6.6.
199. nanoparticle compositions according to any one of the preceding claims, wherein the inner body of the nanoparticle is escaped Efficiency of escaping is about 15%.
A kind of 200. pharmaceutical compositions, it includes nanoparticle compositions according to any one of the preceding claims and medicines Acceptable carrier on.
A kind of 201. methods that therapeutic agent and/or prophylactic are delivered to mammalian cell, the method includes to subject Apply nanoparticle compositions according to any one of the preceding claims, the application include make the cell with it is described Nanoparticle compositions contact, is thus delivered to the cell for the therapeutic agent and/or prophylactic.
202. method according to any of the preceding claims, wherein the mammalian cell is in mammalian body It is interior.
203. method according to any of the preceding claims, wherein the mammal is people.
204. method according to any of the preceding claims, wherein the nanoparticle compositions are through intravenous, flesh Meat is interior, intradermal, subcutaneous, intranasal or pass through sucking application.
205. method according to any of the preceding claims, wherein by about 0.01mg/kg to about 10mg/kg dosage The therapeutic agent and/or prophylactic are administered to the mammal.
A kind of 206. methods for generating polypeptide of interest in mammalian cells, the method includes making the cell and basis The contact of nanoparticle compositions described in any one of preceding claims, wherein the therapeutic agent and/or prophylactic are mRNA, And wherein the mRNA encodes the polypeptide of interest, thus the mRNA can be translated in the cell to generate the institute Pay close attention to polypeptide.
207. method according to any of the preceding claims, wherein the mammalian cell is in mammalian body It is interior.
208. method according to any of the preceding claims, wherein the mammal is people.
209. method according to any of the preceding claims, wherein the nanoparticle compositions are through intravenous, flesh Meat is interior, intradermal, subcutaneous, intranasal or pass through sucking application.
210. method according to any of the preceding claims, wherein will about 0.001mg/kg to about 10mg/kg dosage The mRNA be administered to the mammal.
The method of a kind of 211. diseases for treating mammal in need or illness, the method includes applying to the mammal With the nanoparticle compositions according to any one of the preceding claims of therapeutically effective amount.
212. nanoparticle compositions according to any one of the preceding claims, are used to treat mammal in need Disease or illness.
213. nanoparticle compositions according to any one of the preceding claims are used as dynamic for treating lactation in need The disease of object or the medicament of illness.
214. nanoparticle compositions according to any one of the preceding claims are in manufacture for treating lactation in need Purposes in the disease of animal or the medicament of illness.
215. method, purposes or the nanoparticle compositions used according to any one of preceding claims, wherein described Disease or illness are characterized by malfunction or the protein or polypeptide active of exception.
216. method, purposes or the nanoparticle compositions used according to any one of preceding claims, wherein described Disease or illness are selected from the group being made up of: infectious diseases, cancer and proliferative disease, genetic disease, autoimmunity Property disease, diabetes, neurodegenerative disorders, angiocarpy and renal vascular diseases and metabolic disease.
217. method, purposes or the nanoparticle compositions used according to any one of preceding claims, wherein described Mammal is people.
218. method, purposes or the nanoparticle compositions used according to any one of preceding claims, wherein described Nanoparticle compositions are through intravenous, intramuscular, intradermal, subcutaneous, intranasal or applied by sucking.
219. method, purposes or the nanoparticle compositions used according to any one of preceding claims, wherein described Nanoparticle compositions are subcutaneous administrations.
220. method, purposes or the nanoparticle compositions used according to any one of preceding claims, wherein will about The therapeutic agent and/or prophylactic of 0.001mg/kg to about 10mg/kg dosage are administered to the mammal or in which described Medicament includes the therapeutic agent and/or prophylactic of 0.001mg/kg to about 10mg/kg.
A kind of 221. methods by therapeutic agent and/or prophylactic specific delivery to mammalian organs, the method includes to Mammal applies nanoparticle compositions according to any one of the preceding claims, and the application includes making the food in one's mouth Newborn animal organ contacts with the nanoparticle compositions, and the therapeutic agent and/or prophylactic are thus delivered to the organ.
222. method according to any of the preceding claims, wherein the mammal is people.
223. method according to any of the preceding claims, wherein the nanoparticle compositions are through intravenous, flesh Meat is interior, intradermal, subcutaneous, intranasal or pass through sucking application.
224. method according to any of the preceding claims, wherein will about 0.001mg/kg to about 10mg/kg dosage The therapeutic agent and/or prophylactic be administered to the mammal.
225. method according to any of the preceding claims further include using before the contact or step of applying Mammal described in one or more other compound pretreatments, wherein pretreatment includes by one or more other chemical combination Object is administered to the mammal.
226. method according to any of the preceding claims, wherein it is described contact or step of applying the last fortnight or Shorter time, one week or shorter time, 24 hours or shorter time carry out pretreatment to the mammal.
227. method according to any of the preceding claims, wherein about one small before the contact or step of applying When, pretreatment is carried out to the mammal.
228. method according to any of the preceding claims, wherein one or more other compounds be selected from by Group consisting of: anti-inflammatory compound, steroids, statins, estradiol, BTK inhibitor, S1P1 agonist, sugared cortex Hormone receptor modulator (GRM) and antihistaminicum.
229. method according to any of the preceding claims, wherein one or more other compounds be selected from by Group consisting of: dexamethasone, methotrexate (MTX), paracetamol, H1 receptor blocking pharmacon and H2 receptor blocking pharmacon.
Technical field
The disclosure provides new compound, the composition comprising these compounds and is related to lipid nanoparticle composition One or more therapeutic agents and/or prophylactic are delivered to mammalian cell or organ and/or in mammalian cell or device The method of polypeptide is generated in official.In addition to novel lipid, the lipid nanoparticle composition of the disclosure can also include in specific ratio The one or more cationics and/or ionizable amino lipids, the phosphatide including how unsaturated lipid, PEG rouge of example Matter, structural lipid, and/or therapeutic agent and/or prophylactic.
Background of invention
The bioactive substance such as efficient targeting of small-molecule drug, protein and nucleic acid delivering proposes a lasting doctor Learn problem.Exactly, delivery of nucleic acids to cell is become because of the relative instability of these species and low cell permeability It is difficult.Therefore, it is necessary to develop to facilitate the method and composition of therapeutic agent and/or prophylactic such as delivery of nucleic acids to cell.
Verified, nanoparticle compositions, liposome and liposome complex (lipoplex) containing lipid are as transport Bioactive substance such as small-molecule drug, protein and nucleic acid are effectively transported to cell and/or cellular compartment by medium In.These compositions generally comprise one or more " cationics " and/or amino (ionizable) lipid including how unsaturated Phosphatide, structural lipid (such as sterol) including lipid and/or the lipid containing polyethylene glycol (PEG lipid).Cationic and/ Or ionizable lipid includes the amine-containing lipid that for example can easily protonate.Although shown a variety of such receiving containing lipid Nanoparticle composition, but safety, effect and specificity still need to be improved.
Summary of the invention
The disclosure provides new compound and is related to the method for these compounds.
Disclosure first aspect is related to the compound of formula (I):
Or its N- oxide,
Or its salt or isomers, in which:
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring, heterocycle ,-OR ,-O (CH2)nN (R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)C(O)R、-N(R)S (O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (= NR9)N(R)2,-N (R) C (=CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (= CHR9)N(R)2,-C (=NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o are independently selected From 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR ", (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13.
On the other hand the disclosure is related to the compound of formula (III):
Or its N- oxide,
Or its salt or isomers, wherein
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring, heterocycle ,-OR ,-O (CH2)nN (R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)C(O)R、-N(R)S (O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9) N(R)2,-N (R) C (=CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N (OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N (R)2,-C (=NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o is independently selected from 1,2,3 With 4, and each n is independently selected from 1,2,3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13.
In some embodiments, the compound of a small group formula (I) includes compounds some in this way, in these compounds In, work as R4It is-(CH2)nQ、-(CH2)nCHQR ,-CHQR or-CQ (R)2When, then (i) when n is 1,2,3,4 or 5, Q is not-N (R)2；, or (ii), when n is 1 or 2, Q is not 5,6 or 7 membered heterocycloalkyls.
For example, working as R4It is-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2(CH2)n-oQ ,-CHQR or-CQ (R)2When, Then (i) when n is 1,2,3,4 or 5, Q is not-N (R)2；Or (ii), when n is 1 or 2, Q is not 5,6 or 7 membered heterocycloalkyls.
In another embodiment, the compound of another group's formula (I) includes compounds some in this way, in these chemical combination In object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from C3-6Carbocyclic ring is selected from one or more N, heteroatomic 5 to 14 unit's heteroaryl of O and S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、- CXH2、-CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-CRN (R)2C(O)OR、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (=CHR9)N(R) 2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N (R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (=NR9)N(R)2、-C (=NR9) R ,-C (O) N (R) OR and with one or more heteroatomic 5 to 14 membered heterocycloalkyls for being selected from N, O and S, Replaced by one or more from the following substituent group: oxo (=O), OH, amino, monoalkyl or dialkyl amido and C1-3Alkane Base, each o is independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H,
And each q is independently selected from 1,2 and 3；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound of another group's formula (I) includes compounds some in this way, in these changes It closes in object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from C3-6Carbocyclic ring, 5 to 14 circle heterocyclic rings have one Or multiple hetero atoms selected from N, O and S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、- CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-CRN(R)2C(O) OR、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (=CHR9)N(R)2、-OC(O) N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR) C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (=NR9)N(R)2, each o is independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；And when Q is 5 to 14 Circle heterocyclic ring and (i) R4It is-(CH2)nQ, wherein n is 1 or 2, or (ii) R4It is-(CH2)nCHQR, wherein n is 1, or (iii) R4Be- CHQR and-CQ (R)2When, then Q is 5 to 14 unit's heteroaryls or 8 to 14 membered heterocycloalkyls；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound of another group's formula (I) includes compounds some in this way, in these changes It closes in object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from C3-6Carbocyclic ring is selected from one or more N, heteroatomic 5 to 14 unit's heteroaryl of O and S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、- CXH2、-CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-CRN (R)2C(O)OR、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (=CHR9)N(R) 2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N (R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (=NR9)R、-C(O)N (R) OR, each o are independently selected from 1,2,3 and 4 and-C (=NR9)N(R)2, and each n is independently selected from 1,2,3,4 and 5；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl,
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound of another group's formula (I) includes compounds some in this way, in these changes It closes in object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring ,-OR ,-O (CH2)nN(R)2、-C(O) OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N (R)2、-N(R)C(S)N(R)2、N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (= CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N (OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (= NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o independently selected from 1,2,3 and 4, and Each n is independently selected from 1,2,3,4 and 5；
Each R5Independently selected from the group being made up of: OH, C1-3Alkyl, C2-3Alkenyl and H；
Each R6Independently selected from the group being made up of: OH, C1-3Alkyl, C2-3Alkenyl and H；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR ", (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13.
In another embodiment again, the compound of another group's formula (I) includes compounds some in this way, in these changes It closes in object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C2-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4It is-(CH2)nQ or-(CH2)nCHQR, wherein Q is-N (R)2, and n is selected from 3,4 and 5；
Each R5Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C1-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound of another group's formula (I) includes compounds some in this way, in these changes It closes in object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R*OR ", Or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of :-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is-N (R)2, And n is selected from 1,2,3,4 and 5；
Each R5Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C1-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In some embodiments, the compound (III) of a small group formula includes compounds some in this way, in these compounds In, work as R4It is-(CH2)nQ、-(CH2)nCHQR ,-CHQR or-CQ (R)2When, then (i) when n is 1,2,3,4 or 5, Q is not-N (R)2；Or (ii), when n is 1 or 2, Q is not 5,6 or 7 membered heterocycloalkyls.
In another embodiment, the compound (III) of another group's formula includes compounds some in this way, in these changes It closes in object
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from C3-6Carbocyclic ring is selected from one or more N, heteroatomic 5 to 14 unit's heteroaryl of O and S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、- CXH2、-CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-CRN (R)2C(O)OR、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (=CHR9)N (R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N (R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (=NR9)N(R)2、-C (=NR9) R ,-C (O) N (R) OR and with one or more heteroatomic 5 to 14 membered heterocycloalkyls for being selected from N, O and S, Replaced by one or more from the following substituent group: oxo (=O), OH, amino, monoalkyl or dialkyl amido and C1-3Alkane Base, each o is independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H,
And each q is independently selected from 1,2 and 3；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound (III) of another group's formula includes compounds some in this way, at these In compound
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from C3-6Carbocyclic ring, 5 to 14 circle heterocyclic rings have one Or multiple hetero atoms selected from N, O and S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、- CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-CRN(R)2C(O) OR、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (=CHR9)N(R)2、-OC(O) N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR) C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (=NR9)N(R)2, each o is independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；And when Q is 5 to 14 Circle heterocyclic ring and (i) R4It is-(CH2)nQ, wherein n is 1 or 2, or (ii) R4It is-(CH2)nCHQR, wherein n is 1, or (iii) R4Be- CHQR and-CQ (R)2When, then Q is 5 to 14 unit's heteroaryls or 8 to 14 membered heterocycloalkyls；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound (III) of another group's formula includes compounds some in this way, at these In compound
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from C3-6Carbocyclic ring is selected from one or more N, heteroatomic 5 to 14 unit's heteroaryl of O and S ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、- CXH2、-CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-CRN (R)2C(O)OR、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (=CHR9)N(R) 2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N (R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (=NR9)R、-C(O)N (R) OR, each o are independently selected from 1,2,3 and 4 and-C (=NR9)N(R)2, each o is independently selected from 1,2,3 and 4, and each n is independent Ground is selected from 1,2,3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound (III) of another group's formula includes compounds some in this way, at these In compound
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring ,-OR ,-O (CH2)nN(R)2、-C(O) OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-C(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N (R)2、-N(R)C(S)N(R)2、N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N(R)2,-N (R) C (= CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N (OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N(R)2,-C (= NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o independently selected from 1,2,3 and 4, and Each n is independently selected from 1,2,3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR ", (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13.
In another embodiment again, the compound (III) of another group's formula includes compounds some in this way, at these In compound
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C2-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4It is-(CH2)nQ or-(CH2)nCHQR, wherein Q is-N (R)2, and n is selected from 3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C1-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In another embodiment again, the compound (III) of another group's formula includes compounds some in this way, at these In compound
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R*OR ", Or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of :-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is-N (R)2, And n is selected from 1,2,3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R is independently selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C1-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13,
Or its N- oxide or its salt or isomers.
In certain embodiments, the compound of a small group formula (I) includes the compound of formula (IA):
Or its N- oxide or its salt or isomers, wherein l is selected from 1,2,3,4 and 5；M is selected from 5,6,7,8 and 9；M1It is Key or M '；R4It is hydrogen, unsubstituted C1-3Alkyl ,-(CH2)oC(R10)2(CH2)n-oQ or-(CH2)nQ, wherein Q is OH ,-NHC (S)N(R)2、-NHC(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)R8,-NHC (=NR9)N(R)2,-NHC (= CHR9)N(R)2、-OC(O)N(R)2,-N (R) C (O) OR, heteroaryl or Heterocyclylalkyl；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl and heteroaryl；And R2And R3Solely On the spot selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.For example, m is 5,7 or 9.For example, Q is OH ,-NHC (S) N (R)2 Or-NHC (O) N (R)2.For example, Q is-N (R) C (O) R or-N (R) S (O)2R。
In certain embodiments, the compound of a small group formula (I) includes the compound of formula (IB):
Or its N- oxide or its salt or isomers, wherein all changes It measures as defined herein.For example, m is selected from 5,6,7,8 and 9；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)- M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl and heteroaryl；And R2And R3Independently selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.For example, m is 5,7 or 9.
In certain embodiments, the compound of a small group formula (I) includes the compound of formula (II):
Or its N- oxide or its salt or isomers, wherein l is selected from 1,2,3,4 and 5；M1It is key or M '；R4It is hydrogen, unsubstituted C1-3Alkyl ,-(CH2)oC(R10)2(CH2)n-oQ, or-(CH2)nQ, wherein n is 2,3 or 4, and Q is OH ,-NHC (S) N (R)2、-NHC(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N (R)R8,-NHC (=NR9)N(R)2,-NHC (=CHR9)N(R)2、-OC(O)N(R)2,-N (R) C (O) OR, heteroaryl or heterocycle alkane Base；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,- S-S-, aryl and heteroaryl；And R2And R3Independently selected from by H, C1-1Alkyl and C2-14The group of alkenyl composition.
In certain embodiments, the compound of a small group formula (I) includes formula (IIa), (IIb), (IIc) or (IIe) Compound:
Or its N- oxide or its salt or isomers, wherein R4It is as described herein.
In certain embodiments, the compound of a small group formula (I) includes the compound of formula (IId):
Or its N- oxide or its salt or isomers, wherein n is 2,3 or 4；And m, R ', R " and R2To R6Such as this paper institute Description.For example, R2And R3It respectively can be independently selected from by C5-14Alkyl and C5-14The group of alkenyl composition.
In another embodiment, the compound of a small group formula (I) includes the compound of formula (IIf):
Or its N- oxide or its salt or isomers, wherein n is 2,3 or 4；And m, M, M ", R ', R " and R2To R6Such as this Described by text.For example, R2And R3It respectively can be independently selected from by C5-14Alkyl and C5-14Alkenyl composition group, and n be selected from 2, 3 and 4.
In another embodiment, the compound of a small group formula (I) includes the compound of formula (IIg):
Or its N- oxide or its salt or isomers, wherein l, m, M, M1、R’、R2And R3As described herein.For example, R2 And R3It respectively can be independently selected from by C5-14Alkyl and C5-14Alkenyl composition group, l be selected from 1,2,3,4 and 5 and m be selected from 5, 6,7,8 and 9.On the other hand, the disclosure is characterized in that a kind of nanoparticle compositions, and the composition includes containing as retouched herein State compound (such as according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or the compound of (III)) lipid composition.
Another aspect, the disclosure are characterized in that a kind of pharmaceutical composition, and it includes according to aforementioned aspects for the composition Nanoparticle compositions and pharmaceutically acceptable carrier.For example, described pharmaceutical composition is refrigerated or is freezed to store And/or transport is (such as in 4 DEG C or lower temperature, such as between about -150 DEG C and about 0 DEG C or between about -80 DEG C and about -20 DEG C (for example, about -5 DEG C, -10 DEG C, -15 DEG C, -20 DEG C, -25 DEG C, -30 DEG C, -40 DEG C, -50 DEG C, -60 DEG C, -70 DEG C, -80 DEG C, -90 DEG C, -130 DEG C or -150 DEG C) at a temperature of store).For example, described pharmaceutical composition is in solution form so as to for example, about about -20 DEG C, -30 DEG C, -40 DEG C, -50 DEG C, -60 DEG C, store at -70 DEG C or -80 DEG C and/or transport.
On the other hand, the disclosure, which provides, a kind of be delivered to cell for therapeutic agent and/or prophylactic (such as mRNA) and (such as feed Newborn zooblast) method.This method includes applying nanoparticle compositions to subject (such as mammal, such as people) Step, the nanoparticle compositions include: (i) lipid composition comprising phosphatide (such as how unsaturated lipid), PEG lipid, knot Structure lipid and formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) compound；(ii) therapeutic agent and/or prophylactic, wherein application is comprising making the cell and the nanoparticle subgroup Object contact is closed, the therapeutic agent and/or prophylactic are thus delivered to the cell.
On the other hand, the disclosure provides a kind of side that polypeptide of interest is generated in cell (such as mammalian cell) Method.This method includes the steps that contacting the cell with nanoparticle compositions, and the nanoparticle compositions include: (i) Lipid composition comprising phosphatide (such as how unsaturated lipid), PEG lipid, structural lipid and formula (I), (IA), (IB), (II), the compound of (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III)；(ii) coding is closed The mRNA of polypeptide is infused, thus the mRNA can be translated in the cell to generate the polypeptide.
On the other hand, the disclosure provides a kind of method of the disease for treating mammal in need (such as people) or illness. This method includes the steps that the nanoparticle compositions that therapeutically effective amount is applied to the mammal, the combinations of nanoparticles Object includes: (i) lipid composition comprising phosphatide (such as how unsaturated lipid), PEG lipid, structural lipid and formula (I), (IA), the compound of (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III)；With (ii) therapeutic agent and/or prophylactic (such as mRNA).In some embodiments, the disease or illness be with malfunction or Abnormal protein or polypeptide active is characterized.For example, the disease or illness are selected from the group being made up of: rare disease, infection Property disease, cancer and proliferative disease, genetic disease (such as cystic fibrosis), autoimmune disease, diabetes, mind Through degenerative disorders, angiocarpy and renal vascular diseases and metabolic disease.
On the other hand, the disclosure provides a kind of for treating the disease of mammal in need (such as people) or receiving for illness Nanoparticle composition.The nanoparticle compositions include: (i) lipid composition comprising phosphatide (such as how unsaturated lipid), PEG lipid, structural lipid and formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), the compound of (IIg) or (III)；(ii) therapeutic agent and/or prophylactic (such as mRNA).In some embodiments In, the disease or illness are characterized by malfunction or the protein or polypeptide active of exception.For example, the disease or illness Selected from the group being made up of: rare disease, infectious diseases, cancer and proliferative disease, genetic disease (such as Cystic fibre Dimensionization), autoimmune disease, diabetes, neurodegenerative disorders, angiocarpy and renal vascular diseases and metabolic disease.
On the other hand, the disclosure provides a kind of disease or disease for manufacturing for treating mammal (such as people) in need The nanoparticle compositions of the medicament of disease.The nanoparticle compositions include: (i) lipid composition comprising phosphatide is (such as more Unsaturated lipids), PEG lipid, structural lipid and formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), the compound of (IIe), (IIf), (IIg) or (III)；(ii) therapeutic agent and/or prophylactic (such as mRNA).One In a little embodiments, the disease or illness are characterized by malfunction or the protein or polypeptide active of exception.For example, should Disease or illness are selected from the group being made up of: rare disease, infectious diseases, cancer and proliferative disease, genetic disease (example Such as cystic fibrosis), autoimmune disease, diabetes, neurodegenerative disorders, angiocarpy and renal vascular diseases, and Metabolic disease.
On the other hand, the disclosure provides nanoparticle compositions in manufacture for treating mammal in need (such as people) Disease or illness medicament in purposes.The nanoparticle compositions include: (i) lipid composition comprising phosphatide is (such as more Unsaturated lipids), PEG lipid, structural lipid and formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), the compound of (IIe), (IIf), (IIg) or (III)；(ii) therapeutic agent and/or prophylactic (such as mRNA).One In a little embodiments, the disease or illness are characterized by malfunction or the protein or polypeptide active of exception.For example, should Disease or illness are selected from the group being made up of: rare disease, infectious diseases, cancer and proliferative disease, genetic disease (example Such as cystic fibrosis), autoimmune disease, diabetes, neurodegenerative disorders, angiocarpy and renal vascular diseases, and Metabolic disease.
On the other hand, the disclosure provide it is a kind of by therapeutic agent and/or prophylactic delivering (such as specific delivery) to lactation The method of animal organ's (such as liver, spleen, lung or femur).This method includes applying nanometer to subject (such as mammal) The step of particle composition, the nanoparticle compositions include: (i) lipid composition comprising phosphatide (such as how unsaturated rouge Matter), PEG lipid, structural lipid and formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), the compound of (IIg) or (III)；(ii) therapeutic agent and/or prophylactic (such as mRNA), wherein application is comprising making institute Cell is stated to contact with the nanoparticle compositions, thus by the therapeutic agent and/or prophylactic be delivered to target organ (such as Liver, spleen, lung or femur).
On the other hand, the disclosure is characterized in that a kind of for promoting ground for therapeutic agent and/or prophylactic (such as mRNA) The method for being delivered to destination organization (such as liver, spleen, lung or femur).This method includes applying to subject (such as mammal) The step of with nanoparticle compositions, the composition include: (i) lipid composition comprising formula (I), (IA), (IB), (II), (IIa), the compound of (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), phosphatide, structural lipid and PEG lipid；(ii) therapeutic agent and/or prophylactic, the application include making the destination organization and the combinations of nanoparticles Object contact, is thus delivered to the destination organization for the therapeutic agent and/or prophylactic.
Another aspect, the disclosure are characterized in that a kind of method for reducing immunogenicity, and this method includes by the disclosure Nanoparticle compositions be introduced into cell, wherein such as with comprising reference lipid rather than formula (I), (IA), (IB), (II), (IIa), the reference portfolios object of the compound of (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) is induced The induction that cellular immunity responds in cell compares, and the nanoparticle compositions, which are reduced, induces the cell to the nanoparticle The cellular immunity of sub-portfolio object responds.For example, cellular immunity response is congenital immunity response, adaptive immunity response or two Kind.
The disclosure further include synthesis formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), the method for the compound of (IIg) or (III) and the method for preparing nanoparticle compositions, the composition include containing The compound of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) Lipid composition.
Detailed description of the invention
Fig. 1 is shown in application including using methotrexate (MTX) (methotrexate) or ground before the nanoparticle compositions of MC3 The result of Sai meter Song (dexamethasone) pretreatment non-human primate.
Fig. 2 is shown by being transfused within 60 minutes to the various nanometers for not treating Macaca inus and intravenously applying 0.01mpk dosage The hEPO mrna expression amount measured after particle composition.
It includes 26,18,25 and MC3's of compound that Fig. 3-6, which is respectively illustrated apply various dosage into rat vein, The result of the hEPO expression quantity measured after various nanoparticle compositions.
Fig. 7 is shown in the nanometer including 26,18,25 and MC3 of compound of the various dosage between 0.005mpk and 2mpk The area under the curve (AUC) of particle composition.
Fig. 8 be shown below various time points applied into mouse muscle 0.01mpk include MC3, compound 168-170 and The result of the luciferase expression amount measured after the various nanoparticle compositions of 173-175: 3 hours (left side block), 6 hours (centre block) and 24 hours (right side block).Number 1-7 in this figure corresponds respectively to MC3, compound 168-170 and 173- 175。
Fig. 9 be shown below various time points applied into mouse muscle 0.01mpk include MC3, compound 18,25,30, The result of the hEPO expression quantity measured after the various nanoparticle compositions of 108-112,60 and 122: 3 hours (left side block), 6 Hour (centre block) and 24 hours (right side block).Number 1-11 in this figure correspond respectively to MC3, compound 18,25, 30,108-112,60 and 122.
Figure 10 is shown in the various combinations of nanoparticles that intravenous application includes the various compounds of MC3 or disclosed herein The result of the luciferase expression amount (total flux) measured after object.Number 1-12 in this figure correspond respectively to compound 18, MC3, compound 48-50,54,111,60,75,68,66,128,65,130,133-135,147,96 and 151.
Figure 11 A and 11B, which show to be transfused by 60 minutes to untreated Macaca inus, intravenously applies 0.1mpk (Figure 11 A) Or the anti-haemocyte measured after the various nanoparticle compositions including MC3 and compound 18 of 0.3mpk (Figure 11 B) dosage The result of agglutinin (anti-HA) antibody expression amount.
Figure 12 A-12C is a series of figures, is outlined in the nanoparticle for applying the compound containing the disclosure into mouse vein (Figure 12 A) 3 hours after composition, (Figure 12 B) 6 hours and (Figure 12 C) 24 hours luciferase expression amount.Total light flux value is It is obtained by living body luminescence imaging (body luminescent imaging, BLI).In these figures, number 1-14 is respectively Refer to the composition containing compound 160,98,161-165,171,172,183-186 and MC3.
Figure 13 A-13C is a series of figures, is outlined in the nanoparticle for applying the compound containing the disclosure into mouse vein (Figure 13 A) 3 hours after composition, (Figure 13 B) 6 hours and (Figure 13 C) 24 hours luciferase expression amount.Total light flux value is It is obtained by living body luminescence imaging (BLI).Phosphate buffered saline (PBS) is used as control.As a result it is in logarithmic scale It is existing.In these figures, number 1-15 refer respectively to containing MC3, compound 18,111,168-170,174,175,178,179, 181,182,218,198 composition and PBS.
Figure 14 A-14C is a series of figures, is outlined in the nanoparticle for applying the compound containing the disclosure into mouse vein 6 hours in vitro (Figure 14 A) livers after composition, (Figure 14 B) spleen and (Figure 14 C) kidney luciferase expression amount.Total light flux value is It is obtained by living body luminescence imaging (BLI).Phosphate buffered saline (PBS) is used as control.In these figures, number 1-15 It refers respectively to containing MC3, compound 18,111, the compositions of 168-170,174,175,178,179,181,182,218,198 And PBS.
Figure 15 A and 15B are a pair of of figures, it is shown that give disclosure compound compared to the CD-1 mouse for giving MC3 with And compared to the activating B cell frequency in the spleen for the mouse (untreated test subject) for not receiving any treatment.PBS is used as Control.Figure 15 A shows the percentage of CD19+ cell.Figure 15 B shows the percentage of CD19+CD69+CD86+ cell.Number 1-16 Refer to the composition of mRNA and following object containing expressing luciferase: 1:MC3；2: compound 18；3: compound 111；4: changing Close object 168；5: compound 169；6: compound 170；7: compound 174；8: compound 175；9: compound 178；10: compound 179；11: compound 181；12: compound 182；13: compound 218；14: compound 198；15:PBS；16: it is untreated by Examination person.
Figure 16 A and 16B are a pair of of figures, it is shown that give disclosure compound compared to the CD-1 mouse for giving MC3 with And compared to the activating B cell frequency in the spleen for the mouse (untreated test subject) for not receiving any treatment.PBS is used as Control.Figure 16 A shows the percentage of CD19+ cell.Figure 16 B shows the percentage of CD19+CD69+CD86+ cell.Number 1-14 Refer to the composition of mRNA and following object containing expressing luciferase: 1: compound 147；2: compound 184；3: compound 232；4: compound 189；5: compound 200；6: compound 233；7: compound 234；8: compound 235；9: compound 237； 10: compound 239；11: compound 243；12:MC3；13:PBS；14: untreated subject.
Figure 17 is shown in 3 hours (left side block), 6 hours (centre block) after intravenous application nanoparticle compositions With the figure of the hEPO mrna expression amount in the CD1 mouse of 24 hours (right side block) measurement.Number 1-13 refers to the hEPO containing expression MRNA and following object composition: 1: compound 147；2: compound 184；3: compound 232；4: compound 189；5: changing Close object 200；6: compound 233；7: compound 234；8: compound 235；9: compound 237；10: compound 239；11: chemical combination Object 243；12:MC3；13:PBS.
Figure 18 A and 18B are shown in apply 0.01mpk various nanoparticle compositions into CD-1 mouse muscle after measure The result of luciferase expression amount.Figure 18 A be shown in application after 6 hours total flux column diagram.Above each cylindricality Expression ratio of the number instruction relative to MC3.Figure 18 B shows 3 hours after application, 6 hours and 24 hours total fluxs.In figure Number 1-11 refer to the composition containing following object: 1:MC3；2: compound 143；3: compound 49；4: compound 113； 5: compound 61；6: compound 72；7: compound 75；8: compound 71；9: compound 128；10: compound 156；11: chemical combination Object 157.
Figure 19 A and 19B be shown in after the various nanoparticle compositions of CD-1 mouse subcutaneous administration 0.05mpk measure it is glimmering The result of light element expression of enzymes amount.Figure 19 A be shown in application after 6 hours total flux column diagram.Volume above each cylindricality Number expression ratio of the instruction relative to MC3.Figure 19 B shows 3 hours after application, 6 hours and 24 hours total fluxs.In figure Number 1-12 refers to the composition containing following object: 1:PBS；2:MC3；3: compound 25；4: compound 30；5: compound 20；6: compound 110；7: compound 112；8: compound 113；9: compound 72；10: compound 75；11: compound 122； 12: compound 24.
Figure 20 A-20C is a series of figures, is outlined in the nanoparticle subgroup to CD-1 mouse application compound containing the disclosure Luciferase expression amount after conjunction object at 24 hours in vitro (Figure 20 A) spleens, (Figure 20 B) liver and the injection site (Figure 20 C).Total light is logical Magnitude is obtained by living body luminescence imaging (BLI).Phosphate buffered saline (PBS) is used as control.Number 1- in figure 12 refer to the composition containing following object: 1:PBS；2:MC3；3: compound 25；4: compound 30；5: compound 20；6: changing Close object 110；7: compound 112；8: compound 113；9: compound 72；10: compound 75；11: compound 122；12: compound 24。
Figure 21 A-21J is a series of figures, is shown by the cell factor table of the composition induction of the lipid comprising the disclosure Up to amount.Figure 21 A:G-CSF (12)；Figure 21 B:IFN- λ (38)；Figure 21 C:MCP-1 (51)；Figure 21 D:IFN- α (30)；Figure 21 E: IL-6(28)；Figure 21 F:IL-12p70 (39)；Figure 21 G:IL-10 (22)；Figure 21 H:MIP-1 β (72)；Figure 21 I:TNF- α (45)； Figure 21 J:RANTES (44).Number 1-12 in figure refers to the composition containing following object: 1:PBS；2:MC3；3: compound 25；4: compound 30；5: compound 20；6: compound 110；7: compound 112；8: compound 113；9: compound 72；10: changing Close object 75；11: compound 122；12: compound 24.
Figure 22 A-22C is a series of figures, is outlined in the nanoparticle subgroup to mouse subcutaneous administration compound containing the disclosure Close (Figure 22 A) 3 hours after object, (Figure 22 B) 6 hours and (Figure 22 C) 24 hours luciferase expression amount.Total light flux value is logical Cross living body luminescence imaging (BLI) acquisition.Phosphate buffered saline (PBS) is used as control.Number 1-12 in figure, which refers to, to be contained There is the composition of following object: 1:PBS；2:MC3；3: compound 168；4: compound 23；5: compound 19；6: compound 108； 7: compound 109；8: compound 111；9: compound 60；10: compound 61；11: compound 69；12: compound 128.
Figure 23 is shown below the nanoparticle that various time points include disclosure compound to mouse subcutaneous administration 0.05mpk The result of the hEPO expression quantity measured after sub-portfolio object.3 hours (left side block), 6 hours (centre blocks) and 24 hours (right sides Block).Number 1-11 in this figure corresponds respectively to MC3, PBS and 18,25,48,49,111,60,168,207 and of compound 233。
Figure 24 is shown below various time points and applies the nanometer that 0.01mpk includes disclosure compound into mouse muscle The result of the luciferase expression amount measured after particle composition.3 hours (left side block), 6 hours (centre blocks) and 24 are small When (right side block).Number 1-9 in this figure correspond respectively to MC3 and compound 178,181,182,218,198,200, 233 and 239.
Figure 25, which is shown in, applies mRNA of the 0.5mpk containing compound 18 or MC3 and modified into CD-1 mouse vein After nanoparticle compositions, 3 hours after application, 6 hours and 24 hours measurement hEPO expression quantity as a result, in the mRNA In, each uridine is replaced by N1- methyl pseudouridine or in which each uridine is replaced by 5- methoxyuridine.Number 1-4 in figure Refer to the composition containing following object: 1: the mRNA and MC3 for the modified that each uridine is replaced by 5- methoxyuridine；2: The mRNA and MC3 for the modified that each uridine is replaced by N1- methyl pseudouridine；3: each uridine is replaced by 5- methoxyuridine Modified mRNA and compound 18；4: the mRNA and chemical combination for the modified that each uridine is replaced by N1- methyl pseudouridine Object 18.
The figure of Figure 26, which is shown, is giving the small of the nanoparticle compositions of the mRNA containing compound 18 or MC3 and modified B cell activation in mice spleen cell, in the mRNA, each uridine is replaced or in which each uridine by N1- methyl pseudouridine It is replaced by 5- methoxyuridine.PBS is used as control.Number 1-5 in figure refers to the composition containing following object: 1: each urine The mRNA and MC3 for the modified that glycosides is replaced by 5- methoxyuridine；2: the modification that each uridine is replaced by N1- methyl pseudouridine The mRNA and MC3 crossed；3: the mRNA and compound 18 for the modified that each uridine is replaced by 5- methoxyuridine；4: each urine The mRNA and compound 18 for the modified that glycosides is replaced by N1- methyl pseudouridine；5:PBS.
Figure 27 is shown in 3 hours (left side block), 6 hours after the various nanoparticle compositions of subcutaneous administration 0.5mpk The figure of hEPO mrna expression amount in the CD1 mouse of (centre block) and 24 hours (right side block) measurement.Number 1-9 refers to The mRNA of the hEPO containing expression and the composition of following object: 1:PBS；2: compound 18；3: compound 30；4: compound 96；5: Compound 151；6: compound 98；7: compound 163；8: compound 164；9: compound 165.
Figure 28 A-28J is a series of figures, and showing is including disclosure lipid and modified to CD-1 mouse subcutaneous administration Expression hEPO mRNA composition after 6 hours measurement the cytokine-expressing amount induced by these compositions, described In mRNA, each uridine is replaced by N1- methyl vacation guanosine.Figure 28 A:G-CSF；Figure 28 B:IFN- λ；Figure 28 C:IFN- α；Figure 28 D: IL-12p70；Figure 28 E:IP-10；F:IL-6；Figure 28 G:MCP-1；Figure 28 H:MIP-1 β；Figure 28 I:RANTES；Figure 28 J:TNF- α.Number 1-9 in figure refers to the composition containing following object: 1:PBS；2: compound 18；3: compound 30；4: compound 96；5: compound 151；6: compound 98；7: compound 163；8: compound 164；9: compound 165.
Figure 29 A -29C is a series of figures, shows the optimization of the efficiency and clearance rate of amino lipids.Figure 29 A is in vein 6 hours novel LNP and MC3 measured in CD-1 mouse (n=6) after the lipid of the interior application mRNA of hEPO containing 0.5mg/kg The whole body fluorescent element enzyme bioluminescence of LNP is compared.Serum hEPO concentration is shown in figure；Error bars indicate novel lipid expression quantity The standard deviation of ratio relative to MC3 expression quantity.* p < 0.05, * * p < 0.01, * * * p < 0.001, n.s.=is without statistically significant Property.Number 1-9 refers to the composition containing following object: 1: compound 281；2: compound 138；3: compound 136；4: chemical combination Object 6；5: compound 18；6: compound 29；7: compound 14；8: compound 25；And 9: compound 26.Figure 29 B is outlined It is obtained from the Sprague Dawley rat (each time point n=3 is only) of the LNP of application 0.2mg/kg dosage mRNA containing hEPO Hepatic tissue in the comparision contents of compound 18 and compound 25 and MC3 that measure.For compound 18 and compound 25AUC phase For MC3, p < 0.05.Figure 29 C is shown in the figure of hEPO expression quantity in Sprague Dawley rat.HEPO serum-concentration is It is measured after intravenously application LNP of the 1mg/kg dosage containing compound 18, compound 25, compound 26 or MC3 and hEPO mRNA (n=3).
Figure 30 A-30C is a series of figures, it is shown that the pharmacokinetics and express spectra of compound 18 after multiple dosing.Figure 30A is to give the mRNA containing 0.05mg/kg that intravenously applies weekly to CD-1 mouse (each time point n=3 only) three times The comparison of the Tissue distribution of MC3 and compound 18 after bolus dosage.Figure 30 B is shown in CD-1 mouse (n=8 is only) and gives weekly 6 hours hEPO serum-concentrations after the bolus dosage of the LNP including 0.5mg/kg mRNA containing hEPO intravenously applied.Figure 30 C Show compound 18 and its main generation after the dosage for giving the mRNA containing 0.25mg/kg weekly to CD-1 mouse (n=3 is only) The hepatic tissue for thanking to compounds 166 removes situation.
Figure 31 A-31C is a series of figures, shows the expression of the lipid nanoparticle of the disclosure in Macaca inus research Spectrum.Figure 31 A shows the hEPO serum-concentration after delivering 0.01mg/kg hEPO mRNA with MC3 or compound 18.Pass through 60 Minute infusion (n=3), intravenously applies lipid nanoparticle.For compound 18AUC relative to MC3, p < 0.05.Figure 31 B is aobvious Show and 0.3mg/kg antibody mRNA descendant was being delivered with MC3 or compound 18LNP by infusion (n=3) intravenous application in 60 minutes IgG influenza A antibody sera concentration, for compound 18AUC relative to MC3, p < 0.05.Figure 31 C is shown in weekly by 60 points Clock is transfused (n=4), and intravenously application delivers the hEPO serum-concentration after 0.2mg/kg hEPO mRNA with compound 18LNP.
Figure 32 A-32C is a series of figures, outlines in rat and non-human primate month toxicity assessment As a result.Phosphate buffered saline (PBS) is used as control.Figure 32 A is shown by applying in 10 minutes intravenous injections Serum alanine aminotransferase in Sprague Dawley rat is horizontal, and weekly administration continues 5 weeks.24 after the 5th dose Hour measurement serum levels (n=10).Statistical discrepancy is not observed between PBS and each dosage level.Figure 32 B shows logical The serum aspartat transaminases levels in the Sprague Dawley rat applied in 10 minutes intravenous injections are crossed, weekly Administration, continues 5 weeks.24 hours measurement serum levels (n=10) after the 5th dose.* p < 0.05, in PBS and 0.05 and 2.0mg/ Without statistical discrepancy between kg dosage.Figure 32 C shows the food crab Mi by application 1mg/kg mRNA in 60 minutes intravenous injections weekly Serum alanine aminotransferase in monkey is horizontal.24 hours measurement serum levels (n=4) after the 5th dose.PBS before administration Statistical discrepancy is not observed between the 30th day level of compound 18.Figure 32 D is shown by 60 minutes intravenous injections weekly Apply the serum aspartat transaminases levels in the Macaca inus of 1mg/kg mRNA.It measures within 24 hours after the 5th dose Serum levels (n=4).Statistical discrepancy is not observed between PBS and the 30th day level of compound 18 before administration.
Figure 33 A and 33B are a pair of of figures, outline the knot of a month toxicity assessment in rat and non-human primate Fruit.Figure 33 A shows the C5b9 serum-concentration (n=4) in the Macaca inus for applying 1mg/kg mRNA with the 29th day on day 1. At all time points, statistical discrepancy is not observed between PBS and compound 18.Figure 33 B shows and applied on day 1 with the 29th day With the MCP-1 serum-concentration in the Macaca inus of 1mg/kg mRNA.P < 0.05 n=4, *, at any other time point, in PBS Without statistical discrepancy between compound 18.
Figure 34 A-34C is a series of fixed cell images of the inner body escape efficiency of the lipid nanoparticle of the disclosure.With It is encapsulated with the MC3 and compound 18LNP transfection HeLa cell of luciferase mRNA marked by rhodamine (Rhodamine), and It is processed after being incubated at 4 hours to carry out unimolecule FISH (smFISH, red), in addition, electroporation is put into not into cell By the mRNA of preparation.The mRNA molecule in cytosol is flowed out to from endocytosis organelle with green display (image analysis covering Figure).Escaped by calculating the ratio between the quantity of the cytosol mRNA of each cell and the quantity of internalization LNP to evaluate inner body Ease efficiency.Figure 34 A is the image for the HeLa cell for showing that electroporation is crossed.Figure 34 B is the figure for showing the processed HeLa cell of MC3 Picture.Figure 34 C is the image for showing the processed HeLa cell of compound 18.
Figure 35 A and 35B are a pair of of the figures for comparing the Tissue distribution of MC3 and compound 18.Figure 35 A is shown in CD-1 mouse (each time point n=3 is only) intravenously applies the Tissue distribution of MC3 and compound 18 after 0.05mg/kg mRNA three times.Figure 35 B It is shown in after Macaca inus (n=2 is only) application 0.2mg/kg mRNA 12 hours, the Tissue distribution of MC3 and compound 18.
Figure 36 is shown in through 60 minutes intravenous injections to apply 0.1mg/ comprising the composition of MC3 or compound 18 The figure (n=3) of human IgG expression quantity in the Macaca inus of kg human IgG mRNA.
Figure 37 is a series of figures for showing MC3 unicellular necrosis in rats'liver and liver enzyme.Upper figure is to apply 0.3mg/kg not Lipid nanoparticle (LNP) (right side) and PBS (phosphate buffered saline) containing mRNA as control rat liver one To image.The following figure is the expression quantity of ALT (left side) and AST (right side) in liver after application 0.3mg/kg includes the LNP of mRNA and MC3 A pair of of figure.ALT and AST is increased and pathological analysis shows downright bad sign.
Figure 38 is shown in the figure of the mRNA level in-site in 29 days processes after repeat administration in NHP.
Figure 39 A and 39B are shown in the ApoE knock out mice and LDLr gene knockout of LNP of the application containing compound 18 A pair of of figure of hEPO expression quantity in mouse.Figure 39 A is shown in the hEPO expression quantity in ApoE knock out mice.Figure 39 B is aobvious Show the hEPO expression quantity in LDLr knock out mice.
Specific embodiment
This disclosure relates to novel lipid and the lipid nanoparticle composition including novel lipid.The disclosure additionally provide by Therapeutic agent and/or prophylactic are exactly delivered to by the method that therapeutic agent and/or prophylactic are delivered to mammalian cell Mammalian organs generate polypeptide of interest in mammalian cells and treat the disease or illness of mammal in need Method.For example, the method for generating polypeptide of interest in cell includes keeping the nanoparticle compositions comprising mRNA and lactation dynamic The contact of object cell, thus the mRNA can be translated to generate polypeptide of interest.Therapeutic agent and/or prophylactic are delivered to lactation The method of zooblast or organ may include the combinations of nanoparticles to subject's application including the therapeutic agent and/or prophylactic Object, wherein the application includes contacting the cell or organ with the composition, thus by the therapeutic agent and/or prevention Agent is delivered to the cell or organ.
Lipid
Present disclose provides the lipids including center amine moiety and at least one biodegradable groups.Rouge as described herein Matter may be advantageously used in lipid nanoparticle composition with by therapeutic agent and/or prophylactic be delivered to mammalian cell or Organ.For example, lipid as described herein is poly- to be had extremely low or not to have an immunogenicity.For example, formula (I), (IA), (IB), (II), (IIa), the immunogene of the lipid compounds of any of (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) Property lower than refer to lipid (such as MC3, KC2 or DLinDMA).For example, including lipid disclosed herein and therapeutic agent or prevention The therapeutic index of the formulation of agent, which is higher than, includes reference lipid (such as MC3, KC2 or DLinDMA) and identical treatment agent or prevention The corresponding formulation of agent.
In the first aspect of the present invention, compound as described herein has formula (I):
Or its N- oxide or its salt or isomers, in which:
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring, heterocycle ,-OR ,-O (CH2)nN (R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)C(O)R、-N(R)S (O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (= NR9)N(R)2,-N (R) C (=CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N(OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (= CHR9)N(R)2,-C (=NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o are independently selected From 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,
-N(R’)C(O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S (O)2,-S-S-, aryl and heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13；And wherein work as R4It is-(CH2)nQ、-(CH2)nCHQR ,-CHQR or- CQ(R)2When, then (i) when n is 1,2,3,4 or 5, Q is not-N (R)2；, or (ii), when n is 1 or 2, Q is not 5,6 or 7 yuan miscellaneous Naphthenic base.
On the other hand the disclosure is related to the compound of formula (III):
Or its N- oxide,
Or its salt or isomers, wherein
Or its salt or isomers, wherein
R1Selected from the group being made up of: C5-30Alkyl, C5-20Alkenyl ,-R*YR " ,-YR " and-R " M ' R '；
R2And R3Independently selected from the group being made up of: H, C1-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R* OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring；
R4Selected from the group being made up of: hydrogen, C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、-(CH2)oC(R10)2 (CH2)n-oQ、-CHQR、-CQ(R)2With unsubstituted C1-6Alkyl, wherein Q is selected from carbocyclic ring, heterocycle ,-OR ,-O (CH2)nN (R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-C(O)N(R)2、-N(R)C(O)R、-N(R)S (O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、N(R)R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9) N(R)2,-N (R) C (=CHR9)N(R)2、-OC(O)N(R)2、-N(R)C(O)OR、-N(OR)C(O)R、-N(OR)S(O)2R、-N (OR)C(O)OR、-N(OR)C(O)N(R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2,-N (OR) C (=CHR9)N (R)2,-C (=NR9)N(R)2,-C (=NR9) R ,-C (O) N (R) OR and-C (R) N (R)2C (O) OR, each o is independently selected from 1,2,3 With 4, and each n is independently selected from 1,2,3,4 and 5；
RxSelected from the group being made up of: C1-6Alkyl, C2-6Alkenyl ,-(CH2)rOH and-(CH2)rNR2,
Wherein r is selected from 1,2,3,4,5 and 6；
Each R5Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
Each R6Independently selected from by OH, C1-3Alkyl, C2-3The group of alkenyl and H composition；
M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-N (R ') C (O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S(O)2,-S-S-, aryl and Heteroaryl, wherein M " is key, C1-13Alkyl or C2-13Alkenyl；
R7Selected from by C1-3Alkyl, C2-3The group of alkenyl and H composition；
R8Selected from by C3-6The group of carbocyclic ring and heterocycle composition；
R9Selected from the group being made up of: H, CN, NO2、C1-6Alkyl ,-OR ,-S (O)2R、-S(O)2N(R)2、C2-6Alkenyl, C3-6Carbocyclic ring and heterocycle；
R10Selected from the group being made up of: H, OH, C1-3Alkyl and C2-3Alkenyl；
Each R is independently selected from the group being made up of: C1-3Alkyl, C2-3Alkenyl, (CH2)qOR* and H,
And each q is independently selected from 1,2 and 3；
Each R ' is independently selected from the group being made up of: C1-18Alkyl, C2-18Alkenyl ,-R*YR " ,-YR " and H；
Each R " is independently selected from by C3-15Alkyl and C3-15The group of alkenyl composition；
Each R* is independently selected from by C1-12Alkyl and C2-12The group of alkenyl composition；
Each Y is independently C3-6Carbocyclic ring；
Each X is independently selected from the group being made up of: F, Cl, Br and I；And
M is selected from 5,6,7,8,9,10,11,12 and 13.
In certain embodiments, the compound of a small group formula (I) includes the compound of formula (IA):
Or its N- oxide or its salt or isomers, wherein l is selected from 1,2,3,4 and 5；M is selected from 5,6,7,8 and 9；M1It is Key or M '；R4It is hydrogen, unsubstituted C1-3Alkyl ,-(CH2)oC(R10)2(CH2)n-oQ, or-(CH2)nQ, wherein Q is OH ,-NHC (S)N(R)2、-NHC(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)R8,-NHC (=NR9)N(R)2,-NHC (= CHR9)N(R)2、-OC(O)N(R)2,-N (R) C (O) OR, heteroaryl or Heterocyclylalkyl；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl and heteroaryl；And R2And R3Solely On the spot selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.For example, m is 5,7 or 9.For example, Q is OH ,-NHC (S) N (R)2, Or-NHC (O) N (R)2.For example, Q is-N (R) C (O) R or-N (R) S (O)2R。
In certain embodiments, the compound of a small group formula (I) includes the compound of formula (IB):
Or its N- oxide or its salt or isomers, wherein all changes It measures as defined herein.For example, m is selected from 5,6,7,8 and 9；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)- M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl and heteroaryl；And R2And R3Independently selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.For example, m is 5,7 or 9.In certain embodiments, the compound of a small group formula (I) Compound including formula (II):
Or its N- oxide or its salt or isomers, wherein l is selected From 1,2,3,4 and 5；M1It is key or M '；R4It is hydrogen, unsubstituted C1-3Alkyl ,-(CH2)oC(R10)2(CH2)n-oQ or-(CH2)nQ, wherein n is 2,3 or 4, and Q is OH ,-NHC (S) N (R)2、-NHC(O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N (R)R8,-NHC (=NR9)N(R)2,-NHC (=CHR9)N(R)2、-OC(O)N(R)2,-N (R) C (O) OR, heteroaryl or heterocycle alkane Base；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,- S-S-, aryl and heteroaryl；And R2And R3Independently selected from by H, C1-14Alkyl and C2-14The group of alkenyl composition.
The compound of any of formula (I) or (IA) include one or more following characteristics as applicable.
In some embodiments, M1It is M '.
In some embodiments, M and M ' is independently-C (O) O- or-OC (O)-.
In some embodiments, at least one of M and M ' are-C (O) O- or-OC (O)-.
In certain embodiments, at least one of M and M ' are-OC (O)-.
In certain embodiments, M be-OC (O)-and M ' be-C (O) O-. in some embodiments, M is-C (O) O- and M ' are-OC (O)-.In certain embodiments, M and M ' is individually-OC (O)-.In some embodiments, M and M ' Individually-C (O) O-.
In certain embodiments, at least one of M and M ' they are-OC (O)-M "-C (O) O-.
In some embodiments, M and M ' is independently-S-S-.
In some embodiments, at least one of M and M ' are-S-S.
In some embodiments, M's and M ' first is that-C (O) O- or-OC (O)-and the other is-S-S-.For example, M It is-C (O) O- or-OC (O)-and M ' is-S-S- or M ' is-C (O) O- or-OC (O)-and M is-S-S-.
In some embodiments, M's and M ' first is that-OC (O)-M "-C (O) O-, wherein M " is key, C1-13Alkyl or C2-13 Alkenyl.In other embodiments, M " is C1-6Alkyl or C2-6Alkenyl.In certain embodiments, M " is C1-4Alkyl or C2-4 Alkenyl.
In some embodiments, l is 1,3 or 5.
In some embodiments, R4It is hydrogen.
In some embodiments, R4It is not hydrogen.
In some embodiments, R4It is unsubstituted methyl or-(CH2)nQ, wherein Q is OH ,-NHC (S) N (R)2、- NHC(O)N(R)2,-N (R) C (O) R or-N (R) S (O)2R。
In some embodiments, Q is OH.
In some embodiments, Q is-NHC (S) N (R)2。
In some embodiments, Q is-NHC (O) N (R)2。
In some embodiments, Q is-N (R) C (O) R.
In some embodiments, Q is-N (R) S (O)2R。
In some embodiments, Q is-O (CH2)nN(R)2。
In some embodiments, Q is-O (CH2)nOR。
In some embodiments, Q is-N (R) R8。
In some embodiments, Q is-NHC (=NR9)N(R)2。
In some embodiments, Q is-NHC (=CHR9)N(R)2。
In some embodiments, Q is-OC (O) N (R)2。
In some embodiments, Q is-N (R) C (O) OR.
In some embodiments, n is 2.
In some embodiments, n is 3.
In some embodiments, n is 4.
In some embodiments, M1It is not present.
In some embodiments, at least one R5It is hydroxyl.For example, a R5It is hydroxyl.
In some embodiments, at least one R6It is hydroxyl.For example, a R6It is hydroxyl.
In some embodiments, R5And R6First is that hydroxyl.For example, a R5It is hydroxyl and each R6It is hydrogen.For example, One R6It is hydroxyl and each R5It is hydrogen.
In some embodiments, RxIt is C1-6Alkyl.In some embodiments, RxIt is C1-3Alkyl.For example, RxIt is first Base.For example, RxIt is ethyl.For example, RxIt is propyl.
In some embodiments, RxIt is-(CH2)rOH, and r is 1,2 or 3.For example, RxIt is formoxyl.For example, RxIt is Acetyl group.For example, RxIt is propiono.
In some embodiments, RxIt is-(CH2)rNR2, r is that 1,2 or 3 and each R is H or methyl.For example, RxIt is first ammonia Base, methyl methylamino or dimethyl methyl amino.For example, RxIt is amino methyl, Methylaminomethyl or dimethylaminomethyl.Example Such as, RxIt is amino-ethyl, methylaminoethyl or dimethyl aminoethyl.For example, RxBe aminopropyl, dimethylaminopropyl or Dimethylaminopropyl.
In some embodiments, R ' is C1-18Alkyl, C2-18Alkenyl ,-R*YR " or-YR ".
In some embodiments, R2And R3It is independently C3-14Alkyl or C3-14Alkenyl.
In one embodiment, the compound of formula (I) has formula (IIa),
Or its N- oxide or its salt or isomers, wherein R4It is as described herein.
In another embodiment, the compound of formula (I) has formula (IIb),
Or its N- oxide or its salt or isomers, wherein R4It is as described herein.
In another embodiment, the compound of formula (I) has formula (IIc) or (IIe):
Or its N- oxide or its salt or isomers, wherein R4It is as described herein.
In another embodiment, the compound of formula (I) has formula (IIf):
Or its N- oxide or its salt or isomers,
It is C that wherein M, which is-C (O) O- or-OC (O)-, M ",1-6Alkyl or C2-6Alkenyl, R2And R3Independently selected from by C5-14Alkane Base and C5-14The group of alkenyl composition, and n is selected from 2,3 and 4.
In another embodiment, the compound of formula (I) has formula (IId),
Or its N- oxide or its salt or isomers, wherein n is 2,3 or 4；And m, R ', R " and R2To R6As herein It is described.For example, R2And R3It respectively can be independently selected from by C5-14Alkyl and C5-14The group of alkenyl composition.
In another embodiment, the compound of formula (I) has formula (IIg),
Or its N- oxide or its salt or isomers, wherein l be selected from 1,2, 3,4 and 5；M is selected from 5,6,7,8 and 9；M1It is key or M '；M and M ' is independently selected from-C (O) O- ,-OC (O)-,-OC (O)-M "-C (O) O- ,-C (O) N (R ')-,-P (O) (OR ') O- ,-S-S-, aryl and heteroaryl；And R2And R3Independently selected from by H, C1-14 Alkyl and C2-14The group of alkenyl composition.For example, M " is C1-6Alkyl (such as C1-4Alkyl) or C2-6Alkenyl (such as C2-4Alkenyl).Example Such as, R2And R3Independently selected from by C5-14Alkyl and C5-14The group of alkenyl composition.
Formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) and (III) Any of compound as applicable include one or more following characteristics.
In some embodiments, R4Selected from the group being made up of: C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、- (CH2)oC(R10)2(CH2)n-oQ ,-CHQR and-CQ (R)2, wherein Q is selected from
C3-6Carbocyclic ring, heteroatomic 5 to 14 yuan of aromatic series with one or more selected from N, O, S and P or non-aromatic are miscellaneous Ring ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-N(R)2、-N(R)S(O)2R8、-C (O)N(R)2、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2With-C (R) N (R)2C(O) OR, each o are independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5.
In another embodiment, R4Selected from the group being made up of: C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、- (CH2)oC(R10)2(CH2)n-oQ ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6There is carbocyclic ring one or more to be selected from N, O and S Heteroatomic 5 to 14 unit's heteroaryl ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、- CN、-C(O)N(R)2、-N(R)S(O)2R8、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N (R)2、-C(R)N(R)2C (O) OR and heteroatomic 5 to 14 membered heterocycloalkyls that N, O and S are selected from one or more, By one or more selected from oxo (=O), OH, amino and C1-3The substituent group of alkyl replaces, each o independently selected from 1,2,3 and 4, And each n is independently selected from 1,2,3,4 and 5.
In another embodiment, R4Selected from the group being made up of: C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、- (CH2)oC(R10)2(CH2)n-oQ ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6Carbocyclic ring, 5 to 14 circle heterocyclic rings have one or more Hetero atom ,-OR ,-O (CH selected from N, O and S2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、-CN、-C(O) N(R)2、-N(R)S(O)2R8、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N(R)2、-C(R)N (R)2C (O) OR, each o is independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5；And when Q is 5 to 14 yuan Heterocycle and (i) R4It is-(CH2)nQ, wherein n is 1 or 2, or (ii) R4It is-(CH2)nCHQR, wherein n is 1, or (iii) R4Be- CHQR and-CQ (R)2When, then Q is 5 to 14 unit's heteroaryls or 8 to 14 membered heterocycloalkyls.
In another embodiment, R4Selected from the group being made up of: C3-6Carbocyclic ring ,-(CH2)nQ、-(CH2)nCHQR、- (CH2)oC(R10)2(CH2)n-oQ ,-CHQR and-CQ (R)2, wherein Q is selected from C3-6There is carbocyclic ring one or more to be selected from N, O and S Heteroatomic 5 to 14 unit's heteroaryl ,-OR ,-O (CH2)nN(R)2、-C(O)OR、-OC(O)R、-CX3、-CX2H、-CXH2、- CN、-C(O)N(R)2、-N(R)S(O)2R8、-N(R)C(O)R、-N(R)S(O)2R、-N(R)C(O)N(R)2、-N(R)C(S)N (R)2、-C(R)N(R)2C (O) OR, each o is independently selected from 1,2,3 and 4, and each n is independently selected from 1,2,3,4 and 5.
In another embodiment, R4It is-(CH2)nQ, wherein Q is-N (R) S (O)2R8And n is selected from 1,2,3,4 and 5.In In another embodiment, R4It is-(CH2)nQ, wherein Q is-N (R) S (O)2R8, wherein R8It is C3-6Carbocyclic ring, such as C3-6Naphthenic base, And n is selected from 1,2,3,4 and 5.For example, R4It is-(CH2)3NHS(O)2R8And R8It is cyclopropyl.
In another embodiment, R4It is-(CH2)oC(R10)2(CH2)n-oQ, wherein Q is-N (R) C (O) R, n is selected from 1, 2,3,4 and 5, and o is selected from 1,2,3 and 4.In another embodiment, R4It is-(CH2)oC(R10)2(CH2)n-oQ, wherein Q It is-N (R) C (O) R, wherein R is C1-C3Alkyl and n are selected from 1,2,3,4 and 5, and o is selected from 1,2,3 and 4.In another implementation In scheme, R4It is-(CH2)oC(R10)2(CH2)n-oQ, wherein Q is-N (R) C (O) R, and wherein R is C1-C3Alkyl, n is 3, and o It is 1.In some embodiments, R10It is H, OH, C1-3Alkyl or C2-3Alkenyl.For example, R4It is 3- acetamido -2,2- dimethyl Propyl.
In some embodiments, a R10It is H and R10It is C1-3Alkyl or C2-3Alkenyl.In another embodiment party In case, each R10It is C1-3Alkyl or C2-3Alkenyl.In another embodiment, each R10It is C1-3Alkyl (such as methyl, ethyl or Propyl).For example, a R10It is methyl and a R10It is ethyl or propyl.For example, a R10It is ethyl and a R10It is methyl Or propyl.For example, a R10It is propyl and a R10It is methyl or ethyl.For example, each R10It is methyl.For example, each R10It is second Base.For example, each R10It is propyl.
In some embodiments, a R10It is H and R10It is OH.In another embodiment, each R10It is OH.
In another embodiment, R4It is unsubstituted C1-4Alkyl, such as unsubstituted methyl.
In another embodiment, R4It is hydrogen.
In certain embodiments, the disclosure provides a kind of compound with formula (I), wherein R4It is-(CH2)nQ or- (CH2)nCHQR, wherein Q is-N (R)2, and n is selected from 3,4 and 5.
In certain embodiments, the disclosure provides a kind of compound with formula (I), wherein R4Selected from being made up of Group :-(CH2)nQ、-(CH2)nCHQR ,-CHQR and-CQ (R)2, wherein Q is-N (R)2, and n is selected from 1,2,3,4 and 5.
In certain embodiments, the disclosure provides a kind of compound with formula (I), wherein R2And R3Independently selected from The group being made up of: C2-14Alkyl, C2-14Alkenyl ,-R*YR " ,-YR " and-R*OR " or R2And R3The original connected together with it Son is formed together heterocycle or carbocyclic ring, and R4It is-(CH2)nQ or-(CH2)nCHQR, wherein Q is-N (R)2, and n is selected from 3,4 and 5。
In certain embodiments, R2And R3Independently selected from the group being made up of: C2-14Alkyl, C2-14Alkenyl ,-R* YR " ,-YR " and-R*OR " or R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring.
In some embodiments, R1Selected from by C5-20Alkyl and C5-20The group of alkenyl composition.
In other embodiments, R1Selected from by-R*YR " ,-YR " and-R " group that forms of M ' R '.
In certain embodiments, R1Selected from-R*YR " and-YR ".In some embodiments, Y is cyclopropyl.Some In embodiment, R* is C8Alkyl or C8Alkenyl.In certain embodiments, R " is C3-12Alkyl.For example, R " can be C3Alkane Base.For example, R " can be C4-8Alkyl (such as C4、C5、C6、C7Or C8Alkyl).
In some embodiments, R is (CH2)qOR*, q are selected from 1,2 and 3, and R* is by one or more selected from by ammonia Base, C1-C6Alkyl amino and C1-C6The C that the substituent group of the group of dialkyl amido composition replaces1-12Alkyl.For example, R is (CH2)qOR*, q are selected from 1,2 and 3, and R* is by C1-C6The C that dialkyl amido replaces1-12Alkyl.For example, R is (CH2)qOR*, q choosing From 1,2 and 3, and R* is by C1-C6The C that dialkyl amido replaces1-3Alkyl.For example, R is (CH2)qOR*, q are selected from 1,2 and 3, And R* is the C replaced by dimethylamino (such as dimethyl aminoethyl)1-3Alkyl.
In some embodiments, R1It is C5-20Alkyl.In some embodiments, R1It is C6Alkyl.In some embodiment party In case, R1It is C8Alkyl.In other embodiments, R1It is C9Alkyl.In certain embodiments, R1It is C14Alkyl.Other In embodiment, R1It is C18Alkyl.
In some embodiments, R1It is C21-30Alkyl.In some embodiments, R1It is C26Alkyl.In some implementations In scheme, R1It is C28Alkyl.In certain embodiments, R1It is
In some embodiments, R1It is C5-20Alkenyl.In certain embodiments, R1It is C18Alkenyl.In some embodiment party In case, R1It is sub- oil base.
In certain embodiments, R1It is branch's (such as decyl- 2- base, hendecane -3- base, dodecane -4- base, 13 Alkane -5- base, the tetradecane -6- base, 2- methylundecane -3- base, 2- methyl decyl- 2- base, 3- methylundecane -3- base, 4- methyl Dodecane -4- base or heptadecane -9- base).In certain embodiments, R1It is
In certain embodiments, R1It is unsubstituted C5-20Alkyl or C5-20Alkenyl.In certain embodiments, R ' It is substituted C5-20Alkyl or C5-20Alkenyl (such as by C3-6Carbocyclic ring such as 1- cyclopropyl nonyl substituent group, or by OH or alkoxy Replace).For example, R1It is
In other embodiments, R1It is-R " M ' R '.In certain embodiments, M ' is-OC (O)-M "-C (O) O-.Example Such as, R1It isWherein x is the integer (such as selected from 3,4,5 and 6) between 1 and 13, and s is to be situated between Integer (such as selected from 1,2 and 3) between 1 and 13, and t is the integer (such as selected from 4,5 and 6) between 2 and 14. For example, x is selected from 3,4,5 and 6, s is selected from 1,2 and 3, and t is selected from 4,5 and 6.
In other embodiments, R1It is not-(CHR5R6)m–M–CR2R3R7。
In some embodiments, R ' is selected from-R*YR " and-YR ".In some embodiments, Y is C3-8Naphthenic base.In In some embodiments, Y is C6-10Aryl.In some embodiments, Y is cyclopropyl.In some embodiments, Y is ring Hexyl.In certain embodiments, R* is C1Alkyl.
In some embodiments, R " is selected from by C3-12Alkyl and C3-12The group of alkenyl composition.In some embodiments, The R " of neighbouring Y is C1Alkyl.In some embodiments, the R " of neighbouring Y is C4-9Alkyl (such as C4、C5、C6、C7Or C8Or C9Alkane Base).
In some embodiments, R " is substituted C3-12(such as the C replaced by such as hydroxyl3-12Alkyl).For example, R " is
In some embodiments, R ' is selected from C4Alkyl and C4Alkenyl.In certain embodiments, R ' is selected from C5Alkyl and C5Alkenyl.In some embodiments, R ' is selected from C6Alkyl and C6Alkenyl.In some embodiments, R ' is selected from C7Alkyl and C7 Alkenyl.In some embodiments, R ' is selected from C9Alkyl and C9Alkenyl.
In some embodiments, R ' isIn some realities It applies in scheme, R ' isAnd M ' is-OC (O)-.In other implementations In scheme, R ' is And M ' is-C (O) O-.
In other embodiments, R ' is selected from C11Alkyl and C11Alkenyl.In other embodiments, R ' is selected from C12Alkyl, C12Alkenyl, C13Alkyl, C13Alkenyl, C14Alkyl, C14Alkenyl, C15Alkyl, C15Alkenyl, C16Alkyl, C16Alkenyl, C17Alkyl, C17 Alkenyl, C18Alkyl and C18Alkenyl.In certain embodiments, R ' is straight chain C4-18Alkyl or C4-18Alkenyl.In certain embodiment party In case, R ' be branched chain (such as decyl- 2- base, hendecane -3- base, dodecane -4- base, tridecane -5- base, the tetradecane -6- base, 2- methylundecane -3- base, 2- methyl decyl- 2- base, 3- methylundecane -3- base, 4- methyl dodecane -4- base or heptadecane - 9- yl).In certain embodiments, R ' is
In certain embodiments, R ' is unsubstituted C1-18Alkyl.In certain embodiments, R ' is substituted C1-18Alkyl (such as by such as alkoxy such as methoxyl group or C3-6Carbocyclic ring such as 1- cyclopropyl nonyl or C (O) O- alkyl or OC (O)-alkyl such as C (O) OCH3Or OC (O) CH3Substituted C1-15Alkyl).For example, R ' is
In certain embodiments, R ' is branched chain C1-18Alkyl.For example, R ' is
In some embodiments, R " is selected from by C3-15Alkyl and C3-15The group of alkenyl composition.In some embodiments, R " is C3Alkyl, C4Alkyl, C5Alkyl, C6Alkyl, C7Alkyl or C8Alkyl.In some embodiments, R " is C9Alkyl, C10Alkane Base, C11Alkyl, C12Alkyl, C13Alkyl, C14Alkyl or C15Alkyl.
In some embodiments, M ' is-C (O) O-.In some embodiments, M ' is-OC (O)-.In some implementations In scheme, M ' is-OC (O)-M "-C (O) O-.
In other embodiments, M ' is aryl or heteroaryl.For example, M ' can select free phenyl, oxazole and thiazole group At group.
In some embodiments, M is-C (O) O-.In some embodiments, M is-OC (O)-.In some embodiment party In case, M is-C (O) N (R ')-.In some embodiments, M is-P (O) (OR ') O-.In some embodiments, M is-OC (O)-M”-C(O)O-。
In other embodiments, M is aryl or heteroaryl.For example, M can select free phenyl, oxazole and thiazole composition Group.
In some embodiments, M is identical as M '.In other embodiments, M is different from M '.
In some embodiments, M " is key.In some embodiments, M " is C1-13Alkyl or C2-13Alkenyl.Some In embodiment, M " is C1-6Alkyl or C2-6Alkenyl.In certain embodiments, M " is straight chained alkyl or alkenyl.In certain realities It applies in scheme, M " is branched chain, such as-CH (CH3)CH2-。
In some embodiments, each R5It is H.In certain such embodiments, each R6It is also H.
In some embodiments, R7It is H.In other embodiments, R7It is C1-3Alkyl (such as methyl, ethyl, propyl Or isopropyl).
In some embodiments, R2And R3It is independently C5-14Alkyl or C5-14Alkenyl.
In some embodiments, R2With R3It is identical.In some embodiments, R2And R3It is C8Alkyl.In certain implementations In scheme, R2And R3It is C2Alkyl.In other embodiments, R2And R3It is C3Alkyl.In some embodiments, R2And R3It is C4Alkyl.In certain embodiments, R2And R3It is C5Alkyl.In other embodiments, R2And R3It is C6Alkyl.In some realities It applies in scheme, R2And R3It is C7Alkyl.
In other embodiments, R2With R3It is different.In certain embodiments, R2It is C8Alkyl.In some embodiments In, R3It is C1-7(such as C1、C2、C3、C4、C5、C6Or C7Alkyl) or C9Alkyl.
In some embodiments, R7And R3It is H.
In certain embodiments, R2It is H.
In some embodiments, m is 5,7 or 9.
In some embodiments, R4Selected from-(CH2)nQ and-(CH2)nCHQR。
In some embodiments, Q is selected from the group being made up of :-OR ,-OH ,-O (CH2)nN(R)2、-OC(O)R、- CX3、-CN、-N(R)C(O)R、-N(H)C(O)R、-N(R)S(O)2R、-N(H)S(O)2R、-N(R)C(O)N(R)2、-N(H)C(O) N(R)2、-N(H)C(O)N(H)(R)、-N(R)C(S)N(R)2、-N(H)C(S)N(R)2、-N(H)C(S)N(H)(R)、-C(R)N (R)2C(O)OR、-N(R)S(O)2R8, carbocyclic ring and heterocycle.
In certain embodiments, Q is-N (R) R8、-N(R)S(O)2R8、-O(CH2)nOR ,-N (R) C (=NR9)N (R)2,-N (R) C (=CHR9)N(R)2、-OC(O)N(R)2Or-N (R) C (O) OR.
In certain embodiments, Q is-N (OR) C (O) R ,-N (OR) S (O)2R、-N(OR)C(O)OR、-N(OR)C(O)N (R)2、-N(OR)C(S)N(R)2,-N (OR) C (=NR9)N(R)2Or-N (OR) C (=CHR9)N(R)2。
In certain embodiments, Q is thiocarbamide or its isostere, such asOr-NHC (=NR9)N (R)2。
In certain embodiments, Q is-C (=NR9)N(R)2.For example, when Q is-C (=NR9)N(R)2When, n is 4 or 5. For example, R9It is-S (O)2N(R)2。
In certain embodiments, Q is-C (=NR9) R or-C (O) N (R) OR, such as-CH (=N-OCH3)、-C(O)NH- OH、-C(O)NH-OCH3、-C(O)N(CH3)-OH or-C (O) N (CH3)-OCH3。
In certain embodiments, Q is-OH.
In certain embodiments, Q is substituted or unsubstituted 5 to 10 unit's heteroaryl, for example, Q be triazole, imidazoles, Pyrimidine, purine, 2- amino -1,9- dihydro -6H- purine-6-one -9- base (or guanine -9- base), adenine -9- base, born of the same parents are phonetic Pyridine -1- base or uracil -1- base are respectively optionally selected from alkyl, OH, alkoxy,-alkyl-OH,-alkyl-by one or more The substituent group of O- alkyl replaces, and the substituent group can be further substituted.In certain embodiments, Q is substituted 5 to 14 membered heterocycloalkyls, such as by one or more selected from oxo (=O), OH, amino, monoalkyl or dialkyl amido with And C1-3The substituent group of alkyl replaces.For example, Q is 4- methyl piperazine base, 4- (4- mehtoxybenzyl) piperazinyl, isoindoline- 2- base -1,3- diketone, pyrrolidin-1-yl -2,5- diketone or imidazolidine -3- base -2,4- diketone.
In certain embodiments, Q is-NHR8, wherein R8It is optionally to be replaced by one or more from the following substituent group C3-6Naphthenic base: oxo (=O), amino (NH2), monoalkyl or dialkyl amido, C1-3Alkyl and halogenated.For example, R8It is ring fourth Alkenyl, such as 3- (dimethylamino)-ring butyl- 3- alkene -4- base -1,2- diketone.In other embodiments, R8It is optionally by one The C that a or multiple substituent groups selected from the following replace3-6Naphthenic base: oxo (=O), thio (=S), amino (NH2), monoalkyl Or dialkyl amido, C1-3Alkyl, Heterocyclylalkyl and halogenated, wherein the monoalkyl or dialkyl amido, C1-3Alkyl and heterocycle Alkyl is further substituted.For example, R8It is the cyclobutane bases replaced by the one or more in oxo, amino and alkyl amino, Wherein the alkyl amino is further by for example following one or more substitutions: C1-3Alkoxy, amino, monoalkyl or dialkyl group Amino and halogenated.For example, R8It is 3- (((dimethylamino) ethyl) amino) ring butyl- 3- alkenyl -1,2- diketone.For example, R8Be by One or more cyclobutane bases replaced in oxo and alkyl amino.For example, R8It is alkene -1 3- (ethylamino) ring butyl- 3-, 2- diketone.For example, R8It is by one or more cyclobutane bases replaced in oxo, thio and alkyl amino.For example, R8It is 3- (ethylamino) -4- sulphur oxo ring but-2-ene -1- ketone or 2- (ethylamino) -4- sulphur oxo ring but-2-ene -1- ketone.For example, R8It is by one or more cyclobutane bases replaced in thio and alkyl amino.For example, R8It is 3- (ethylamino) ring butyl- 3- Alkene -1,2- dithione.For example, R8It is by one or more cyclobutane bases replaced in oxo and dialkyl amido.For example, R8 It is 3- (diethylamino) ring butyl- 3- alkene -1,2- diketone.For example, R8Be by one in oxo, thio and dialkyl amido or Multiple substituted cyclobutane bases.For example, R8It is 2- (diethylamino) -4- sulphur oxo ring but-2-ene -1- ketone or 3- (diethyl Amino) -4- sulphur oxo ring but-2-ene -1- ketone.For example, R8It is by one or more substitutions in thio and dialkyl amido Cyclobutane base.For example, R8It is 3- (diethylamino) ring butyl- 3- alkene -1,2- dithione.For example, R8It is by oxo and alkyl amino Or one or more cyclobutane bases replaced in dialkyl amido, wherein alkyl amino or dialkyl amido are further by for example One or more alkoxies replace.For example, R8It is 3- (bis- (2- methoxy ethyl) amino) ring butyl- 3- alkene -1,2- diketone.Example Such as, R8It is by one or more cyclobutane bases replaced in oxo and Heterocyclylalkyl.For example, R8It is by oxo and piperidyl, piperazine One or more cyclobutane bases replaced in piperazine base or morpholinyl.For example, R8Be by one in oxo and Heterocyclylalkyl or Multiple substituted cyclobutane bases, wherein Heterocyclylalkyl is further by such as one or more C1-3Alkyl replaces.For example, R8Be by One or more cyclobutane bases replaced in oxo and Heterocyclylalkyl, wherein Heterocyclylalkyl (such as piperidyl, piperazinyl or Quinoline base) further replaced by methyl.
In certain embodiments, Q is-NHR8, wherein R8It is optionally to be replaced by one or more from the following substituent group Heteroaryl: amino (NH2), monoalkyl or dialkyl amido, C1-3Alkyl and halogenated.For example, R8It is thiazole or imidazoles.
In certain embodiments, Q is-NHC (=NR9)N(R)2, wherein R9It is CN, C1-6Alkyl, NO2、-S(O)2N (R)2、-OR、-S(O)2R or H.For example, Q is-NHC (=NR9)N(CH3)2,-NHC (=NR9)NHCH3,-NHC (=NR9)NH2。 In some embodiments, Q is-NHC (=NR9)N(R)2, wherein R9It is CN and R is replaced by monoalkyl or dialkyl amido C1-3Alkyl, such as R are ((dimethylamino) ethyl) amino.In some embodiments, Q is-NHC (=NR9)N(R)2, Wherein R9It is C1-6Alkyl, NO2、-S(O)2N(R)2、-OR、-S(O)2R or H and R are replaced by monoalkyl or dialkyl amido C1-3Alkyl, such as R are ((dimethylamino) ethyl) amino.
In certain embodiments, Q is-NHC (=CHR9)N(R)2, wherein R9It is NO2、CN、C1-6Alkyl ,-S (O)2N (R)2、-OR、-S(O)2R or H.For example, Q is-NHC (=CHR9)N(CH3)2,-NHC (=CHR9)NHCH3Or-NHC (=CHR9) NH2。
In certain embodiments, Q is-OC (O) N (R)2,-N (R) C (O) OR ,-N (OR) C (O) OR, such as-OC (O) NHCH3、-N(OH)C(O)OCH3、-N(OH)C(O)CH3、-N(OCH3)C(O)OCH3、-N(OCH3)C(O)CH3、-N(OH)S(O)2CH3Or-NHC (O) OCH3。
In certain embodiments, Q is-N (R) C (O) R, and wherein R is optionally by C1-3Alkoxy or S (O)tC1-3Alkyl takes The alkyl in generation, wherein t is 0,1 or 2.
In certain embodiments, Q is unsubstituted or substituted C6-10Aryl (such as phenyl) or C3-6Naphthenic base.
In some embodiments, n is 1.In other embodiments, n is 2.In other embodiments, n is 3.In In certain other embodiments, n is 4.For example, R4It can be-(CH2)2OH.For example, R4It can be-(CH2)3OH.For example, R4It can To be-(CH2)4OH.For example, R4It can be benzyl.For example, R4It can be 4- mehtoxybenzyl.
In some embodiments, R4It is C3-6Carbocyclic ring.In some embodiments, R4It is C3-6Naphthenic base.For example, R4It can To be optionally by such as OH, halogenated, C1-6The substituted cyclohexyl such as alkyl.For example, R4It can be 2- hydroxy-cyclohexyl.
In some embodiments, R is H.
In some embodiments, R is the C replaced by monoalkyl or dialkyl amido1-3Alkyl, such as R are ((dimethyl Amino) ethyl) amino.
In some embodiments, R is by one or more selected from by C1-3Alkoxy, amino and C1-C3Dialkyl amido The C that the substituent group of the group of composition replaces1-6Alkyl.
In some embodiments, R is unsubstituted C1-3Alkyl or unsubstituted C2-3Alkenyl.For example, R4It can be with It is-CH2CH(OH)CH3、-CH(CH3)CH2OH or-CH2CH(OH)CH2CH3。
In some embodiments, R is substituted C1-3Alkyl, such as CH2OH.For example, R4It can be-CH2CH(OH) CH2OH、-(CH2)3NHC(O)CH2OH、-(CH2)3NHC(O)CH2OBn、-(CH2)2O(CH2)2OH、-(CH2)3NHCH2OCH3、- (CH2)3NHCH2OCH2CH3、CH2SCH3、CH2S(O)CH3、CH2S(O)2CH3Or-CH (CH2OH)2。
In some embodiments, R4Selected from any of following group:
In some embodiments, R4Selected from any of following group:
In some embodiments, the compound of formula (III) also includes anion.As described herein, and anion Can be can react any anion to form ammonium salt with amine.Example include but is not limited to chloride ion, bromide ion, iodide ion, Fluorine ion, acetate, formate, trifluoroacetic acid root, difluoroacetic acid root, trichloroacetic acid root and phosphate radical.
In some embodiments, any of various compound described herein is suitable for preparing applies for intramuscular Nanoparticle compositions.
In some embodiments, R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring.In some implementations In scheme, R2And R3The atom connected together with it be formed together with one or more heteroatomic 5 selected from N, O, S and P to 14 yuan of aromatic series or non-aromatic heterocyclic.In some embodiments, R2And R3The atom connected together with it is formed together optionally Substituted aromatic series or non-aromatic C3-20Carbocyclic ring (such as C3-18Carbocyclic ring, C3-15Carbocyclic ring, C3-12Carbocyclic ring or C3-10Carbocyclic ring).One In a little embodiments, R2And R3The atom connected together with it is formed together C3-6Carbocyclic ring.In other embodiments, R2And R3Even C is formed together with its atom connected6Carbocyclic ring, such as cyclohexyl or phenyl.In certain embodiments, the heterocycle or C3-6 Carbocyclic ring is substituted with one or more alkyl groups (such as at same annular atom or at adjacent or non-conterminous annular atom).Example Such as, R2And R3The atom connected together with it, which can be formed, has one or more C5Alkyl-substituted cyclohexyl or phenyl. In certain embodiments, by R2And R3The heterocycle or C of formation3-6Carbocyclic ring is replaced by carbon ring group.For example, R2And R3Together with its institute The atom of connection can form cyclohexyl or phenyl together, which is replaced by cyclohexyl.In some embodiments, R2And R3 The atom connected together with it is formed together C7-15Carbocyclic ring, such as suberyl, cyclopentadecane base or naphthalene.
In some embodiments, R4Selected from-(CH2)nQ and-(CH2)nCHQR.In some embodiments, Q be selected from by with The group of lower composition :-OR ,-OH ,-O (CH2)nN(R)2、-OC(O)R、-CX3、-CN、-N(R)C(O)R、-N(H)C(O)R、-N(R)S (O)2R、-N(H)S(O)2R、-N(R)C(O)N(R)2、-N(H)C(O)N(R)2、-N(R)S(O)2R8、-N(H)C(O)N(H)(R)、- N(R)C(S)N(R)2、-N(H)C(S)N(R)2,-N (H) C (S) N (H) (R) and heterocycle.In other embodiments, Q be selected from by with The group of lower composition: imidazoles, pyrimidine and purine.
In some embodiments, R2And R3The atom connected together with it is formed together heterocycle or carbocyclic ring.In some implementations In scheme, R2And R3The atom connected together with it is formed together C3-6Carbocyclic ring, such as phenyl.In certain embodiments, described miscellaneous Ring or C3-6Carbocyclic ring is substituted with one or more alkyl groups (such as at same annular atom or in adjacent or non-conterminous annular atom Place).For example, R2And R3The atom connected together with it, which can be formed, has one or more C5Alkyl-substituted phenyl.
In some embodiments, at least one existing R5And R6It is C1-3Alkyl, such as methyl.In some embodiments In, the R of neighbouring M5And R6First is that C1-3Alkyl, such as methyl, and the other is H.In some embodiments, adjacent to M's R5And R6First is that C1-3Alkyl, such as methyl, and the other is H, and M is-OC (O)-or-C (O) O-.
In some embodiments, R5And R6In at most one in the presence of be C1-3Alkyl, such as methyl.In some implementations In scheme, the R of neighbouring M5And R6First is that C1-3Alkyl, such as methyl, and the other is H.In some embodiments, neighbouring The R of M5And R6First is that C1-3Alkyl, such as methyl, and the other is H, and M is-OC (O)-or-C (O) O-.
In some embodiments, R5And R6It is H at each occurrence.
In some embodiments, the compound of formula (I) is selected from the group being made up of:
In other embodiments, the compound of formula (I) is selected from the group being made up of:
In some embodiments, the compound of formula (I) is selected from the group being made up of:
And its N- oxide, its salt and isomers.
In some embodiments, the lipid of the disclosure includes compound 340:
According to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) the center amine moiety of lipid can protonate at physiological ph.Therefore, lipid can it is positively charged at physiological ph or Part positive charge.These lipids are properly termed as cationic or ionizable (amino) lipid.Lipid can also be amphoteric ion Property, that is, while positively charged and negative electrical charge neutral molecule.
As used herein, term " alkyl " or " alkyl group " are meant to including one or more carbon atoms (such as one It is a, two, three, four, five, six, seven, eight, nine, ten, 11,12,13,14, 15,16,17,18,19,20 or more carbon atoms) optionally substituted straight chain or Branched chain saturated hydrocarbons.Mark " C1-14Alkyl " is meant to optionally substituted straight chain including 1-14 carbon atom or branched chain is full And hydrocarbon.Unless specifically stated otherwise, otherwise alkyl as described herein refers to two kinds of unsubstituted and substituted alkyl.
As used herein, term " alkenyl " or " alkenyl group " be meant to including two or more carbon atoms (such as Two, three, four, five, six, seven, eight, nine, ten, 11,12,13,14,15 A, 16,17,18,19,20 or more carbon atoms) and the optional of at least one double bond taken The straight chain or branch's chain hydrocarbon in generation.Mark " C2-14Alkenyl " is meant to including 2-14 carbon atom and at least one carbon-to-carbon double bond Optionally substituted straight chain or branch's chain hydrocarbon.Alkenyl may include two, three, four, or more carbon-to-carbon double bond. For example, C18Alkenyl may include one or more double bonds.C including two double bonds18Alkenyl can be sub- oil base.Unless in addition It illustrates, otherwise alkenyl as described herein refers to two kinds of unsubstituted and substituted alkenyl.
As used herein, term " alkynyl " or " alkynyl group " be meant to including two or more carbon atoms (such as Two, three, four, five, six, seven, eight, nine, ten, 11,12,13,14,15 A, 16,17,18,19,20 or more carbon atoms) and at least one carbon-carbon triple bond is optional Substituted straight chain or branch's chain hydrocarbon.Mark " C2-14Alkynyl " is meant to including 2-14 carbon atom and at least one carbon-to-carbon three The optionally substituted straight chain or branch's chain hydrocarbon of key.Alkynyl may include two, three, four, or more carbon-to-carbon three Key.For example, C18Alkynyl may include one or more carbon-carbon triple bonds.Unless specifically stated otherwise, otherwise alkynyl as described herein Refer to two kinds of unsubstituted and substituted alkynyl.
As used herein, term " carbocyclic ring " or " carbon ring group ", which are meant to, is made of including one or more carbon atom The optionally substituted monocycle or multi-loop system of ring.Ring can be ternary, quaternary, five yuan, hexa-atomic, seven yuan, eight yuan, nine yuan, ten Member, ten unitary, ten binary, ten ternarys, ten quaternarys, 15 yuan, ten hexa-atomic, 17 yuan, 18 yuan, 19 yuan or two ten-rings. Mark " C3-6Carbocyclic ring " is meant to the carbocyclic ring including the monocycle with 3-6 carbon atom.Carbocyclic ring may include one or more carbon- Carbon double or triple bonds and it can be non-aromatic or aromatic ring (such as naphthenic base or aryl).The example of carbocyclic ring includes cyclopropyl Base, cyclopenta, cyclohexyl, phenyl, naphthalene and 1,2- ihydro naphthyl.As used herein, term " naphthenic base " is meant to non-aromatic Fragrant race's carbocyclic ring and it may include or may not include any double or triple bonds.Unless specifically stated otherwise, otherwise as described herein Carbocyclic ring refers to two kinds of unsubstituted and substituted carbon ring group, that is, optionally substituted carbocyclic ring.
As used herein, term " heterocycle " or " heterocyclic group " are meant to including one or more rings and at least one ring Including at least one heteroatomic optionally substituted monocycle or multi-loop system.Hetero atom can be such as nitrogen, oxygen or sulphur atom. Ring can be ternary, quaternary, five yuan, hexa-atomic, seven yuan, eight yuan, nine yuan, ten yuan, ten unitary, ten binary, ten ternarys or ten quaternarys Ring.Heterocycle may include one or more double or triple bonds and can be non-aromatic or aromatic ring (such as Heterocyclylalkyl Or heteroaryl).The example of heterocycle includes imidazole radicals, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazoles Alkyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazole alkyl, isothiazolyl, morpholinyl, pyrrole radicals, pyrrolidinyl, furan It mutters base, tetrahydrofuran base, thienyl, pyridyl group, piperidyl, quinolyl and isoquinolyl.As used herein, term " heterocycle Alkyl " is meant to non-aromatic heterocyclic and may include or may not include any double or triple bonds.Unless specifically stated otherwise, Otherwise heterocycle as described herein refers to two kinds of unsubstituted and substituted heterocyclic group, that is, optionally substituted heterocycle.
As used herein, " biodegradable groups " can help to accelerate lipid be metabolized in mammalian subject Group.Biodegradable groups can be selected from by but be not limited to group consisting of :-C (O) O- ,-OC (O)-,-C (O) N (R’)-、-N(R’)C(O)-、-C(O)-、-C(S)-、-C(S)S-、-SC(S)-、-CH(OH)-、-P(O)(OR’)O-、-S (O)2, aryl and heteroaryl.As used herein, " aryl " is include one or more aromatic rings optionally substituted Carbon ring group.The example of aryl includes phenyl and naphthalene.As used herein, " heteroaryl " be include one or more aromatic series The optionally substituted heterocyclic group of ring.The example of heteroaryl include pyrrole radicals, furyl, thienyl, imidazole radicals, oxazolyl and Thiazolyl.Aryl and heteroaryl can be optionally substituted.For example, M and M ' can be selected from by optionally substituted phenyl, oxazole With non-limiting group of thiazole composition.In this paper is various, M and M ' can be independently selected from the clear of the above biodegradable groups It is single.Unless specifically stated otherwise, otherwise aryl or heteroaryl as described herein refer to two kinds of unsubstituted and substituted group, That is, optionally substituted aryl or heteroaryl.
Unless specifically stated otherwise, otherwise alkyl, alkenyl and ring group (such as carbocylic radical and heterocycle) can optionally be taken Generation.Optionally substituted base can be selected from by but be not limited to group consisting of: halogen atom (such as chloro, bromo, fluorine-based or iodine Base), carboxylic acid (such as-C (O) OH), alcohol (such as hydroxyl ,-OH), ester (such as-C (O) OR or-OC (O) R), aldehyde (such as-C (O) H), (such as-C (O) X, wherein X is selected from bromine, fluorine, chlorine and iodine for carbonyl (such as-C (O) R, or indicated by C=O), acyl halide Halogen), carbonate group (such as-OC (O) OR), alkoxy (such as-OR), acetal (such as-C (OR)2R " ", wherein each OR is phase With or different alkoxies and R " " be alkyl or alkenyl), phosphate radical (such as P (O)4 3-), sulfenyl (such as-SH), sulfoxide (example Such as-S (O) R), sulfinic acid (such as-S (O) OH), sulfonic acid (such as-S (O)2OH), thioaldehydes (such as-C (S) H), sulfate radical (such as S(O)4 2-), sulfonyl (such as-S (O)2), amide (such as-C (O) NR2Or-N (R) C (O) R), azido (such as-N3), nitre Base (such as-NO2), cyano (such as-CN), isocyano group (such as-NC), acyloxy (such as-OC (O) R), amino (such as-NR2、- NRH or-NH2), carbamyl (such as-OC (O) NR2,-OC (O) NRH or-OC (O) NH2), sulfonamide (such as-S (O)2NR2、-S (O)2NRH、-S(O)2NH2、-N(R)S(O)2R、-N(H)S(O)2R、-N(R)S(O)2H or-N (H) S (O)2H), alkyl, alkenyl and Ring group (such as carbocylic radical or heterocycle).It is aforementioned it is any in, R is alkyl or alkenyl as herein defined.In some realities It applies in scheme, substituent group itself can be further as defined herein by such as one, two, three, four, five or six Substituent group replace.For example, C1-6Alkyl can be further as described herein by one, two, three, four, five or six Substituent group replace.
Disclosure compound containing nitrogen can be by with oxidant (such as 3- chloroperoxybenzoic acid (mCPBA) and/or mistake Hydrogen oxide) it handles and is converted to N- oxide, thus obtain other compounds of the disclosure.Therefore, when valence state and structure allow When, consider all displays and desired nitrogenous compound all includes that shown compound (can be with table with its N- oxide derivative It is shown as N → O or N+-O-).In addition, in other cases, the nitrogen in disclosure compound can be converted to N- hydroxyl or N- alkane Oxo-compound.For example, N- hydroxy compounds can be prepared by aoxidizing parent amine with oxidant such as m-CPBA.When valence state and When structure allows, it is also contemplated that all nitrogenous compounds for showing and requiring include shown compound and its N- hydroxyl (that is, N- OH) and N- alkoxy (that is, N-OR, wherein R is the C being substituted or unsubstituted1-C6Alkyl, C1-C6Alkenyl, C1-C6Alkynyl, 3-14 First carbocyclic ring or 3-14 circle heterocyclic ring) derivative.
About, approximatively: as used herein, term " approximatively " and " about " are when for one or more values of interest Refer to the value similar with the reference value.In certain embodiments, unless specified otherwise herein or in addition from context it is clear that no Then term " approximatively " or " about " refer to the reference value either direction (being more than or less than) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or lower percentage range in a series of values (this value will be more than probable value 100% situation except).For example, working as When for giving the amount of compound in the lipid composition of nanoparticle compositions, " about " can refer to +/- the 10% of described value.Example Such as, the nanoparticle compositions including the lipid composition with about 40% given compound may include describedization of 30-50% Close object.
As used herein, term " compound " is intended to all isomers and isotope including described structure." same to position Element " refers to same atoms number but has the atom of different quality number because the number of neutrons in core is different.For example, hydrogen is same Position element includes tritium and deuterium.In addition, the compound of the disclosure, salt or compound can be with solvents or the preparation of moisture sub-portfolio to pass through Conventional method forms solvate and hydrate.
As used herein, term " contact ", which is meant to, establishes physical connection between two or more entities.For example, It contacts mammalian cell with nanoparticle compositions and connects it is meant that mammalian cell and nanoparticle is made to share physics It connects.The method for contacting cell in vivo and in vitro with external entity is well-known in biological field.For example, making nanoparticle Sub-portfolio object in mammalian cell in the mammalian body contact can by different administration approach (such as intravenously, It is intramuscular, intradermal and subcutaneous) it carries out and different amounts of nanoparticle compositions can be related to.In addition, nanoparticle compositions More than one mammalian cell can be contacted.
As used herein, term " delivering ", which is meant to, is provided to target for entity.For example, by therapeutic agent and/or prevention Agent is delivered to subject and can be related to the nanoparticle compositions including the therapeutic agent and/or prophylactic being administered to the subject (such as passing through intravenous, intramuscular, intradermal or subcutaneous route).Nanoparticle compositions are administered to mammal or lactation is moved Object cell can be related to contact one or more cells with the nanoparticle compositions.
As used herein, term " promoting ground delivering " is meant to and is passed therapeutic agent and/or prophylactic by nanoparticle Send to destination organization (such as mammal liver) of interest and be higher than (such as high at least 1.5 times, it is at least 2 times high, at least 3 times high, High at least 4 times, it is at least 5 times high, at least 6 times high, at least 7 times high, at least 8 times high, at least 9 times high, at least 10 times high) by pair Therapeutic agent and/or prophylactic are delivered to the water of destination organization of interest (such as MC3, KC2 or DLinDMA) according to nanoparticle It is flat.The delivering level of nanoparticle can pass through the amount for the protein that will be generated in tissue and the weight of the tissue in specific organization Amount compares, and the amount of therapeutic agent in tissue and/or prophylactic is compared with the weight of the tissue, the egg that will be generated in tissue The amount of white matter is compared with the amount of gross protein in the tissue or by the amount of therapeutic agent in tissue and/or prophylactic and described group The amount of total therapeutic agent and/or prophylactic is measured compared to relatively in knitting.It will be appreciated that nanometer in treated subject's body need not be measured Enhancement from particle to destination organization deliver, which can the measurement in the substitute such as animal model (such as rat model). In certain embodiments, including according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), the nanoparticle compositions of the compound of (IIg) or (III) there is substantially the same delivering to promote horizontal, no matter it applies With approach how.For example, certain compounds disclosed herein, which are worked as, is used for delivering therapeutic agent and/or prevention in intravenously or intramuscularly Similar delivering enhancement effect is shown when agent.In other embodiments, certain compounds disclosed herein (such as formula (IA) or the compound of (II), as compound 18,25,30,60,108-112 or 122) when for intramuscular delivery therapeutic agent and/ Or the delivering enhancement level showed when prophylactic is higher than the level showed when intravenous delivery.
As used herein, term " specific delivery (specific delivery/specifically deliver/ Specifically delivering) ", be meant to through nanoparticle therapeutic agent and/or prophylactic are delivered to it is of interest Destination organization (such as mammal liver) be higher than (such as high at least 1.5 times, it is at least 2 times high, at least 3 times high, at least 4 times high, high At least 5 times, at least 6 times high, at least 7 times high, at least 8 times high, at least 9 times high, at least 10 times of height) it is delivered to non-target tissues (such as mammal spleen).The delivering level of nanoparticle can pass through the amount for the protein that will be generated in tissue in specific organization Compared with the weight of the tissue, the amount of therapeutic agent in tissue and/or prophylactic is compared with the weight of the tissue, it will The amount of the protein generated in tissue is compared with the amount of gross protein in the tissue or by therapeutic agent in tissue and/or prevention The amount of agent relatively measures compared with the amount of therapeutic agent total in the tissue and/or prophylactic.For example, being targeted for Renal vascular, such as For fruit after systemic administration therapeutic agent and/or prophylactic, the therapeutic agent and/or preventive dose for being delivered to every 1g tissue of kidney are deliverings To 1.5 times, 2 times, 3 times, 5 times, 10 times, 15 times or 20 times of the therapeutic agent and/or preventive dose of liver or spleen, then compared to liver and Spleen, the therapeutic agent and/or prophylactic are provided to mammal kidney by specificity.It will be appreciated that treated subject need not be measured For internal nanoparticle to the specific delivery of destination organization, which can be in substitute such as animal model (such as rat model) Middle measurement.
As used herein, " encapsulation efficiency " refers to the therapeutic agent of a part for becoming nanoparticle compositions and/or pre- The ratio of anti-dose of amount and the initial total amount of the therapeutic agent and/or prophylactic that are used to prepare in nanoparticle compositions.For example, such as Fruit has 97mg therapeutic agent and/or prophylactic quilt in the total 100mg therapeutic agent and/or prophylactic being initially provided of into composition It is encapsulated in nanoparticle compositions, then it can be concluded that encapsulation efficiency is 97%.As used herein, " encapsulating " can refer to Entirely, major part or partial encapsulation, sealing, encirclement or packaging.
As used herein, " expression " of nucleic acid sequence refers to that mRNA translates into polypeptide or protein and/or polypeptide or egg The posttranslational modification of white matter.
As used herein, term " external " refers in artificial environment, such as in test tube or reaction vessel, cell culture Occur in object, in petri dish (Petri dish) etc. rather than is sent out inside organism (such as animal, plant or microorganism) Raw event.
As used herein, term " internal " refer to organism (such as animal, plant or microorganism or its cell or Tissue) the internal event occurred.
As used herein, term " in vitro " refer to organism (such as animal, plant or microorganism or its cell or Tissue) the external event occurred.In vitro event can be sent out changing in the smallest environment relative to natural (such as internal) environment It is raw.
As used herein, term " isomers " is meant to any geometric isomer of compound, tautomer, both sexes Ion, stereoisomer, enantiomer or diastereomer.Compound may include one or more chiral centres and/ Or double bond, and therefore spatially isomers, as double bond isomer (that is, geometry E/Z isomers) or diastereoisomer are (such as right Reflect isomers (that is, (+) or (-)) or cis/trans isomers) form presence.The disclosure covers compounds described herein Any and all isomers, including (such as geometrical isomerism is pure, enantiomer-pure or diastereo-isomerism for the pure form of alloisomerism It is pure) and enantiomter and stereoisomer mixture, such as racemate.The enantiomter and alloisomerism of compound It body mixture and is split into its mode for forming enantiomter or stereoisomer and is well-known.
" tautomer " be balance exist and be easy to be converted to from a kind of isomers two kinds of another isomers or One of more kinds of constitutional isomers.This conversion causes the form of hydrogen atom to migrate the transformation with adjacent conjugated double bond.Interconversion Isomers exists with the form of mixtures of tautomer collection in the solution.It, will in the solution that tautomerization may occurs Reach the chemical balance of tautomer.The definite ratio of tautomer depends on a number of factors, including temperature, solvent and pH Value.It can be known as tautomerism by the concept for the tautomer that tautomerization is mutually converted.
In various types tautomerism that may be present, there are two types of be frequently observed.It mutually makes a variation in keto-enol In structure, electronics and hydrogen atom are displaced simultaneously.Ring-chain tautomerism be due in sugar chain molecule aldehyde radical (- CHO) with it is same A hydroxyl (- OH) in molecule is reacted and assigns it as ring-type (annular) form showed by glucose causes.
Common tautomerism is to having: in heterocycle (such as in nucleobase, in guanine, thymidine and cytimidine) Keto-enol, amide-nitrile, lactams-lactim, amide-imidic acid tautomerism and imine-enamine and enamine-enamine. Tautomeric example in disubstituted guanidine is shown in down.
It will be appreciated that the compound of the disclosure can be described with different tautomers.It should also be clear that when compound has mutually When becoming isomeric form, all tautomeric forms are intended to be included in the scope of the present disclosure, and the name of these compounds It is not excluded for any tautomeric forms.
As used herein, " lipid composition " be include one or more lipids nanoparticle compositions component.Example Such as, lipid composition may include one or more cationics/ionizable lipid, pegylated lipids, structural lipid Or other lipids, such as phosphatide.
As used herein, " connexon " is the company connected between two nucleosides of the part such as cap species of two parts It connects.Connexon may include one or more groups, including but not limited to phosphate-based (such as phosphate-based, borane phosphonate Base, thiophosphoric acid ester group, phosphoroselenoate ester group and phosphonate group), alkyl, amic acid ester group or glycerol.For example, cap analog Two nucleosides can be in its 5 ' position by triphosphoric acid ester group or by including two phosphonate moieties and a borane phosphonate Partially your chain link.
As used herein, " method of administration " may include intravenous, intramuscular, it is intradermal, subcutaneous or deliver composition To other methods of subject.The selection of method of administration answer targeted delivery (such as specific delivery) to the specific region of body or System.
As used herein, " modified " is meant to non-natural.For example, RNA can be the RNA of modified.Also It is to say, RNA may include one or more non-naturally occurring nucleobases, nucleosides, nucleotide or connexon." modified " object Kind can also be known as " change " species herein.Species in chemistry, in structure or functionally can be modified or be changed Become.For example, the nucleobase species of modified may include one or more non-naturally occurring substitutions.
As used herein, " N:P ratio " is phosphorus in (in the physiological pH range) nitrogen-atoms of ionizable in lipid and RNA The molar ratio of perester radical, the ratio in the nanoparticle compositions for example including lipid composition and RNA.
As used herein, " nanoparticle compositions " are the compositions comprising one or more lipids.Nanoparticle subgroup Close object typically about micron order or smaller size and may include double-layer of lipoid.Nanoparticle compositions are covered lipid and are received Rice corpuscles (LNP), liposome (such as lipid vesicle) and lipid complex.For example, nanoparticle compositions, which can be, to be had directly Diameter is the liposome of 500nm or smaller double-layer of lipoid.
As used herein, " naturally occurring " is meant to exists in nature, and prosthetic assists.
As used herein, " patient ", which refers to, may seek or require to treat, need to treat, positive receiving treatment, Ji Jiangjie Treated subject, or the subject under the nursing for specified disease or the trained professional of the patient's condition.
As used herein, " PEG lipid " or " pegylated lipids " refer to the lipid comprising polyethylene glycol component.
Phrase " pharmaceutically acceptable " herein for refer within a reasonable range of medical judgment, be suitable for the mankind and Animal tissue's contact is used and is imitated without excessive toxicity, stimulation, allergic reaction or other problems or complication, and with reasonable Compound, material, composition and/or the dosage form that benefit/Hazard ratio is consistent.
As used herein, phrase " pharmaceutically acceptable excipient " refers to and nothing generally nontoxic in patient's body Inflammatory reaction in addition to compounds described herein any ingredient (such as can make reactive compound suspend, formed it is compound Object or the mediator of dissolution).Excipient may include for example: anti-binder, binder, coating, compression aid, collapses antioxidant Solve agent, dyestuff (pigment), moderator, emulsifier, filler (diluent), film forming agent or coating, flavoring agent, fragrance, glidant Water is used in (flow enhancing agent), lubricant, preservative, printing ink, adsorbent, suspending agent or dispersing agent, sweetener and hydration. Exemplary excipients include but is not limited to: butylated hydroxytoluene (BHT), calcium carbonate, dicalcium phosphate, calcium stearate, crosslinking Sodium carboxymethylcellulose, crosslinked polyvinylpyrrolidone, citric acid, crospovidone (crospovidone), cysteine, second Base cellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, lactose, magnesium stearate, maltitol, mannitol, Methionine, methylcellulose, methyl p-hydroxybenzoate, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, poly- dimension Ketone, pregelatinized starch, P-hydroxybenzoic acid phenyl ester, retinyl palmitate, shellac, silica, sodium carboxymethylcellulose, lemon Lemon acid sodium, sodium starch glycollate, D-sorbite, starch (corn), stearic acid, sucrose, talcum, titanium dioxide, vitamin A, Vitamin E (alpha-tocopherol), vitamin C, xylitol and other species disclosed herein.
In the present specification, the structural formula of compound is convenient and certain isomers is presented in some cases, but this public affairs It opens including all isomers, such as geometric isomer, the optical isomer based on asymmetric carbon, stereoisomer, tautomer Deng, it should be understood that and not all isomers all has identical activity level.In addition, the compound that these formulas are presented is also possible to deposit In crystal polymorphism.It should be noted that its any crystal form, crystal form mixture or acid anhydrides or hydrate are all included in this public affairs In the range of opening.
Term " crystalline polymorph ", " polymorphic " or " crystal form " is meant to crystal structure, in these structures, a kind of Compound (or its salt or solvate) can crystallize into different crystal accumulation arrangement, and all these arrangements all have identical element Composition.Different crystal form usually have different X-ray diffraction modes, infrared spectroscopy, fusing point, density hardness, crystal shape, Optics and electrical characteristics, stability and dissolubility.Recrystallization solvent, crystalline rate, storage temperature and other factors may make A kind of crystal form accounts for leading.The crystalline polymorph of the compound can be prepared by crystallizing at different conditions.
Composition can also include the salt of one or more compounds.Salt can be pharmaceutically acceptable salt.As herein It is used, " pharmaceutically acceptable salt " refers to the derivative of disclosed compound, and wherein parent compound is by by existing acid Or alkali is partially converted into its salt form (such as by making free basic group and suitable organic acid reaction) and changes.Pharmaceutically may be used The example of the salt of receiving includes but is not limited to the inorganic or acylate of alkaline residue such as amine；The alkali metal of acidic residues such as carboxylic acid Or organic salt etc..Representative acid-addition salts include but is not limited to acetate, adipate, alginate, ascorbate, asparagus fern Propylhomoserin salt, benzene sulfonate, benzoate, disulfate, borate, butyrate, camphor hydrochlorate, camsilate, citrate, It is cyclopentane propionate, digluconate, lauryl sulfate, ethane sulfonate, fumarate, gluceptate, sweet Oleophosphoric acid salt, Hemisulphate, enanthate, caproate, hydrobromate, hydrochloride, hydriodate, 2- hydroxy-ethanesulfonate, cream Glycuronate, lactate, laruate, lauryl sulfate, malate, maleate, malonate, Loprazolam Salt, 2- naphthalene sulfonate, nicotine hydrochlorate, nitrate, oleate, oxalates, palmitate, embonate, pectate, over cure Hydrochlorate, 3- phenylpropionic acid salt, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, wine Stone hydrochlorate, rhodanate, toluene fulfonate, undecanoate, valerate etc..Representative alkali or alkaline earth metal salt include but It is not limited to sodium, lithium, potassium, calcium, magnesium salts etc.；And nontoxic ammonium, quaternary ammonium and amine cation, including but not limited to ammonium, tetramethyl-ammonium, four Ethyl ammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethamine etc..The pharmaceutically acceptable salt of the disclosure includes for example by nothing The conventional non-toxic salts for the parent compound that malicious inorganic or organic acid is formed.The pharmaceutically acceptable salt of the disclosure can be by containing The parent compound of alkalinity or acidic moiety is synthesized by conventional chemical processes.In general, these salt can be by making these The free acid or alkali form of compound and the appropriate alkali of the amount of stoichiometric amount or acid in water or in organic solvent, or at this Reaction is in two kinds of mixture to prepare；Generally preferably non-aqueous medium, such as ether, ethyl acetate, ethyl alcohol, isopropanol or second Nitrile.It is suitble to the inventory of salt to see Remington ' s Pharmaceutical Sciences, the 17th edition, Mack Publishing Company, Easton, Pa., 1985, page 1418, Pharmaceutical Salts:Properties, Selection, And Use, P.H.Stahl and C.G.Wermuth (editor), Wiley-VCH, 2008；With Berge et al., Journal of Pharmaceutical Science, 66,1-19 (1977) are respectively incorporated herein in its entirety by reference.
As used herein, " phosphatide " be include phosphonate moiety and one or more carbochains, such as unsaturated fatty acid chain Lipid.Phosphatide may include one or more multikeys (such as double or triple bonds) (such as one or more are unsaturated).It is specific Phosphatide can help to merge with film.For example, cationic phosphatide can be with one kind of film (such as cell membrane or intercellular membrane) Or a variety of electronegative phosphatide interactions.Phosphatide is merged with film can make one of composition containing lipid or Multiple components Across film, thus allow one or more ingredient deliveries to cell for example.
As used herein, " polydispersity index " is a kind of ratio for describing the homogenieity of size distribution of a system. Lesser value is, for example, less than 0.3, indicates relatively narrow size distribution.
As used herein, term " polypeptide " or " polypeptide of interest " refer to typically by it is naturally-produced (such as separation or Purifying) or the polymer of the amino acid residue of peptide keyed engagement that is synthetically produced.
As used herein, " RNA " refers to possible naturally occurring or non-naturally occurring ribonucleic acid.For example, RNA can be with Including modified and/or non-naturally occurring component, such as one or more nucleobases, nucleosides, nucleotide or connexon.RNA It may include cap structure, chain termination nucleosides, stem ring, polyadenylic acid sequence and/or polyadenylation signal.RNA can have volume The nucleotide sequence of code polypeptide of interest.For example, RNA can be mRNA (mRNA).The mRNA of encoding specific polypeptides is translated, Such as mRNA is translated in inside mammalian cells body and can produce the polypeptide of coding.RNA can be selected from being made up of Non-limiting group: siRNA (siRNA), asymmetric aiRNA (aiRNA), microRNA (miRNA), Dicer- substrate RNA (dsRNA), children purpura nephritis (shRNA), mRNA, single-stranded guide RNA (sgRNA), cas9 mRNA and its mixture.
As used herein, with dose/primary/single channel/single contact point, i.e., singly " single unit dose " is The dosage of any therapeutic agent of one application event application.
As used herein, " fractionated dose " is that single unit dose or total daily dosage are divided into agent two or more times Amount.
As used herein, " total daily dosage " is to give in 24 hour periods or defined amount.The dosage can be with It is applied as single unit dose.
As used herein, in nanoparticle compositions, " size " or " mean size " refers to combinations of nanoparticles The average diameter of object.
As used herein, term " subject " or " patient ", which refer to, can apply the composition according to the disclosure with for example For testing, diagnosing, prevent and/or any organism of therapeutic purposes.Exemplary subject person includes that (such as mammal is such as animal Mouse, rat, rabbit, non-human primate with and the mankind) and/or plant.
As used herein, " target cell " refers to one or more cells of interest.These cells can see biology In the external, internal of body, original position or tissue or organ.Organism can be animal, preferably mammal, more preferably people And most preferably patient.
As used herein, " destination organization " refer to delivering therapeutic agent and/or prophylactic will cause desired biology and/ Or any one or more organization types of interest of pharmacotoxicological effect.The example of destination organization of interest includes specific group It knits, organ and system or its group.It has been desirable in certain applications, destination organization can be kidney, lung, spleen, blood vessel (in coronary artery or stock Intra-arterial) in blood vessel endothelium or tumor tissues (such as passing through intra-tumoral injection)." non-target tissues " refers to coded albumen The expression of matter will not cause any one or more organization types of desired biology and/or pharmacotoxicological effect.In specific application In, non-target tissues may include liver and spleen.
Term " therapeutic agent " or " prophylactic ", which refer to when being administered to subject, has treatment, diagnosis and/or prevention effect And/or cause any reagent of desired biology and/or pharmacotoxicological effect.Therapeutic agent is also known as " active matter " or " activity Agent ".These reagents include but is not limited to cytotoxin, isotopic ion, chemotherapeutant, small-molecule drug, protein and core Acid.
As used herein, term " therapeutically effective amount ", which is meant to work as to be administered to, suffers from or is susceptible to suffer from infection, disease, illness And/or the patient's condition subject when be enough to treat the infection, disease, illness and/or the patient's condition, improve its symptom, diagnose, prevent and/ Or postpone the amount of its breaking-out and the reagent (such as nucleic acid, drug, composition, therapeutic agent, diagnosticum, prophylactic etc.) of delivering.
As used herein, " transfection ", which refers to, is introduced into a species (such as RNA) in cell.Transfection can be for example in body Outside, in vitro or internal generation.
As used herein, term " treatment ", which refers to, mitigates partially or completely, improves, improving, alleviating specific infection, disease The one or more symptoms or feature of disease, illness and/or the patient's condition, postpone its breaking-out, inhibit its progress, reduce its severity And/or reduce its generation.For example, " treatment " cancer, which can refer to, inhibits tumor survival, growth and/or diffusion.Treatment can be applied Subject to the symptom for not showing disease, illness and/or the patient's condition and/or the early stage disease for only showing disease, illness and/or the patient's condition The subject of sign develops pathological risk relevant to the disease, illness and/or the patient's condition to realize to reduce.
As used herein, " zeta potential " refers to the eletrokinetic potential of lipid in such as nanoparticle compositions.
Nanoparticle compositions
The disclosure is further characterized in that nanoparticle compositions comprising containing as described herein according to formula (I), (IA), the lipid of the compound of (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) Component.
In some embodiments, when for example by dynamic light scattering (DLS), transmission electron microscopy, scanning electron it is aobvious Measured by micro- art or another method, the full-size of nanoparticle compositions be 1 μm or shorter (such as 1 μm, 900nm, 800nm, 700nm, 600nm, 500nm, 400nm, 300nm, 200nm, 175nm, 150nm, 125nm, 100nm, 75nm, 50nm or shorter). Nanoparticle compositions include such as lipid nanoparticle (LNP), liposome, lipid vesicle and lipid complex.In some realities It applies in scheme, nanoparticle compositions are the vesicas for including one or more double-layers of lipoid.In certain embodiments, nanoparticle Sub-portfolio object includes two or more concentric bilayers separated by aqueous compartments.Double-layer of lipoid can be functionalized and/or It is cross-linked to each other.Double-layer of lipoid may include one or more ligands, protein or channel.
Nanoparticle compositions include it is at least one according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), the lipid composition of the compound of (IIe), (IIf), (IIg) or (III).For example, the lipid group of nanoparticle compositions Dividing may include one of compound 1-280 or a variety of.Nanoparticle compositions can also include a variety of other components.Example Such as, the lipid composition of nanoparticle compositions remove comprising according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), It (IId), further include one or more other lipids outside the lipid of (IIe), (IIf), (IIg) or (III).
Cationic/ionizable lipid
Nanoparticle compositions except include according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), It (IIe), further include one or more cationics and/or ionizable lipid (example outside the lipid of (IIf), (IIg) or (III) As at physiological ph can positively charged or part positive charge lipid).Cationic and/or ionizable lipid can be selected from Non-limiting group: 3- (double dodecylaminos)-N1, N1,4- tri--dodecyl -1- piperazine ethanamine being made up of (KL10), N1- [2- (double dodecylaminos) ethyl]-N1, N4, N4- tri--dodecyl -1,4- piperazine diethylamine (KL22), Sub- oil base oxygroup-N, the N- diformazan of-three octadecane (KL25) of four azepine of 14,25- double tridecyl -15,18,21,24-, 1,2- bis- Base aminopropane (DLin-DMA), bis- Asia oil base -4- dimethylaminomethyl of 2,2--[1,3]-dioxolane (DLin-K- DMA), 37 carbon -6,9,28,31- tetraene -19- base ester (DLin-MC3-DMA) of 4- (dimethylamino) butyric acid, 2,2- bis- are sub- Oily oxygroup-the N, N- of oil base -4- (2- dimethyl aminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2- bis- Dimethylaminopropanecompounds (DODMA), 2- ({ 8- [solid -5- alkene -3- base oxygroup of (3 β)-gallbladder] octyl } oxygroup)-N, N- dimethyl -3- [(9Z, 12Z)-Linolenic Acid, 12- diene -1- base oxygroup] propyl- 1- amine (Octyl-CLinDMA), (2R) -2- ({ 8- [(3 β) - Gallbladder consolidates -5- alkene -3- base oxygroup] octyl } oxygroup)-N, N- dimethyl -3- [(9Z, 12Z)-Linolenic Acid, 12- diene -1- base oxygen Base] propyl- 1- amine (Octyl-CLinDMA (2R)) and (2S) -2- ({ 8- [solid -5- alkene -3- base oxygroup of (3 β)-gallbladder] octyl } oxygen Base)-N, N- dimethyl -3- [(9Z, 12Z)-Linolenic Acid, 12- diene -1- base oxygroup] propyl- 1- amine (Octyl-CLinDMA (2S)).In addition thereto, cationic lipid can also be the lipid including cyclic aminocarbonyl.
PEG lipid
The lipid composition of nanoparticle compositions may include the modified lipid of one or more PEG or PEG.These species It can be alternatively referred to as pegylated lipids.PEG lipid is with poly ethyldiol modified lipid.PEG lipid can selected from by The ceramide of phosphatidyl-ethanolamine, the PEG of non-limiting group: PEG modification of consisting of modified phosphatidic acid, PEG modification (PEG-CER), PEG modified dialkylamine, PEG modified diacylglycerol (PEG-DEG), PEG modified dialkyl glycerol And its mixture.For example, PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC Or PEG-DSPE lipid.
Structural lipid
The lipid composition of nanoparticle compositions may include one or more structural lipids.Structural lipid can select Freedom but be not limited to group consisting of: cholesterol, stercorin, sitosterol, ergosterol, campesterol, stigmasterol, vegetable seed are solid Alcohol, tomatidine (tomatidine), tomatin (tomatine), ursolic acid, alpha-tocopherol and its mixture.In some implementations In scheme, structural lipid is cholesterol.In some embodiments, structural lipid includes cholesterol and corticosteroid (such as prednisolone (prednisolone), dexamethasone, prednisone (prednisone) and hydrocortisone (hydrocortisone)) or combinations thereof.
Phosphatide
The lipid composition of nanoparticle compositions may include one or more phosphatide, such as one or more (more) unsaturated Lipid.Phosphatide can be assembled into one or more double-layers of lipoid.In general, phosphatide may include phospholipid moiety and one or more A fatty acid part.For example, phosphatide can be the lipid according to formula (IV):
Wherein RpIndicate phospholipid moiety and R1And R2It indicates with or without unsaturated fatty acid part, these rouge Fat acid moieties can be identical or different.Phospholipid moiety can be selected from non-limiting group be made up of: phosphatidyl choline, Phosphatidyl-ethanolamine, phosphatidyl glycerol, phosphatidylserine, phosphatidic acid, 2- lysophosphatidyl choline and sphingomyelins.Fatty acid moieties Point can be selected from be made up of non-limiting group: lauric acid, myristic acid, myristoleic acid, palmitinic acid, palmitoleic acid, Stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, Shan Yu Acid, clupanodonic acid and docosahexaenoic acid.It also covers including the non-natural with modification and the natural species replaced Species, the modification and substitution include branch, oxidation, cyclisation and alkynes.For example, phosphatide can use one or more alkynes (examples The alkenyl replaced such as one or more double bonds by three keys) it is functionalized or is crosslinked with one or more alkynes.In appropriate reaction item Under part, alkynyl may undergo the cycloaddition reaction of copper catalysis when being exposed to azide.These reactions can be used for making nanoparticle The double-layer of lipoid functionalization of sub-portfolio object is to promote film to permeate or cell recognition, or such as by nanoparticle compositions and useful constituent Targeting or imaging moiety (such as dyestuff) coupling.
The phosphatide that can be used in these compositions and method can be hard selected from non-limiting group: the 1,2- bis- be made up of Fatty acyl group-sn- glycerol-3-phosphocholine (DSPC), 1,2- dioleoyl-sn- glycerol-3-phosphate ethanol amine (DOPE), 1,2- Two sub-oleoyl-sn- glycerol-3-phosphocholines (DLPC), bis- myristoyl-sn- glycerol-3-phosphate choline (DMPC) of 1,2-, 1,2- dioleoyl-sn- glycerol-3-phosphocholine (DOPC), bis- palmityl-sn- glycerol-3-phosphocholine of 1,2- (DPPC), the bis- hendecyl-sn- glycerol-3-phosphate choline (DUPC) of 1,2-, 1- palmityl -2- oleoyl-sn- glycerol -3- Phosphocholine (POPC), bis--O- octadecene base-sn- glycerol-3-phosphocholine (18:0Diether PC) of 1,2-, 1- oleoyl Half succinyl group-sn- glycerol-3-phosphocholine (OChemsPC) of base -2- cholesteryl, 1- cetyl-sn- glycerol -3- phosphorus Sour choline (C16 Lyso PC), bis- linolenyl-sn- glycerol-3-phosphocholine of 1,2-, bis- arachidonic acyl group-sn- of 1,2- The bis- two dodecahexaenes acyl group-sn- glycerol-3-phosphocholines of glycerol-3-phosphocholine, 1,2-, bis- phytane acyl group-sn- of 1,2- The sub- oil of glycerol-3-phosphate ethanol amine (16.0 PE of ME), 1,2- distearyl acyl group-sn- glycerol-3-phosphate ethanol amine, 1,2- bis- Acyl group-sn- glycerol-3-phosphate ethanol amine, bis- linolenyl-sn- glycerol-3-phosphate ethanol amine of 1,2-, bis- arachidonic of 1,2- Acyl group-sn- glycerol-3-phosphate ethanol amine, the bis- two dodecahexaenes acyl group-sn- glycerol-3-phosphate ethanol amines of 1,2-, 1,2- bis- Oleoyl-sn- glycerol-3-phosphate-rac- (1- glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palm Acyl group oleolyl phosphatidyl ethanol amine (POPE), distearyl acyl group-phosphatidyl-ethanol amine (DSPE), two palmityl phosphatidyls Ethanol amine (DPPE), two myristoyl phosphoethanolamines (DMPE), 1- stearyl -2- oleoyl-stearoyl ethanol amine (SOPE), 1- stearyl -2- oleoyl-phosphatidyl choline (SOPC), sphingomyelins, phosphatidyl choline, phosphatidyl-ethanolamine, phosphorus Acyl serine, phosphatidylinositols, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, lysophosphatidyl choline, lysophosphatide Acyl ethanol amine (LPE) and its mixture.In some embodiments, nanoparticle compositions include DSPC.In certain implementations In scheme, nanoparticle compositions include DOPE.In some embodiments, nanoparticle compositions include DSPC and DOPE two Kind.
Adjuvant
In some embodiments, nanoparticle compositions including one or more lipids described herein can be with Including one or more adjuvants, such as glucopyranosyl lipid adjuvant (GLA), CpG oligodeoxynucleotide (such as A Class or B class), poly (I:C), aluminium hydroxide and Pam3CSK4.
Therapeutic agent
Nanoparticle compositions may include one or more therapeutic agents and/or prophylactic.The disclosure is characterized in that will Therapeutic agent and/or prophylactic be delivered to mammalian cell or organ, generate polypeptide of interest in mammalian cells and Treat the disease of mammal in need or the method for illness, these methods include to mammal application include therapeutic agent and/ Or prophylactic nanoparticle compositions and/or contact mammalian cell with the nanoparticle compositions.
Therapeutic agent and/or prophylactic include bioactive substance and are alternatively referred to as " activating agent ".Therapeutic agent and/or pre- Anti- dose can be and cause institute in the cell or organ or in other bodily tissues or system after being delivered to cell or organ The substance of desired variation.Such species can be used for treating one or more diseases, illness or the patient's condition.In some embodiments In, therapeutic agent and/or prophylactic are the small-molecule drugs that can be used for treating specified disease, illness or the patient's condition.It can be used for nanoparticle The example of the drug of sub-portfolio object includes but is not limited to nti-neoplastic agent (such as vincristine (vincristine), Doxorubicin (doxorubicin), mitoxantrone (mitoxantrone), camptothecine (camptothecin), cis-platinum (cisplatin), rich Lay mycin (bleomycin), cyclophosphamide (cyclophosphamide), methotrexate (MTX) and streptozotocin (streptozotocin)), antitumor agent (such as actinomycin D (actinomycin D), vincristine, vincaleukoblastinum (vinblastine), cytarabin (cytosine arabinoside), anthracycline (anthracycline), Alkylating agent, platinum-like compounds, antimetabolite and nucleoside analog, such as methotrexate (MTX) and purine and pyrimidine analogue), anti-sense Stain, local anesthetic (such as cincaine (dibucaine) and chlorpromazine (chlorpromazine)), beta-adrenergic Blocking agent (such as Propranolol (propranolol), Mo Luo (timolol) and labetalol (labetalol)), anti-high blood Press agent (such as clonidine (clonidine) and hydralazine (hydralazine)), antidepressant (such as imipramine (imipramine), amitriptyline (amitriptyline) and doxepin (doxepin)), Anticonvulsants (such as phenytoinum naticum (phenytoin)), antihistamine (such as diphenhydramine (diphenhydramine), chlorphenamine (chlorpheniramine) With fenazil (promethazine)), antibiotic/antibacterial agent (such as gentamicin (gentamycin), Ciprofloxacin (ciprofloxacin) and Cefoxitin (cefoxitin)), antifungal agent (such as Miconazole (miconazole), terconazole (terconazole), econazole (econazole), Isoconazole (isoconazole), butoconazole (butaconazole), gram mould How azoles (clotrimazole) Itraconazole (itraconazole), nystatin (nystatin), replaces fragrant (naftifine) It is short of money with amphotericin B (amphotericin B)), antiparasitic, hormone, hormone antagonist, immunomodulator, neurotransmitter Anti-agent, Betimol, vitamin, sedative and preparation.
In some embodiments, therapeutic agent and/or prophylactic are cytotoxin, isotopic ion, chemotherapeutant, epidemic disease Seedling, the compound for causing immune response and/or another therapeutic agent and/or prophylactic.Cytotoxin or cytotoxic agent include pair The harmful any reagent of cell.Example include but is not limited to taxol (taxol), cytochalasin B (cytochalasin B), Gramicidin D (gramicidin D), ethidium bromide (ethidium bromide), emetine (emetine), mitomycin (mitomycin), Etoposide (etoposide), Teniposide (teniposide), vincristine, vincaleukoblastinum, colchicin (colchicine), Doxorubicin, daunorubicin (daunorubicin), chinizarin (dihydroxy anthracin Dione), mitoxantrone, mithramycin (mithramycin), actinomycin D, 1- boldenone, glucocorticoid, Proca Because (procaine), totokaine (tetracaine), lidocaine (lidocaine), Propranolol, puromycin, class U.S.A are stepped on Plain (maytansinoid) such as maytansinol (maytansinol), miramycin (rachelmycin) (CC-1065) and its class are drawn Like object or homologue.Isotopic ion includes but is not limited to iodine (such as I125 or iodine 131), strontium 89, phosphorus, palladium, caesium, iridium, phosphoric acid Root, cobalt, Y90, samarium 153 and praseodymium.Vaccine includes being capable of providing to be directed to and infectious diseases such as influenza, morbilli, human papilloma virus (HPV), rabies, meningitis, pertussis, tetanus, pestilence, hepatitis and the relevant one or more patient's condition of pulmonary tuberculosis is immune Property compound and preparation and may include the mRNA for encoding infectious diseases source property antigen and/or epitope.Vaccine can be with Including guiding compound and preparation for the immune response of cancer cell and may include codes for tumor cell source antigen, table The mRNA of position and/or new epitope.The compound for causing immune response may include vaccine, corticosteroid (such as dexamethasone) With other species.In some embodiments, by include according to formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) compound (such as compound 3,18,20,25,26,29,30, 60,108-112 or composition intramuscular application 122) can cause the vaccine and/or compound of immune response.Other treatments Agent and/or prophylactic include but is not limited to antimetabolite (such as methotrexate (MTX), Ismipur, 6- thioguanine, cytarabine With 5 FU 5 fluorouracil Dacarbazine (dacarbazine)), alkylating agent (such as mustargen (mechlorethamine), thio-tepa (thiotepa), Chlorambucil (chlorambucil), draw miramycin (CC-1065), alkeran (melphalan), card not Take charge of spit of fland (carmustine, BSNU), Lomustine (lomustine, CCNU), cyclophosphamide, busulfan (busulfan), dibromo Mannitol, streptozotocin, mitomycin C and along dichlorodiamine network platinum (II) (DDP), cis-platinum), anthracycline it is (such as soft red Mycin (being formerly referred to as daunomycin (daunomycin)) and Doxorubicin), antibiotic (such as dactinomycin D (dactinomycin) (being formerly referred to as D actinomycin D), bleomycin, mithramycin (mithramycin) and Anthramycin (anthramycin, AMC)) and antimitotic agent (such as vincristine, vincaleukoblastinum, taxol and class maytansine).
In other embodiments, therapeutic agent and/or prophylactic are protein.It can be used in the nanoparticle in the disclosure Therapeutic protein include but is not limited to gentamicin, amikacin (amikacin), insulin, hematopoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimutaing factor (GM-CSF), factor Ⅴ IR, Luteinizing hormone-releasing hormone (LHRH) analog, interferon, heparin, hepatitis B surface antibody, antityphoid vaccine and cholera vaccine.
Polynucleotides and nucleic acid
In some embodiments, therapeutic agent is polynucleotides or nucleic acid (such as ribonucleic acid or DNA). The most broad sense of term " polynucleotides " includes in oligonucleotide chain or any compound that can be incorporated in oligonucleotide chain And/or substance.It include but is not limited to one or more of according to the Exemplary polynucleotide that the disclosure uses: deoxyribose core Sour (DNA)；Ribonucleic acid (RNA), including messenger mrna (mRNA), its hybrid；RNAi inducible factor；The RNAi factor； siRNA；shRNA；miRNA；Antisense RNA；Ribozyme；Catalytic DNA；The RNA for inducing triple helix to be formed；Aptamer；Carrier etc.. In some embodiments, therapeutic agent and/or prophylactic are RNA.The RNA that can be used in compositions described herein and method It can be selected from by but be not limited to group consisting of: shortmer, antagomir, antisense RNA, ribozyme, siRNA (siRNA), asymmetric aiRNA (aiRNA), microRNA (miRNA), Dicer- substrate RNA (dsRNA), children purpura nephritis (shRNA), transfer RNA (tRNA), mRNA (mRNA) and its mixture.In certain embodiments, RNA is mRNA.
In certain embodiments, therapeutic agent and/or prophylactic are mRNA.MRNA can encode any polypeptide of interest, The polypeptide modified including any natural or non-naturally-occurring or in other ways.It can have by the polypeptide that mRNA is encoded any big It is small and can have any secondary structure or activity.In some embodiments, by the polypeptide of mRNA coding in cell It can have therapeutic effect when expression.
In other embodiments, therapeutic agent and/or prophylactic are siRNA.SiRNA can selectively reduce base of interest The expression of cause or the expression for lowering the gene.For example, the selection of siRNA can include the nanoparticle of the siRNA Composition makes gene silencing related with specified disease, illness or the patient's condition after being administered to subject in need.SiRNA may include The sequence complementary with the mRNA sequence for encoding gene or protein of interest.In some embodiments, siRNA can be immune Modulability siRNA.
In certain embodiments, therapeutic agent and/or prophylactic are sgRNA and/or cas9 mRNA.SgRNA and/or Cas9 mRNA may be used as gene editing tool.For example, the mRNA that sgRNA-cas9 compound can influence cytogene is turned over It translates.
In some embodiments, therapeutic agent and/or prophylactic are shRNA or its code carrier or plasmid.ShRNA can To be generated inside target cell after it will proper build up body and be delivered in core.Construct relevant to shRNA and mechanism are phases It is well-known in the field of pass.
The nucleic acid and polynucleotides that can be used in the disclosure typically comprise the of the associated nucleotide for encoding polypeptide of interest One region (such as code area), positioned at first area 5 '-ends the first flanking region (such as 5 '-UTR), be located at the firstth area The second flanking region (such as 3 '-UTR) of the 3 ' of domain-end, at least one 5 '-cap region and 3 '-stabilizing areas.One In a little embodiments, nucleic acid or polynucleotides further include polyadenylic acid region or Kozak sequence (such as in 5 '-UTR).One In a little situations, polynucleotides can contain the one or more introne nucleotide sequences that can be cut off from the polynucleotides.One In a little embodiments, polynucleotides or nucleic acid (such as mRNA) may include 5 ' cap structures, chain termination nucleotide, stem ring, poly- gland Nucleotide sequence and/or polyadenylation signal.Any one region of nucleic acid can include one or more alternative component (examples Such as alternative nucleosides).For example, 3 '-stabilizing areas can contain alternative nucleosides, such as L- nucleosides is inverted thymidine or 2 '-O- first Yl nucleosides and/or code area, 5 '-UTR, 3 '-UTR or cap area may include alternative nucleosides, uridine (such as the 5- replaced such as 5- Methoxyuridine), 1- replace pseudouridine (such as 1- methyl-pseudouridine or 1- ethyl-pseudouridine) and/or 5- replace cytidine (such as 5- Methyl-Cytidine).
In general, the shortest length of polynucleotides can be the length for being enough to encode the polynucleotide sequence of dipeptides.In In another embodiment, the length of polynucleotide sequence is enough to encode tripeptides.In another embodiment, polynucleotides sequence The length of column is enough to encode tetrapeptide.In another embodiment, the length of polynucleotide sequence is enough to encode pentapeptide.Another In a embodiment, the length of polynucleotide sequence is enough to encode hexapeptide.In another embodiment, polynucleotide sequence Length is enough to encode heptapeptide.In another embodiment, the length of polynucleotide sequence is enough to encode octapeptide.In another reality It applies in scheme, the length of polynucleotide sequence is enough to encode nonapeptide.In another embodiment, the length of polynucleotide sequence It is enough to encode decapeptide.
It can include but is not limited to carnosine and anserine by the example of the dipeptides of alternative polynucleotide sequence coding.
In some cases, the length of polynucleotides is more than 30 nucleotide.In another embodiment, polynucleotides The length of molecule is more than 35 nucleotide.In another embodiment, length is at least 40 nucleotide.In another implementation In scheme, length is at least 45 nucleotide.In another embodiment, length is at least 55 nucleotide.At another In embodiment, length is at least 50 nucleotide.In another embodiment, length is at least 60 nucleotide.Another In one embodiment, length is at least 80 nucleotide.In another embodiment, length is at least 90 nucleotide. In another embodiment, length is at least 100 nucleotide.In another embodiment, length is at least 120 cores Thuja acid.In another embodiment, length is at least 140 nucleotide.In another embodiment, length is at least 160 nucleotide.In another embodiment, length is at least 180 nucleotide.In another embodiment, length It is at least 200 nucleotide.In another embodiment, length is at least 250 nucleotide.In another embodiment In, length is at least 300 nucleotide.In another embodiment, length is at least 350 nucleotide.In another reality It applies in scheme, length is at least 400 nucleotide.In another embodiment, length is at least 450 nucleotide.Another In one embodiment, length is at least 500 nucleotide.In another embodiment, length is at least 600 nucleosides Acid.In another embodiment, length is at least 700 nucleotide.In another embodiment, length is at least 800 A nucleotide.In another embodiment, length is at least 900 nucleotide.In another embodiment, length be to Few 1000 nucleotide.In another embodiment, length is at least 1100 nucleotide.In another embodiment, Length is at least 1200 nucleotide.In another embodiment, length is at least 1300 nucleotide.In another implementation In scheme, length is at least 1400 nucleotide.In another embodiment, length is at least 1500 nucleotide.Another In one embodiment, length is at least 1600 nucleotide.In another embodiment, length is at least 1800 nucleosides Acid.In another embodiment, length is at least 2000 nucleotide.In another embodiment, length is at least 2500 nucleotide.In another embodiment, length is at least 3000 nucleotide.In another embodiment, long Degree is at least 4000 nucleotide.In another embodiment, length is at least 5000 nucleotide or more than 5000 cores Thuja acid.
Nucleic acid and polynucleotides may include one or more naturally occurring components, including classical nucleotide A (adenosine), Any of G (guanosine), C (cytidine), U (uridine) or T (thymidine).It in one embodiment, include (a) 5 '-UTR, (b) Open reading frame (ORF), (c) 3 '-UTR, (d) poly A tail and (above a, b, c or d) it is any combination of all or basic Upper all nucleotide all include naturally occurring classics nucleotide A (adenosine), G (guanosine), C (cytidine), U (uridine) or T (chest Glycosides).
Nucleic acid and polynucleotides may include one or more alternative components as described herein, thus assign useful Characteristic, including increase stability and/or lack to introduce the polynucleotides cell congenital immunity response significant induction Effect.For example, alternative polynucleotides or nucleic acid show the degradation for introducing the cell of the polynucleotides or nucleic acid relative to phase Polynucleotides should not be changed or nucleic acid is reduced.These alternative species can increase the efficiency of protein manufacture, multicore glycosides The changeability of the cell of the Intracellular retention and/or contact of acid, and there is reduced immunogenicity.
Polynucleotides and nucleic acid can be naturally occurring or non-naturally occurring.Polynucleotides and nucleic acid may include one Kind or (such as change or alternative) nucleobases of a variety of modifieds, nucleosides, nucleotide or combinations thereof.It can be used for nanoparticle Nucleic acid and polynucleotides in composition may include any useful modifications and changes, such as between nucleobase, sugar or nucleosides The modifications and changes of bonded (such as connectivity phosphate/di-phosphate ester bonded/phosphodiester backbone).In certain embodiments In, change (such as one or more changes) and is respectively present in nucleobase, sugar and internucleoside linkage connection.According to the change of the disclosure Can be ribonucleic acid (RNA) becomes the change of DNA (DNA), such as 2 '-OH of ribofuranose basic ring are substituted At 2 '-H, threose nucleic acid (TNA), ethylene glycol nucleic acid (GNA), peptide nucleic acid (PNA), lock nucleic acid (LNA) or its hybrid.It is other to change Become as described herein.
Polynucleotides and nucleic acid along the molecule complete length can with or can be inhomogenous change.For example, one or more Or all types of nucleotide (such as purine or pyrimidine or A, G, U, C any one or more of or whole) are in multicore glycosides Acid or nucleic acid in, in its given predetermined sequence region can with or can change inhomogenously.In some cases, multicore glycosides All nucleotide X in acid (or in its given sequence region) are changed, and wherein X can be appointing in nucleotide A, G, U, C One, or any of combination A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.
Different sugar changes and/or internucleoside linkage connection (such as backbone structure) can reside in the various positions in polynucleotides Set place.It should be appreciated by those skilled in the art that nucleotide analog or other changes can be located at any of polynucleotides Position, so that the function of the polynucleotides does not reduce substantially.Change can also be that 5 '-or 3 '-ends change.In some realities It applies in scheme, the polynucleotides include the change of 3 '-ends.The polynucleotides can contain about 1% to about 100% substitution Property nucleotide (related to overall nucleotide content, or the nucleotide with one or more types, i.e. any of A, G, U or C Or multiple correlations) or any intermediate percentage (such as 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% To 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% To 95%, 90% to 100% and 95% to 100%).It will be appreciated that any residual percentage be attributed to classical nucleotide (such as A, G, U or C) presence.
Polynucleotides can be or any intermediate percentage containing the alternative nucleosides of minimum 0 and most 100%, such as extremely Few 5% alternative nucleotide, at least 10% alternative nucleotide, at least 25% alternative nucleotide, at least 50% alternative core Thuja acid, at least 80% alternative nucleotide or at least 90% alternative nucleotide.For example, polynucleotides can contain it is alternative phonetic Pyridine, such as alternative uracil or cytimidine.In some embodiments, at least 5% in polynucleotides, at least 10%, at least 25%, (such as the urine that 5- replaces is phonetic by alternative uracil at least 50%, at least 80%, at least 90% or 100% uracil Pyridine) displacement.Alternative uracil can be replaced by the compound with single unique texture, or can be by with different structure The multiple compounds of (such as 2,3,4 or more unique textures) are replaced.In some cases, at least 5% in polynucleotides, extremely Few 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% cytimidine by alternative cytimidine (such as The cytimidine that 5- replaces) displacement.Alternative cytimidine can be replaced by the compound with single unique texture, or can be had There are the multiple compounds of different structure (such as 2,3,4 or more unique textures) to replace.
In some cases, nucleic acid will not substantially induce congenital in the cell for introducing polynucleotides (such as mRNA) Property immune response.The feature of the congenital immunity response of induction includes that the expression of 1) pro-inflammatory cytokine increases, 2) is intracellular PRR (RIG-I, MDA5 etc.) activation and/or 3) protein translation terminates or reduction.
Nucleic acid can optionally include other factors (such as RNAi inducible factor, the RNAi factor, siRNA, shRNA, RNA, aptamer and the carrier that miRNA, antisense RNA, ribozyme, catalytic DNA, tRNA, induction triple helix are formed).Some In embodiment, nucleic acid may include having one or more alternative nucleosides or nucleotide (that is, alternative mRNA molecule) One or more mRNAs (mRNA).
In some embodiments, nucleic acid (such as mRNA) molecule, relative formula, composition or method include containing such as One or more polynucleotides of feature described in below: WO2002/098443, WO2003/051401, WO2008/ 052770、WO2009127230、WO2006122828、WO2008/083949、WO2010088927、WO2010/037539、 WO2004/004743、WO2005/016376、WO2006/024518、WO2007/095976、WO2008/014979、WO2008/ 077592、WO2009/030481、WO2009/095226、WO2011069586、WO2011026641、WO2011/144358、 WO2012019780、WO2012013326、WO2012089338、WO2012113513、WO2012116811、 WO2012116810、WO2013113502、WO2013113501、WO2013113736、WO2013143698、 WO2013143699、WO2013143700、WO2013/120626、WO2013120627、WO2013120628、 WO2013120629、WO2013174409、WO2014127917、WO2015/024669、WO2015/024668、WO2015/ 024667、WO2015/024665、WO2015/024666、WO2015/024664、WO2015101415、WO2015101414、 WO2015024667, WO2015062738, WO2015101416 are all incorporated herein by reference.
Nucleobase substitute
Alternative nucleosides and nucleotide may include alternative nucleobase.The nucleobase of nucleic acid is organic base, such as purine Or pyrimidine or derivatives thereof.Nucleobase can be classical base, and (such as adenine, guanine, uracil, thymidine and born of the same parents are phonetic Pyridine).These nucleobases can be changed or fully replace to provide characteristic enhancing, such as stability is such as to the resistance of nuclease Increased polynucleotide molecule.Non-classical or modified base may include for example one or more substitutions or modify, including But it is not limited to alkyl, aryl, halogenated, oxo, hydroxyl, alkoxy and/or thio substitution；One or more condenses or open loop；Oxygen Change and/or restores.
It is fast that standard adenine-thymidine, adenine-uracil or bird are not only covered in alternative nucleotide base pairing Purine-cytosine base pair, and also cover in nucleotide and/or the alternative nucleosides including non-standard or alternative base The base-pair formed between acid, wherein the arrangement of hydrogen bond donor and hydrogen bond receptor allows between non-standard bases and standard base Or hydrogen bond is formed between two complementary non-standard bases structures.One example of such non-standard bases pairing is alternative Base pairing between nucleotide inosine and adenine, cytimidine or uracil.
In some embodiments, nucleobase is alternative uracil.Exemplary nucleobase with alternative uracil It include pseudouridine (ψ), pyridine -4- ketone ribonucleotide, 5- azepine-uracil, 6- azepine-uracil, the thio -5- nitrogen of 2- with nucleosides Miscellaneous-uracil, 2- thio-uracil (s2U), 4- thio-uracil (s4U), 4- it is thio-pseudouridine, 2- be thio-pseudouridine, 5- Hydroxyl-uracil (ho5U), 5- aminoallyl-uracil, 5- it is halogenated-uracil (such as 5- iodo-uracil or 5- bromine Generation -- uracil), 3- methyl-uracil (m3U), 5- methoxyl group-uracil (mo5U), uracil 5- ethoxyacetic acid (cmo5U)、 Uracil 5- ethoxyacetic acid methyl esters (mcmo5U), 5- carboxymethyl group-uracil (cm5U), 1- carboxymethyl group-pseudouridine, 5- carboxyl Hydroxymethyl-uracil (chm5U), 5- carboxy hydroxy methyl-uracil methyl esters (mchm5U), 5- Methoxycarbonylmethyl-urine is phonetic Pyridine (mcm5U), 5- Methoxycarbonylmethyl -2- thio-uracil (mcm5s2U), 5- amino methyl -2- thio-uracil (nm5s2U), 5- Methylaminomethyl-uracil (mnm5U), 5- Methylaminomethyl -2- thio-uracil (mnm5s2U)、5- Methylaminomethyl -2- seleno-uracil (mnm5se2U), 5- carbamoyhnethyl-uracil (ncm5U), 5- carboxymethyl group ammonia Ylmethyl-uracil (cmnm5U), 5- carboxymethyl group amino methyl -2- thio-uracil (cmnm5s2U), 5- propinyl-urine is phonetic Pyridine, 1- propinyl-pseudouracil, 5- taurine methyl-uracil (τ m5U), 1- taurine methyl-pseudouridine, 5- taurine first Base -2- thio-uracil (τ m5s2U), 1- taurine methyl -4- it is thio-pseudouridine, 5- methyl-uracil (m5U has core Base deoxythymidine), 1- methyl-pseudouridine (m1ψ), 1- ethyl-pseudouridine (Et1ψ), 5- methyl -2- thio-uracil (m5s2U), 1- methyl -4- it is thio-pseudouridine (m1s4ψ), the thio -1- methyl-pseudouridine of 4-, 3- methyl-pseudouridine (m3ψ)、2- Thio-1- methyl-1-denitrogenation-the pseudouridine of thio-1- methyl-pseudouridine, 1- methyl-1-denitrogenation-pseudouridine, 2-, dihydro urine are phonetic Pyridine (D), dihydro pseudouridine, 5,6- dihydrouracil, 5- methyl-dihydro uracil (m5D), 2- it is thio-dihydrouracil, 2- sulphur Generation-dihydro pseudouridine, 2- methoxyl group-uracil, 2- methoxyl group -4- thio-uracil, 4- methoxyl group-pseudouridine, 4- methoxy Base -2- is thio-pseudouridine, N1- methyl-pseudouridine, 3- (3- amino -3- carboxypropyl) uracil (acp3U), 1- methyl -3- (3- amino -3- carboxypropyl) pseudouridine (acp3ψ), 5- (isopentene group amino methyl) uracil (inm5U), 5- (isopentene group Amino methyl) -2- thio-uracil (inm5s2U), 5,2 '-O- dimethyl-uridine (m5Um), thio -2 '-O- methyl-urine of 2- Glycosides (s2Um), -2 '-O- of 5- Methoxycarbonylmethyl methyl-uridine (mcm5Um), -2 '-O- of 5- carbamoyhnethyl methyl-uridine (ncm5Um), 5- carboxymethyl group amino methyl -2 '-O- methyl-uridine (cmnm5Um), 3,2 '-O- dimethyl-uridine (m3Um) with And 5- (isopentene group amino methyl) -2 '-O- methyl-uridine (inm5Um), 1- thio-uracil, deoxythymidine, 5- (2- first Oxygen carbonyl vinyl)-uracil, 5- (carbamyl hydroxymethyl)-uracil, 5- carbamoyhnethyl -2- be thio-and urine is phonetic Pyridine, 5- carboxymethyl group -2- thio-uracil, 5- cyano methyl-uracil, 5- methoxyl group -2- thio-uracil and 5- [3- (1-E- allylamino)] uracil.
In some embodiments, nucleobase is alternative cytimidine.Exemplary nucleobase with alternative cytimidine It include 5- aza-cytosine, 6- aza-cytosine, false different cytidine, 3- methyl-cytosine (m3C), N4- acetyl group-with nucleosides Cytimidine (ac4C), 5- formoxyl-cytimidine (f5C), N4- methyl-cytosine (m4C), 5- methyl-cytosine (m5C), 5- halogen Generation-cytimidine (such as 5- iodo-cytimidine), 5- hydroxymethyl-cytimidine (hm5C), 1- methyl-different cytidine of vacation, pyrrolo- born of the same parents Thio-false different cytidine of the false different cytidine of pyrimidine, pyrrolo-, 2- thio-cytosine (s2C), the thio -5- methyl-cytosine of 2-, 4-, Thio-1- methyl-1-different the cytidine of denitrogenation-vacation of the thio-1- methyl of the 4--different cytidine of vacation, 4-, the 1- methyl-1-different cytidine of denitrogenation-vacation, Ze Bulalin (zebularine), 5- azepine-Ze Bulalin, 5- methyl-Ze Bulalin, the thio-Ze Bulalin of 5- azepine -2-, Thio-the Ze Bulalin of 2-, 2- methoxyl group-cytimidine, 2- methoxyl group -5- methyl-cytosine, 4- methoxyl group-different cytidine of vacation, 4- first Oxy-1-different the cytidine of methyl-vacation relies cytidine (lysidine) (k2C), 5,2 '-O- dimethyl-cytidine (m5Cm), N4- acetyl Base -2 '-O- Methyl-Cytidine (ac4Cm), N4,2 '-O- dimethyl-cytidine (m4Cm), 5- formoxyl -2 '-O- Methyl-Cytidine (f5Cm), N4, N4,2 '-O- trimethyl-cytidine (m42Cm), 1- thio-cytosine, 5- hydroxy-cytosine, 5- (3- azido Propyl)-cytimidine and 5- (2- Azidoethyl)-cytimidine.
In some embodiments, nucleobase is alternative adenine.Exemplary nucleobase with alternative adenine With nucleosides include 2- Amino-purin, 2,6-diaminopurine, 2- amino -6- it is halogenated-(such as 2- amino -6- is chloro- fast for purine Purine), 6- it is halogenated-purine (such as the chloro- purine of 6-), 2- amino -6- methyl-Purine, 8- azido-adenine, 7- denitrogenation-gland be fast Purine, 7- denitrogenation -8- azepine-adenine, 7- denitrogenation -2- Amino-purin, 7- denitrogenation -8- azepine -2- Amino-purin, 7- denitrogenation - 2,6-diaminopurine, 7- denitrogenation -8- azepine -2,6-diaminopurine, 1- methyl-adenine (m1A), 2- methyl-adenine (m2A), N6- methyl-adenine (m6A), 2- methyl thio-N6- methyl-adenine (ms2m6A), N6- isopentene group-gland are fast Purine (i6A), 2- methyl thio-N6- isopentenyl-adenine (ms2i6A), N6- (cis-hydroxyl groups isopentene group) adenine (io6A), 2- methyl thio-N6- (cis-hydroxyl groups isopentene group) adenine (ms2io6A), N6- glycyl carbamyl- Adenine (g6A), N6- Threonyl carbamyl-adenine (t6A), N6- methyl-N6- Threonyl carbamyl-gland are fast Purine (m6t6A), 2- methyl thio-N6- Threonyl carbamyl-adenine (ms2g6A), N6, N6- dimethyl-adenine (m62A), the positive valyl base carbamyl of N6- hydroxyl-adenine (hn6A), the positive valyl base ammonia of 2- methyl thio-N6- hydroxyl Formoxyl-adenine (ms2hn6A), N6- acetyl group-adenine (ac6A), 7- methyl-adenine, 2- methyl thio-gland are fast Purine, 2- methoxyl group-adenine, N6,2 '-O- dimethyl-adenosine (m6Am), N6, N6,2 '-O- trimethyl-adenosine (m62Am), 1, 2 '-O- dimethyl-adenosine (m1Am), 2- amino-N6- methyl-Purine, 1- be thio-adenine, 8- azido-adenine, N6- (- five oxa- nonadecyl of 19- amino)-adenine, 2,8- dimethyl-adenine, N6- formoxyl-adenine and N6- hydroxyl Methyl-adenine.
In some embodiments, nucleobase is alternative guanine.Exemplary nucleobase with alternative guanine It include inosine (I), 1- methyl-inosine (m1I), bifurcation glycosides (imG), methyl bifurcation glycosides (mimG), 4- demethylation-bifurcation glycosides with nucleosides (imG-14), different bifurcation glycosides (imG2), bosom fourth glycosides (yW), peroxide bosom fourth glycosides (o2yW), hydroxyl bosom fourth glycosides (OHyW), modification are insufficient Hydroxyl cherishes fourth glycosides (OHyW*), 7- denitrogenation-guanine, pigtail glycosides (Q), epoxy pigtail glycosides (oQ), galactosyl-pigtail glycosides (galQ), sweet dew Glycosyl-pigtail glycosides (manQ), 7- cyano -7- denitrogenation-guanine (preQ0), 7- amino methyl -7- denitrogenation-guanine (preQ1), Ancient fast glycosides (G+), 7- denitrogenation -8- azepine-guanine, 6- thio-guanine, the thio -7- denitrogenation-guanine of 6-, the thio -7- of 6- Thio -7- methyl-the guanine of denitrogenation -8- azepine-guanine, 7- methyl-guanine (m7G), 6-, 7- methyl-inosine, 6- methoxy Base-guanine, 1- methyl-guanine (m1G), N2- methyl-guanine (m2G), N2, N2- dimethyl-guanine (m22G), N2,7- dimethyl-guanine (m2,7G), N2, N2,7- dimethyl-guanine (m2,2,7G), 8- oxo-guanine, 7- first Base -8- oxo-guanine, 1- methyl -6- thio-guanine, N2- methyl -6- thio-guanine, N2, N2- dimethyl -6- sulphur Generation-guanine, N2- -2 '-O- of methyl methyl-guanosine (m2Gm), N2, N2- -2 '-O- of dimethyl methyl-guanosine (m22Gm), 1- Methyl -2 '-O- methyl-guanosine (m1Gm), N2,7- -2 '-O- of dimethyl methyl-guanosine (m2,7Gm), 2 '-O- methyl-inosine (Im), 1,2 '-O- dimethyl-inosine (m1Im), 1- thio-guanine and O-6- methyl-guanine.
The alternative nucleobase of nucleotide can be independently purine, pyrimidine, purine or pyrimidine analogue.For example, core alkali Base can be adenine, cytimidine, guanine, uracil or hypoxanthic substitute.In another embodiment, core alkali Base can also include for example naturally occurring base and its synthesis of derivatives, including pyrazolo [3,4-d] pyrimidine；5- methyl born of the same parents are phonetic Pyridine (5-me-C)；5-hydroxymethyl cytosine；Xanthine；Hypoxanthine；2- aminoadenine；The 6- methyl of adenine and guanine With other alkyl derivatives；The 2- propyl and other alkyl derivatives of adenine and guanine；The thio chest of 2- paper substrate, 2- Gland pyrimidine and the thio cytimidine of 2-；5- propynyluracil and cytimidine；6- azo uracil, cytimidine and thymidine；5- Uracil (pseudouracil)；4- paper substrate；8- halogenated (such as 8- bromine), 8- amino, 8- mercaptan, 8- alkylthio, 8- hydroxyl The adenine and guanine that base and other 8- replace；5- is halogenated, and the urine of especially 5- bromine, 5- trifluoromethyl and other 5- substitution is phonetic Pyridine and cytimidine；7- methyl guanine and 7- methyl adenine；Guanozola and 8- azaadenine；Deazaguanine, 7- deazaguanine, 3- deazaguanine, denitrogenation adenine, 7- denitrogenation adenine, 3- denitrogenation adenine；Pyrazolo [3,4-d] Pyrimidine；1,3,5 triazinone of imidazo [1,5-a]；9- deazapurine；Imidazo [4,5-d] pyrazine；Triazol [4,5-d] pyrimidine； Pyrazine -2- ketone；1,2,4- triazine；Pyridazine；Or 1,3,5 triazine.When describing nucleotide using abbreviation A, G, C, T or U, each letter Refer to representative base and/or its derivative, such as A includes adenine or Adenine derivatives, such as 7- denitrogenation adenine.
The change of sugar
Nucleosides includes glycan molecule (such as 5- carbon or 6- carbon sugar, such as pentose, ribose, arabinose, xylose, glucose, gala Sugar or its deoxidation derivative) with the combination of nucleobase, and nucleotide is containing nucleosides and phosphate-based or alternative group (borine phosphorus Perester radical, thiophosphoric acid ester group, phosphoroselenoate ester group, phosphonate group, alkyl, amic acid ester group and glyceryl) nucleosides.Nucleosides Or nucleotide can be classical species, for example including classical nucleobase, sugar and include phosphate-based in nucleotide Nucleosides or nucleotide, or can be alternative nucleosides or nucleotide including one or more alternative components.For example, alternative Nucleosides and nucleotide can be changed on the sugar of nucleosides or nucleotide.In some embodiments, alternative nucleosides or nucleosides Acid includes with flowering structure:
In each of formula IV, V, VI and VII,
M and n is 0 to 5 integer each independently,
U and U ' is O, S, N (R each independentlyU)nuOr C (RU)nu, wherein nu be 0 to 2 integer and each RUIndependently It is H, halogenated or optionally substituted alkyl；
R1′、R2′、R1″、R2″、R1、R2、R3、R4And R5It is each it is comfortable in the presence of be independently H, halogenated, hydroxyl, mercaptan, optionally Substituted alkyl, optionally substituted alkenyl oxygroup, optionally substituted alkynyl oxygroup, is appointed at optionally substituted alkoxy It selects substituted aminoalkoxy, optionally substituted alkyloxy-alkoxy, optionally substituted hydroxy alkoxy base, optionally taken The amino in generation, optionally substituted aryl, optionally substituted aminoalkyl, optionally substituted aminoalkenyl, is appointed at azido Substituted aminoalkynyl is selected, or is not present；Wherein R3With R1′、R1″、R2′、R2″Or R5One or more of combination (such as R1′With R3Combination, R1″With R3Combination, R2′With R3Combination, R2″With R3Combination or R5With R3Combination) one can be bonded on It rises and forms optionally substituted alkylidene or optionally substituted sub- miscellaneous alkyl, and the carbon connected together with it provides and appoints Select substituted heterocycle (such as bicyclic, tricyclic or Fourth Ring heterocycle)；Wherein R5With R1′、R1″、R2′Or R2″In one or more A combination (such as R1′With R5Combination, R1″With R5Combination, R2′With R5Combination or R2″With R5Combination) can be bonded on It is formed together optionally substituted alkylidene or optionally substituted sub- miscellaneous alkyl, and the carbon connected together with it provides Optionally substituted heterocycle (such as bicyclic, tricyclic or Fourth Ring heterocycle)；And wherein R4With R1′、R1″、R2′、R2″、R3Or R5 One or more of combination can be bonded together to form optionally substituted alkylidene or the optionally substituted miscellaneous alkane in Asia Base, and the carbon connected together with it provides optionally substituted heterocycle (such as bicyclic, tricyclic or Fourth Ring heterocycle)； M ' and m " is the integer of 0 to 3 (such as 0 to 2,0 to 1,1 to 3 or 1 to 2) each independently；
Y1、Y2And Y3It is O, S, Se ,-NR each independentlyN1-, optionally substituted alkylidene or optionally substituted Asia Miscellaneous alkyl, wherein RN1It is H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, is optionally taken The aryl in generation, or be not present；
Each Y4It is independently H, hydroxyl, mercaptan, boryl, optionally substituted alkyl, optionally substituted alkenyl, optionally quilt Substituted alkynyl, optionally substituted alkoxy, optionally substituted alkenyl oxygroup, optionally substituted alkynyl oxygroup, optionally Substituted thio alkoxy, optionally substituted alkyloxy-alkoxy or optionally substituted amino；
Each Y5It is independently O, S, Se, optionally substituted alkylidene (such as methylene) or the optionally substituted miscellaneous alkane in Asia Base；And
B is modification or unmodified nucleobase.In some embodiments, 2 '-hydroxyls (OH) can be taken by multiple and different It modifies or replaces for base.Exemplary substitution at 2 '-positions include but is not limited to H, azido, halogenated (such as fluoro), optionally Substituted C1-6Alkyl (such as methyl)；Optionally substituted C1-6Alkoxy (such as methoxy or ethoxy)；Optionally taken The C in generation6-10Aryloxy group；Optionally substituted C3-8Naphthenic base；Optionally substituted C6-10Aryl-C1-6Alkoxy is optionally substituted C1-12(heterocycle) oxygroup；Sugared (such as ribose, pentose or described herein any)；Polyethylene glycol (PEG) ,-O (CH2CH2O)nCH2CH2OR, wherein R is H or optionally substituted alkyl, and n be 0 to 20 (such as 0 to 4,0 to 8,0 to 10, 0 to 16,1 to 4,1 to 8,1 to 10,1 to 16,1 to 20,2 to 4,2 to 8,2 to 10,2 to 16,2 to 20,4 to 8,4 to 10,4 to 16 and 4 to 20) integer；" lock " nucleic acid (LNA), wherein 2 '-hydroxyls pass through C1-6Alkylidene or C1-6Sub- miscellaneous alkyl bridging is connected to 4 '-carbon of same sugar ribose, wherein exemplary bridge includes methylene, propylidene, ether or amino bridge；Amino as herein defined Alkyl；Aminoalkoxy as herein defined；Amino as herein defined；And amino acid as herein defined.
In general, RNA includes glycosyl ribose, which is oxygen containing 5 member ring.The alternative nucleotide of exemplary, non-limitative (such as being replaced by S, Se or alkylidene such as methylene or ethylidene) is replaced including the oxygen in ribose；Double bond addition (such as with With cyclopentenyl or cyclohexenyl group displacement ribose)；The ring of ribose shrinks (such as forming 4 yuan of cyclobutane or oxetanes ring)； Ribose circle amplification (such as formed have additional carbon or heteroatomic 6 yuan or 7 member rings, such as dewatering hexitol, altrose Alcohol, mannitol, cyclohexyl, cyclohexenyl group and morpholino (in addition there is phosphoramidate main chain))；Polycyclic form (such as Tricyclic and " unlocked " form, as (such as R-GNA or S-GNA, wherein ribose is connected to di(2-ethylhexyl)phosphate to ethylene glycol nucleic acid (GNA) The ethylene glycol replacement unit of ester bond), threose nucleic acid (TNA, wherein ribose by α-L- furans threose base-(3 ' → 2 ') replace), with And peptide nucleic acid (PNA, wherein the bonded displacement ribose of 2- amino-ethyl glycine and phosphodiester backbone).
In some embodiments, glycosyl contains one or more carbon, these carbon are opposed with carbon corresponding in ribose Body chemical structure.Therefore, polynucleotide molecule may include the nucleotide containing such as arabinose or L- ribose as sugar.
In some embodiments, polynucleotides include at least one nucleosides, and wherein sugar is L- ribose, 2 '-O- methyl cores Sugar, 2 '-fluoro- ribose, arabinose, hexitol, LNA or PNA.
The change of internucleoside linkage connection
Alternative nucleotide can join in internucleoside linkage to be changed on (such as phosphate backbone).Herein, in multicore In the case where thuja acid main chain, phrase " phosphate " is used interchangeably with " di-phosphate ester ".Backbone phosphates base can be by with not One or more oxygen atoms are replaced with substituent group to change.
Alternative nucleotide may include that unchanged phosphonate moiety is joined by another internucleoside linkage as described herein Complete displacement.Alternative phosphate-based example includes but is not limited to thiophosphate, phosphoroselenoate, borane phosphonate (boranophosphate), borane phosphonate (boranophosphate ester), hydrogen phosphate, phosphoramidate, diamino Base phosphate, alkyl or aryl phosphonate ester and phosphotriester.There is thiophosphate disconnected oxygen to be replaced by sulphur.Phosphate connects Connect son can also be by being set with nitrogen (bridging phosphoramidate), sulphur (bridging thiophosphate) and carbon (bridging methene phosphonate ester) Connectivity oxygen is changed to change.
Alternative nucleosides and nucleotide may include with borine part (BH3), sulphur (thio), methyl, ethyl and/or methoxy The one or more non-bridged oxygen of base displacement.As a non-limiting example, two at same position (such as α, β or γ) A non-bridged oxygen can be replaced by sulphur (thio) and methoxyl group.
The displacement (such as α-thiophosphate) for providing one or more oxygen atoms at the position α of phosphonate moiety can pass through Non-natural phosphorothioate backbone is bonded and assigns RNA and DNA stability (as the steady of exonuclease and endonuclease It is qualitative).Phosphorothioate dna and RNA partly decline with increased nuclease resistant and then in cellular environment with longer Phase.
The other internucleoside linkages connection that can be used according to the disclosure, is associated in herein including the internucleoside linkage without phosphorus atoms It is described.
Internal ribosome entry site
Polynucleotides can contain internal ribosome entry site (IRES).IRES can serve as unique ribosomes and combine One of site, or may be used as multiple mRNA ribosome bind sites.Containing having more than a functional ribosomes binding site Polynucleotides can encode several peptides or polypeptide, these peptides or polypeptide are independently turned over by ribosomes (such as polycistronic mRNA) It translates.When the polynucleotides of offer have IRES, optionally in addition providing second can translated region.It can be used according to the disclosure The example of IRES sequence includes but is not limited to come from Pironavirus (such as FMDV), insect viruses (CFFV), polio Virus (PV), encephalomyocarditis virus (ECMV), foot and mouth disease virus (FMDV), Hepatitis C Virus (HCV), swine fever virus (CSFV), those of Murine Leukemia Virus (MLV), simian immunodeficiency virus (SIV) or cricket paralysis virus (CrPV).
5 '-cap structures
Polynucleotides (such as mRNA) may include 5 '-cap structures.The 5 ' of polynucleotides-cap structure participates in core and exports and increase It adds nucleotide stability, and combines mRNA cap binding protein (CBP), CBP with polyadenylic acid binding protein by associating shape The stability and translation ability of polynucleotides in cell are realized at mature ring-type mRNA species.The cap also helps to cut in mRNA 5 ' neighbouring intrones are removed during connecing.
Endogenous polynucleotides molecule can undergo 5 '-ends to attach the names of pre-determined candidates, in the end guanosine cap residue of the polynucleotides and 5 '-ends Hold formation 5 '-ppp-5 '-triguaiacyl phosphate between the ariyoshi nucleotide of transcription bonded.Then, this 5 '-guanylation cap can be by Methylation is to generate N7- methyl-guanosine acidification residue.In the core that 5 ' ends of the polynucleotides and/or end front are transcribed The sugared ribose of thuja acid may also optionally be methylated by 2 '-O-.5 '-carried out by hydrolyzing and cracking guanylation cap are raised one's hat can With targeting degradation polynucleotide molecule, such as mRNA molecule.
Changing polynucleotides can produce the cap structure of non-hydrolysable, thus prevents from raising one's hat and therefore increases polynucleotides half It declines the phase.Since to need to crack 5 '-ppp-5 ' di-phosphate ester bonded for cap structure hydrolysis, therefore substitution can be used during reaction of attaching the names of pre-determined candidates Property nucleotide.For example, according to the explanation of manufacturer, the cowpox of New England Biolabs (Ipswich, MA) is come from Virus attach the names of pre-determined candidates enzyme can be used for α-Thioguanosine nucleotide in 5 '-ppp-5 ' cap generate thiophosphate it is bonded.It is other to replace It also can be used for property guanosine nucleotide, such as Alpha-Methyl phosphonate ester and phosphoroselenoate nucleotide.
Other nucleotide before changing the including but not limited to 5 '-ends and/or 5 '-ends of polynucleotides (as previously discussed) Ribose occur on 2 '-hydroxyls of the sugar 2 '-O- methylation.It is more to generate that a variety of 5 '-different cap structures can be used Nucleotide, such as 5 '-caps of mRNA molecule.
5 '-cap structures include International Patent Publication No. W WO2008127688, WO 2008016473 and WO 2011015347 Those of described in, the cap structure of each case is all incorporated herein by reference.
Cap analog also known as synthesizes cap analog, chemical cap, chemical cap analog or structure or function herein Property cap analog be different from native chemical structure natural (that is, endogenous, wild type or physiological) 5 '-cap structures, simultaneously Keep cap function.Cap analog can be synthesized and/or be connected to more by chemical mode (that is, non-enzymatic) or enzymatic Nucleotide.
For example, anti-reflective contains two birds connected by 5 ' -5 '-triguaiacyl phosphate group to cap analog (ARCA) cap Glycosides, one of guanosine contain N7- methyl and 3 '-O- methyl (that is, N7,3 '-O- dimethyl-guanosine -5 '-triguaiacyl phosphate -5 ' - Guanosine, i.e. m7G-3 ' mppp-G can equally be known as 3 ' O-Me-m7G (5 ') ppp (5 ') G).Another unchanged guanosine 3 '-O atoms become the 5 '-terminal nucleotides for being connected to polynucleotides of attaching the names of pre-determined candidates (such as mRNA).N7- methylation and 3 '-O- first The guanosine of base provides the end section of polynucleotides of attaching the names of pre-determined candidates (such as mRNA).
Another exemplary cap is mCAP, is similar to ARCA, but has 2 '-O- methyl (that is, N7,2 '-O- diformazans on guanosine Base guanosine -5 '-triguaiacyl phosphate -5 '-guanosine, i.e. m7Gm-ppp-G)。
Cap can be dinucleotides cap analog.As a non-limiting example, dinucleotides cap analog can be It is modified at different phosphate positions with boranophosphate ester group or phosphoroselenoate ester group, such as institute in U.S. Patent No. 8,519,110 The dinucleotides cap analog of description, the cap structure of the case are incorporated herein by reference.
Alternatively, cap analog can be as is generally known in the art and/or N7- described herein (4- chlorophenoxy ethyl) Substituted dinucleotides cap analog.The non-limiting reality for the dinucleotides cap analog that N7- (4- chlorophenoxy ethyl) replaces Example includes N7- (4- chlorophenoxy ethyl)-G (5 ') ppp (5 ') G and N7- (4- chlorophenoxy ethyl)-m3 '-OG (5 ') ppp (5 ') G cap analog is (see, for example, Kore et al., 2013 21:4570- of Bioorganic&Medicinal Chemistry Various cap analogs described in 4574 and the method for synthesizing cap analog；Its cap structure is hereby incorporated herein by In).In other cases, the cap analog that can be used in the polynucleotides of the disclosure is 4- chlorine bromine Phenoxyethyl analog.
Although cap analog allows simultaneously to attach the names of pre-determined candidates to polynucleotides in responsive transcription in vitro, there is up to 20% transcription Object is not attached the names of pre-determined candidates.The endogenous 5 '-of this point and cap analog and the polynucleotides generated by endogenous cell transcriptional machinery The architectural difference of cap structure, which may cause translation ability, to be weakened reduces with cell stability.
Alternative polynucleotides can also be attached the names of pre-determined candidates after transcription using enzyme, to generate more true 5 '-cap structure.Such as this Text is used, and phrase " more really ", which refers to, closely reflects or simulate endogenous or wild-type characteristics in structure or in function Feature.That is, the composite character or the like of the aspect ratio prior art of " truer " more preferably represents endogenous, wild Type, natural or physiological cell function and/or function, or surpass corresponding endogenous, wild type, natural in one or more aspects Or physiological feature.The non-limiting example for the more true 5 '-cap structure that can be used in the polynucleotides of the disclosure is to compare In 5 '-cap structures of synthesis as known in the art (or wild type, natural or physiological 5 '-cap structure) there is the cap of enhancing to combine Protein binding, increased half-life period, those of raising one's hat etc. to the 5 '-of 5 '-endonuclease sensibility and/or reduction of reducing. For example, recombined vaccinia virus is attached the names of pre-determined candidates, enzyme and 2 '-O- transmethylases of recombination can be in 5 '-terminal nucleotides of polynucleotides and birds It is bonded that typical 5 ' -5 '-triguaiacyl phosphate is generated between glycosides cap nucleotide, wherein the cap guanosine contain N7- methylation and it is described more The 5 ' of nucleotide-terminal nucleotide contains 2 '-O- methyl.This class formation is known as 1 structure of cap.This cap is generated compared to for example originally The cell proinflammatory of known other 5 ' cap analog structures increase in field translation ability, cell stability and reduction is thin Intracellular cytokine activation.Other examples cap structure includes 7mG (5 ') ppp (5 ') N, pN2p (cap 0), 7mG (5 ') ppp (5 ') NlmpNp (cap 1), 7mG (5 ')-ppp (5 ') NlmpN2mp (cap 2) and m (7) Gpppm (3) (6,6,2 ') Apm (2 ') Apm (2 ') Cpm (2) (3,2 ') Up (cap 4).
Since alternative polynucleotides can attach the names of pre-determined candidates after transcription, and since this process is more effective, thus it is close 100% alternative polynucleotides can be attached the names of pre-determined candidates.This is with responsive transcription in vitro in the process by cap analog and polynucleotides About 80% when association is contrasted.
5 '-end caps may include endogenous cap or cap analog.5 '-end caps may include guanosine analogue.It is useful Guanosine analogue include inosine, N1- methyl-guanosine, 2 '-fluoro- guanosines, 7- denitrogenation-guanosine, 8- oxo-guanosine, 2- amino- Guanosine, LNA- guanosine and 2- azido-guanosine.
In some cases, polynucleotides contain 5 '-caps of modified.Modification on 5 '-caps can increase polynucleotides Stability, increase the half-life period of polynucleotides, and polynucleotides translation efficiency can be increased.The 5 ' of modified-cap can be with Including but not limited to following one or more modifications: repairing at the 2 ' positions and/or 3 ' positions of guanosine triphosphate ester (GTP) of attaching the names of pre-determined candidates Decorations, saccharide ring oxygen (generating carbocyclic ring) are by methylene moiety (CH2) displacement, the modification at the triguaiacyl phosphate bridge portion of cap structure or Modification at nucleobase (G) part.
5′-UTR
5 '-the UTR provided can be used as and the flanking region of polynucleotides (such as mRNA).5 '-UTR can be with multicore glycosides Code area seen in acid is homologous or not homologous.Multiple 5 '-UTR can be included in flanking region and can have identical Or different sequences.Any part of flanking region, including no part can undergo codon optimization and any part can be with Independently containing one or more different structures or chemical modification before or after codon optimization.
In table 21 in U.S. Provisional Application No. 61/775,509 and U.S. Provisional Application No. 61/829,372 Show the starting of alternative polynucleotides (such as mRNA) and the inventory of termination site in table 21 and table 22, each case is to quote Mode is incorporated herein.In table 21, each 5 '-UTR (5 '-UTR-005 to 5 '-UTR 68511) are natural or wild relative to it Raw type (homologous) transcript identifies (ENST by its starting and termination site；Identifier used in ENSEMBL database).
In order to change one or more characteristics of polynucleotides (such as mRNA), with alternative polynucleotides (such as mRNA) The not homologous 5 '-UTR in code area can undergo it is engineered.Then, these polynucleotides (such as mRNA) can be applied To cell, tissue or organism and can be not homologous to evaluate with measurement result such as protein level, positioning and/or half-life period 5 '-UTR may be to beneficial effect caused by alternative polynucleotides (mRNA).The variant that can use 5 '-UTR, in these changes In body, one or more nucleotide, including A, T, C or G are added or removed in end.It is excellent that 5 '-UTR may also go through codon Change, or by it is described herein it is any in a manner of change.
5 '-UTR, 3 '-UTR and translational enhancer element (TEE)
5 '-UTR of polynucleotides (such as mRNA) may include at least one translational enhancer element." translation increases term Hadron element " refer to increase polypeptide or by polypeptide generate protein amount sequence.As a non-limiting example, TEE It can be between transcripting promoter and initiation codon.In 5 '-UTR at least one TEE polynucleotides (such as It mRNA) can include cap at 5 '-UTR.In addition, at least one TEE can be located at the 5 '-UTR of polynucleotides (such as mRNA) In, undergo cap dependence or the translation independent of cap.
In one aspect, TEE is the Conserved Elements in UTR, these elements can promote the translation activity of polynucleotides, such as But it is not limited to cap dependence or the translation independent of cap.Panek et al. (Nucleic Acids Research, 2013,1- 10) conservative of these sequences between 14 species including humans previously has been displayed.
In one non-limiting example, it is known that TEE can be in the 5 '-leading of Gtx homeodomain protein (Chappell et al., Proc.Natl.Acad.Sci.USA 101:9590-9594,2004, the TEE side to quote in sequence Formula is incorporated herein).
In another non-limiting example, TEE is disclosed in U.S. Patent Publication the 2009/0226470th and the 2013/th No. 0177581, international patent publications No. WO2009/075886, No. WO2012/009644 and No. WO1999/024595, And in U.S. Patent No. 6,310, No. 197 and the 6th, 849, No. 405, the TEE sequence of each case is hereby incorporated herein by In.
In another non-limiting example again, TEE can be internal ribosome entry site (IRES), HCV-IRES or IRES element, such as, but not limited to, U.S. Patent No. 7,468, No. 275, U.S. Patent Publication the 2007/0048776th and No. 2011/0124100 and international patent publications No. WO2007/025008 and No. WO2001/055369, each case IRES sequence is incorporated herein by reference.IRES element can include but is not limited to Chappell et al. (Proc.Natl.Acad.Sci.USA 101:9590-9594,2004) and Zhou et al. (PNAS 102:6273-6278, And U.S. Patent Publication No. 2007/0048776 and No. 2011/0124100 and international patent publications 2005) Gtx sequence (such as Gtx9-nt, Gtx8-nt, Gtx7-nt) described in No. WO2007/025008, the IRES sequence of each case It is incorporated herein by reference.
" translational enhancer polynucleotides " be include one or more spy illustrated herein and/or disclosed in the art TEE is determined (see, for example, U.S. Patent No. 6,310,197, No. 6,849,405, No. 7,456,273, the 7,183,395th Number；U.S. Patent Publication the 20090/226470th, No. 2007/0048776, No. 2011/0124100, the 2009/th No. 0093049, No. 2013/0177581；International patent publications the WO2009/075886th, No. WO2007/025008, No. WO2012/009644, No. WO2001/055371, No. WO1999/024595；And European Patent No. 2610341 and No. 2610340) or its variant, homologue or functional derivatives.There may be specific in polynucleotides (such as mRNA) One or more copies of TEE.TEE in translational enhancer polynucleotides can be organized in one or more sequence sections. One sequence section can be with one or more specific TEE illustrated herein, and each TEE is deposited with one or more copy In.When, there are when multiple sequence sections, these sequence areas can be homologous or not homologous in translational enhancer polynucleotides 's.Therefore, multiple sequence sections in translational enhancer polynucleotides can be with the illustrated herein of identical or different type Specific TEE, each specific TEE identical or different quantity copy and/or identical or different TEE group in each sequence section It knits.
Polynucleotides (such as mRNA) may include at least one TEE, and the TEE is in international patent publications WO1999/ No. 024595, No. WO2012/009644, No. WO2009/075886, No. WO2007/025008, WO1999/ No. 024595；European patent publication No. 2610341 and No. 2610340；U.S. Patent No. 6,310,197, the 6,849th, No. 405, No. 7,456,273, No. 7,183,395；And U.S. Patent Publication the 2009/0226470th, the 2011/th No. 0124100, No. 2007/0048776, No. 2009/0093049 and No. 2013/0177581, the TEE sequence of each case with The mode of reference is incorporated herein.TEE can be in the 5 '-UTR of polynucleotides (such as mRNA).
Polynucleotides (such as mRNA) may include at least one and U.S. Patent Publication the 2009/0226470th, No. 2007/0048776, No. 2013/0177581 and No. 2011/0124100；International patent publications WO1999/024595 Number, No. WO2012/009644, No. WO2009/075886 and No. WO2007/025008；European patent publication No. 2610341 and No. 2610340；U.S. Patent No. 6,310,197, No. 6,849,405, No. 7,456,273, the 7th, TEE described in No. 183,395 have at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, the TEE of at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity, the TEE sequence of each case with The mode of reference is incorporated herein.
5 '-UTR of polynucleotides (such as mRNA) may include at least one, at least two, at least three, at least four, extremely Few 5, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, extremely Few 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 It is a, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, extremely Few 55 or more than 60 TEE sequences.TEE sequence in 5 '-UTR of polynucleotides (such as mRNA) can be identical or different TEE sequence.TEE sequence can in be repeated once, twice or more than three times such as ABABAB, AABBAABBAABB or ABCABCABC or its variant isotype.In these modes, each letter A, B or C indicate different on nucleotide level TEE sequence.
In some cases, 5 '-UTR may include the introns for separating two TEE sequences.It is unrestricted as one Property example, introns can be introns and/or other introns as known in the art containing 15 nucleotide.As another A non-limiting example, 5 '-UTR may include be repeated at least once more in 5 '-UTR, at least twice, at least 3 times, at least 4 times, At least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or TEE sequence-interval submodule more than 9 times.
In other cases, the introns for separating two TEE sequences may include the controllable disclosure as is generally known in the art Polynucleotides (such as mRNA) translation other sequences, such as, but not limited to, miR sequence (such as miR binding site and miR kind Subsequence).As a non-limiting example, each introns for separating two TEE sequences may include different miR sequences The component (such as miR seed sequence) of column or miR sequence.
In some cases, the TEE in the 5 '-UTR of polynucleotides (such as mRNA) include at least 5%, at least 10%, At least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, At least 99% or the following case more than 99% disclosed in TEE sequence: U.S. Patent Publication the 2009/0226470th, No. 2007/0048776, No. 2013/0177581 and No. 2011/0124100；International patent publications WO1999/024595 Number, No. WO2012/009644, No. WO2009/075886 and No. WO2007/025008；European patent publication No. 2610341 and No. 2610340；And U.S. Patent No. 6,310,197, No. 6,849,405, No. 7,456,273 With the 7th, 183, No. 395, the TEE sequence of each case is incorporated herein by reference.In another embodiment, in this public affairs TEE in 5 '-UTR of the polynucleotides (such as mRNA) opened may include U.S. Patent Publication the 2009/0226470th, No. 2007/0048776, No. 2013/0177581 and No. 2011/0124100；International patent publications WO1999/024595 Number, No. WO2012/009644, No. WO2009/075886 and No. WO2007/025008；European patent publication No. 2610341 and No. 2610340；And U.S. Patent No. 6,310,197, No. 6,849,405, No. 7,456,273 With the segment of 5-30 nucleotide of the TEE sequence disclosed in No. 7,183,395, the segment of 5-25 nucleotide, 5-20 The segment of a nucleotide, the segment of 5-15 nucleotide, the segment of 5-10 nucleotide；Side of the TEE sequence of each case to quote Formula is incorporated herein.
In some cases, the TEE in the 5 '-UTR of the polynucleotides of the disclosure (such as mRNA) may include at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, At least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or the following case more than 99% disclosed in TEE sequence: Chappell et al. (Proc.Natl.Acad.Sci.USA 101:9590-9594,2004) and Zhou et al. (PNAS 102:6273-6278, 2005)；Wellensiek et al. (Genome-wide profiling of human cap-independent translation-enhancing elements,Nature Methods,2013；DOI:10.1038/NMETH.2522 in) Disclosed supplement table 1 and supplement table 2；The TEE sequence of each case is incorporated herein by reference.In another embodiment In, the TEE in 5 '-UTR of the polynucleotides (such as mRNA) of the disclosure may include Chappell et al. (Proc.Natl.Acad.Sci.USA 101:9590-9594,2004) and Zhou et al. (PNAS 102:6273-6278, 2005)；Wellensiek et al. (Genome-wide profiling of human cap-independent translation-enhancing elements,Nature Methods,2013；DOI:10.1038/NMETH.2522 in) Disclosed supplement table 1 and augment the segment of 5-30 nucleotide of TEE sequence disclosed in table 2,5-25 nucleotide Segment, the segment of 5-20 nucleotide, the segment of 5-15 nucleotide, the segment of 5-10 nucleotide；The TEE sequence of each case with The mode of reference is incorporated herein.
In some cases, the TEE used in the 5 '-UTR of polynucleotides (such as mRNA) is IRES sequence, such as but not Those of described in being limited to U.S. Patent No. 7,468, No. 275 and international patent publications the WO2001/055369th, each case TEE sequence is incorporated herein by reference.
In some cases, the TEE used in the 5 '-UTR of polynucleotides (such as mRNA) can pass through United States Patent (USP) Announce No. 2007/0048776 and No. 2011/0124100 and international patent publications the WO2007/025008th and Method described in No. WO2012/009644 identifies, and the method for each case is incorporated herein by reference.
In some cases, the TEE used in the 5 '-UTR of the polynucleotides of the disclosure (such as mRNA) can be beauty State's patent No. 7,456,273 and No. 7,183,395, U.S. Patent Publication the 2009/0093049th and international publication The TEE sequence of transcriptional regulatory element described in No. WO2001/055371, each case is incorporated herein by reference.Turn Record controlling element can by method as known in the art, such as, but not limited to, U.S. Patent No. 7,456, No. 273 and the 7th, Described in No. 183,395, U.S. Patent Publication the 2009/0093049th and international publication the WO2001/055371st Method identifies, and the method for each case is incorporated herein by reference.
In other situations again, the TEE used in the 5 '-UTR of polynucleotides (such as mRNA) is such as U.S. Patent No. No. 7,456,273 and No. 7,183,395, U.S. Patent Publication the 2009/0093049th and international publication WO2001/ The TEE sequence of polynucleotides described in No. 055371 or part thereof, each case is incorporated herein by reference.
5 '-the UTR including at least one TEE as described herein can be incorporated into monocistronic sequence, such as, but not limited to, carry In system system or polynucleotide carrier.As a non-limiting example, carrier system and polynucleotide carrier may include beauty State's patent No. 7,456,273 and No. 7,183,395, U.S. Patent Publication the 2007/0048776th, the 2009/th In No. 0093049 and No. 2011/0124100 and international publication No. WO2007/025008 and No. WO2001/055371 It is described those, the TEE sequence of each case is incorporated herein by reference.
TEE described herein can be in the 5 '-UTR and/or 3 '-UTR of polynucleotides (such as mRNA).It is located at TEE in 3 '-UTR can from be located at and/or the described TEE being incorporated in 5 '-UTR is identical and/or different.
In some cases, 3 '-UTR of polynucleotides (such as mRNA) may include at least one, at least two, at least 3 A, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12 It is a, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, extremely Few 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45 A, at least 50, at least 55 or more than 60 TEE sequences.In 3 '-UTR of the polynucleotides (such as mRNA) of the disclosure TEE sequence can be identical or different TEE sequence.TEE sequence can in be repeated once, twice or more than three times as ABABAB, AABBAABBAABB or ABCABCABC or its variant isotype.In these modes, each letter A, B or C are in core Different TEE sequences is indicated on nucleotide levels.
In one case, 3 '-UTR may include the introns for separating two TEE sequences.It is unrestricted as one Property example, introns can be introns and/or other introns as known in the art containing 15 nucleotide.As another A non-limiting example, 3 '-UTR may include be repeated at least once more in 3 '-UTR, at least twice, at least 3 times, at least 4 times, At least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or TEE sequence-interval submodule more than 9 times.
In other cases, the introns for separating two TEE sequences may include the controllable disclosure as is generally known in the art Polynucleotides (such as mRNA) translation other sequences, such as, but not limited to, miR sequence described herein (such as miR knot Coincidence point and miR seed sequence).It as a non-limiting example, can be with for separating each introns of two TEE sequences Component (such as miR seed sequence) including different miR sequences or miR sequence.
In other situations again, it is incorporated to the shape that miR sequence and/or TEE sequence will change stem ring area, it is possible thereby to increase And/or reduce translation.(see, for example, Kedde et al., A Pumilio-induced RNA structure switch in p27-3′UTR controls miR-221 and miR-22accessibility.Nature Cell Biology.2010)。
Stem ring
Polynucleotides (such as mRNA) may include stem ring, such as, but not limited to, histone stem ring.Stem ring can be length The nucleotide sequence of about 25 or about 26 nucleotide, institute in such as, but not limited to, international patent publications the WO2013/103659th Those of description, which is incorporated herein by reference.Histone stem ring can be located at 3 '-end (examples relative to code area Such as in 3 '-ends of code area).As a non-limiting example, stem ring can be located at polynucleotides as described herein 3 '-ends.In some cases, polynucleotides (such as mRNA) include more than one stem ring (such as two stem rings).Stem ring sequence Example be described in international patent publications No. WO2012/019780 and No. WO201502667, stem ring sequence is to quote Mode be incorporated herein.In some cases, polynucleotides include stem ring sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO:1).In other cases, polynucleotides include stem ring sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO:2)。
Stem ring can be located in another terminal region of polynucleotides.As a non-limiting example, stem ring can be with In untranslated region (such as 3 '-UTR) in another terminal region.
In some cases, including the polynucleotides of histone stem ring, such as, but not limited to, mRNA, addition 3 '-can be passed through Area's (3 '-for example including at least one chain termination nucleosides stabilize area) is stabilized to realize and stablize.It is not wishing to be bound by theory, adds Add at least one chain termination nucleosides that can slow down the degradation of polynucleotides and therefore can increase the half-life period of the polynucleotides.
It in other cases, can be by changing multicore including the polynucleotides of histone stem ring, such as, but not limited to, mRNA The 3 ' of thuja acid-area thus it can be prevented that and/or the addition of oligomerization (U) is inhibited to stablize to realize (see, for example, international patent publications No. WO2013/103659).
Under other situations again, the polynucleotides including histone stem ring, such as, but not limited to, mRNA, can by add with 3 '-deoxyribonucleosides, 2 ', 3 '-dideoxyribonucleosides, 3 '-O- methyl nucleosides, 3 '-O- ethyl nucleosides, 3 '-Arabinosides and sheet The oligonucleotides of other alternative nucleosides sealing ends known and/or described herein realizes stabilization in field.
In some cases, the polynucleotides of the disclosure may include histone stem ring, polyadenylic acid area and/or 5 '-caps Structure.Histone stem ring can be before or after polyadenylic acid area.Including histone stem ring and polyadenylic acid region sequence Polynucleotides may include chain termination nucleosides described herein.
In other cases, the polynucleotides of the disclosure may include histone stem ring and 5 '-cap structures.5 '-cap structures Can include but is not limited to it is described herein and/or it is as known in the art those.
In some cases, conservative stem ring area may include miR sequence described herein.It is non-limiting as one Example, stem ring area may include the seed sequence of miR sequence described herein.In another non-limiting example, stem ring Area may include miR-122 seed sequence.
In some cases, conservative stem ring area may include miR sequence described herein and can also include TEE Sequence.
In some cases, it is incorporated to the shape that miR sequence and/or TEE sequence will change stem ring area, it is possible thereby to increase And/or reduce translation.(see, for example, Kedde et al., A Pumilio-induced RNA structure switch in P27-3 ' UTR controls miR-221 and miR-22accessibility.Nature Cell Biology.2010, It is incorporated herein by reference in its entirety).
Polynucleotides may include at least one histone stem ring and polyadenylic acid area or polyadenylation signal.Coding is extremely The non-limiting example description of the polynucleotide sequence of a few histone stem ring and polyadenylic acid area or polyadenylation signal In international patent publications the WO2013/120497th, No. WO2013/120629, No. WO2013/120500, WO2013/ No. 120627, No. WO2013/120498, No. WO2013/120626, No. WO2013/120499 and WO2013/ In No. 120628, the sequence of each case is incorporated herein by reference.In some cases, encoding histone stem ring and poly- gland The polynucleotides of thuja acid area or polyadenylation signal can be with encoding pathogen antigen or its segment, such as international patent publications Polynucleotide sequence described in No. WO2013/120499 and No. WO2013/120628, side of the sequence of two cases to quote Formula is incorporated herein.In other cases, the multicore glycosides of encoding histone stem ring and polyadenylic acid area or polyadenylation signal Acid can encode therapeutic protein, such as institute in international patent publications No. WO2013/120497 and No. WO2013/120629 The sequence of the polynucleotide sequence of description, two cases is incorporated herein by reference.In some cases, encoding histone stem The polynucleotides of ring and polyadenylic acid area or polyadenylation signal can be with encoding tumor-antigens or its segment, such as international monopoly public affairs Polynucleotide sequence described in cloth No. WO2013/120500 and No. WO2013/120627, the sequence of two cases is to quote Mode be incorporated herein.In other cases, encoding histone stem ring and polyadenylic acid area or polyadenylation signal is more Nucleotide can encode sensitizing antigen or autoimmune self-antigen, and such as international patent publications the WO2013/120498th With No. WO2013/120626 described in polynucleotide sequence, the sequence of two cases is incorporated herein by reference.
Polyadenylic acid area
Polynucleotides or nucleic acid (such as mRNA) may include polyadenylic acid sequence and/or polyadenylation signal.Poly- gland Nucleotide sequence can be entirely or primarily made of adenylic acid or its analog or derivative.Polyadenylic acid sequence can be Tail near 3 ' untranslated region of nucleic acid.
During RNA processing, long-chain adenylic acid (polyadenylic acid area) is usually added to mRNA (mRNA) point Son is to increase the stability of the molecule.After transcription, the 3 ' of transcript-ends are cracked into free 3 '-hydroxyl immediately.Then, poly- gland Adenylic acid chain is added to RNA by thuja acid polymerase.The process is known as polyadenylation, addition length between 100 with Polyadenylic acid area between 250 residues.
Unique polyadenylic acid section length can provide certain benefits for the alternative polynucleotides of the disclosure.
In general, the length in the polyadenylic acid area of the disclosure is that at least 30 nucleotide are long.In another embodiment In, polyadenylic acid area is that at least 35 nucleotide are long.In another embodiment, length is at least 40 nucleotide.Another In one embodiment, length is at least 45 nucleotide.In another embodiment, length is at least 55 nucleotide. In another embodiment, length is at least 60 nucleotide.In another embodiment, length is at least 70 nucleosides Acid.In another embodiment, length is at least 80 nucleotide.In another embodiment, length is at least 90 Nucleotide.In another embodiment, length is at least 100 nucleotide.In another embodiment, length is at least 120 nucleotide.In another embodiment, length is at least 140 nucleotide.In another embodiment, length It is at least 160 nucleotide.In another embodiment, length is at least 180 nucleotide.In another embodiment In, length is at least 200 nucleotide.In another embodiment, length is at least 250 nucleotide.In another reality It applies in scheme, length is at least 300 nucleotide.In another embodiment, length is at least 350 nucleotide.Another In one embodiment, length is at least 400 nucleotide.In another embodiment, length is at least 450 nucleosides Acid.In another embodiment, length is at least 500 nucleotide.In another embodiment, length is at least 600 A nucleotide.In another embodiment, length is at least 700 nucleotide.In another embodiment, length be to Few 800 nucleotide.In another embodiment, length is at least 900 nucleotide.In another embodiment, long Degree is at least 1000 nucleotide.In another embodiment, length is at least 1100 nucleotide.In another embodiment party In case, length is at least 1200 nucleotide.In another embodiment, length is at least 1300 nucleotide.Another In a embodiment, length is at least 1400 nucleotide.In another embodiment, length is at least 1500 nucleosides Acid.In another embodiment, length is at least 1600 nucleotide.In another embodiment, length is at least 1700 nucleotide.In another embodiment, length is at least 1800 nucleotide.In another embodiment, long Degree is at least 1900 nucleotide.In another embodiment, length is at least 2000 nucleotide.In another embodiment party In case, length is at least 2500 nucleotide.In another embodiment, length is at least 3000 nucleotide.
In some cases, the polyadenylic acid area on alternative polynucleotide molecule described herein can be 80 Nucleotide, 120 nucleotide, 160 nucleotide are long.
In other cases, the polyadenylic acid area on alternative polynucleotide molecule described herein can be 20, 40,80,100,120,140 or 160 nucleotide are long.
In some cases, polyadenylic acid area is the Design of length relative to entire alternative polynucleotides.This design It can length based on the code area of the alternative polynucleotides, the special characteristic of the alternative polynucleotides (such as mRNA) or area The length in domain, or the length based on the final product expressed by the alternative polynucleotides.When relative to alternative polynucleotides Any feature (such as except include polyadenylic acid area mRNA part in addition to) when, the length in the polyadenylic acid area can be more additional than this Feature long 10,20,30,40,50,60,70,80,90 or 100%.Polyadenylic acid area can also be designed as substitution belonging to it A part of property polynucleotides.In this case, polyadenylic acid area can be construct total length or without polyadenylic acid area Construct total length 10,20,30,40,50,60,70,80 or 90% or greater percentage.
In some cases, the engineered bound site of polynucleotides (such as mRNA) Yu polyadenylic acid area can be used Point and/or coupling Enhanced expressing.Engineered binding site can be sensor sequence, these sequences can be used as polynucleotides The binding site of the ligand of (such as mRNA) local microenvironment operates.As a non-limiting example, polynucleotides (such as It mRNA may include) at least one engineered binding site to change polyadenylic acid binding protein (PABP) and its analog Binding affinity.Be incorporated at least one engineered binding site can increase PABP and its analog combination it is affine Power.
In addition, the substitution in 3 '-end of polyadenylic acid area can be used in multiple and different polynucleotides (such as mRNA) Property nucleotide through 3 '-end be connected to PABP (polyadenylic acid binding protein) together.It is real that transfection can be carried out in relevant cell system It tests and can be measured with 12 hours after transfection, 24 hours, 48 hours, 72 hours and the 7th day by ELISA.As one It is right caused by least one engineered binding site as adding that transfection experiment evaluation can be used in a non-limiting example The influence of PABP or its analog binding affinity.
In some cases, polyadenylic acid area can be used and adjust translation initiation.It is not wishing to be bound by theory, polyadenylic acid Area raises PABP, and the PABP of recruitment can interact with translation initiation complex again and therefore may be blended into pass to protein It is important.
In some cases, polyadenylic acid area can be used in the disclosure to prevent 3 ' -5 '-exonuclease digestion.
In some cases, polynucleotides (such as mRNA) may include poly A-G tetrad.G- tetrad is by four The array for the cycloalkyl hydroperoxide bond that guanylic acid is constituted, can be formed by the sequence for being rich in G in DNA and RNA.In this reality It applies in scheme, G- tetrad is incorporated into the end in polyadenylic acid area.It can be in the thus obtained multicore glycosides of various time point determinings The stability of sour (such as mRNA), protein generates and the other parameters including half-life period.It has been found that poly A-G tetra- It is conjuncted to be equivalent to protein output using at least 75% seen in the only polyadenylic acid area of 120 nucleotide.
In some cases, polynucleotides (such as mRNA) may include polyadenylic acid area and can be by addition 3 '- It stabilizes area and realizes and stablize.Polynucleotides (such as mRNA) with polyadenylic acid area can also include 5 '-cap structures.
In other cases, polynucleotides (such as mRNA) may include poly A-G tetrad.With poly A-G tetrad The polynucleotides (such as mRNA) of body can also include 5 '-cap structures.
In some cases, may be used to include polyadenylic acid area or poly A-G tetrad polynucleotides (such as MRNA) stable 3 '-stabilize area can be but not limited to international patent publications the WO2013/103659th described in that A bit, the polyadenylic acid area of the case or poly A-G tetrad are incorporated herein by reference.In other cases, Ke Yiyong Stabilizing area in the 3 '-of the disclosure includes chain termination nucleosides, such as cordycepin (cordycepin (cordycepin)), 3 '-deoxidations Uridine, 3 '-dideoxycytosines, 3 '-deoxyguanosines, 3 '-deoxythymidines, 2 ', 3 '-dideoxyribonucleosides, such as 2 ', 3 '-is bis- de- Oxygen adenosine, 2 ', 3 '-dideoxyuridines, 2 ', 3 '-double deoxidation cytimidines, 2 ', 3 '-dideoxyguanosines, 2 ', 3 '-double deoxidation thymus gland Pyrimidine, 2 '-deoxyribonucleosides or O- methyl nucleoside.
In other cases, the polynucleotides including polyadenylic acid area or poly A-G tetrad, such as, but not limited to, mRNA, Can by change polynucleotides 3 '-areas, thus it can be prevented that and/or inhibits the addition of oligomerization (U) come realize stabilization (referring to Such as international patent publications the WO2013/103659th).
In other situations again, the polynucleotides including polyadenylic acid area or poly A-G tetrad, such as, but not limited to, MRNA, can by add with 3 '-deoxyribonucleosides, 2 ', 3 '-dideoxyribonucleosides, 3 '-O- methyl nucleosides, 3 '-O- ethyl nucleosides, 3 '-Arabinosides and as is generally known in the art and/or the oligonucleotide of other alternative nucleosides sealing ends described herein To realize stabilization.
Chain termination nucleosides
Nucleic acid may include chain termination nucleosides.For example, chain termination nucleosides may include at the 2 ' of its glycosyl and/or 3 ' positions Those of deoxidation nucleosides.Such species may include 3'-Deoxyadenosine (cordycepin), 3'- BrdU, 3'- dideoxycytosine, 3'- deoxyguanosine, 3'- deoxythymidine and 2', 3'- dideoxyribonucleoside, such as 2', 3 '-Didanosines, 2', 3'- double deoxidation Uridine, 2', 3'- double deoxidation cytimidine, 2', 3'- dideoxyguanosine and 2', 3'- double deoxidation thymidine.
Other components
Nanoparticle compositions may include it is one or more those of described in the preceding sections in addition to component.Example Such as, nanoparticle compositions may include one or more hydrophobic small molecules, such as vitamin (such as vitamin A or vitamin ) or sterol E.
Nanoparticle compositions can also include that one or more permeability enhance molecule, carbohydrate, polymer, table Face changes agent or other components.Permeability enhancing molecule can be such as No. 2005/0222064 institute of U.S. Patent Application Publication The molecule of description.Carbohydrate may include simple sugars (such as glucose) and polysaccharide (such as glycogen and its derivative and Analog).
Polymer can be included in nanoparticle compositions and/or for being encapsulated or part is encapsulated combinations of nanoparticles Object.Polymer can be biodegradable and/or biocompatible.Polymer can be selected from but not limited to polyamine, polyethers, polyamides Amine, polyester, polyurethanes, polyureas, polycarbonate, polystyrene, polyimides, polysulfones, polyurethane, polyacetylene, poly- second Alkene, polyethyleneimine, polyisocyanate, polyacrylate, polymethacrylates, polyacrylonitrile and Aromatic polyester.For example, poly- Closing object may include poly- (caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly- (lactic acid) (PLA), poly- (L- cream Acid) (PLLA), poly- (hydroxyacetic acid) (PGA), poly- (lactic acid-co-glycolic acid) (PLGA), poly- (Pfansteihl -co- hydroxyacetic acid) (PLLGA), poly- (D, L- lactide) (PDLA), poly- (L- lactide) (PLLA), poly(D,L-lactide-co-caprolactone), gather (D, L- lactide-co-caprolactone -co- glycolide), poly- (the co- D of D, L- lactide-co-PEO-, L- lactide), poly- (D, L- The co- D of lactide-co-PPO-, L- lactide), polyalkylcyanoacrylate, polyurethane, polylysine (PLL), metering system Sour hydroxy propyl ester (HPMA), polyethylene glycol, L-glutamic acid, poly- (carboxylic acid), polyanhydride, polyorthoester, poly- (esteramides), polyamides Amine, poly- (ester ether), polycarbonate, polyolefin such as polyethylene and polypropylene, poly- alkane glycol such as poly(ethylene glycol) (PEG), polyoxygenated Alkene (PEO), poly terephthalic acid alkane diester for example poly- (ethylene terephthalate), polyvinyl alcohol (PVA), polyvinylether, poly- second Alkenyl esters for example poly- (vinyl acetate), polyvinyl halide for example poly- (vinyl chloride) (PVC), polyvinylpyrrolidone (PVP), polysiloxanes, polystyrene (PS), polyurethane, derivative cellulose such as alkylcellulose, hydroxy alkyl cellulose, fibre It is for example poly- ((methyl) to tie up plain ether, cellulose esters, NC Nitroncellulose, hydroxypropyl cellulose, carboxymethyl cellulose, acrylate copolymer Methyl acrylate) (PMMA), poly- ((methyl) ethyl acrylate), poly- ((methyl) butyl acrylate), poly- ((methyl) acrylic acid is different Butyl ester), poly- ((methyl) Hexyl 2-propenoate), poly- ((methyl) isodecyl acrylate), poly- ((methyl) lauryl acrylate), poly- ((methyl) phenyl acrylate), poly- (methyl acrylate), poly- (isopropyl acrylate), poly- (isobutyl acrylate), poly- (acrylic acid Octadecane ester) and its copolymer and mixture, polydioxanone and its copolymer, polyhydroxyalkanoates, poly- fumaric acid Propylene diester, polyformaldehyde, poloxamer (poloxamer), polyoxy amine, poly- (ortho acid) ester, poly- (butyric acid), poly- (valeric acid), poly- (third hands over Ester -co- caprolactone), trimethylene carbonate, poly- (N- acryloyl morpholine) (PAcM), poly- (2- methyl -2- oxazoline) (PMOX), poly- (2- ethyl -2- oxazoline) (PEOZ) and polyglycereol.
Surface modification agent can include but is not limited to anionic property protein (such as bovine serum albumin(BSA)), surfactant (such as cationic surfactant, such as GERBU Adjuvant 100), sugar or sugar derivatives (such as cyclodextrin), core Acid, polymer (such as heparin, polyethylene glycol and poloxamer), mucolytic agent (such as acetylcysteine, argy wormwood, pineapple Protease (bromelain), papain, smalt (clerodendrum), bromhexine (bromhexine), carbocisteine (carbocisteine), Eprazinone (eprazinone), mesna (mesna), ambroxol (ambroxol), Sobrerol (sobrerol), dimiodol (domiodol), Letosteine (letosteine), Stepronin (stepronin), general sieve of sulphur Rather (tiopronin), gelsolin (gelsolin), thymic peptide (thymosin) β 4, streptodornase α (dornase Alfa), Neltenexine (neltenexine) and Erdosteine (erdosteine)) and DNA enzymatic (such as rhDNA enzyme).Surface changes Becoming agent can be placed in the nanoparticles of nanoparticle compositions and/or on surface (such as by coating, absorption, covalent Connection or other methods).
Nanoparticle compositions can also include one or more functionalization lipids.For example, lipid can use alkynyl function Change, which may undergo cycloaddition reaction when being exposed to azide under the conditions of appropriate reaction.Exactly, lipid is double Layer can be effectively facilitated the group functionalization of film infiltration, cell recognition or imaging with one or more by this mode. It the surface of nanoparticle compositions can also be with one or more useful antibody couplings.Can be used for targeting cell delivering, imaging and The functional group of film infiltration and conjugate are well known in the art.
Exceptionally except these groups, nanoparticle compositions may include any substance that can be used in pharmaceutical composition.For example, Nanoparticle compositions may include one or more pharmaceutically acceptable excipient or auxiliary element, such as, but not limited to, one kind Or multi-solvents, decentralized medium, diluent, dispersing aid, suspension aids, granulation aid, disintegrating agent, filler, glidant, liquid Body mediator, adhesive, surfactant, isotonic agent, thickener or emulsifier, buffer, lubricant, oil, preservative and other Species.It can also include excipient, such as wax, butter, colorant, coating, flavoring agent and aromatic.Pharmaceutically acceptable figuration Agent is well known in the art (see, for example, Remington ' s The Science and Practice of Pharmacy, the 21st edition, A.R.Gennaro；Lippincott,Williams&Wilkins,Baltimore,MD,2006).
The example of diluent can include but is not limited to calcium carbonate, sodium carbonate, calcium phosphate, Dicalcium Phosphate, calcium sulfate, phosphoric acid Hydrogen calcium, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, D-sorbite, inositol, sodium chloride, Dried starch, cornstarch, powdered sugar and/or combination thereof.Granulating agent and dispersing agent can be unrestricted selected from being made up of Property inventory: potato starch, cornstarch, tapioca, sodium starch glycollate, clay, alginic acid, guar gum, citrus pulp, Agar, bentonite, cellulose and woodwork, natural sponge, cation exchange resin, calcium carbonate, silicate, sodium carbonate, crosslinking Polyvinylpyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycollate), carboxymethyl cellulose, crosslinking carboxylic Methylcellulose (croscarmellose) sodium, pregelatinized starch (starch 1500), Microcrystalline Starch, does not dissolve in methylcellulose Starch, calcium carboxymethylcellulose, the aluminum magnesium silicate of waterNaLS, quaternary ammonium compound and/or its Combination.
Surfactant and/or emulsifier can include but is not limited to naturally occurring emulsifying agent (such as Arabic gum, agar, sea Alginic acid, sodium alginate, tragacanth, Irish moss (chondrux), cholesterol, xanthan gum, pectin, gelatin, yolk, casein, sheep Hair rouge, cholesterol, wax and lecithin), colloidal clay (such as bentonite [alumina silicate] and[aluminum magnesium silicate]), Long chain amino acid derivative, high molecular weight alcohol (such as stearyl alcohol, cetanol, oleyl alcohol, cholesterol, ethylene glycol two Stearate, glyceryl monostearate and propylene glycol monostearate, polyvinyl alcohol), carbomer (carbomers) (such as carboxylic Base polymethylene, polyacrylic acid, acrylate copolymer and carboxyl vinyl polymer), carrageenan, cellulose derivative (example Such as sodium carboxy methyl cellulose, powdery cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, first Base cellulose), sorbitan fatty acid esters (such as Tween 20 [ 20], polyoxyethylene sorbitan [60], Polysorbate 80 [80], span 40 [40], sorbitan monostearate [60], sorbitan tristearate [65], Monoolein, sorbitan list oleic acid Ester [80]), polyoxyethylene ester (such as polyoxyl 40 stearate [45], polyethylene glycol hydrogenated castor Sesame oil, GREMAPHOR GS32, polyoxymethylene stearate and), sucrose fatty ester, polyethylene glycol Aliphatic ester (such as), polyoxyethylene ether (such as polyoxyethylene lauryl ether [30]), gather (vinyl-pyrrolidinone), diethylene glycol monolaurate, Emulphor FM, enuatrol, potassium oleate, ethyl oleate, oil Acid, ethyl laurate, NaLS, F 68、188, cetane front three Base ammonium bromide, greening cetyl pyridinium, benzalkonium chloride (benzalkonium chloride), docusate sodium (docusate Sodium) and/or combination thereof.
Adhesive can be starch (such as cornstarch and starch paste)；Gelatin；Sugar (such as sucrose, glucose, dextrorotation Sugar, dextrin, molasses, lactose, lactitol, mannitol)；Natural and synthesis jelly (such as Arabic gum, sodium alginate, love The blue moss extract of that, panwar glue, ghatti gum, Yi Shabei shell viscose glue (mucilage of isapol husks), carboxylic Methylcellulose, methylcellulose, ethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, Microcrystalline cellulose, cellulose acetate, poly- (vinyl-pyrrolidinone), magnesium alumina silicateWith pine Arabic half Newborn glycan (larch arabogalactan))；Alginate；Polyethylene glycol oxide；Polyethylene glycol；Inorganic calcium salt；Silicic acid；Poly- first Base acrylate；Wax；Water；Alcohol；And a combination thereof or any other suitable adhesive.
The example of preservative can include but is not limited to antioxidant, chelating agent, anti-microbial preservative, antimycotic anti-corrosion Agent, alcohols preservative, acidic preservative and/or other preservatives.The example of antioxidant includes but is not limited to alpha tocopherol, resists Bad hematic acid, Vitamin C base palmitate, butylated hydroxyanisol, butylated hydroxytoluene, monothioglycerol, inclined bisulfite Potassium, propionic acid, propylgallate, sodium ascorbate, sodium hydrogensulfite, sodium metabisulfite and/or sodium sulfite.Chelating agent Example includes ethylenediamine tetra-acetic acid (EDTA), citric acid monohydrate, natrium adetate (disodium edetate), edetic acid(EDTA) Dipotassium, edetic acid(EDTA), fumaric acid, malic acid, phosphoric acid, edetate sodium, tartaric acid and/or edetate trisodium.It is antimicrobial anti- The example of rotten agent includes but is not limited to benzalkonium chloride, benzethonium chloride (benzethonium chloride), benzyl alcohol, bronopol (bronopol), the bent bromo-amine (cetrimide) in west, cetyl pyridinium chloride, Chlorhexidine (chlorhexidine), methaform, chlorine Cresols (chlorocresol), chloroxylenol (chloroxylenol), cresols (cresol), ethyl alcohol, glycerol, Hexetidine (hexetidine), her miaow urea (imidurea), phenol, phenoxetol, benzyl carbinol, phenylmercuric nitrate (phenylmercuric Nitrate), propylene glycol and/or thimerosal (thimerosal).The example of antifungal preservative includes but is not limited to para hydroxybenzene Butyl formate, methyl p-hydroxybenzoate, ethyl-para-hydroxybenzoate, propylparaben, benzoic acid, hydroxy benzenes first Acid, Potassium Benzoate, potassium sorbate, sodium benzoate, sodium propionate and/or sorbic acid.The example of alcohols preservative includes but is not limited to Ethyl alcohol, polyethylene glycol, benzyl alcohol, phenol, phenolic compound, bis-phenol, methaform, hydroxybenzoate and/or benzyl carbinol.It is acid The example of preservative includes but is not limited to that vitamin A, vitamin C, vitamin E, beta carotene, citric acid, acetic acid, dehydrogenation are anti- Bad hematic acid, ascorbic acid, sorbic acid and/or phytic acid.Other preservatives include but is not limited to tocopherol, tocopherol acetate, first Sulfonic acid ground special oxime (deteroxime mesylate), cetrimonium bromide, butylated hydroxyanisol (BHA), butylated hydroxytoluene (BHT), ethylenediamine, NaLS (SLS), sodium laureth sulfate (SLES), sodium hydrogensulfite, sodium metabisulfite, Potassium bisulfite, inclined potassium bisulfite, GLYDANT Methyl p-hydroxybenzoate,115、 II、NEOLONETM、KATHONTMAnd/or
The example of buffer includes but is not limited to that citrate buffer solution, acetate buffer solution, phosphate-buffered are molten Liquid, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, neo-calglucon (calcium glubionate), Calcium Glucoheptonate, Portugal Calciofon, d- gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propionic acid, calcium levulinate, valeric acid, Dicalcium Phosphate, phosphorus Acid, tricalcium phosphate, three alkali calcium phosphates, potassium acetate, potassium chloride, potassium gluconate, potassium mixture, dikalium phosphate, monopotassium phosphate, phosphorus Sour potassium mixture, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, disodium hydrogen phosphate, monosodium phosphate, sodium phosphate are mixed Close object, tromethamine (tromethamine), sulfamic acid salt buffer (such as HEPES), magnesium hydroxide, aluminium hydroxide, sea Alginic acid, apyrogeneity matter water, isotonic physiological saline, Ringer's solution (Ringer's solution), ethyl alcohol and/or combination thereof.Profit Lubrication prescription can be selected from non-limiting group be made up of: magnesium stearate, calcium stearate, stearic acid, silica, talcum, wheat Bud, Compritol 888 ATO, hydrogenated vegetable oil, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, lauryl sulfate Magnesium, NaLS and a combination thereof.
The example of oil includes but is not limited to apricot kernel oil, apricot persic oil, avocado oil, babassu oil, bergamot oil, currant Oil, borage oil, cade oil, oil of chamomile, canola oil, caraway seed oil, babassu oil, castor oil, cinnamon oil, cocoa butter, Coconut oil, cod-liver oil, caffeol, corn oil, cottonseed oil, fat of Oromaius norvaehollandeae, You Jiali oil (eucalyptus), evening primrose oil, fish Oil, linseed oil, geraniol, calaba oil, grape seed oil, hazelnut oil, oil of hyssop (hyssop), isopropyl myristate, lotus lotus Bar oil, bankoul nut oil, lavandin oil, lavender oil, lemon oil, litsea citrate oil, macadimia nut oil, high mallow oil, mango seed oil, pond Flower seed oil, ermine oil, mace oil, olive oil, orange oil, Atlantic Ocean helmet chest porgy oil (orange roughy), palm oil, palm kernel Oil, persic oil, peanut oil, poppy seed oil, pumpkin seed oil, rapeseed oil, rice bran oil, rosemary oil, safflower oil, sandalwood oil, camellia Caul-fat, savory oil, Seabuckthorn Oil, sesame oil, shea butter, silicone, soybean oil, sunflower oil, tea oil, Ji oil, camellia oil, Prolong fragrant thoroughwort oil, walnut oil and wheat-germ oil and butyl stearate, Trivent OCG, Triglyceride DDD, cyclohexyl methyl silicon It is ketone, diethyl sebacate, dimethyl silscone 360, Simethicone (simethicone), isopropyl myristate, mineral oil, pungent Base dodecanol, oleyl alcohol, silicone oil and/or combination thereof.
Formulation
Nanoparticle compositions may include lipid composition and one or more other components, such as therapeutic agent and/or in advance Anti- dose.Nanoparticle compositions can be designed to one or more specific applications or target.Nanoparticle compositions at Point can be based on specific application or target, and/or be based on one or more ingredients the effect of, toxicity, expense, ease of use, Availability or other feature selection.Similarly, the specific formulation of nanoparticle compositions can be according to such as special component group The effect of conjunction and toxicity, for specific application or target selection.
The lipid composition of nanoparticle compositions may include for example according to formula (I), (IA), (IB), (II), (IIa), (IIb), the lipid of (IIc), (IId), (IIe), (IIf), (IIg) or (III), phosphatide (such as unsaturated lipids, for example, DOPE or DSPC), PEG lipid and structural lipid.The ingredient of provided lipid composition can be in specific ratios.
In some embodiments, the lipid composition of nanoparticle compositions include according to formula (I), (IA), (IB), (II), the lipid of (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), phosphatide, PEG lipid and knot Structure lipid.In certain embodiments, the lipid composition of nanoparticle compositions includes about 30mol% to about 60mol% The chemical combination of formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III) Object；About 0mol% is to about 30mol% phosphatide；About 18.5mol% is to about 48.5mol% structural lipid；And about 0mol% is extremely About 10mol%PEG lipid, condition are that total mol% is no more than 100%.In some embodiments, the rouge of nanoparticle compositions Matter component include the formula (I) of about 35mol% to about 55mol%, (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), (IIe), the compound of (IIf), (IIg) or (III)；About 5mol% is to about 25mol% phosphatide；About 30mol% to about 40mol% Structural lipid；And about 0mol% is to about 10mol%PEG lipid.In one particular embodiment, the lipid composition packet Include compound described in about 50mol%, about 10mol% phosphatide, about 38.5mol% structural lipid and about 1.5mol%PEG lipid. In another specific embodiment, the lipid composition includes compound described in about 40mol%, about 20mol% phosphatide, about 38.5mol% structural lipid and about 1.5mol%PEG lipid.In some embodiments, phosphatide can be DOPE or DSPC. In other embodiments, PEG lipid can be PEG-DMG and/or structural lipid can be cholesterol.
Nanoparticle compositions can be designed to one or more specific applications or target.For example, nanoparticle subgroup Close object can be designed to by therapeutic agent and/or prophylactic such as RNA delivery in the mammalian body specific cells, tissue, Organ or system or combinations thereof.In order to increase the selectivity to given body target, thus it is possible to vary the object of nanoparticle compositions Physical chemistry characteristic.For example, granularity can be adjusted based on the window size of Different Organs.It is included in nanoparticle compositions to control Treating agent and/or prophylactic desired based on one or more can also deliver target selection.For example, specific adaptations can be directed to Disease, the patient's condition, disease or illness and/or for be delivered to specific cells, tissue, organ or system or combinations thereof (such as part or Specific delivery) select therapeutic agent and/or prophylactic.In certain embodiments, nanoparticle compositions may include coding The mRNA of polypeptide of interest, the mRNA can be translated in the cell to generate polypeptide of interest.Such composition can be set Meter is for specific delivery to certain organs.In some embodiments, composition can be designed to specific delivery extremely Mammal liver.
In nanoparticle compositions the amount of therapeutic agent and/or prophylactic can depend on nanoparticle compositions size, The characteristic of composition, desired target and/or application or other characteristics and therapeutic agent and/or prophylactic.For example, can be used for The amount of RNA in nanoparticle compositions can depend on size, sequence and the other feature of RNA.In nanoparticle compositions The relative quantity of therapeutic agent and/or prophylactic and other ingredients (lipid) can also change.In some embodiments, nanoparticle The wt/wt ratio of lipid composition and therapeutic agent and/or prophylactic can be about 5:1 to about 60:1 in composition, as 5:1,6:1, 7:1、8:1、9:1、10:1、11:1、12:1、13:1、14:1、15:1、16:1、17:1、18:1、19:1、20:1、25:1、30:1、 35:1,40:1,45:1,50:1 and 60:1.For example, the wt/wt ratio of lipid composition and therapeutic agent and/or prophylactic can be about 10:1 to about 40:1.In certain embodiments, wt/wt ratio is about 20:1.Therapeutic agent and/or pre- in nanoparticle compositions Anti- dose of amount can be measured for example using absorption spectrometry (such as ultravioletvisible spectroscopy)
In some embodiments, combinations of nanoparticles includes one or more RNA, and is selected described a kind of or more Kind RNA, lipid and its amount can provide specific N:P ratio.The N:P ratio of the composition refers to nitrogen-atoms in one or more lipids Molar ratio and RNA in phosphate-based quantity ratio.In general, lower N:P ratio is preferred.Described one kind of selection Or a variety of RNA, lipid and its amount can provide about 2:1 to about 30:1, as 2:1,3:1,4:1,5:1,6:1,7:1,8:1,9:1, The N:P ratio of 10:1,12:1,14:1,16:1,18:1,20:1,22:1,24:1,26:1,28:1 or 30:1.In certain embodiments In, N:P ratio can be about 2:1 to about 8:1.In other embodiments, N:P ratio is about 5:1 to about 8:1.For example, N:P ratio can To be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1 or about 7.0:1.For example, N:P ratio can be about 5.67: 1。
Physical characteristic
The feature of nanoparticle compositions can depend on its component.E.g., including cholesterol is as structural lipid Nanoparticle compositions can have the feature different from including the nanoparticle compositions of different structure lipid.Similarly, The feature of nanoparticle compositions can depend on the absolute or relative quantity of its component.E.g., including higher molar fraction phosphatide Nanoparticle compositions can have and include the different feature of the nanoparticle compositions of lower molar fraction phosphatide.Feature It might also depend on the method and condition for preparing nanoparticle compositions and change.
Nanoparticle compositions can be characterized by a variety of methods.It is, for example, possible to use microscopy, (such as transmitted electron is aobvious Micro- art or scanning electron microscope, which are picked up, to be looked into) check that the form of nanoparticle compositions and size are distributed.Dynamic light scattering or potential Analytic approach (such as electrometric titration) can be used for measuring zeta potential.Dynamic light scattering can be also used for measurement granularity.It can also make With instrument such as Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) The multiple features for measuring nanoparticle compositions, such as granularity, polydispersity index and zeta potential.
Such as example measured by dynamic light scattering (DLS), the average-size of nanoparticle compositions can be received tens of Between rice and hundreds of nanometers.For example, the average-size can be about 40nm to about 150nm, such as from about 40nm, 45nm, 50nm, 55nm、60nm、65nm、70nm、75nm、80nm、85nm、90nm、95nm、100nm、105nm、110nm、115nm、120nm、 125nm, 130nm, 135nm, 140nm, 145nm or 150nm.In some embodiments, the average ruler of nanoparticle compositions It is very little to can be about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm extremely About 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm extremely About 150nm, about 70nm are to about 130nm, about 70nm to about 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm To about 150nm, about 80nm to about 130nm, about 80nm to about 100nm, about 80nm to about 90nm, about 90nm to about 150nm, about 90nm to about 130nm or about 90nm to about 100nm.In certain embodiments, the average-size of nanoparticle compositions can be with It is about 70nm to about 130nm or about 70nm to about 100nm.In one particular embodiment, average-size can be about 80nm. In other embodiments, average-size can be about 100nm.In other embodiments, average-size can be about 120nm。
Nanoparticle compositions can be with relative homogeneous.Polydispersity index can serve to indicate that the equal of nanoparticle compositions Matter, such as the size distribution of nanoparticle compositions.Smaller (being, for example, less than 0.3) polydispersity index generally indicates relatively narrow grain Degree distribution.The polydispersity index of nanoparticle compositions can be about 0 to about 0.25, such as 0.01,0.02,0.03,0.04, 0.05、0.06、0.07、0.08、0.09、0.10、0.11、0.12、0.13、0.14、0.15、0.16、0.17、0.18、0.19、 0.20,0.21,0.22,0.23,0.24 or 0.25.In some embodiments, the polydispersity index of nanoparticle compositions can To be about 0.10 to about 0.20.
The zeta potential of nanoparticle compositions can serve to indicate that the eletrokinetic potential of the composition.For example, zeta potential can be retouched State the surface charge of nanoparticle compositions.With relatively low charge, i.e., nanoparticle compositions positively or negatively It is usually desired, because the species with higher charge may be not intended to intracorporal cell, tissue and other elements Interaction.In some embodiments, the zeta potential of nano-particle composition can be about -10mV to about+20mV, about -10mV To about+15mV, about -10mV to about+10mV, about -10mV to about+5mV, about -10mV to about 0mV, about -10mV to about -5mV, about - 5mV to about+20mV, about -5mV to about+15mV, about -5mV to about+10mV, about -5mV to about+5mV, about -5mV to about 0mV, about 0mV to about+20mV, about 0mV to about+15mV, about 0mV to about+10mV, about 0mV to about+5mV, about+5mV to about+20mV, about+ 5mV to about+15mV or about+5mV to about+10mV.
The encapsulation efficiency of therapeutic agent and/or prophylactic describe be encapsulated in after preparation in nanoparticle compositions or with Ratio of the amount of therapeutic agent and/or prophylactic of the other way in conjunction with nanoparticle compositions relative to provided primary quantity Rate.Higher encapsulation efficiency is ideal (such as close to 100%).Encapsulation efficiency can be for example by comparing with a kind of or more Therapeutic agent and/or pre- in solution containing nanoparticle compositions before and after kind of organic solvent or detergent division nanoparticle compositions Anti- dose of amount measures.Fluorescence can be used for measuring the amount of therapeutic agent and/or prophylactic (such as RNA) in solution.For herein The encapsulation efficiency of the nanoparticle compositions, therapeutic agent and/or prophylactic can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.In some embodiments, encapsulation efficiency can be at least 80%.In certain embodiments, encapsulation efficiency It can be at least 90%.
Nanoparticle compositions can optionally include one or more coatings.For example, nanoparticle compositions can be by It is configured to capsule, diaphragm or tablet form with coating.Capsule, diaphragm or tablet including compositions described herein can With any usable size, tensile strength, hardness or density.
Pharmaceutical composition
Nanoparticle compositions can be formulated as pharmaceutical composition in whole or in part.Pharmaceutical composition may include one Kind or a variety of nanoparticle compositions.For example, pharmaceutical composition may include containing one or more different therapeutic agents and/or prevention One or more nanoparticle compositions of agent.Pharmaceutical composition can also include one or more pharmaceutically acceptable figurations Agent or auxiliary element, as described herein those.General guidelines in relation to preparing and manufacturing pharmaceutical composition are found in Such as Remington ' s The Science and Practice of Pharmacy, the 21st edition, A.R.Gennaro； Lippincott,Williams&Wilkins,Baltimore,MD,2006.Conventional excipients and auxiliary element can be used for appointing In what pharmaceutical composition, unless any conventional excipients or auxiliary element can be with one or more groups of nanoparticle compositions Divide incompatible.If a kind of combination of component of excipient or auxiliary element and nanoparticle compositions may cause and any not wish The biological effect of prestige or other illeffects, then it may be incompatible with the component.
In some embodiments, one or more excipient or auxiliary element can be accounted for including nanoparticle compositions The gross mass or volume of pharmaceutical composition are more than 50%.For example, one or more excipient or auxiliary element can account for drug Composition 50%, 60%, 70%, 80%, 90% or greater percentage.In some embodiments, pharmaceutically acceptable tax Shape agent is that at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% are pure.In some embodiments, Excipient is approved for the mankind and animal doctor uses.In some embodiments, excipient obtains U.S.'s food and medication management Office (United States Food and Drug Administration) approval.In some embodiments, excipient is Pharmaceutical grade.In some embodiments, excipient meet United States Pharmacopeia (USP), European Pharmacopoeia (EP), British Pharmacopoeia and/or The standard of International Pharmacopoeia.
Depending on the characteristic of treated subject, physique and/or situation and it is additionally dependent on plan applying said compositions Approach, one or more nanoparticle compositions, one or more pharmaceutically acceptable excipient and/or root Relative quantity according to any other ingredient of the pharmaceutical composition of the disclosure will change.For example, pharmaceutical composition may include One or more nanoparticle compositions between 0.1% and 100% (wt/wt).
In certain embodiments, the nanoparticle compositions of the disclosure and/or pharmaceutical composition are refrigerated or are freezed storage It deposits and/or transports (such as under 4 DEG C or lower temperature, such as between about -150 DEG C and about 0 DEG C or in about -80 DEG C and about -20 DEG C Between (for example, about -5 DEG C, -10 DEG C, -15 DEG C, -20 DEG C, -25 DEG C, -30 DEG C, -40 DEG C, -50 DEG C, -60 DEG C, -70 DEG C, -80 DEG C, - 90 DEG C, -130 DEG C or -150 DEG C) at a temperature of store).For example, including formula (I), (IA), (IB), (II) and (IIa)-(IIg) Any of compound pharmaceutical composition be at for example, about -20 DEG C, -30 DEG C, -40 DEG C, -50 DEG C, -60 DEG C, -70 DEG C or - Stored under refrigeration and/or the solution of transport at 80 DEG C.In certain embodiments, present disclosure also relates to it is a kind of increase comprising formula (I), (IA), the nanoparticle compositions of the compound of any of (IB), (II) and (IIa)-(IIg) and/or pharmaceutical composition The method of stability, this method are by under 4 DEG C or lower temperature, such as between about -150 DEG C and about 0 DEG C or about -80 DEG C and about -20 DEG C between, for example, about -5 DEG C, -10 DEG C, -15 DEG C, -20 DEG C, -25 DEG C, -30 DEG C, -40 DEG C, -50 DEG C, -60 DEG C, - The nanoparticle compositions are stored at a temperature of 70 DEG C, -80 DEG C, -90 DEG C, -130 DEG C or -150 DEG C and/or pharmaceutical composition is real It is existing.For example, nanoparticle compositions disclosed herein and/or pharmaceutical composition are for example in 4 DEG C or lower temperature (such as about Between 4 DEG C and -20 DEG C) under stablize keep about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, extremely Few 1 month, at least two moon, at least four moon, at least six moon, at least eight moon, at least ten moon, at least 12 months, at least 14 A month, at least 16 months, at least 18 months, at least 20 months, at least 22 months or at least 24 months.In an embodiment In, formulation is stablized at about 4 DEG C to be kept at least 4 weeks.In certain embodiments, the pharmaceutical composition of the disclosure includes herein Disclosed nanoparticle compositions and pharmaceutically acceptable carrier, the carrier are selected from one or more of: Tris, acetic acid Salt (such as sodium acetate), citrate (such as sodium citrate), physiological saline, PBS and sucrose.In certain embodiments, originally The pH value of disclosed pharmaceutical composition between about 7 and 8 (such as 6.8,6.9,7.0,7.1,7.2,7.3,7.4,7.5,7.6, 7.7,7.8,7.9 or 8.0, or between 7.5 and 8 or between 7 and 7.8).For example, the pharmaceutical composition of the disclosure includes this Nanoparticle compositions disclosed in text, Tris, physiological saline and sucrose, and its pH value is about 7.5-8, is suitable for for example It stores and/or transports at about -20 DEG C.For example, the pharmaceutical composition of the disclosure includes nanoparticle compositions disclosed herein And PBS, and its pH value is about 7-7.8, is suitable for storing and/or transporting under for example, about 4 DEG C or lower temperature.In the disclosure In context, " stability ", " stabilisation " and " stabilization " refers to nanoparticle compositions and/or pharmaceutical composition disclosed herein Object is under given manufacture, preparation, transport, storage and/or use condition, such as when applying stress such as shearing force, freeze/thaw The resistance of chemically or physically variation (such as degradation, granularity variation, aggregation, encapsulating variation etc.) whens stress etc..
Nanoparticle compositions and/or pharmaceutical composition including one or more nanoparticle compositions can be administered It is one or more specific by the way that therapeutic agent and/or prophylactic to be delivered to comprising that can have benefited to any patient or subject The patient or subject of therapeutic effect provided by cell, tissue, organ or system or combinations thereof.Although pass provided in this article In nanoparticle compositions and the pharmaceutical composition including nanoparticle compositions description mainly for be suitable for be administered to the mankind Composition, but those of skill in the art are it will be appreciated that these compositions are typically adapted to be administered to any other mammal.It should be abundant Understand, the composition for being suitable for being administered to the mankind can be improved to make these compositions be suitable for being administered to various animals, And ordinary skill veterinary pharmacology man only needs routine experiment (if present) that can design and/or execute such change It is good.It is expected that the subject that can apply these compositions includes but is not limited to the mankind, other primates and other mammals, It is included in the relevant mammal of business, such as ox, pig, horse, sheep, cat, dog, mouse and/or rat.
After pharmaceutical composition including one or more nanoparticle compositions can be by known or area of pharmacology It prepared by any method of exploitation.In general, these preparation methods include making active constituent and excipient and/or one kind or more The other auxiliary elements of kind combine, and are then needing and/or when necessary, product are being divided into, be shaped to and/or is packaged into are desired Single dose unit or multi-dose unit.
According to the pharmaceutical composition of the disclosure can integrally, with single unit dose and/or with multiple single unit doses Form preparation, packaging and/or sale.As used herein, " unit dose " is comprising predetermined amounts of active ingredients (such as nanoparticle Sub-portfolio object) pharmaceutical composition discrete amount.The amount of active constituent is generally equivalent to that the active constituent of subject will be administered to The convenience part of dosage and/or such dosage, such as a half or thirds of such dosage.
Pharmaceutical composition can be prepared to the diversified forms suitable for a variety of administration method and method.For example, pharmaceutical composition Object can be prepared to liquid dosage form (such as lotion, microemulsion, nanoemulsions, solution, suspension, syrup and elixir), can infuse Penetrate form, solid dosage forms (such as capsule, tablet, pill, powder and granule), for the dosage form (example of surface and/or transdermal administration Such as ointment, paste, emulsifiable paste, washing lotion, gel, powder, solution, spray, inhalant and patch), suspension, powder and other shapes Formula.
Include but is not limited to pharmaceutically acceptable lotion, microemulsion, receive for oral and parenteral administration liquid dosage form Rice milk liquid, solution, suspension, syrup and/or elixir.In addition to the active ingredient (s, liquid dosage form can also include commonly used in the art Inert diluent, such as water or other solvents；Solubilizer and emulsifier, such as ethyl alcohol, isopropanol, ethyl carbonate, ethyl acetate, benzene Methanol, benzyl benzoate, propylene glycol, 1,3 butylene glycol, dimethylformamide, oil (especially cottonseed oil, peanut oil, corn oil, Embryo oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and sorbitan fatty acid esters, and Its mixture.Besides inert diluents, Orally administered composition can also include other therapeutic agents and/or prophylactic, other reagents such as Wetting agent, emulsifier and suspending agent, sweetener, flavoring agent and/or aromatic.In certain embodiments for parenteral administration In, such as with solubilizer by compositionAlcohol, oil, modified oil, glycol, polysorbate, cyclodextrin, polymer And/or combination thereof mixing.
Injectable formulation can be prepared using suitable dispersing agent, wetting agent and/or suspending agent according to known technology, Such as sterile injection is aqueous or oily suspensions.Sterile injectable preparation can be in the acceptable diluent of nontoxic parenteral And/or sterile injectable solution, suspension and/or lotion in solvent, such as the solution in 1,3-BDO.It can use Acceptable mediator and solvent have water, Ringer's solution, U.S.P. and isotonic sodium chlorrde solution.It generallys use sterile non-volatile Property oil is as solvent or suspension media.It for this purpose, can be sweet using any mild fixed oil, including synthesis mono-acid Grease or Diglyceride.Fatty acid such as oleic acid can be used to prepare injectable formulation.
Injectable formulation can be in for example sterile solid group by filtering bacteria retaining filter, and/or by being incorporated to The bactericidal agent of solvate form sterilizes, the aseptic solid composite can be dissolved or dispersed in front of use sterile water or In other sterile injectable mediums.
For the effect for extending active constituent, it usually needs slow down the suction of the active constituent as caused by subcutaneous or intramuscular injection It receives.This can use the liquid suspension with weak water-soluble crystallization or amorphous materials and realizes.The absorption rate of drug is then Depending on its rate of dissolution, and its rate of dissolution may depend on crystalline size and crystal form.Alternatively, by by parenteral The medicament forms of application dissolve or are suspended in oily mediator the delayed absorption for realizing the drug.By polymerizeing in biodegradable The micro-encapsulation matrix of drug is formed in object such as polylactide-polyglycolide injectable storage tank form is made.Depending on drug with The property of the ratio of polymer and particular polymers used can control the rate of release of drug.Other biodegradable polymerizations The example of object includes poly- (ortho esters) and poly- (acid anhydride).It can also be by the way that the drug to be packed in the lipid compatible with bodily tissue Storage tank formula injectable formulation is prepared in body or microemulsion.
Composition for rectum or vaginal application is typically suppository, these suppositorys can by by composition be suitble to it is non- To prepare, the suppository wax is solid at ambient temperature for irritation excipient such as cocoa butter, polyethylene glycol or suppository wax mixing It but is liquid under body temperature, and therefore melting and discharge active component in rectum or vaginal canal.
It include capsule, tablet, pill, diaphragm, powder and granule for oral solid dosage forms.In these solid dosage forms In, by active constituent and at least one inertia, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate, and/or Following object mixing: filler or incremental agent (such as starch, lactose, sucrose, glucose, mannitol and silicic acid), adhesive (such as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and Arabic gum), moisturizer (such as it is sweet Oil), disintegrating agent (such as agar, calcium carbonate, potato or tapioca, alginic acid, certain silicates and sodium carbonate), dissolution prolong Slow agent (such as paraffin), absorbsion accelerator (such as quaternary ammonium compound), wetting agent (such as cetanol and glycerin monostearate), Adsorbent (such as kaolin and bentonite, silicate) and lubricant (such as calcium stearate, magnesium stearate, solid polyethylene glycol, NaLS) and its mixture.In the case where capsule, pastille and pill, these dosage forms can also include buffering Agent.
Such as lactose or toffee and high molecular weight polyethylene glycol can be used as excipient, by the solid of similar type Composition is used as the filler in soft hard-filled gelatin capsule.Solid dosage forms tablet, dragee, capsule, pill and granule Coating and shell preparation can be used, such as enteric coating and other coatings well known in the art.These dosage forms can be optional Ground containing opacifier and can also having make its only or preferentially optionally released in a manner of delaying in enteron aisle a part Put the composition of active constituent.The example for the embedding composition that can be used includes polymeric material and wax.It can be used such as lactose Or toffee and high molecular weight polyethylene glycol etc. are used as excipient, it is bright that the solid composite of similar type is used as soft and hard filling Filler in glue capsule.
Dosage form for surface or transdermal administration composition includes ointment, paste, emulsifiable paste, washing lotion, gel, powder, solution, spray Mist agent, inhalant and/or patch.In general, active constituent aseptically with pharmaceutically acceptable excipient and/or Any required preservative that may be needed or buffer mixing.In addition, the disclosure covers using percutaneous plaster, these patches are usual Added benefit with the controlled delivery for providing body compound.These dosage forms can be for example by dissolving or dividing compound It dissipates in appropriate medium and prepares.It alternately or in addition, can be by providing rate controlling membranes, and/or by by compound It is scattered in polymer substrate and/or gel and carrys out speed control.
Device suitable for delivering intradermal drug composition described herein includes hour hand device, such as United States Patent (USP) 4, 886,499,5,190,521,5,328,483,5,527,288,4,270,537,5,015,235,5,141,496 and 5,417, Those of described in 662.Intradermal composition can be needled into the device of the Effective depth penetration of skin, such as PCT by limiting It announces device described in WO 99/34850 and its functional equivalent is applied.Jet injection device is suitable, these devices It is pierced into cuticula by liquid jet injector and/or pass through and sprays and reach the needle of corium and be delivered to liquid composition very Skin.Jet injection device is described in such as United States Patent (USP) 5,480,381,5,599,302,5,334,144,5,993,412,5, 649,912、5,569,189、5,704,911、5,383,851、5,893,397、5,466,220、5,339,163、5,312, 335,5,503,627,5,064,413,5,520,639,4,596,556,4,790,824,4,941,880,4,940,460；With And in PCT Publication WO 97/37705 and WO 97/13537.Impact type powder/particle delivery device is also suitable, these dresses It sets and accelerates to enter corium across skin outer layer in the vaccine of powder type using compressed gas.Alternately or in addition, Ke Yi Conventional syringe is used in the classical Man Tuofa of intradermal administration.
Formulation suitable for surface applied includes but is not limited to liquid and/or semi-liquid preparations such as liniment, washing lotion, oil-in-water And/or water-in-oil emulsion such as emulsifiable paste, ointment and/or paste and/or solution and/or suspension.Can the formulation of surface applied can With for example comprising about 1% to about 10% (wt/wt) active constituent, but the concentration of active constituent can be up to the active constituent in Solubility limit value in solvent.For surface applied formulation can also comprising it is one or more it is described herein it is other at Point.
Pharmaceutical composition can be in the preparation of formulation form, packaging and/or the sale for being suitable for realizing lung application by oral cavity. Such formulation may include drying particulate, these particles include active constituent.These compositions are advantageously in dried powder shape For formula to use the device comprising dry powder storage tank to apply, propellant stream can guide the device to apply with powder；And/or use self-propelled Solvent/powder applies dispensing container, the dress for such as dissolving and/or being suspended in low boiling propellant comprising active constituent in a sealed container Set application.Dry powder composite may include solid fines shape diluent such as sugar, and advantageously be provided with unit dosage forms.
Low boiling propellant is commonly included in the liquid propellant that atmospheric pressure boiling point is lower than 65 ℉.In general, it promotes Agent may be constructed the composition of 50% to 99.9% (wt/wt), and active constituent may be constructed 0.1% to 20% (wt/wt's) Composition.Propellant can also comprising other ingredients such as liquid nonionic and/or solid anion surfactant and/or Solid diluent (its granularity is roughly the same with the particle comprising active constituent).
Be formulated into pulmonary delivery pharmaceutical composition can provide activity in solution and/or suspension drop form at Point.These formulations can be in optional sterile aqueous and/or dilute alcohol solution and/or suspension form system containing active constituent Standby, packaging and/or sale, and can advantageously be applied using any spraying and/or atomising device.These formulations can be with Include one or more other ingredients, including but not limited to flavoring agent such as saccharin sodium, ethereal oil, buffer, surfactant And/or preservative such as methyl hydroxybenzoate.The average diameter of the drop provided by this administration method can be in about 1nm to about Within the scope of 200nm.
The formulation for being described herein as can be used for pulmonary delivery can be used for intranasal delivery pharmaceutical composition.Suitable for intranasal administration Another formulation be comprising active constituent and average particle is about 0.2 μm to 500 μm of coarse powder.Such formulation is with snuffing Mode is applied by quickly sucking through nostril from the powder container close to nose.
Formulation suitable for nose application can be for example comprising as little as about 0.1% (wt/wt) and up to 100% (wt/wt) Active constituent, and may include one or more other ingredients described herein.Pharmaceutical composition can be buccal in being suitable for The preparation of formulation form, packaging and/or the sale of application.These formulations can be for example in the tablet for using conventional method to prepare And/or the form of buccal tablet, and the active constituent of such as 0.1% to 20% (wt/wt) can be contained, rest part includes oral Dissolvable and/or degradable composition and optionally one or more other ingredients described herein.Alternatively, it is suitable for warp The formulation of cheek application may include powdered and/or smoke-like containing active constituent and/or cloudy solution and/or suspension. Such powdered, smoke-like and/or smoke-like formulation are can have when dispensed within the scope of about 0.1nm to about 200nm Average particle size and/or drop size, and can also include one or more any other ingredients described herein.
Pharmaceutical composition can be in the preparation of formulation form, packaging and/or the sale suitable for ocular administration.These formulations It can be for example in eye drop form comprising 0.1/1.0% of such as active constituent in aqueous or oil-based liquid excipient (wt/wt) solution and/or suspension.These dropping liquids can also include buffer, salt and/or one or more described herein Any other ingredient.Applicable other formulations that can be applied through eye include containing in microcrystalline form and/or in Liposomal formulation shape Those of active constituent of formula.Auristilla and/or eye drops are included within the scope of this disclosure.
MRNA therapy
It is possible to delivering cross-film and intracellular protein using mRNA as drug form, i.e., standard biological reagent is because it can not The target that can not be approached across cell membrane.(referring to Sahin, U., Karik ó K., T ü reci Nat.Rev.Drug.Discov.2014,13,759-780, content is incorporated herein by reference in its entirety).Make mRNA The main bugbear that class therapy becomes a reality is the identification of best delivering mediator.Since mRNA has larger size, chemistry not Stability and potential immunogenicity, therefore mRNA needs a kind of delivering mediator, which can prevent endonuclease and nucleic acid Excision enzyme influences, and cargo is protected not attacked by immune sentry.For this point, lipid nanoparticle (LNP) by Identify as main selection.(referring to Hajj, K.A., Whitehead, K.A.Nat.Rev.Mater.2017,2,1-17, content It is incorporated herein by reference in its entirety).In the recent period, by showing, securely and effectively delivering is formulated in LNP this method MRNA class vaccine and be confirmed.(referring to Bahl, K. et al., Mol.Ther.2017,25,1316-1327, content is with complete The mode of text reference is incorporated herein).
Key performance criteria in relation to lipid nanoparticle delivery system be keep cellular uptake maximum and can make mRNA from Inner body efficiently discharges.Meanwhile LNP must provide stable pharmaceutical product and can safely be given with treating related levels. LNP is multicomponent system, these systems are typically made of amino lipids, phosphatide, cholesterol and PEG- lipid.Realization is efficiently passed Nucleic acid cargo and particle stability characteristic is sent to need every kind of component.It is considered to driving cellular uptake, inner body escape and tolerance Key component be amino lipids.Cholesterol and PEG- lipid promote drug products in vivo and keep stablizing on shelf, and Phosphatide offer is merged with the further of LNP, therefore helps that inner body is driven to escape and realize that the biology of cytosol amplifying nucleic acid can The property used.
In over the past several decades, several amino lipids series is developed and have carried out oligonucleotide delivering.(referring to Stanton M.G.,Murphy-Benenato,K.E.RNA Therapeutics.Topics in Medicinal Chemistry, volume 2017,27, A.Garner is compiled, and the 237-253 pages of (Springer, Cham), content is to be cited in full text Mode be incorporated herein).The document highlights the structure and thus caused LNP delivery efficiency and tolerance of amino lipids Between direct correlation.Amino lipids MC3 (DLin-MC3-DMA) is clinically state-of-the-art oligonucleotide delivery system, because It is the siRNA that is prepared in MC3 class LNP to the of the amyloidosis treatment mediated about transthyretin The III phase.(referring to Coelho, T. et al., N.Engl.J.Med.2013,369,819-829.；Butler, J.S. et al., Amyloid 2016,23,109-118, respective content are incorporated herein by reference in its entirety).Recently, there is document report Lead the validity of shown MC3 class LNP delivering mRNA.(referring to Nanbhan, J.F. et al., Sci.Rep.2016,6, 20019, content is incorporated herein by reference in its entirety).Such LNP is quickly got when intravenous delivery carries rouge egg White E (ApoE) conditioning, can be by LDL receptor (LDLr) cellular uptake.(referring to Akinc, A. et al., Mol.Ther.2010,18,1357-1364, content is incorporated herein by reference in its entirety.) however, there are still MC3's Longer tissue half-life may cause adverse side effect, thus the problem of hindering it to be used for extended regimen.(referring to Maier M.A. Et al., Mol.Ther.2013,21,1570-1578, content is incorporated herein by reference in its entirety).In addition, numerous Documentary evidence, which shows to give lipid nanoparticle for a long time, can generate several toxic side effects, including complement activation associated class allergy is anti- Answer (CARPA) and hepatic injury (referring to Szebeni J.Mol.Immunol.2014,61,163-173, content is to be cited in full text Mode be incorporated herein).Therefore, to utilize mRNA therapy for mankind's latent effect, delivery efficiency is needed to increase and be metabolized Allow to give a kind of LNP of the mankind for a long time with toxicity spectrum.
The ability for treating numerous diseases needs the flexibility that long-term safety is administered under different dose levels.Pass through systematicness Optimize amino lipids structure, disclosure compound is identified to take into account chemical stability, the delivering caused by inner body escape improvement The compound (embodiment 26) of efficiency raising, quickly metabolism in vivo and net toxicity spectrum.The combination of these features, which will provide, to be grown The drug candidates that phase is administered without activated immune system.Initial rodent screening, which allows to identify, has good delivering effect The leading lipid of rate and pharmacokinetics.It further dissects in non-human primate and is dominated after single and repeat administration The delivery efficiency of LNP.Finally, being commented in rat and non-human primate in one month repeated doses toxicity research The LNP of valence optimization.Be not wishing to be bound by theory, the novel ionizable lipid of the disclosure allow in acute and chronic diseases safety and MRNA class therapy is efficiently used.
The method of polypeptide is generated in cell
Present disclose provides the methods for generating polypeptide of interest in mammalian cells.The method for generating polypeptide is related to making Cell is contacted with the nanoparticle compositions for the mRNA for including coding polypeptide of interest.It is contacted in cell with nanoparticle compositions Afterwards, mRNA, which can be absorbed into cell and translate, generates polypeptide of interest.
In general, mammalian cell and the nanoparticle compositions for the mRNA for including coding polypeptide of interest are contacted The step of can execute in vitro, in vitro, in culture or in vitro.The amount of the nanoparticle compositions contacted with cell, and/ Or in which the amount of mRNA can depend on the type of contacted cell or tissue, method of application, nanoparticle compositions and its The physicochemical characteristic (such as size, charge and chemical composition) and other factors of middle mRNA.In general, a effective amount of to receive Permission is efficiently produced polypeptide by nanoparticle composition in cell.Measurement in relation to efficiency may include polypeptide translation (by more The instruction of peptide expression quantity), mRNA Degradation Level and immune response index.
Make to include the steps that the nanoparticle compositions of mRNA are contacted with cell to may relate to or cause to transfect.It is included in and receives Phosphatide in the lipid composition of nanoparticle composition can for example by with cell or intercellular membrane interact and/or merge come Promote transfection and/or increases transfection efficiency.Transfection can permit mRNA and translate in the cell.
In some embodiments, nanoparticle compositions described herein can be used for treatment use.For example, nanometer The mRNA for including in particle composition can encode therapeutical peptide (such as can translated region in) and contact and/or enter Therapeutical peptide is generated after (transfection is extremely) cell.In other embodiments, the mRNA for including in nanoparticle compositions can be with Coding can improve or increase the polypeptide of subject immune's property.For example, mRNA can be appropriate with encoding granulocyte colony stimulating factor or song Pearl monoclonal antibody (trastuzumab).
In certain embodiments, the mRNA for including in nanoparticle compositions can be with encoding recombinant polypeptide, and the recombination is more Peptide can replace that there is substantially no in one of cell contacted with nanoparticle compositions or multiple polypeptides.The one kind or It is a variety of there is substantially no polypeptide may lack because of the gene mutation of encoding gene or its control path.Alternatively, by The recombinant polypeptide that mRNA translation generates can be present in cell, on cell surface or endogenous egg secreted by cell with antagonism The activity of white matter.Antagonism recombinant polypeptide may be needed to resist the illeffects as caused by the activity of endogenous protein, such as The activity caused by being mutated or positioning change.It again alternatively, can indirectly or directly by the recombinant polypeptide that mRNA translation generates Ground antagonism is present in cell, on cell surface or the activity of biological moieties secreted by cell.By the biological moieties of antagonism It can include but is not limited to lipid (such as cholesterol), lipoprotein (such as low-density lipoprotein), nucleic acid, carbohydrate and small Molecule toxin.The recombinant polypeptide generated by mRNA translation can by engineered intracellular at being positioned at, such as particular compartment such as In core, or can by it is engineered at by cell secrete or be indexed into cytoplasma membrane.
In some embodiments, contacting cell with the nanoparticle compositions including mRNA, can to reduce cell external The congenital immunity of source property nucleic acid responds.Cell can with include the first amount contain can translated region the first exogenous mRNA the One nanoparticle compositions contact and can measure the water of congenital immunity response of the cell to the first exogenous mRNA It is flat.Then, the cell can be contacted with the second chamber for the first exogenous mRNA for including the second amount, which is low In the first exogenous mRNA of the first amount.Alternatively, second chamber may include the second exogenous mRNA of the first amount, this Two exogenous mRNA are different from the first exogenous mRNA.The step of contacting cell and the first and second compositions, repeats one It is secondary or multiple.Furthermore it is also possible to the optionally measurement efficiency that generates (such as translation) polypeptide in cell, and the cell can be with It is repeatedly contacted again with first and/or second chamber, until realizing target protein generation efficiency.
The method that therapeutic agent is delivered to cell and organ
Present disclose provides the methods that therapeutic agent and/or prophylactic are delivered to mammalian cell or organ.It will treatment Agent and/or prophylactic be delivered to cell be related to by include the therapeutic agent and/or prophylactic nanoparticle compositions be administered to by Examination person, wherein the application of the composition is related to contacting the cell with the composition.For example, protein, cytotoxic agent, radiation Property ion, chemotherapeutant or nucleic acid (such as RNA, such as mRNA) may be delivered into cell or organ.In therapeutic agent and/or in advance In the case that anti-dose is mRNA, after cell is contacted with nanoparticle compositions, interpretable mRNA can be translated in cell Generate polypeptide of interest.But, the mRNA that cannot generally translate can also be delivered to cell.The mRNA that cannot generally translate It may be used as vaccine and/or the translation components of cell can be obstructed to reduce expression of other species in cell.
In some embodiments, nanoparticle compositions can target specific type or classification cell it is (such as specific The cell of organ or its system).E.g., including the nanoparticle compositions of therapeutic agent and/or prophylactic of interest can be special Property is delivered to mammal liver,kidney,spleen, femur or lung.It is passed to the specificity of particular category cell, organ or system or combinations thereof It send and shows for example after nanoparticle compositions are administered to mammal, relative to other targets, have higher proportion includes The nanoparticle compositions of therapeutic agent and/or prophylactic are delivered to destination of interest (such as tissue).In some embodiment party In case, specific delivery can make the therapeutic agent of the tissue (such as tissue of interest, such as liver) of every 1g target destination and/or pre- Anti- dose of amount compared to another object (such as spleen) has more than 2 times, 5 times, 10 times, 15 times or 20 times increases.In some implementations In scheme, tissue of interest is selected from the group that is made up of: liver, kidney, lung, spleen, femur, ocular tissue are (such as by intraocular, view Under film or intravitreal injection), the blood vessel endothelium (such as in coronary artery or in femoral artery) in blood vessel or kidney and tumor group Knit (such as passing through intra-tumoral injection).
As targeting or another example of specific delivery, cell surface can be included in nanoparticle compositions Upper coding protein combines the mRNA of collocation object (such as antibody or its functional fragment, skelemin matter or peptide) or receptor. MRNA can be additionally or alternatively used for the synthesis and extracellular positioning of guidance lipid, carbohydrate or other biological moieties. Alternatively, other therapeutic agents in nanoparticle compositions and/or prophylactic or ingredient (such as one or more lipids) can be with Affinity of special receptor (such as LDL receptor) is selected based on it, so that nanoparticle compositions can more hold It changes places and interacts with the cell population of interest for including these receptors.For example, ligand can include but is not limited to particular combination pair Member, antibody, monoclonal antibody, Fv segment, scFv (scFv) segment, Fab ' segment, 2 segment of F (ab '), single domain are anti- Body, camelised antibodies and its segment, humanization antibody and its segment and its multivalent forms；Multivalence binding reagents, including Dan Te Anisotropic or stable bispecific antibody such as disulfide bond Fv segment, series connection scFv, bifunctional antibody, three function antibodies or four functions Antibody；And aptamer, receptor and fusion protein.
In some embodiments, ligand can be surface bound antibody, and it is special which can permit tuning cell-targeting It is anisotropic.The antibody with high specificity of the epitope of interest of desired target site is directed to due to can produce, therefore this point especially has With.In one embodiment, Multiple Antibodies are expressed on cell surface, and each antibody can have desired target There is not homospecificity.These methods can increase the affinity and specificity of targeting interaction.
Technical staff in biological field for example can select ligand based on desired cellular localization or function.For example, Estrogen receptor ligands, if tamoxifen (tamoxifen) can make cell-targeting estrogen dependent breast cancer cell, these are thin Born of the same parents have greater number of estrogen receptor on cell surface.Other non-limiting example packets of ligand/receptor interaction Include CCR1 (such as joint tissue or brain and/or multiple sclerosis for treating inflammation in rheumatoid arthritis), CCR7, CCR8 (such as targeting lymph node tissue), CCR6, CCR9, CCR10 (such as targeting intestinal tissue), CCR4, CCR10 (such as For targeting skin), CXCR4 (such as migrating enhancing extensively), HCELL (such as treat inflammation and inflammatory conditions, Marrow), α 4 β 7 (such as targeting intestinal mucosa) and VLA-4NCAM-1 (such as targeting endothelium).In general, targeting is participated in Any receptor of (such as metastasis of cancer) can be used in approach described herein and composition.
Target cell can include but is not limited to liver cell, epithelial cell, hematopoietic cell, epithelial cell, endothelial cell, lung Cell, bone cells, stem cell, mesenchymal cell, nerve cell, heart cell, fat cell, vascular smooth muscle cells, the heart Myocyte, Skeletal Muscle Cell, β cell, pituicyte, synovial membrane stave cell, gonad cell, testicular cell, fibroblast, B Cell, T cell, granulophilocyte, leucocyte, granulocyte and tumour cell.
In some embodiments, nanoparticle compositions can be with hepatocytes-targeting.Through showing, apolipoprotein is as carried rouge egg White E (apoE) with containing neutral or combined in vivo close to the nanoparticle compositions of neutral lipid, and it is known its with it is thin in liver The receptor found on cellular surface such as LDL receptor (LDLR) combines.It therefore, will be containing with neutral or close to neutrality The nanoparticle compositions of the lipid composition of charge are administered to subject and can obtain apoE in subject's body and then may be used Therapeutic agent and/or prophylactic (such as RNA) are delivered to the liver cell including LDLR in a targeted manner.
The method for treating disease and illness
Nanoparticle compositions can be used for treating disease, illness or the patient's condition.Exactly, these compositions can be used for Treat by lose or abnormal protein or polypeptide active characterized by disease, illness or the patient's condition.For example, comprising coding lose or it is different The nanoparticle compositions of the mRNA of normal polypeptide can be administered or be delivered to cell.The mRNA then translate can produce it is described Thus polypeptide reduces or eliminates being not present or the problem of abnormal activity causes by the polypeptide.Since translation can promptly be sent out It is raw, therefore these method and compositions can be used for treating acute illness, illness or the patient's condition such as septicemia, apoplexy and myocardial infarction. The therapeutic agent and/or prophylactic that include in nanoparticle compositions can also change the transcription rate of given species, thus influence Gene expression.
The disease characterized by malfunction or abnormal protein or polypeptide active, the illness of composition can be administered And/or the patient's condition include but is not limited to rare disease, infectious diseases (in vaccine and therapeutic agent form), cancer and proliferative disease, Genetic disease (such as cystic fibrosis), autoimmune disease, diabetes, neurodegenerative disorders, angiocarpy and Renal vascular Disease and metabolic disease.Can be lost by protein active there are many disease, illness and/or the patient's condition (or generally drop It is low so that appropriate protein function can not occur) characterization.These protein may be not present or it may be substantially idle Energy.The specific example of the protein of malfunction is that the missense of cystic fibrosis transmembrane transduction regulatory protein (CFTR) gene is prominent Become variant, these mutation variants generate the protein variant of the malfunction of CFTR protein, thus cause cystic fibrosis. Present disclose provides a kind of such disease that subject is treated by application nanoparticle compositions, illness and/or the patient's condition Method, the nanoparticle compositions include RNA and lipid composition, the lipid composition include according to formula (I), (IA), (IB), (II), the lipid of (IIa), (IIb), (IIc), (IId), (IIe), (IIf), (IIg) or (III), phosphatide (are optionally unsaturated ), PEG lipid and structural lipid, wherein RNA can be coding antagonism or overcome in subject cell in other ways and exists The active polypeptide of abnormal protein mRNA.
The method that the disclosure provides is related to applying the nanoparticle compositions containing one or more therapeutic agents and/or prophylactic With the pharmaceutical composition comprising these nanoparticle compositions.For the feature and embodiment of the disclosure, term therapeutic agent and Prophylactic can be used interchangeably herein.Therapeutic composition or imaging, diagnosis or prophylactic compositions can be used any Reasonable amount and any administration method are administered to subject, the reasonable amount and administration method can effectively realize disease, illness and/or The patient's condition is prevented, treated, diagnoses or is imaged and/or for any other purpose.The Specific amounts for being applied to given subject can be with Depending on the species of subject, age and general status；Apply purpose；Concrete composition；Administration mode etc. and change.According to this Disclosed composition can be formulated into unit dosage forms to facilitate the application and homogeneity of dosage.It will be appreciated, however, that disclosure group The total every consumption per day for closing object will be determined within the scope of reasonable medical judgment by attending physician.For the specific of any particular patient Treatment is effectively, prevention is effective or other suitable dosages horizontal (such as being imaged) will depend on many factors, including is treated The severity and attribute of illness (if present)；One or more therapeutic agents and/or prophylactic used；Specific group used Close object；Age, weight, general health, gender and the diet of patient；The administration time of certain drug composition used is applied With approach and discharge rate；Duration for the treatment of；The drug for using with certain drug combination of compositions used or using simultaneously；With And well-known similar factor in medical domain.
Nanoparticle compositions containing one or more therapeutic agents and/or prophylactic can be applied by any approach.In In some embodiments, the composition including one or more nanoparticle compositions described herein, including it is preventative, examine Disconnected or image forming composition be through a variety of ways in one or more applications, including oral, intravenous, intramuscular, intra-arterial, Marrow is interior, intrathecal, essence is interior, subcutaneous, indoor, in transdermal or intradermal, mesothelium (interdermal), rectum, intravaginal, peritonaeum, eye Under interior, retina, in vitreum, surface (such as passing through powder ointment, emulsifiable paste, gel, washing lotion and/or dropping liquid), mucous membrane, nose, Cheek, intestines, vitreum, in tumour, it is sublingual, intranasal；It instils and/or sucks by intratracheal instillation, bronchus；In oral spray And/or it powder, nose spray and/or aerosol form, and/or is applied by portal vein conduit.In some embodiments, it combines Object can be by intravenous, intramuscular, intradermal, intra-arterial, tumour, under subcutaneous, intraocular, retina, in vitreum, in essence Or by any other parenteral administration approach or pass through sucking application.However, it is contemplated that drug delivery science in it is possible into Exhibition, the disclosure cover through any appropriate approach delivering or application compositions described herein.In general, optimal to apply Many factors, the property including the nanoparticle compositions containing one or more therapeutic agents and/or prophylactic will be depended on approach Matter (such as its stability in various physical environments such as blood flow and gastrointestinal tract), the situation of patient (such as no matter patient whether It is resistant to particular route of administration) etc..
In certain embodiments, the dosage level of the composition according to the disclosure of application can be enough in given dose Deliver about 0.0001mg/kg to about 10mg/kg, about 0.001mg/kg to about 10mg/kg, about 0.005mg/kg to about 10mg/kg, About 0.01mg/kg to about 10mg/kg, about 0.05mg/kg are to about 10mg/kg, about 0.1mg/kg to about 10mg/kg, about 1mg/kg To about 10mg/kg, about 2mg/kg to about 10mg/kg, about 5mg/kg to about 10mg/kg, about 0.0001mg/kg to about 5mg/kg, About 0.001mg/kg to about 5mg/kg, about 0.005mg/kg are to about 5mg/kg, about 0.01mg/kg to about 5mg/kg, about 0.05mg/ Kg to about 5mg/kg, about 0.1mg/kg to about 5mg/kg, about 1mg/kg to about 5mg/kg, about 2mg/kg to about 5mg/kg, about 0.0001mg/kg to about 2.5mg/kg, about 0.001mg/kg to about 2.5mg/kg, about 0.005mg/kg to about 2.5mg/kg, about 0.01mg/kg to about 2.5mg/kg, about 0.05mg/kg are to about 2.5mg/kg, about 0.1mg/kg to about 2.5mg/kg, about 1mg/kg To about 2.5mg/kg, about 2mg/kg to about 2.5mg/kg, about 0.0001mg/kg to about 1mg/kg, about 0.001mg/kg to about 1mg/kg, about 0.005mg/kg to about 1mg/kg, about 0.01mg/kg to about 1mg/kg, about 0.05mg/kg to about 1mg/kg, about 0.1mg/kg to about 1mg/kg, about 0.0001mg/kg to about 0.25mg/kg, about 0.001mg/kg to about 0.25mg/kg, about 0.005mg/kg to about 0.25mg/kg, about 0.01mg/kg to about 0.25mg/kg, about 0.05mg/kg to about 0.25mg/kg, or About 0.1mg/kg is to about 0.25mg/kg therapeutic agent and/or prophylactic (such as mRNA), and wherein 1mg/kg (mpk) dosage provides every 1 Kg subject's weight 1mg therapeutic agent and/or prophylactic.In some embodiments, it can apply containing about 0.001mg/kg extremely The nanoparticle compositions of about 10mg/kg dosage therapeutic agent and/or prophylactic (such as mRNA).In other embodiments, may be used To apply the therapeutic agent and/or prophylactic of about 0.005mg/kg to about 2.5mg/kg dosage.In certain embodiments, Ke Yishi With about 0.1mg/kg to about 1mg/kg dosage.In other embodiments, about 0.05mg/kg can be applied to about 0.25mg/kg Dosage.Dosage can be one or many with the application of identical or different amount daily, to obtain desired mRNA expression and/or control It treats, diagnosis, prevent or be imaged exposure level.Desired dosage with for example three times a day, one day it is secondary, once a day, every Once a day, once every three days, once a week, once every two weeks, once every three weeks or every four weeks once deliver.In certain implementations In scheme, desired dosage can be used multiple applications (such as it is secondary, three times, four times, five times, six times, seven times, eight times, nine It is secondary, ten times, it is ten primary, 12 times, ten three times, 14 times or more time applications) delivering.It in some embodiments, can example Such as single dose is applied before or after surgical procedures or in the case where acute illness, illness or the patient's condition.
Nanoparticle compositions including one or more therapeutic agents and/or prophylactic other can be controlled with one or more Agent, prophylactic, diagnosticum or preparation is treated to be applied in combination." with ... combine " it is not intended to show that these reagents must be when identical Between apply and/or be formulated into and be delivered together, but these delivering methods are within the scope of this disclosure.E.g., including it is a kind of Or one or more nanoparticle compositions of a variety of different therapeutic agents and/or prophylactic can be administered in combination.Composition can be with While one or more other desired therapeutic agents or medical procedure, before or after apply.It is, in general, that every kind of examination Agent will be applied with the dosage determined by the reagent and/or time-histories.In some embodiments, the disclosure covers delivering combination Object or its imaging, diagnosis prevent composition and improve its bioavailability, reduction and/or improve its metabolism, inhibit its excretion And/or improve the combination of the reagent of its distribution in vivo.
In addition, it should be understood that therapeutic, preventative, the diagnostic or imaging active agent being applied in combination can use single combination Object is applied together or with different components separate administration.Generally, it is contemplated that the dosage for the reagent being applied in combination will be to be no more than Its level independently used.In some embodiments, the level being applied in combination can be lower than the level independently used.
Specific combination for the therapy (therapeutic agent or program) in assembled scheme be considered as desired therapeutic agent and/or The compatibility of program and the therapeutic effect for wishing acquisition.It should also be understood that therapy used can be wished for the realization of same illness The effect (such as can be used for the composition for the treatment of cancer can be administered simultaneously with chemotherapeutant) of prestige or these therapies can be real Existing different role (such as controlling any ill-effect, be such as transfused correlated response).
Nanoparticle compositions can be applied in combination with the reagent of the validity and/or therapeutic window that increase the composition.This Class reagent can be such as anti-inflammatory compound, steroids (such as corticosteroid), Statins (statin), estradiol, BTK suppression Preparation, S1P1 agonist, glucocorticoid receptor modulator (GRM) or antihistamine.In some embodiments, nanoparticle subgroup Closing object can be applied in combination with dexamethasone, methotrexate (MTX), paracetamol, H1 receptor blocking pharmacon or H2 receptor blocking pharmacon. In some embodiments, it treats subject in need or therapeutic agent and/or prophylactic is delivered to subject (such as lactation is dynamic Object) method can be related to before applying nanoparticle compositions, with one or more reagent pretreatment subjects.For example, It can be with having dosage (such as 10mg, 20mg, 30mg, 40mg, 50mg, 60mg, 70mg, 80mg, 90mg, 100mg or any other Have dosage) dexamethasone, methotrexate (MTX), paracetamol, H1 receptor blocking pharmacon or H2 receptor blocking pharmacon pretreatment it is tested Person.Pretreatment can before applying nanoparticle compositions 24 hours or shorter time (such as 24 hours, 20 hours, it is 16 small When, 12 hours, 8 hours, 4 hours, 2 hours, 1 hour, 50 minutes, 40 minutes, 30 minutes, 20 minutes or 10 minutes) carry out simultaneously And it can be carried out once, two or more times by such as ascending-dose.
It would be recognized by those skilled in the art that or can be determined using only routine experiment described herein according to the disclosure Specific embodiment many equivalents.The scope of the present disclosure is not intended to be limited to above description, but such as appended right It is stated in claim.
Unless making opposite instruction or from context in addition it is clear that otherwise in detail in the claims, such as " one (kind) " Words such as " described " can indicate one (kind) or more than one (kind).Unless making opposite instruction or in addition aobvious and easy from context See, otherwise the claims or description between one group of one or more member including "or" is considered as one met in the group membership It is a, be present in, be used for or be related in other ways given product or method more than one or all.The disclosure includes in the group Only one member is present in, is used for or is related in other ways the embodiment of given product or method.The disclosure includes super It crosses one or all group memberships is present in, is used for or is related in other ways the embodiment of given product or method.Unless In addition illustrate, otherwise as used herein, state " one or more of A, B or C ", " one or more A, B or C ", " A, B One or more of with C ", " one or more A, B and C ", " being selected from A, B and C ", " selected from the group being made of A, B and C " etc. can It is used interchangeably and all refers to and selected from the group being made of A, B and/or C, i.e. one or more A, one or more B, one A or multiple C or any combination thereof.
It shall yet further be noted that term "comprising" is intended that open and allows but do not need to include other elements or step.When When term "comprising" used herein, be thus also covered by and open term " mainly by ... form " and " by ... form ". Specification in the whole text, when by composition be described as having including or when comprising specific components, it is contemplated that composition also mainly by or by Described group is grouped as.Similarly, when method or technique are described as having including or when comprising specific process step, these works Skill is also mainly formed by or by the processing step.Additionally it should be appreciated that the order of step or the order for executing certain operations are not Important, as long as present invention holding can operate.In addition, two or more steps or operation can carry out simultaneously.
In the case where given range, terminal is included.Also, it should be appreciated that unless otherwise instructed or from context and The understanding of those of ordinary skill in the art is in addition it is clear that can be using in disclosure difference embodiment party with the value of Range Representation Any particular value or subrange in the range of being stated in case, unless otherwise context is in addition clearly stipulate that be accurate to the model Enclose 1/10th of lower limit unit.
The synthesis technology of the disclosure can allow multiple functional groups, therefore various substituted initial substances can be used. These techniques generally provide desired final compound at the end of entire technique terminates or is fast, but in certain situations The compound is further converted into its pharmaceutically acceptable salt by lower possible needs.
Commercially available initial substance, known in the literature compound can be used in the compound of the disclosure, or by being easy to make Standby intermediary, it is interior according to teaching for this paper by using Standard synthetic methods and known to those skilled in the art or technical staff Hold obvious program, prepares in many ways.It is used to prepare the Standard synthetic methods and program and function of organic molecule Group's conversion and operation can be obtained from related science document or from the standard textbook of this field.If although not limited to any or Dry source, but the classical textbook being incorporated herein by reference, such as Smith, M.B., March, J., March ' s Advanced Organic Chemistry:Reactions, Mechanisms, and Structure, the 5th edition, John Wiley&Sons:New York,2001；Greene,T.W.,Wuts,P.G.M.,Protective Groups in Organic Synthesis, the 3rd edition, John Wiley&Sons:New York, 1999；R.Larock,Comprehensive Organic Transformations,VCH Publishers(1989)；L.Fieser and M.Fieser, Fieser and Fieser ' s Reagents for Organic Synthesis,John Wiley and Sons(1994)；And L.Paquette is edited, Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), is to have And it is known to the skilled in the art generally acknowledged organic synthesis to make reference to the text-book.Below in connection with the description of synthetic method It is designed to the illustrative and not limiting general program for being used to prepare disclosure compound.
With various disclosure compound described herein can according to the program illustrated in following scheme 1,2 and 3, It is prepared by commercially available initial substance or the initial substance that literature procedure preparation can be used.Variable (such as R in each scheme1、 R2And R3Deng as defined herein).Those skilled in the art are it should be noted that in reaction process described herein and conjunction At during scheme, the order of certain steps can change, such as the introducing and removal of protecting group.
Those skilled in the art will be recognized, it may be necessary to protect certain groups from reacting item using protecting group Part influences.Protecting group can be also used for the similar functional group in difference molecule.The inventory of protecting group and introducing and remove these The method of group is found in Greene, T.W., Wuts, P.G.M., Protective Groups in Organic Synthesis, the 3rd edition, John Wiley&Sons:New York, 1999.
Preferred protecting group includes but is not limited to:
For hydroxylic moiety: TBS, benzyl, THP, Ac；
For carboxylic acid: benzene methyl, methyl esters, ethyl ester, allyl ester；
For amine: Fmoc, Cbz, BOC, DMB, Ac, Bn, Tr, Ts, trifluoroacetyl group, phthalimide, sub- benzene first Base amine；
For glycol: Ac (× 2), TBS (× 2) are acetone when connecting together；
For mercaptan: Ac；
For benzimidazole: SEM, benzyl, PMB, DMB；
For aldehyde: dialkyl acetal, such as dimethoxy acetal or diethyl acetyl group.
In reaction scheme described herein, it is possible to produce multiple stereoisomers.When not indicating that specific solid is different When structure body, this is interpreted as being meant to all possible stereoisomer that can be manufactured by the reaction.Ordinary skill Personnel should be understood that the reaction can be optimized to preferentially obtain a kind of isomers, or can be designed that new scheme to make Make individual isomer.If producing mixture, can be used such as preparative thin-layer chromatography method, preparative HPLC, preparative The technical separation isomers such as chiral HPLC or preparative SFC.
Scheme 1
As illustrated in above scheme 1,8- bromine octanoic acid is reacted with alcohol a1 (such as heptadecane -9- alcohol) to obtain ester b1 (example Such as 8- bromine octanoic acid heptadecane -9- base ester).Step 1 can be in organic solvent (such as methylene chloride), in such as N- (3- diformazan Base aminopropyl)-N '-ethylcarbodiimine dihydrochloride, N, it carries out in the presence of N- diisopropylethylamine and DMAP.Step 1 It can carry out at room temperature 18 hours.Next, ester b1 is reacted with 2- amino second -1- alcohol to obtain amine c1 (such as 8- ((2- hydroxyl Ethyl) amino) octanoic acid heptadecane -9- base ester).Step 2 can carry out at a temperature of for example, about 60 DEG C in ethanol.Then, amine C1 and bromine alkyl R1- Br (such as 1- bromo-tetradecane) reaction is to obtain compound d1 (such as 8- ((2- hydroxyethyl) (tetradecane Base) amino) octanoic acid heptadecane -9- base ester).Step 3 can carry out in the presence of n,N-diisopropylethylamine in ethanol.
Scheme 2
As described in above scheme 2, (t is the integer between 1 and 7 to sour a2；Such as 8- bromine octanoic acid) and alcohol b2 (such as Nonyl- 1- alcohol) it reacts to obtain ester c2 (such as 8- bromine nonyl caprylate).Step 1 can in organic solvent (such as methylene chloride), In such as N- (3- dimethylaminopropyl)-N '-ethylcarbodiimine dihydrochloride, N, N- diisopropylethylamine and DMAP are deposited In lower progress.Alcohol e2 (such as heptadecane -9- alcohol) can be by making aldehyde d2 (such as aldehyde C-9) and Grignard Reagent R3- MgX (such as n- C8H17MgBr it) is reacted through step 2 to obtain.Next, 8- bromine octanoic acid is reacted with alcohol e2 (such as heptadecane -9- alcohol) to obtain ester F2 (such as the sad 17 carbon -9- base esters of 8- bromine).Step 3 can be in organic solvent (such as methylene chloride), in such as N- (3- Dimethylaminopropyl)-N '-ethylcarbodiimine dihydrochloride, N, it carries out in the presence of N- diisopropylethylamine and DMAP.It connects Get off, ester f2 is reacted with 2- amino second -1- alcohol to obtain amine g2 (such as the sad heptadecane -9- base of 8- ((2- ethoxy) amino) Ester).Step 4 can in ethanol, in i-Pr2It is carried out in the presence of EtN.Then, amine g2 and ester c2 (such as 8- bromine nonyl caprylate) Reaction is to obtain compound h2 (such as the sad heptadecane -9- of 8- ((2- ethoxy) (8- (nonyl epoxide) -8- oxo octyl) amino) Base ester).Step 5 can under such as high temperature (such as at about 70-90 DEG C, for example, about 80 DEG C), organic solvent (such as CPME with The mixture of MeCN) in, in alkali (such as inorganic base (such as K2CO3) or non-nucleophilic organic base (such as i-Pr2EtN it)) and is catalyzed It is carried out in the presence of agent (such as iodine such as KI or NaI).
Scheme 3
As described in above scheme 3, halogenated alkanol (t is the integer between 1 and 12, such as 6- bromine hex- 1- alcohol) with rise Beginning substance a3 (s is the integer between 1 and 6, such as 4- (hexyloxy) -4- ketobutyric acid) is reacted to obtain halogenated diester b3 (such as the own ester of the own ester of succinic acid 6- bromine).Compound a 3 can by alcohol (such as hex- 1- alcohol) and acid anhydrides (such as succinic anhydride, - 2,6 (3H)-diketone of dihydro -2H- pyrans, 3- (tert-butoxy) -3- oxopropanoic acid, 4- (tert-butoxy) -3- methyl -4- oxo Butyric acid or 4- (tert-butoxy) -2- methyl -4- ketobutyric acid) reaction obtain.Step 1 can be in organic solvent (such as dichloromethane Alkane) in, such as N- (3- dimethylaminopropyl)-N '-ethylcarbodiimine dihydrochloride, n,N-diisopropylethylamine and It is carried out in the presence of DMAP.Next, (u is the integer between 5 and 13, and v is whole between 1 and 5 by halogenated diester b3 and amine c3 Number, such as 8- ((2- hydroxyethyl) amino) octanoic acid heptadecane -9- base ester) it reacts to obtain product d3.Step 2 can be in high temperature Under (for example, about 90 DEG C), in organic solvent (such as mixture of CPME and MeCN), in alkali (such as inorganic base (such as K2CO3)) It is carried out in the presence of catalyst (such as iodide such as KI) and ether solvents (such as cyclopentyl-methyl ether).
It will be recognized that in above scheme, the order of certain steps can be interchanged those skilled in the art.
In some aspects, the disclosure further include synthesis formula (I), (IA), (IB), (II), (IIa), (IIb), (IIc), (IId), the method for the compound of any of (IIe), (IIf), (IIg) or (III) and for synthesizing in the compound Between object.
In some embodiments, the method for synthesizing formula (I) compound includes the compound of formula (X2):With R1- Br is reacted to obtain formula (I) compound, wherein each variable is as defined herein.Example Such as, m is 5,6,7,8 or 9, preferably 5,7 or 9.For example, R5、R6And R7Individually H.For example, M is-C (O) O- or-OC (O)-.For example, R4It is unsubstituted C1-3Alkyl, or-(CH2)nQ, it is OH ,-NHC (S) N that wherein n, which is 2,3 or 4 and Q, (R)2、-NHC(O)N(R)2,-N (R) C (O) R or-N (R) S (O)2R.For example, formula (X2) compound and R1The reaction of-Br is in alkali (such as inorganic base (such as K2CO3) or non-nucleophilic organic base (such as i-Pr2EtN it is carried out in the presence of)).For example, the reaction be Inorganic base (such as K2CO3) and catalyst (such as iodide such as KI or NaI) in the presence of carry out.For example, reaction be at high temperature, Such as it is carried out at about 50-100 DEG C, 70-90 DEG C or about 80 DEG C.
The method can also include the compound of formula (X1):With R4NH2Reaction To obtain formula (X2) compound, wherein each variable is as defined herein.
In some embodiments, intermediary includes having those of any of formula (X1) and (X2):Wherein each variable such as this paper institute Definition.For example, intermediary includes 8- bromine octanoic acid heptadecane -9- base ester and the sad heptadecane -9- of 8- ((2- hydroxyethyl) amino) Base ester and its morphology form (such as crystal form).
In addition, it should also be understood that any specific embodiment of the disclosure within the scope of the prior art can expressly exclude Outside any one or more claims.Since these embodiments are considered as known to ordinary skill people, therefore It can be foreclosed, even if the exclusion is not explicitly stated herein.
The source of all references, such as bibliography cited herein, announcement, database, data base entries and technology It is all herein incorporated by reference in the application, even if being not explicitly stated in citation.Occur in the statement of reference source and the application In contradictory situation, it should be subject to the statement of the application.
- 上一篇：一种医用注射器针头装配设备
- 下一篇：甲基磺草酮的合成方法