阅读说明：本技术 连接肽、含有连接肽的融合蛋白及其应用 (Connecting peptide, fusion protein containing connecting peptide and application of fusion protein ) 是由 吴希 张翀 云振宇 赵琳 吴琦 于 2021-02-20 设计创作，主要内容包括：本发明公开了一种连接肽、含有连接肽的融合蛋白及其应用。所述连接肽为R0、R1、R2或R3,其中,R0的氨基酸序列为AAA,R1的氨基酸序列为EAAAK,R2的氨基酸序列为(EAAAK)-2,R3的氨基酸序列为(EAAAK)-3。本发明所设计的连接肽,可用于融合蛋白的分子改造。通过对醇脱氢酶与NAD(P)H氧化酶的融合蛋白的连接肽的设计,使得醇脱氢酶与NAD(P)H氧化酶的活性提高,催化特性改善,通过连接肽的长度调节合理控制两个酶之间的距离,在体外实现了空间靠近效应,提高了辅酶的循环效率,实现了高效的氧化型辅酶再生。进一步利用单一融合蛋白能够高效制备出光学纯的手性醇,简化体系,降低成本,为药物与化学工业的中间体的生产提供了新的工具。(The invention discloses a connecting peptide, a fusion protein containing the connecting peptide and application thereof. The connecting peptide is R0, R1, R2 or R3, wherein the amino acid sequence of R0 is AAA, the amino acid sequence of R1 is EAAAK, and the amino acid sequence of R2 is (EAAAK) 2 And the amino acid sequence of R3 is (EAAAK) 3 . The connecting peptide designed by the invention can be used for molecular modification of fusion protein. The design of the connecting peptide of the fusion protein of the alcohol dehydrogenase and the NAD (P) H oxidase improves the activity of the alcohol dehydrogenase and the NAD (P) H oxidase and the catalytic property, reasonably controls the distance between the two enzymes by adjusting the length of the connecting peptide, realizes the space approach effect in vitro, improves the circulating efficiency of coenzyme and realizes the high-efficiency regeneration of oxidized coenzyme. Further, the single fusion protein can be used for efficiently preparing the optically pure chiral alcohol, so that the system is simplified, the cost is reduced, and a new tool is provided for the production of intermediates of the pharmaceutical and chemical industries.)

1. A connecting peptide is R0, R1, R2 or R3, wherein the amino acid sequence of R0 is AAA, the amino acid sequence of R1 is EAAAK, and the amino acid sequence of R2 is (EAAAK)₂And the amino acid sequence of R3 is (EAAAK)₃。

2. A DNA molecule encoding the connecting peptide of claim 1.

3. Use of the linker peptide of claim 1for coenzyme regeneration.

4. A fusion protein selected from one of the following:

alcohol dehydrogenase-R0-NAD (P) H oxidase, alcohol dehydrogenase-R1-NAD (P) H oxidase, alcohol dehydrogenase-R2-NAD (P) H oxidase, alcohol dehydrogenase-R3-NAD (P) H oxidase, NAD (P) H oxidase-R0-alcohol dehydrogenase, NAD (P) H oxidase-R1-alcohol dehydrogenase, NAD (P) H oxidase-R2-alcohol dehydrogenase, and NAD (P) H oxidase-R3-alcohol dehydrogenase.

5. The protein of claim 4, which has an amino acid sequence selected from one of:

SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO. 16.

6. A nucleic acid molecule encoding the fusion protein of claim 4 or 5.

7. A vector comprising the nucleic acid molecule of claim 6.

8. A genetically engineered bacterium comprising the vector of claim 7.

9. Use of the fusion protein of claim 4 or 5 for coenzyme regeneration.

10. Use of the fusion protein of claim 4 or 5 for the production of chiral secondary alcohols.

11. A method of coenzyme regeneration comprising:

regeneration of NAD (P) H into NAD (P) using the fusion protein of claim 4 or 5⁺。

12. The method of claim 11, wherein the fusion protein is alcohol dehydrogenase-R2-nad (p) H oxidase.

13. A method for producing a chiral secondary alcohol, comprising:

performing chiral resolution on a mixture comprising (R) -secondary alcohol and (S) -secondary alcohol using the fusion protein of claim 4 or 5 to obtain (R) -secondary alcohol.

14. The production method according to claim 13, wherein the secondary alcohol is an aliphatic secondary alcohol or an aryl secondary alcohol, and preferably, the aryl secondary alcohol is 1-phenylethyl alcohol.

15. The production method according to claim 13 or 14, wherein the fusion protein is alcohol dehydrogenase-R2-nad (p) H oxidase.

16. Use of the connecting peptide of claim 1for the production of chiral secondary alcohols.

Technical Field

The invention relates to the technical field of genetic engineering and enzyme engineering, in particular to a connecting peptide, a fusion protein containing the connecting peptide and application thereof.

Background

Chiral alcohols are important intermediates in the pharmaceutical and chemical industries. The production of chiral alcohols using Alcohol Dehydrogenases (ADHs) has a series of advantages over chemical methods: the reaction has high chemical, stereo and regioselectivity, mild catalysis condition, environment-friendly catalysis process and the like. Alcohol dehydrogenases require a continuous consumption of the nicotinamide coenzyme NAD or NADP in the catalysis of the mutual conversion of alcohol and aldehyde/ketone. However, since coenzymes are expensive and unstable, in order to reduce the cost of industrial application of alcohol dehydrogenases, it is necessary to develop a coenzyme regeneration system with high efficiency.

Coenzyme regeneration includes two main categories, namely reduction coenzyme regeneration and oxidation coenzyme regeneration, according to the oxidation state of the regenerated coenzyme. Because of the wide application of alcohol dehydrogenase in catalyzing prochiral ketone to generate chiral alcohol, research on regeneration of reduced coenzyme has been conductedAnd (5) maturing. However, in some cases, alcohol dehydrogenases can carry out a kinetic resolution of racemic alcohols by means of an oxidation reaction to give the corresponding chiral alcohols, which is also of great value and in the process requires the regeneration of the oxidized coenzyme. Since NAD (P) -dependent dehydrogenases are mostly prone to reduction reactions, the oxidized coenzyme NAD (P)⁺Is much more complicated than the regeneration of reduced coenzyme NAD (P) H.

The enzyme coupling method is a widely used coenzyme regeneration method in which a substrate catalytic enzyme acts on a target substrate to catalyze the production of a target product, and a coenzyme cyclic enzyme acts on a co-substrate to regenerate a coenzyme. The substrate catalytic enzyme and the coenzyme cyclic enzyme are fused by utilizing a genetic engineering means, so that the dual functions of catalysis and coenzyme regeneration can be realized, and in addition, as the active sites of the two enzymes are close, a space approach effect is possibly realized, so that the coenzyme transfer efficiency is improved. Patent applications CN 109628419 a and CN 104845988A relate to the fusion expression of lactate dehydrogenase and coenzyme cycle enzyme, but they all utilize whole cell catalysis to catalyze the production of phenyllactic acid, and the catalytic efficiency of fusion protein in vitro is not evaluated, while whole cell catalysis is in vivo catalysis, which is fundamentally different from the catalysis of coenzyme regeneration by free enzyme in vitro. Torres Pazmino et al have constructed a fusion protein system of Baeyer-Villiger monooxygenase and phosphite dehydrogenase, have realized catalysis and coenzyme regeneration bifunctional, but have not found that the fusion protein system has coenzyme delivery advantages over an isoactive single enzyme mixed system (Torres Pazmino D E, et al. self-deficient Baeyer-Villiger monoxygenase: Effective coenzyme regeneration for biobased regeneration by fusion engineering. Angewandte Chemie International Edition,2008,47: 2275-. Hoelsch et al constructed a ketoreductase-formate dehydrogenase fusion enzyme, and although the catalytic efficiency of the whole cell was higher than that of a cell simultaneously expressing a single enzyme, the catalytic efficiency of the fusion enzyme in the crude cell extract was slightly decreased (Hoelsch K, et al, endogenous selective reduction of a pro-enzyme by engineered biochemical fusion proteins, 2010,56: 131-. This indicates that there is a chance that the use of fusion proteins to achieve the spatial proximity effect of enzymes in vitro may have a significant impact on the molecular design of the fusion proteins in controlling their function. In addition, the cases of using the fusion protein to realize the generation of the target product and the regeneration of the coenzyme are both reduced coenzyme regeneration systems, and there are few cases of using the fusion protein to regenerate oxidized coenzyme.

Disclosure of Invention

Aiming at the problems that the existing fusion enzyme coenzyme regeneration system is limited to reduced coenzyme regeneration, catalytic specificity constant is reduced after enzyme fusion, and coenzyme circulation efficiency is not high, the invention provides a connecting peptide, a fusion protein containing the connecting peptide and application thereof. Further, the fusion protein is utilized to efficiently prepare the optically pure chiral alcohol, so that the system is simplified, the cost is reduced, and a new tool is provided for the production of intermediates of the pharmaceutical and chemical industries.

The specific technical scheme of the invention is as follows:

1. a connecting peptide is R0, R1, R2 or R3, wherein the amino acid sequence of R0 is AAA, the amino acid sequence of R1 is EAAAK, and the amino acid sequence of R2 is (EAAAK)₂And the amino acid sequence of R3 is (EAAAK)₃。

2. A DNA molecule encoding the linker peptide of claim 1.

3. Use of the linker peptide of item 1for coenzyme regeneration.

4. A fusion protein selected from one of the following:

alcohol dehydrogenase-R0-NAD (P) H oxidase, alcohol dehydrogenase-R1-NAD (P) H oxidase, alcohol dehydrogenase-R2-NAD (P) H oxidase, alcohol dehydrogenase-R3-NAD (P) H oxidase, NAD (P) H oxidase-R0-alcohol dehydrogenase, NAD (P) H oxidase-R1-alcohol dehydrogenase, NAD (P) H oxidase-R2-alcohol dehydrogenase, and NAD (P) H oxidase-R3-alcohol dehydrogenase.

5. The protein according to item 4, wherein the amino acid sequence is one selected from the group consisting of:

SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO. 16.

6. A nucleic acid molecule encoding the fusion protein of item 4 or 5.

7. A vector comprising the nucleic acid molecule of item 6.

8. A genetically engineered bacterium comprising the vector of item 7.

9. Use of the fusion protein of item 4 or 5 for coenzyme regeneration.

10. Use of the fusion protein of item 4 or 5 in the production of a chiral secondary alcohol.

11. A method of coenzyme regeneration comprising:

regeneration of NAD (P) H into NAD (P) using the fusion protein of item 4 or 5⁺。

12. The method of claim 11, wherein the fusion protein is alcohol dehydrogenase-R2-nad (p) H oxidase.

13. A method for producing a chiral secondary alcohol, comprising:

subjecting a mixture comprising (R) -secondary alcohol and (S) -secondary alcohol to chiral resolution using the fusion protein of item 4 or 5 to obtain (R) -secondary alcohol.

14. The production method according to claim 13, wherein the secondary alcohol is an aliphatic secondary alcohol or an aryl secondary alcohol, and preferably, the aryl secondary alcohol is 1-phenylethyl alcohol.

15. The production method according to claim 13 or 14, wherein the fusion protein is alcohol dehydrogenase-R2-NAD (P) H oxidase.

16. Use of the linker peptide of item 1 in the production of chiral secondary alcohols.

ADVANTAGEOUS EFFECTS OF INVENTION

The connecting peptide designed by the invention can be used for molecular modification of fusion protein. The design of the connecting peptide of the fusion protein of Alcohol Dehydrogenase (ADH) and NAD (P) H oxidase (NOX) improves the activity of the alcohol dehydrogenase and the NAD (P) H oxidase, improves the catalytic property, reasonably controls the distance between the two enzymes by adjusting the length of the connecting peptide, realizes the space approach effect in vitro, improves the circulating efficiency of coenzyme and realizes the high-efficiency regeneration of oxidized coenzyme. Further, the single fusion protein can be used for efficiently preparing the optically pure chiral alcohol, so that the system is simplified, the cost is reduced, and a new tool is provided for the production of intermediates of the pharmaceutical and chemical industries.

Drawings

FIG. 1 is a SDS-PAGE analysis of fusion protein expressed by Escherichia coli Rosetta (DE3) in example 1, wherein FIG. 1-1 is a supernatant of crude cell extract; FIG. 1-2 shows the supernatant of the crude cell extract after heat treatment at 85 ℃; the band 1 is fusion protein ADH-R1-NOX, the band 2 is fusion protein ADH-R2-NOX, the band 3 is fusion protein ADH-R0-NOX, the band 4 is fusion protein NOX-R1-ADH, the band 5 is NOX-R2-ADH, the band 6 is NOX-R0-ADH, the band M is protein molecular weight standard, and the unit is kDa; the arrow indicates where the band of the fusion protein of interest is located.

FIG. 2 is a SDS-PAGE analysis of fusion protein expressed by Escherichia coli Rosetta (DE3) in example 1, wherein FIG. 2-1 is a supernatant of crude cell extract; FIG. 2-2 shows the supernatant of the crude cell extract after heat treatment at 85 ℃; the band 1 is fusion protein ADH-R3-NOX, the band 2 is fusion protein NOX-R3-ADH, the band M is protein molecular weight standard, and the unit is kDa; the arrow indicates where the band of the fusion protein of interest is located.

FIG. 3 is a reaction scheme of the regeneration of oxidized coenzyme to chiral aryl secondary alcohol using the fusion protein in examples 4 and 5.

FIG. 4 is a graph showing the conversion rate of (S) -1-phenylethyl alcohol and (R) -1-phenylethyl alcohol with time during the production of chiral aryl secondary alcohol catalyzed by the fusion protein in example 5.

Detailed Description

The present invention is described in detail in the following description of embodiments with reference to the figures, in which like numbers represent like features throughout the figures. While specific embodiments of the invention are shown in the drawings, it should be understood that the invention may be embodied in various forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

It should be noted that certain terms are used throughout the description and claims to refer to particular components. As one skilled in the art will appreciate, various names may be used to refer to a component. This specification and claims do not intend to distinguish between components that differ in name but not function. In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, however, the description is given for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the present invention is defined by the appended claims.

The invention provides a connecting peptide which is R0, R1, R2 or R3, wherein the amino acid sequence of R0 is AAA (SEQ ID NO:1), the amino acid sequence of R1 is EAAAK (SEQ ID NO:2), and the amino acid sequence of R2 is (EAAAK)₂(SEQ ID NO:3) and the amino acid sequence of R3 is (EAAAK)₃(SEQ ID NO:4)。

The linker peptide is an amino acid sequence used to link two or more proteins or protein domains of interest, and is typically 3-50 amino acids in length. The linking peptide may be used to link two or more proteins, polypeptides, antibodies, etc. of different systems, and one skilled in the art can select an appropriate linking peptide depending on the nature of the proteins, polypeptides, antibodies, etc. to be linked.

The present invention provides a DNA molecule encoding a linker peptide as described herein.

There is no particular limitation on the gene encoding the linker peptide, as long as the corresponding linker peptide sequence is expressed by translation. For example, when the linker peptide is R0, the nucleotide sequence can be that shown in SEQ ID NO. 5, which is as follows:

GCGGCCGCG(SEQ ID NO:5)

when the connecting peptide is R1, the nucleotide sequence can be the nucleotide sequence shown in SEQ ID NO. 6, and the nucleotide sequence is as follows:

GAAGCGGCCGCGAAA(SEQ ID NO:6)

when the connecting peptide is R2, the nucleotide sequence can be shown as SEQ ID NO. 7, and the nucleotide sequence is as follows: GAAGCCGCGGCGAAAGAAGCGGCCGCGAAA (SEQ ID NO: 7).

When the connecting peptide is R3, the nucleotide sequence can be shown as SEQ ID NO. 8, and the nucleotide sequence is as follows: GAAGCCGCGGCGAAAGAAGCGGCCGCGAAAGAAGCCGCGGCGAAA (SEQ ID NO: 8).

The invention provides application of the connecting peptide in coenzyme regeneration, for example, the connecting peptide can be used for connecting Alcohol Dehydrogenase (ADH) and NAD (P) H oxidase (NOX), and the obtained fusion protein can be used for coenzyme regeneration.

The invention provides a fusion protein, which is selected from one of the following: alcohol dehydrogenase (hereinafter ADH) -R0-NAD (P) H oxidase (hereinafter NOX), Alcohol Dehydrogenase (ADH) -R1-NAD (P) H oxidase (NOX), Alcohol Dehydrogenase (ADH) -R2-NAD (P) H oxidase (NOX), Alcohol Dehydrogenase (ADH) -R3-NAD (P) H oxidase (NOX), NAD (P) H oxidase (NOX) -R0-Alcohol Dehydrogenase (ADH), NAD (P) H oxidase (NOX) -R1-Alcohol Dehydrogenase (ADH), NAD (P) H oxidase (NOX) -R2-Alcohol Dehydrogenase (ADH), and NAD (NAD P) H oxidase (NOX) -R3-Alcohol Dehydrogenase (ADH).

When the fusion protein is ADH-R0-NOX, the amino acid sequence is shown as SEQ ID NO. 9; when the fusion protein is ADH-R1-NOX, the amino acid sequence is shown as SEQ ID NO. 10; when the fusion protein is ADH-R2-NOX, the amino acid sequence is shown as SEQ ID NO. 11; when the fusion protein is ADH-R3-NOX, the amino acid sequence is shown as SEQ ID NO. 12; when the fusion protein is NOX-R0-ADH, the amino acid sequence is shown as SEQ ID NO. 13; when the fusion protein is NOX-R1-ADH, the amino acid sequence is shown as SEQ ID NO. 14; when the fusion protein is NOX-R2-ADH, the amino acid sequence is shown as SEQ ID NO. 15; when the fusion protein is NOX-R3-ADH, the amino acid sequence is shown in SEQ ID NO. 16.

Among them, the Alcohol Dehydrogenases (ADHs) are important oxidoreductases catalyzing the interconversion of alcohols and aldehydes/ketones, which are widely distributed among various organisms and have an important role in maintaining the normal physiological functions of the organisms.

NAD (P) H oxidases (NOX) can catalyze the oxidation of NAD (P) H by two-electron transfer to reduce molecular oxygen to hydrogen peroxide or by four-electron transfer to reduce molecular oxygen to water. NOX is widely distributed among species of diverse relativity, such as humans, vertebrates, plants, bacteria and archaea, belonging to the pyrimidine nucleotide dithiooxidoreductases, and generally requires FAD (flavin adenine dinucleotide) as a second coenzyme, covalently bound to the highly conserved GXT (H/S) AG motif in the N-terminal domain.

The present invention provides a nucleic acid molecule encoding a fusion protein herein.

With respect to the nucleic acid molecule encoding the fusion protein, the present invention is not particularly limited as long as the corresponding fusion protein is expressed by translation.

For example, when the fusion protein is ADH-R0-NOX, the nucleotide sequence is shown in SEQ ID NO. 17; when the fusion protein is ADH-R1-NOX, the nucleotide sequence is shown as SEQ ID NO. 18; when the fusion protein is ADH-R2-NOX, the nucleotide sequence is shown as SEQ ID NO. 19; when the fusion protein is ADH-R3-NOX, the nucleotide sequence is shown as SEQ ID NO. 20; when the fusion protein is NOX-R0-ADH, the nucleotide sequence is shown as SEQ ID NO. 21; when the fusion protein is NOX-R1-ADH, the nucleotide sequence is shown as SEQ ID NO. 22; when the fusion protein is NOX-R2-ADH, the nucleotide sequence is shown as SEQ ID NO. 23; when the fusion protein is NOX-R3-ADH, the nucleotide sequence is shown in SEQ ID NO. 24.

The present invention provides a vector comprising a nucleic acid molecule encoding the above-described fusion protein.

The vector of the present invention is not limited in any way, and an appropriate vector can be selected as needed, and for example, the vector may be a plasmid.

The invention provides a genetic engineering bacterium, which comprises the vector.

The present invention is not limited to the genetically engineered bacterium, and the person skilled in the art can determine it as desired, for example, the genetically engineered bacterium can be Escherichia coli.

The invention provides a method for constructing and expressing a fusion protein, which is to fuse a connecting peptide with a target protein, wherein the constructed fusion protein is obtained by connecting two target proteins (such as ADH and NOX) through the connecting peptide according to a certain sequence.

Methods for the construction and expression of fusion proteins are well known to those skilled in the art and may, for example, be carried out by the following steps:

(1) constructing a fusion gene by connecting a gene encoding a protein of interest (e.g., ADH and NOx) to a gene encoding a linker peptide in tandem, the method comprising: designing proper primers, and obtaining a fusion gene by a Polymerase Chain Reaction (PCR) method; the desired fusion gene can also be synthesized directly by artificial synthesis.

(2) Inserting the fusion gene in (1) into the multiple cloning site region of an expression vector to obtain an expression vector containing the fusion gene;

(3) transforming the expression vector containing the fusion gene obtained in the step (2) into a suitable host cell to obtain a transformed host cell;

(4) culturing the transformed host cell and inducing expression of the fusion protein by a suitable means;

(5) extracting and separating the fusion protein from the cell in (4).

The invention provides application of the fusion protein in coenzyme regeneration.

The coenzyme may be, for example, NAD⁺And NADP⁺Preferably, the present invention can improve the activity and catalytic specificity constant of alcohol dehydrogenase and NAD (P) H oxidase by fusing NOX to the C-terminal or N-terminal of ADH through a linker peptide, and improve the coenzyme circulation efficiency by reasonably controlling the distance between the two enzymes through the length adjustment of the linker peptide.

The present invention uses NAD⁺Is to initiate ADH catalyzed oxidation of a chiral secondary alcohol while the ADH is consuming NAD⁺At the same time, NADH is generated, and NAD is oxidized by NOX⁺The coenzyme is regenerated, and the reaction mechanism of the coenzyme is shown in figure 3. NADP can also be used due to ADH⁺NOX can also oxidize NADPH, so NAD in the above expression is used⁺Replacement by NADP⁺The same holds true for the corresponding substitution of NADH for NADPH.

The invention provides application of the fusion protein in chiral secondary alcohol production.

Preferably, the secondary alcohol is aliphatic secondary alcohol or aryl secondary alcohol, and preferably, the aryl secondary alcohol can be 1-phenylethyl alcohol.

The invention achieves the production of chiral secondary alcohols by using ADH, which consumes NAD⁺At the same time, NADH is generated, and NAD can be oxidized by NOX⁺And regenerating to realize the coenzyme regeneration while realizing the production of the chiral secondary alcohol, wherein the reaction mechanism diagram is shown in figure 3. NADP can also be used due to ADH⁺NOX can also oxidize NADPH, so NAD in the above expression is used⁺Replacement by NADP⁺The same holds true for the corresponding substitution of NADH for NADPH.

By using the fusion protein, the invention can realize complete resolution of chiral secondary alcohol such as aryl secondary alcohol or fatty secondary alcohol, namely, high-efficiency preparation of optically active secondary alcohol such as aryl secondary alcohol or fatty secondary alcohol by single enzyme.

The invention provides a coenzyme regeneration method, which comprises the step of regenerating NAD (P) H into NAD (P) by using the fusion protein⁺。

Preferably, the fusion protein is ADH-R2-NOX.

The present invention provides a method for producing a chiral secondary alcohol, which comprises subjecting a mixture comprising a (R) -secondary alcohol and a (S) -secondary alcohol to chiral resolution using the above-described fusion protein to obtain the (R) -secondary alcohol.

Said composition comprising (R) -secondary alcohol andthe mixture of (S) -secondary alcohols may be racemic (i.e., n)_{(R) -Secondary alcohols}:n_{(S) -Secondary alcohols}Either or not the racemate (i.e., in different molar ratios) may be subjected to chiral resolution to give (R) -secondary alcohols.

Preferably, the secondary alcohol is aliphatic secondary alcohol or aryl secondary alcohol, preferably, the aryl secondary alcohol is 1-phenylethyl alcohol, and the fusion protein is ADH-R2-NOX.

Examples

The present invention will be further described with reference to examples.

The following examples are conventional unless otherwise specified. Wherein, the PCR related reagent is from Beijing Quanzijin company; restriction enzymes were purchased from NEB (New England BioLabs); t4 DNA ligase was purchased from Takara Bio Inc.; the plasmid extraction kit was purchased from Omega; purifying PCR products, wherein an enzyme digestion product purification kit is purchased from Shunhun corporation; coenzyme NAD⁺And NADH from Roche; other analytical chemicals were purchased from Sigma.

Example 1 construction of fusion protein of alcohol dehydrogenase and NAD (P) H oxidase

The alcohol dehydrogenase and NAD (P) H oxidase referred to in this example are derived from hyperthermophiles Thermococcus kodakarensis KOD1, and are named TkADH and TkNOX, respectively, and the accession numbers in Genebank are BAD85034.1 and BAD84493.1, respectively.

Heterologous expression and purification of TkADH and TkNOX are described in the literature (Wu Xi, et al. Thermosable alcohol dehydrogenase from Thermococcus kodakarensis KOD1for interactive biochemical conversion of organic secondary alcohols. applied and Environmental Microbiology,2013,79:2209-2217.) and (Wu Xi, et al. application of alpha novel thermal NAD (P) H oxidative from hydrolytic organic synthesis for generation of bone NAD⁺and NADP⁺.Biotechnology and Bioengineering,2012,109:53-62.)。

The construction of the fusion protein related by the invention is that the genes coding part of the connecting peptide are respectively connected to one end of two target protein genes by skillful design of a primer and a restriction enzyme cutting site and a PCR amplification method, and then the complete gene coding the target connecting peptide is inserted between the two target protein genes by restriction enzyme cutting and connection, wherein an upstream primer in a primer combination 1 is shown as SEQ ID NO. 25, and a downstream primer is shown as SEQ ID NO. 26;

the upstream primer in the primer combination 2 is shown as SEQ ID NO. 27, and the downstream primer is shown as SEQ ID NO. 28;

the upstream primer in the primer combination 3 is shown as SEQ ID NO. 25, and the downstream primer is shown as SEQ ID NO. 29;

the upstream primer in the primer combination 4 is shown as SEQ ID NO. 30, and the downstream primer is shown as SEQ ID NO. 28;

the upstream primer in the primer combination 5 is shown as SEQ ID NO. 25, and the downstream primer is shown as SEQ ID NO. 31;

the upstream primer in the primer combination 6 is shown as SEQ ID NO. 32, and the downstream primer is shown as SEQ ID NO. 28;

the upstream primer in the primer combination 7 is shown as SEQ ID NO. 25, and the downstream primer is shown as SEQ ID NO. 33;

the upstream primer in the primer combination 8 is shown as SEQ ID NO. 34, and the downstream primer is shown as SEQ ID NO. 28;

the upstream primer in the primer combination 9 is shown as SEQ ID NO. 35, and the downstream primer is shown as SEQ ID NO. 36;

the upstream primer in the primer combination 10 is shown as SEQ ID NO. 37, and the downstream primer is shown as SEQ ID NO. 38;

the upstream primer in the primer combination 11 is shown as SEQ ID NO. 35, and the downstream primer is shown as SEQ ID NO. 39;

the upstream primer in the primer combination 12 is shown as SEQ ID NO. 40, and the downstream primer is shown as SEQ ID NO. 38;

the upstream primer in the primer combination 13 is shown as SEQ ID NO. 35, and the downstream primer is shown as SEQ ID NO. 41;

the upstream primer in the primer combination 14 is shown as SEQ ID NO. 42, and the downstream primer is shown as SEQ ID NO. 38;

the upstream primer in the primer combination 15 is shown as SEQ ID NO. 35, and the downstream primer is shown as SEQ ID NO. 43;

the upstream primer in the primer combination 16 is shown as SEQ ID NO. 44, and the downstream primer is shown as SEQ ID NO. 38;

also, the nucleotide sequences (underlined representing the restriction sites) are shown in the following table:

TABLE 1 plasmid construction primer List for fusion protein expression

The specific construction steps are as follows:

taking a sequence containing a TkADH coding gene as a template, and carrying out PCR reaction by using a primer combination 1 to amplify a TkADH gene fragment of a connecting peptide sequence of a connecting part, wherein the PCR amplification program is as follows: pre-denaturation at 98 ℃ for 30s, then entering the following 30 cycles: denaturation at 98 ℃ for 10s, annealing at 63 ℃ for 30s, and extension at 72 ℃ for 45 s; after the circulation is finished, the extension is carried out for 10min at 72 ℃.

Taking a sequence containing the TkNOX coding gene as a template, and carrying out PCR reaction by using a primer combination 2 to amplify a tkNOX gene fragment connected with the rest connecting peptide, wherein the PCR amplification procedure is as follows: pre-denaturation at 98 ℃ for 30s, then entering the following 30 cycles: denaturation at 98 ℃ for 10s, annealing at 63 ℃ for 45s, and extension at 72 ℃ for 45 s; after the circulation is finished, the extension is carried out for 10min at 72 ℃.

The amplified tkadh fragment was digested with Nde I and Not I, and the tknox fragment with Not I and EcoR I, and plasmid pET-21b (+) (purchased from Novagen) was digested with Nde I and EcoR I, and then recovered, and the three fragments were ligated with T4 ligase to construct plasmid pET-21b/ADH-R0-NOX containing the gene encoding the desired fusion protein, and the plasmid was digested and sequenced to verify the correctness.

Plasmids pET-21b/ADH-R1-NOX, pET-21b/ADH-R2-NOX, pET-21b/ADH-R3-NOX, pET-21b/NOX-R0-ADH, pET-21b/NOX-R1-ADH, pET-21b/pET-NOX-R2-ADH and pET-21b/NOX-R3-ADH were successfully constructed by similar methods using the above-mentioned primer combinations 3 to 16, respectively;

the plasmid was transformed into E.coli Rosetta (DE3) strain (purchased from Novagen) to construct the engineered bacteria Rosetta (DE3)/pET21b/ADH-R0-NOX, Rosetta (DE3)/pET21b/ADH-R1-NOX, Rosetta (DE3)/pET21b/ADH-R2-NOX, Rosetta (DE3)/pET21b/ADH-R3-NOX, Rosetta (DE3)/pET21b/NOX-R0-ADH, Rosetta (DE3)/pET21b/NOX-R1-ADH, Rosetta (DE3)/pET21 b/NOX-R2-686 and Rosetta (DE 847)/pET 21 8658/NOX-R3-ADH.

The following method is utilized to culture the genetic engineering bacteria: LB Medium (100. mu.g/ml) was used as the liquid medium for the genetically engineered bacteria^-1Ampicillin and 34. mu.g/ml^-1Chloramphenicol) at 170rpm on a shaker. And inducing and culturing the genetically engineered bacteria by the following method: inoculating single colony from solid plate into LB culture medium, pre-culturing at 37 deg.C for 12-16h, transferring the culture to fresh LB culture medium at an inoculum size of 1% (v/v), culturing at 37 deg.C for about 3h to obtain OD₆₀₀When 0.6 is reached, the induction is carried out by adding IPTG to a final concentration of 0.05mM and the cultivation is continued for 20h by transferring the mixture into an air bath shaker at 20 ℃. After completion of the culture, the cells were centrifuged at 8,000 Xg at 4 ℃ for 10min, collected and washed three times with 50mM Tris-HCl buffer (pH 8.5), and finally resuspended in 50mM Tris-HCl buffer (pH 8.5) containing 0.1mM FAD and 100mM NaCl. The resulting resuspension was sonicated at low temperature, centrifuged at 8,000 Xg and 4 ℃ for 10min to collect the supernatant and obtain the crude enzyme solution. The crude enzyme solution of the fusion protein is subjected to heat treatment at 85 ℃ for 10min, and then centrifuged at 15,000 Xg at 4 ℃ for 30min, so that the denatured and precipitated protein can be removed, and the supernatant is obtained and the purified fusion protein is concentrated. Through the identification of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (figure 1 and figure 2), the crude enzyme solution contains the target fusion protein, and can achieve better purification effect through heat treatment, and further identification shows that the obtained fusion proteins ADH-R0-NOX, ADH-R1-NOX, ADH-R2-NOX, ADH-R3-NOX, NOX-R0-ADH, NOX-R1-ADH, NOX-R2-ADH and NOX-R3-ADH simultaneously have the activity of TkADH and TkNOX.

Example 2 Activity analysis of fusion proteins

The fusion proteins ADH-R0-NOX, ADH-R1-NOX, ADH-R2-NOX, ADH-R3-NOX, NOX-R0-ADH, NOX-R1-ADH, NOX-R2-ADH and NOX-R3-ADH were constructed and expressed by the method in example 1, and the fusion proteins were purified by heat treatment. In order to examine the intrinsic changes in the activity of these eight fusion proteins with different linker peptide lengths and fusion orientations, the alcohol dehydrogenase activity and the NAD (P) H oxidase activity were measured at 70 ℃ respectively.

(1) Determination of alcohol dehydrogenase Activity

The activity of Alcohol Dehydrogenase (ADH) in the fusion protein is detected as follows: the reaction system was 750. mu.L, comprising 50mM glycine-sodium hydroxide buffer (pH9.0), 100mM (RS) -1-phenylethyl alcohol, 1mM NAD⁺An appropriate amount of enzyme solution (fusion protein when the activity of the fusion protein is measured; TkADH when the activity of the monoose TkADH is measured) was added, and the mixture was rapidly and uniformly mixed to initiate the reaction at 70 ℃ and the change in absorbance at 340nm within 1min, NAD, was measured by a spectrophotometer (Ultrospec 3100Pro, Amersham Biosciences, USA)⁺No absorption at 340nm, and an absorption coefficient of NADH at 340nm of ε₃₄₀＝6.22mM^-1cm^-1. The activity of 1U ADH is defined as the reduction of 1. mu. mol NAD per minute⁺The amount of enzyme required.

(2) Determination of NAD (P) H oxidase Activity

The activity of NAD (P) H oxidase (NOX) in the fusion protein is detected as follows: the reaction system was 750. mu.L, and included 100mM Tris-HCl buffer (pH 7.0), 0.1mM FAD (flavin adenine dinucleotide), 0.2mM NADH, and an appropriate amount of enzyme solution (the enzyme solution was a fusion protein when the activity of the fusion protein was measured, and the enzyme solution was TkNOX when the activity of the monoase TkNOX was measured) was added thereto, followed by rapid and uniform mixing to initiate the reaction at 70 ℃ and measuring the change in absorbance at 340nm within 1min using a spectrophotometer (Ultrospec 3100Pro, Amersham Biosciences, USA), NAD⁺No absorption at 340nm, and an absorption coefficient of NADH at 340nm of ε₃₄₀＝6.22mM^-1cm^-1. The activity of 1U NOX is defined as the amount of enzyme required to oxidize 1. mu. mol NADH per minute.

The protein concentration was measured by the standard method of Bradford using Bovine Serum Albumin (BSA) as a standard protein. In order to calculate the specific activity of the fusion protein, the gel density scan of the fusion protein is performed to estimate the ratio of the target protein to the total protein.

Specific activities of purified monooxygenase TkADH (alcohol dehydrogenase derived from Thermococcus kodakarensis KOD1, heterologously expressed in e. coli) and TkNOX (nad (p) H oxidase derived from Thermococcus kodakarensis KOD1, heterologously expressed in e. coli) were set to 100%, respectively, and absolute values of the specific activities of the eight fusion proteins are shown in table 2.

TABLE 2 ADH and NOX specific activities of the Mono-and fusion proteins

Note that the value in parentheses is the ratio of the specific activity of the fusion protein relative to the specific activity of the corresponding single enzyme.

As can be seen from Table 2, in the case where NOX is fused to the C-terminus of ADH, when the linker peptide is R2, the specific activities of the ADH moiety and the NOX moiety of the fusion protein ADH-R2-NOX are respectively increased by 38% and 27% for the single enzymes TkADH and TkNOX, as compared to the specific activities of the NOX moiety at 70 ℃; the specific activity of the ADH moiety was increased by 20% compared to the fusion protein with the linker peptide R3, while the specific activity of the NOX moiety was leveled.

When NOX is fused at the N-terminal of ADH, when the connecting peptide is R2, the specific activity of the ADH part and the NOX part of the fusion protein NOX-R2-ADH at 70 ℃ is respectively improved by 1 percent and 116 percent compared with that of single-enzyme TkADH and TkNOX; compared with the fusion protein with the connecting peptide of R3, the specific activity of the ADH part and the NOX part is respectively improved by 87 percent and 2 percent.

In summary, the use of the linker peptide R2, regardless of whether NOX is fused to the C-terminus or N-terminus of ADH, results in a fusion protein with different degree of improvement in specific activity of ADH and NOX at 70 ℃ compared to the single enzyme, which is higher than the corresponding fusion protein with linker peptide R3 and slightly worse than the fusion protein with linker peptide R3.

Example 3 determination of kinetic parameters of fusion proteins

In order to minimize the experimental error caused by the volatilization of the substrate at high temperature,to compare better the difference in the coenzyme regeneration efficiency between the fusion protein and its isoactive single enzyme mixed system, the reaction temperature was set to 40 ℃. First, the respective coenzyme NAD of the fusion protein at 40 ℃ was determined⁺And kinetic parameters of NADH. The buffer solution used for measuring the activities of alcohol dehydrogenase and NAD (P) H oxidase was 50mM Gly-NaOH buffer solution (pH9.0) which was used for the coenzyme regeneration reaction.

The specific method comprises the following steps: for the ADH fraction, 100mM of (RS) -1-phenylethyl alcohol was added to the buffer, and NAD was changed in the range of 0-1.0mM⁺Measuring NAD⁺An initial rate of reduction; for the NOX fraction, the initial rate of NADH oxidation was determined by varying the NADH concentration in the range of 0-0.25 mM. Eight fusion proteins and TkADH are added in different NAD⁺The initial reaction rates at the concentrations and the initial reaction rates of the eight fusion proteins and TkNOX at different NADH concentrations were fitted to a Mie equation curve, and kinetic parameters of the proteins were calculated, with the results shown in Table 3.

TABLE 3 kinetic parameters of the monoenzymes and fusion proteins on coenzymes

Note that the values in parentheses are the ratio of the parameter values for the fusion protein relative to the corresponding parameter values for the single enzyme.

As can be seen from Table 3, when the linker peptide is R3 (amino acid sequence (EAAAK)₃) Kinetic analysis of the fusion proteins ADH-R3-NOX and NOX-R3-ADH showed that the protein fusion reduced the affinity of ADH and NOX for the coenzyme and that the catalytic specificity constant k_cat/K_mAll decrease.

Replacement of the linker peptide with R2 (amino acid sequence (EAAAK)₂) Thereafter, for the case where NOx is merged at the C-terminus of the ADH, i.e., ADH-R2-NOx, the ADH portion is for NAD⁺The affinity of the NOX moiety and the affinity of the NADH moiety were improved compared to that of the linker peptide R3. ADH-R2-catalytic specificity constant k for the ADH portion to the NOx portion of NOX_cat/K_mThe values are all different from those of the connecting peptide R3The degree was increased (ratio of 46% to 28%, respectively), and in particular, the value was also increased (ratio of 23% to 8%, respectively) compared to the single enzyme.

Replacement of the linker peptide with R2 (amino acid sequence (EAAAK)₂) Thereafter, in the case where NOx is merged at the N-terminal of the ADH, the catalytic specificity constant k of the ADH portion to the NOx portion in the NOx-R2-ADH_cat/K_mThe values were also improved to different degrees (60% and 35%, respectively) compared to the linker peptide R3.

In conclusion, the application of the connecting peptide R2 has obvious effect on improving the catalytic property of the fusion protein.

EXAMPLE 4 coenzyme regeneration of fusion proteins and their isoactive monoenzyme Mixed System

The total volume of the coenzyme regeneration system was 0.18ml, and the buffer solution was 50mM Gly-NaOH buffer solution (pH9.0) containing 20mM (RS) -1-phenylethyl alcohol, 100mM NaCl, 0.05mM NAD⁺0.17mM FAD, and a proper amount of enzyme solution (the enzyme solution is fusion protein or an isoactive single-enzyme mixed system of the fusion protein). The coenzyme regeneration reaction is schematically shown in FIG. 3, the reaction temperature is 40 ℃, the reaction is terminated after 1 hour, the reaction solution is extracted by ethyl acetate, and the analysis is carried out by gas chromatography (GC-2010plus, Shimazu, Kyoto, Japan), the gas chromatography column is CP-Chirasil-DEX CB (Varian, USA), the carrier gas is helium, the detector is a hydrogen Flame Ion Detector (FID), the detector temperature is 250 ℃, the injection port SPL temperature is 220 ℃, the column incubator temperature is 100 ℃, and the retention times of (R) -1-phenylethyl alcohol and (S) -1-phenylethyl alcohol are 4.94min and 5.60min respectively.

According to the results of example 3, when NOX is fused at the C-terminal of ADH, the use of the linker peptide R2 significantly improves the kinetic properties of the fusion protein, and therefore the coenzyme regeneration reaction employs the fusion protein ADH-R2-NOX system and uses the ADH-R3-NOX system, and the fusion proteins ADH-R2-NOX, ADH-R3-NOX and the single-enzyme mixed systems of their respective isoactive TkADH and TkNOX are compared in terms of coenzyme regeneration efficiency by the above-mentioned method, and the Total Number of conversions (Total Turnover Number, TTN) of the reaction system, i.e., the Number of moles of 1-phenylethyl alcohol converted per mole of coenzyme initially added is calculated, and the results are shown in table 4. The isoactive monoenzyme mixture in Table 4 is a mixture of isoactive monoenzymes in Table 4, and is similarly the same as the isoactive monoenzyme mixture in ADH-R3-NOX in Table 4, except that the amounts of the proteins of the monoenzymes TkADH and TkNOX are adjusted so that the activities thereof are equal to the activities of ADH and NOX in the respective ADH-R2-NOX or ADH-R3-NOX fusion proteins, respectively, under the condition that the amounts of the respective fusion proteins (ADH-R2-NOX or ADH-R3-NOX) are fixed, and that the activities of ADH and NOX in the fusion proteins are determined, for example, ADH-R2-NOX, and then the activities of the monoenzyme having the activity equal to the ADH moiety in the fusion proteins ADH-R2-NOX and the monoenzyme having the activity equal to the NOX moiety in the fusion proteins ADH-R2-NOX are added.

TABLE 4 comparison of coenzyme regeneration efficiency of fusion proteins and their isoactive single-enzyme mixed systems

Fusion proteins	Fusion protein system TTN	Equal activity single enzyme mixed system TTN	Ratio ofa(％)
				ADH-R2-NOX	87.2±1.1	57.0±0.4	153±2
ADH-R3-NOX	43.6±0.4	55.5±0.8	79±1

a ratio of TTN in fusion protein system/TTN in corresponding isoactive single-enzyme mixed system

As can be seen from the results in Table 4, ADH-R2-NOX has an increased coenzyme regeneration efficiency of 53% over the equivalent activity single enzyme mixed system, which may be due to the proximity of the active sites of the proteins by suitable linker peptides, an increased local coenzyme concentration and thus a higher apparent activity of both proteins. When the connecting peptide is R3, the coenzyme regeneration efficiency of the ADH-R3-NOX is slightly reduced compared with that of an active single-enzyme mixed system, and the length control of the connecting peptide plays an important role in the coenzyme circulation efficiency between two enzymes.

Example 5 application of fusion protein to production of chiral aryl Secondary alcohol

ADH-R2-NOX has higher cycle efficiency of oxidized coenzyme compared with the active single-enzyme mixed system, and is further applied to the production of chiral alcohol. The total volume of the reaction system was 1.2ml, and the buffer was 50mM Gly-NaOH buffer (pH9.0) containing 20mM (RS) -1-phenylethyl alcohol, 100mM NaCl, 0.2mM NAD⁺0.17mM FAD, and a proper amount of fusion protease solution, and the reaction scheme is shown in FIG. 3. The reaction temperature is 40 ℃, and the total reaction time is 8 h. The reaction was carried out in 15ml capped tubes and the samples taken in triplicate were placed in an air bath shaker at 150 rpm. After a suitable reaction time, 100. mu.l of the reaction solution was quickly taken out from the test tube and placed on ice, and the reaction solution was extracted with ethyl acetate and subjected to gas chromatography analysis under the same conditions as those in example 4. The curves of the conversion rates of (S) -1-phenylethyl alcohol and (R) -1-phenylethyl alcohol with respect to time during the reaction are shown in FIG. 4.

As can be seen from FIG. 4, with the ADH-R2-NOX fusion protein system, the conversion rate of (S) -1-phenylethyl alcohol was 100% after 8 hours of reaction, but (R) -1-phenylethyl alcohol was not consumed, i.e., 20mM of (RS) -1-phenylethyl alcohol achieved complete resolution, and (R) -1-phenylethyl alcohol with enantiomeric excess (ee) of > 99.8% was produced, i.e., high-efficiency preparation of optically active aryl secondary alcohol by a single enzyme was achieved.

In conclusion, the connecting peptide provided by the invention can be used for molecular modification of fusion protein. The alcohol dehydrogenase and the NAD (P) H oxidase are fused by the connecting peptide, so that the activity of the alcohol dehydrogenase and the NAD (P) H oxidase is improved, the catalytic property of the two enzymes is improved, the distance between the two enzymes is reasonably controlled by the length adjustment of the connecting peptide, and the coenzyme circulation efficiency is improved. The fusion protein is further used for catalyzing the kinetic resolution of a mixture containing the (R) -secondary alcohol and the (S) -secondary alcohol to prepare the optically pure chiral alcohol.

The foregoing is directed to preferred embodiments of the present invention, other and further embodiments of the invention may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow. However, any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present invention are within the protection scope of the technical solution of the present invention.

SEQUENCE LISTING

<110> institute of standardization of China

<120> linker peptide, fusion protein containing linker peptide and use thereof

<130> TPD01333

<160> 44

<170> PatentIn version 3.5

<210> 1

<211> 3

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 1

Ala Ala Ala

1

<210> 2

<211> 5

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 2

Glu Ala Ala Ala Lys

1 5

<210> 3

<211> 10

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 3

Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys

1 5 10

<210> 4

<211> 15

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 4

Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys

1 5 10 15

<210> 5

<211> 9

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 5

gcggccgcg 9

<210> 6

<211> 15

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 6

gaagcggccg cgaaa 15

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 7

gaagccgcgg cgaaagaagc ggccgcgaaa 30

<210> 8

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 8

gaagccgcgg cgaaagaagc ggccgcgaaa gaagccgcgg cgaaa 45

<210> 9

<211> 720

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 9

Met Lys Lys Val Arg Ile Phe Asn Asp Leu Lys Trp Ile Gly Asp Asp

1 5 10 15

Lys Val Thr Ala Ile Gly Met Gly Thr Trp Gly Ile Gly Gly Tyr Glu

20 25 30

Ser Pro Asp Tyr Ser Lys Asp Asn Glu Ser Val Glu Val Leu Arg His

35 40 45

Gly Leu Glu Leu Gly Ile Asn Leu Ile Asp Thr Ala Glu Phe Tyr Gly

50 55 60

Ala Gly His Ser Glu Glu Leu Val Gly Glu Ala Ile Lys Glu Phe Glu

65 70 75 80

Arg Asp Asp Ile Phe Ile Ile Ser Lys Val Trp Pro Thr His Phe Gly

85 90 95

Tyr Glu Glu Ala Lys Arg Ala Ala Arg Ala Ser Ala Lys Arg Leu Gly

100 105 110

Thr Tyr Ile Asp Leu Tyr Leu Leu His Trp Pro Gly Asp Ser Trp Glu

115 120 125

Lys Ile Lys Glu Thr Leu His Ala Leu Glu Glu Leu Val Asp Glu Gly

130 135 140

Leu Ile Arg Tyr Ile Gly Val Ser Asn Phe Asp Leu Glu Leu Leu Lys

145 150 155 160

Arg Ser Gln Glu Ala Met Lys Lys Tyr Glu Ile Val Ala Asn Glu Val

165 170 175

Lys Tyr Ser Leu Lys Asp Arg Trp Pro Glu Thr Thr Gly Leu Leu Asp

180 185 190

Tyr Met Lys Arg Glu Gly Ile Ala Leu Ile Ala Tyr Thr Pro Leu Glu

195 200 205

Lys Gly Thr Leu Ala Arg Asn Glu Cys Leu Ala Glu Ile Gly Lys Lys

210 215 220

Tyr Gly Lys Thr Ala Ala Gln Val Ala Leu Asn Tyr Leu Ile Trp Glu

225 230 235 240

Glu Asn Val Ile Ala Ile Pro Lys Ala Gly Asn Lys Ala His Leu Glu

245 250 255

Glu Asn Phe Gly Ala Met Gly Trp Arg Leu Ser Lys Glu Asp Arg Glu

260 265 270

Asn Ala Arg Gly Cys Val Ala Ala Ala Met Lys Ile Val Val Val Gly

275 280 285

Ser Gly Thr Ala Gly Ser Asn Phe Ala Leu Phe Met Arg Lys Leu Asp

290 295 300

Arg Lys Ala Glu Ile Thr Val Ile Gly Lys Glu Pro Thr Met Gln Tyr

305 310 315 320

Ser Pro Cys Ala Leu Pro His Val Val Ser Gly Thr Ile Glu Lys Pro

325 330 335

Glu Asp Ile Ile Val Phe Pro Asn Glu Phe Tyr Glu Lys Gln Lys Ile

340 345 350

Asn Leu Met Leu Asn Thr Glu Ala Lys Ala Ile Asp Arg Glu Arg Lys

355 360 365

Val Val Val Thr Asp Lys Gly Glu Val Pro Tyr Asp Lys Leu Val Leu

370 375 380

Ala Val Gly Ser Lys Ala Phe Ile Pro Pro Ile Lys Gly Val Glu Asn

385 390 395 400

Glu Gly Val Phe Thr Leu Lys Ser Leu Asp Asp Val Arg Arg Ile Lys

405 410 415

Ala Tyr Ile Ala Glu Arg Lys Pro Lys Lys Ala Val Val Ile Gly Ala

420 425 430

Gly Leu Ile Gly Leu Glu Gly Ala Glu Ala Phe Ala Lys Leu Gly Met

435 440 445

Glu Val Leu Ile Val Glu Leu Met Asp Arg Leu Met Pro Thr Met Leu

450 455 460

Asp Lys Asp Thr Ala Lys Leu Val Gln Ala Glu Met Glu Lys Tyr Gly

465 470 475 480

Val Ser Phe Arg Phe Gly Val Gly Val Ser Glu Ile Ile Gly Ser Pro

485 490 495

Val Arg Ala Val Lys Ile Gly Asp Glu Glu Val Pro Ala Asp Leu Val

500 505 510

Leu Val Ala Thr Gly Val Arg Ala Asn Thr Asp Leu Ala Lys Gln Ala

515 520 525

Gly Leu Glu Val Asn Arg Gly Ile Val Val Asn Glu His Leu Gln Thr

530 535 540

Ser Asp Pro Glu Val Tyr Ala Ile Gly Asp Cys Ala Glu Val Ile Asp

545 550 555 560

Ala Val Thr Gly Lys Arg Thr Leu Ser Gln Leu Gly Thr Ser Ala Val

565 570 575

Arg Met Ala Lys Val Ala Ala Glu His Ile Ala Gly Lys Asp Val Ser

580 585 590

Phe Arg Pro Val Phe Asn Thr Ala Ile Thr Glu Leu Phe Gly Leu Glu

595 600 605

Ile Gly Thr Phe Gly Ile Thr Glu Glu Arg Ala Lys Lys Glu Asp Ile

610 615 620

Glu Val Ala Val Gly Lys Phe Lys Gly Ser Thr Lys Pro Glu Tyr Tyr

625 630 635 640

Pro Gly Gly Lys Pro Ile Thr Val Lys Leu Ile Phe Arg Lys Ser Asp

645 650 655

Arg Lys Leu Ile Gly Gly Gln Ile Val Gly Gly Glu Arg Val Trp Gly

660 665 670

Arg Ile Met Thr Leu Ser Ala Leu Ala Gln Lys Gly Ala Thr Val Glu

675 680 685

Asp Val Ala Tyr Leu Glu Thr Ala Tyr Ala Pro Pro Ile Ser Pro Thr

690 695 700

Ile Asp Pro Ile Thr Val Ala Ala Glu Met Ala Gln Arg Lys Leu Arg

705 710 715 720

<210> 10

<211> 722

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 10

Met Lys Lys Val Arg Ile Phe Asn Asp Leu Lys Trp Ile Gly Asp Asp

1 5 10 15

Lys Val Thr Ala Ile Gly Met Gly Thr Trp Gly Ile Gly Gly Tyr Glu

20 25 30

Ser Pro Asp Tyr Ser Lys Asp Asn Glu Ser Val Glu Val Leu Arg His

35 40 45

Gly Leu Glu Leu Gly Ile Asn Leu Ile Asp Thr Ala Glu Phe Tyr Gly

50 55 60

Ala Gly His Ser Glu Glu Leu Val Gly Glu Ala Ile Lys Glu Phe Glu

65 70 75 80

Arg Asp Asp Ile Phe Ile Ile Ser Lys Val Trp Pro Thr His Phe Gly

85 90 95

Tyr Glu Glu Ala Lys Arg Ala Ala Arg Ala Ser Ala Lys Arg Leu Gly

100 105 110

Thr Tyr Ile Asp Leu Tyr Leu Leu His Trp Pro Gly Asp Ser Trp Glu

115 120 125

Lys Ile Lys Glu Thr Leu His Ala Leu Glu Glu Leu Val Asp Glu Gly

130 135 140

Leu Ile Arg Tyr Ile Gly Val Ser Asn Phe Asp Leu Glu Leu Leu Lys

145 150 155 160

Arg Ser Gln Glu Ala Met Lys Lys Tyr Glu Ile Val Ala Asn Glu Val

165 170 175

Lys Tyr Ser Leu Lys Asp Arg Trp Pro Glu Thr Thr Gly Leu Leu Asp

180 185 190

Tyr Met Lys Arg Glu Gly Ile Ala Leu Ile Ala Tyr Thr Pro Leu Glu

195 200 205

Lys Gly Thr Leu Ala Arg Asn Glu Cys Leu Ala Glu Ile Gly Lys Lys

210 215 220

Tyr Gly Lys Thr Ala Ala Gln Val Ala Leu Asn Tyr Leu Ile Trp Glu

225 230 235 240

Glu Asn Val Ile Ala Ile Pro Lys Ala Gly Asn Lys Ala His Leu Glu

245 250 255

Glu Asn Phe Gly Ala Met Gly Trp Arg Leu Ser Lys Glu Asp Arg Glu

260 265 270

Asn Ala Arg Gly Cys Val Glu Ala Ala Ala Lys Met Lys Ile Val Val

275 280 285

Val Gly Ser Gly Thr Ala Gly Ser Asn Phe Ala Leu Phe Met Arg Lys

290 295 300

Leu Asp Arg Lys Ala Glu Ile Thr Val Ile Gly Lys Glu Pro Thr Met

305 310 315 320

Gln Tyr Ser Pro Cys Ala Leu Pro His Val Val Ser Gly Thr Ile Glu

325 330 335

Lys Pro Glu Asp Ile Ile Val Phe Pro Asn Glu Phe Tyr Glu Lys Gln

340 345 350

Lys Ile Asn Leu Met Leu Asn Thr Glu Ala Lys Ala Ile Asp Arg Glu

355 360 365

Arg Lys Val Val Val Thr Asp Lys Gly Glu Val Pro Tyr Asp Lys Leu

370 375 380

Val Leu Ala Val Gly Ser Lys Ala Phe Ile Pro Pro Ile Lys Gly Val

385 390 395 400

Glu Asn Glu Gly Val Phe Thr Leu Lys Ser Leu Asp Asp Val Arg Arg

405 410 415

Ile Lys Ala Tyr Ile Ala Glu Arg Lys Pro Lys Lys Ala Val Val Ile

420 425 430

Gly Ala Gly Leu Ile Gly Leu Glu Gly Ala Glu Ala Phe Ala Lys Leu

435 440 445

Gly Met Glu Val Leu Ile Val Glu Leu Met Asp Arg Leu Met Pro Thr

450 455 460

Met Leu Asp Lys Asp Thr Ala Lys Leu Val Gln Ala Glu Met Glu Lys

465 470 475 480

Tyr Gly Val Ser Phe Arg Phe Gly Val Gly Val Ser Glu Ile Ile Gly

485 490 495

Ser Pro Val Arg Ala Val Lys Ile Gly Asp Glu Glu Val Pro Ala Asp

500 505 510

Leu Val Leu Val Ala Thr Gly Val Arg Ala Asn Thr Asp Leu Ala Lys

515 520 525

Gln Ala Gly Leu Glu Val Asn Arg Gly Ile Val Val Asn Glu His Leu

530 535 540

Gln Thr Ser Asp Pro Glu Val Tyr Ala Ile Gly Asp Cys Ala Glu Val

545 550 555 560

Ile Asp Ala Val Thr Gly Lys Arg Thr Leu Ser Gln Leu Gly Thr Ser

565 570 575

Ala Val Arg Met Ala Lys Val Ala Ala Glu His Ile Ala Gly Lys Asp

580 585 590

Val Ser Phe Arg Pro Val Phe Asn Thr Ala Ile Thr Glu Leu Phe Gly

595 600 605

Leu Glu Ile Gly Thr Phe Gly Ile Thr Glu Glu Arg Ala Lys Lys Glu

610 615 620

Asp Ile Glu Val Ala Val Gly Lys Phe Lys Gly Ser Thr Lys Pro Glu

625 630 635 640

Tyr Tyr Pro Gly Gly Lys Pro Ile Thr Val Lys Leu Ile Phe Arg Lys

645 650 655

Ser Asp Arg Lys Leu Ile Gly Gly Gln Ile Val Gly Gly Glu Arg Val

660 665 670

Trp Gly Arg Ile Met Thr Leu Ser Ala Leu Ala Gln Lys Gly Ala Thr

675 680 685

Val Glu Asp Val Ala Tyr Leu Glu Thr Ala Tyr Ala Pro Pro Ile Ser

690 695 700

Pro Thr Ile Asp Pro Ile Thr Val Ala Ala Glu Met Ala Gln Arg Lys

705 710 715 720

Leu Arg

<210> 11

<211> 727

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 11

Met Lys Lys Val Arg Ile Phe Asn Asp Leu Lys Trp Ile Gly Asp Asp

1 5 10 15

Lys Val Thr Ala Ile Gly Met Gly Thr Trp Gly Ile Gly Gly Tyr Glu

20 25 30

Ser Pro Asp Tyr Ser Lys Asp Asn Glu Ser Val Glu Val Leu Arg His

35 40 45

Gly Leu Glu Leu Gly Ile Asn Leu Ile Asp Thr Ala Glu Phe Tyr Gly

50 55 60

Ala Gly His Ser Glu Glu Leu Val Gly Glu Ala Ile Lys Glu Phe Glu

65 70 75 80

Arg Asp Asp Ile Phe Ile Ile Ser Lys Val Trp Pro Thr His Phe Gly

85 90 95

Tyr Glu Glu Ala Lys Arg Ala Ala Arg Ala Ser Ala Lys Arg Leu Gly

100 105 110

Thr Tyr Ile Asp Leu Tyr Leu Leu His Trp Pro Gly Asp Ser Trp Glu

115 120 125

Lys Ile Lys Glu Thr Leu His Ala Leu Glu Glu Leu Val Asp Glu Gly

130 135 140

Leu Ile Arg Tyr Ile Gly Val Ser Asn Phe Asp Leu Glu Leu Leu Lys

145 150 155 160

Arg Ser Gln Glu Ala Met Lys Lys Tyr Glu Ile Val Ala Asn Glu Val

165 170 175

Lys Tyr Ser Leu Lys Asp Arg Trp Pro Glu Thr Thr Gly Leu Leu Asp

180 185 190

Tyr Met Lys Arg Glu Gly Ile Ala Leu Ile Ala Tyr Thr Pro Leu Glu

195 200 205

Lys Gly Thr Leu Ala Arg Asn Glu Cys Leu Ala Glu Ile Gly Lys Lys

210 215 220

Tyr Gly Lys Thr Ala Ala Gln Val Ala Leu Asn Tyr Leu Ile Trp Glu

225 230 235 240

Glu Asn Val Ile Ala Ile Pro Lys Ala Gly Asn Lys Ala His Leu Glu

245 250 255

Glu Asn Phe Gly Ala Met Gly Trp Arg Leu Ser Lys Glu Asp Arg Glu

260 265 270

Asn Ala Arg Gly Cys Val Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys

275 280 285

Met Lys Ile Val Val Val Gly Ser Gly Thr Ala Gly Ser Asn Phe Ala

290 295 300

Leu Phe Met Arg Lys Leu Asp Arg Lys Ala Glu Ile Thr Val Ile Gly

305 310 315 320

Lys Glu Pro Thr Met Gln Tyr Ser Pro Cys Ala Leu Pro His Val Val

325 330 335

Ser Gly Thr Ile Glu Lys Pro Glu Asp Ile Ile Val Phe Pro Asn Glu

340 345 350

Phe Tyr Glu Lys Gln Lys Ile Asn Leu Met Leu Asn Thr Glu Ala Lys

355 360 365

Ala Ile Asp Arg Glu Arg Lys Val Val Val Thr Asp Lys Gly Glu Val

370 375 380

Pro Tyr Asp Lys Leu Val Leu Ala Val Gly Ser Lys Ala Phe Ile Pro

385 390 395 400

Pro Ile Lys Gly Val Glu Asn Glu Gly Val Phe Thr Leu Lys Ser Leu

405 410 415

Asp Asp Val Arg Arg Ile Lys Ala Tyr Ile Ala Glu Arg Lys Pro Lys

420 425 430

Lys Ala Val Val Ile Gly Ala Gly Leu Ile Gly Leu Glu Gly Ala Glu

435 440 445

Ala Phe Ala Lys Leu Gly Met Glu Val Leu Ile Val Glu Leu Met Asp

450 455 460

Arg Leu Met Pro Thr Met Leu Asp Lys Asp Thr Ala Lys Leu Val Gln

465 470 475 480

Ala Glu Met Glu Lys Tyr Gly Val Ser Phe Arg Phe Gly Val Gly Val

485 490 495

Ser Glu Ile Ile Gly Ser Pro Val Arg Ala Val Lys Ile Gly Asp Glu

500 505 510

Glu Val Pro Ala Asp Leu Val Leu Val Ala Thr Gly Val Arg Ala Asn

515 520 525

Thr Asp Leu Ala Lys Gln Ala Gly Leu Glu Val Asn Arg Gly Ile Val

530 535 540

Val Asn Glu His Leu Gln Thr Ser Asp Pro Glu Val Tyr Ala Ile Gly

545 550 555 560

Asp Cys Ala Glu Val Ile Asp Ala Val Thr Gly Lys Arg Thr Leu Ser

565 570 575

Gln Leu Gly Thr Ser Ala Val Arg Met Ala Lys Val Ala Ala Glu His

580 585 590

Ile Ala Gly Lys Asp Val Ser Phe Arg Pro Val Phe Asn Thr Ala Ile

595 600 605

Thr Glu Leu Phe Gly Leu Glu Ile Gly Thr Phe Gly Ile Thr Glu Glu

610 615 620

Arg Ala Lys Lys Glu Asp Ile Glu Val Ala Val Gly Lys Phe Lys Gly

625 630 635 640

Ser Thr Lys Pro Glu Tyr Tyr Pro Gly Gly Lys Pro Ile Thr Val Lys

645 650 655

Leu Ile Phe Arg Lys Ser Asp Arg Lys Leu Ile Gly Gly Gln Ile Val

660 665 670

Gly Gly Glu Arg Val Trp Gly Arg Ile Met Thr Leu Ser Ala Leu Ala

675 680 685

Gln Lys Gly Ala Thr Val Glu Asp Val Ala Tyr Leu Glu Thr Ala Tyr

690 695 700

Ala Pro Pro Ile Ser Pro Thr Ile Asp Pro Ile Thr Val Ala Ala Glu

705 710 715 720

Met Ala Gln Arg Lys Leu Arg

725

<210> 12

<211> 732

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 12

Met Lys Lys Val Arg Ile Phe Asn Asp Leu Lys Trp Ile Gly Asp Asp

1 5 10 15

Lys Val Thr Ala Ile Gly Met Gly Thr Trp Gly Ile Gly Gly Tyr Glu

20 25 30

Ser Pro Asp Tyr Ser Lys Asp Asn Glu Ser Val Glu Val Leu Arg His

35 40 45

Gly Leu Glu Leu Gly Ile Asn Leu Ile Asp Thr Ala Glu Phe Tyr Gly

50 55 60

Ala Gly His Ser Glu Glu Leu Val Gly Glu Ala Ile Lys Glu Phe Glu

65 70 75 80

Arg Asp Asp Ile Phe Ile Ile Ser Lys Val Trp Pro Thr His Phe Gly

85 90 95

Tyr Glu Glu Ala Lys Arg Ala Ala Arg Ala Ser Ala Lys Arg Leu Gly

100 105 110

Thr Tyr Ile Asp Leu Tyr Leu Leu His Trp Pro Gly Asp Ser Trp Glu

115 120 125

Lys Ile Lys Glu Thr Leu His Ala Leu Glu Glu Leu Val Asp Glu Gly

130 135 140

Leu Ile Arg Tyr Ile Gly Val Ser Asn Phe Asp Leu Glu Leu Leu Lys

145 150 155 160

Arg Ser Gln Glu Ala Met Lys Lys Tyr Glu Ile Val Ala Asn Glu Val

165 170 175

Lys Tyr Ser Leu Lys Asp Arg Trp Pro Glu Thr Thr Gly Leu Leu Asp

180 185 190

Tyr Met Lys Arg Glu Gly Ile Ala Leu Ile Ala Tyr Thr Pro Leu Glu

195 200 205

Lys Gly Thr Leu Ala Arg Asn Glu Cys Leu Ala Glu Ile Gly Lys Lys

210 215 220

Tyr Gly Lys Thr Ala Ala Gln Val Ala Leu Asn Tyr Leu Ile Trp Glu

225 230 235 240

Glu Asn Val Ile Ala Ile Pro Lys Ala Gly Asn Lys Ala His Leu Glu

245 250 255

Glu Asn Phe Gly Ala Met Gly Trp Arg Leu Ser Lys Glu Asp Arg Glu

260 265 270

Asn Ala Arg Gly Cys Val Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys

275 280 285

Glu Ala Ala Ala Lys Met Lys Ile Val Val Val Gly Ser Gly Thr Ala

290 295 300

Gly Ser Asn Phe Ala Leu Phe Met Arg Lys Leu Asp Arg Lys Ala Glu

305 310 315 320

Ile Thr Val Ile Gly Lys Glu Pro Thr Met Gln Tyr Ser Pro Cys Ala

325 330 335

Leu Pro His Val Val Ser Gly Thr Ile Glu Lys Pro Glu Asp Ile Ile

340 345 350

Val Phe Pro Asn Glu Phe Tyr Glu Lys Gln Lys Ile Asn Leu Met Leu

355 360 365

Asn Thr Glu Ala Lys Ala Ile Asp Arg Glu Arg Lys Val Val Val Thr

370 375 380

Asp Lys Gly Glu Val Pro Tyr Asp Lys Leu Val Leu Ala Val Gly Ser

385 390 395 400

Lys Ala Phe Ile Pro Pro Ile Lys Gly Val Glu Asn Glu Gly Val Phe

405 410 415

Thr Leu Lys Ser Leu Asp Asp Val Arg Arg Ile Lys Ala Tyr Ile Ala

420 425 430

Glu Arg Lys Pro Lys Lys Ala Val Val Ile Gly Ala Gly Leu Ile Gly

435 440 445

Leu Glu Gly Ala Glu Ala Phe Ala Lys Leu Gly Met Glu Val Leu Ile

450 455 460

Val Glu Leu Met Asp Arg Leu Met Pro Thr Met Leu Asp Lys Asp Thr

465 470 475 480

Ala Lys Leu Val Gln Ala Glu Met Glu Lys Tyr Gly Val Ser Phe Arg

485 490 495

Phe Gly Val Gly Val Ser Glu Ile Ile Gly Ser Pro Val Arg Ala Val

500 505 510

Lys Ile Gly Asp Glu Glu Val Pro Ala Asp Leu Val Leu Val Ala Thr

515 520 525

Gly Val Arg Ala Asn Thr Asp Leu Ala Lys Gln Ala Gly Leu Glu Val

530 535 540

Asn Arg Gly Ile Val Val Asn Glu His Leu Gln Thr Ser Asp Pro Glu

545 550 555 560

Val Tyr Ala Ile Gly Asp Cys Ala Glu Val Ile Asp Ala Val Thr Gly

565 570 575

Lys Arg Thr Leu Ser Gln Leu Gly Thr Ser Ala Val Arg Met Ala Lys

580 585 590

Val Ala Ala Glu His Ile Ala Gly Lys Asp Val Ser Phe Arg Pro Val

595 600 605

Phe Asn Thr Ala Ile Thr Glu Leu Phe Gly Leu Glu Ile Gly Thr Phe

610 615 620

Gly Ile Thr Glu Glu Arg Ala Lys Lys Glu Asp Ile Glu Val Ala Val

625 630 635 640

Gly Lys Phe Lys Gly Ser Thr Lys Pro Glu Tyr Tyr Pro Gly Gly Lys

645 650 655

Pro Ile Thr Val Lys Leu Ile Phe Arg Lys Ser Asp Arg Lys Leu Ile

660 665 670

Gly Gly Gln Ile Val Gly Gly Glu Arg Val Trp Gly Arg Ile Met Thr

675 680 685

Leu Ser Ala Leu Ala Gln Lys Gly Ala Thr Val Glu Asp Val Ala Tyr

690 695 700

Leu Glu Thr Ala Tyr Ala Pro Pro Ile Ser Pro Thr Ile Asp Pro Ile

705 710 715 720

Thr Val Ala Ala Glu Met Ala Gln Arg Lys Leu Arg

725 730

<210> 13

<211> 720

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 13

Met Lys Ile Val Val Val Gly Ser Gly Thr Ala Gly Ser Asn Phe Ala

1 5 10 15

Leu Phe Met Arg Lys Leu Asp Arg Lys Ala Glu Ile Thr Val Ile Gly

20 25 30

Lys Glu Pro Thr Met Gln Tyr Ser Pro Cys Ala Leu Pro His Val Val

35 40 45

Ser Gly Thr Ile Glu Lys Pro Glu Asp Ile Ile Val Phe Pro Asn Glu

50 55 60

Phe Tyr Glu Lys Gln Lys Ile Asn Leu Met Leu Asn Thr Glu Ala Lys

65 70 75 80

Ala Ile Asp Arg Glu Arg Lys Val Val Val Thr Asp Lys Gly Glu Val

85 90 95

Pro Tyr Asp Lys Leu Val Leu Ala Val Gly Ser Lys Ala Phe Ile Pro

100 105 110

Pro Ile Lys Gly Val Glu Asn Glu Gly Val Phe Thr Leu Lys Ser Leu

115 120 125

Asp Asp Val Arg Arg Ile Lys Ala Tyr Ile Ala Glu Arg Lys Pro Lys

130 135 140

Lys Ala Val Val Ile Gly Ala Gly Leu Ile Gly Leu Glu Gly Ala Glu

145 150 155 160

Ala Phe Ala Lys Leu Gly Met Glu Val Leu Ile Val Glu Leu Met Asp

165 170 175

Arg Leu Met Pro Thr Met Leu Asp Lys Asp Thr Ala Lys Leu Val Gln

180 185 190

Ala Glu Met Glu Lys Tyr Gly Val Ser Phe Arg Phe Gly Val Gly Val

195 200 205

Ser Glu Ile Ile Gly Ser Pro Val Arg Ala Val Lys Ile Gly Asp Glu

210 215 220

Glu Val Pro Ala Asp Leu Val Leu Val Ala Thr Gly Val Arg Ala Asn

225 230 235 240

Thr Asp Leu Ala Lys Gln Ala Gly Leu Glu Val Asn Arg Gly Ile Val

245 250 255

Val Asn Glu His Leu Gln Thr Ser Asp Pro Glu Val Tyr Ala Ile Gly

260 265 270

Asp Cys Ala Glu Val Ile Asp Ala Val Thr Gly Lys Arg Thr Leu Ser

275 280 285

Gln Leu Gly Thr Ser Ala Val Arg Met Ala Lys Val Ala Ala Glu His

290 295 300

Ile Ala Gly Lys Asp Val Ser Phe Arg Pro Val Phe Asn Thr Ala Ile

305 310 315 320

Thr Glu Leu Phe Gly Leu Glu Ile Gly Thr Phe Gly Ile Thr Glu Glu

325 330 335

Arg Ala Lys Lys Glu Asp Ile Glu Val Ala Val Gly Lys Phe Lys Gly

340 345 350

Ser Thr Lys Pro Glu Tyr Tyr Pro Gly Gly Lys Pro Ile Thr Val Lys

355 360 365

Leu Ile Phe Arg Lys Ser Asp Arg Lys Leu Ile Gly Gly Gln Ile Val

370 375 380

Gly Gly Glu Arg Val Trp Gly Arg Ile Met Thr Leu Ser Ala Leu Ala

385 390 395 400

Gln Lys Gly Ala Thr Val Glu Asp Val Ala Tyr Leu Glu Thr Ala Tyr

405 410 415

Ala Pro Pro Ile Ser Pro Thr Ile Asp Pro Ile Thr Val Ala Ala Glu

420 425 430

Met Ala Gln Arg Lys Leu Arg Ala Ala Ala Met Lys Lys Val Arg Ile

435 440 445

Phe Asn Asp Leu Lys Trp Ile Gly Asp Asp Lys Val Thr Ala Ile Gly

450 455 460

Met Gly Thr Trp Gly Ile Gly Gly Tyr Glu Ser Pro Asp Tyr Ser Lys

465 470 475 480

Asp Asn Glu Ser Val Glu Val Leu Arg His Gly Leu Glu Leu Gly Ile

485 490 495

Asn Leu Ile Asp Thr Ala Glu Phe Tyr Gly Ala Gly His Ser Glu Glu

500 505 510

Leu Val Gly Glu Ala Ile Lys Glu Phe Glu Arg Asp Asp Ile Phe Ile

515 520 525

Ile Ser Lys Val Trp Pro Thr His Phe Gly Tyr Glu Glu Ala Lys Arg

530 535 540

Ala Ala Arg Ala Ser Ala Lys Arg Leu Gly Thr Tyr Ile Asp Leu Tyr

545 550 555 560

Leu Leu His Trp Pro Gly Asp Ser Trp Glu Lys Ile Lys Glu Thr Leu

565 570 575

His Ala Leu Glu Glu Leu Val Asp Glu Gly Leu Ile Arg Tyr Ile Gly

580 585 590

Val Ser Asn Phe Asp Leu Glu Leu Leu Lys Arg Ser Gln Glu Ala Met

595 600 605

Lys Lys Tyr Glu Ile Val Ala Asn Glu Val Lys Tyr Ser Leu Lys Asp

610 615 620

Arg Trp Pro Glu Thr Thr Gly Leu Leu Asp Tyr Met Lys Arg Glu Gly

625 630 635 640

Ile Ala Leu Ile Ala Tyr Thr Pro Leu Glu Lys Gly Thr Leu Ala Arg

645 650 655

Asn Glu Cys Leu Ala Glu Ile Gly Lys Lys Tyr Gly Lys Thr Ala Ala

660 665 670

Gln Val Ala Leu Asn Tyr Leu Ile Trp Glu Glu Asn Val Ile Ala Ile

675 680 685

Pro Lys Ala Gly Asn Lys Ala His Leu Glu Glu Asn Phe Gly Ala Met

690 695 700

Gly Trp Arg Leu Ser Lys Glu Asp Arg Glu Asn Ala Arg Gly Cys Val

705 710 715 720

<210> 14

<211> 722

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 14

Met Lys Ile Val Val Val Gly Ser Gly Thr Ala Gly Ser Asn Phe Ala

1 5 10 15

Leu Phe Met Arg Lys Leu Asp Arg Lys Ala Glu Ile Thr Val Ile Gly

20 25 30

Lys Glu Pro Thr Met Gln Tyr Ser Pro Cys Ala Leu Pro His Val Val

35 40 45

Ser Gly Thr Ile Glu Lys Pro Glu Asp Ile Ile Val Phe Pro Asn Glu

50 55 60

Phe Tyr Glu Lys Gln Lys Ile Asn Leu Met Leu Asn Thr Glu Ala Lys

65 70 75 80

Ala Ile Asp Arg Glu Arg Lys Val Val Val Thr Asp Lys Gly Glu Val

85 90 95

Pro Tyr Asp Lys Leu Val Leu Ala Val Gly Ser Lys Ala Phe Ile Pro

100 105 110

Pro Ile Lys Gly Val Glu Asn Glu Gly Val Phe Thr Leu Lys Ser Leu

115 120 125

Asp Asp Val Arg Arg Ile Lys Ala Tyr Ile Ala Glu Arg Lys Pro Lys

130 135 140

Lys Ala Val Val Ile Gly Ala Gly Leu Ile Gly Leu Glu Gly Ala Glu

145 150 155 160

Ala Phe Ala Lys Leu Gly Met Glu Val Leu Ile Val Glu Leu Met Asp

165 170 175

Arg Leu Met Pro Thr Met Leu Asp Lys Asp Thr Ala Lys Leu Val Gln

180 185 190

Ala Glu Met Glu Lys Tyr Gly Val Ser Phe Arg Phe Gly Val Gly Val

195 200 205

Ser Glu Ile Ile Gly Ser Pro Val Arg Ala Val Lys Ile Gly Asp Glu

210 215 220

Glu Val Pro Ala Asp Leu Val Leu Val Ala Thr Gly Val Arg Ala Asn

225 230 235 240

Thr Asp Leu Ala Lys Gln Ala Gly Leu Glu Val Asn Arg Gly Ile Val

245 250 255

Val Asn Glu His Leu Gln Thr Ser Asp Pro Glu Val Tyr Ala Ile Gly

260 265 270

Asp Cys Ala Glu Val Ile Asp Ala Val Thr Gly Lys Arg Thr Leu Ser

275 280 285

Gln Leu Gly Thr Ser Ala Val Arg Met Ala Lys Val Ala Ala Glu His

290 295 300

Ile Ala Gly Lys Asp Val Ser Phe Arg Pro Val Phe Asn Thr Ala Ile

305 310 315 320

Thr Glu Leu Phe Gly Leu Glu Ile Gly Thr Phe Gly Ile Thr Glu Glu

325 330 335

Arg Ala Lys Lys Glu Asp Ile Glu Val Ala Val Gly Lys Phe Lys Gly

340 345 350

Ser Thr Lys Pro Glu Tyr Tyr Pro Gly Gly Lys Pro Ile Thr Val Lys

355 360 365

Leu Ile Phe Arg Lys Ser Asp Arg Lys Leu Ile Gly Gly Gln Ile Val

370 375 380

Gly Gly Glu Arg Val Trp Gly Arg Ile Met Thr Leu Ser Ala Leu Ala

385 390 395 400

Gln Lys Gly Ala Thr Val Glu Asp Val Ala Tyr Leu Glu Thr Ala Tyr

405 410 415

Ala Pro Pro Ile Ser Pro Thr Ile Asp Pro Ile Thr Val Ala Ala Glu

420 425 430

Met Ala Gln Arg Lys Leu Arg Glu Ala Ala Ala Lys Met Lys Lys Val

435 440 445

Arg Ile Phe Asn Asp Leu Lys Trp Ile Gly Asp Asp Lys Val Thr Ala

450 455 460

Ile Gly Met Gly Thr Trp Gly Ile Gly Gly Tyr Glu Ser Pro Asp Tyr

465 470 475 480

Ser Lys Asp Asn Glu Ser Val Glu Val Leu Arg His Gly Leu Glu Leu

485 490 495

Gly Ile Asn Leu Ile Asp Thr Ala Glu Phe Tyr Gly Ala Gly His Ser

500 505 510

Glu Glu Leu Val Gly Glu Ala Ile Lys Glu Phe Glu Arg Asp Asp Ile

515 520 525

Phe Ile Ile Ser Lys Val Trp Pro Thr His Phe Gly Tyr Glu Glu Ala

530 535 540

Lys Arg Ala Ala Arg Ala Ser Ala Lys Arg Leu Gly Thr Tyr Ile Asp

545 550 555 560

Leu Tyr Leu Leu His Trp Pro Gly Asp Ser Trp Glu Lys Ile Lys Glu

565 570 575

Thr Leu His Ala Leu Glu Glu Leu Val Asp Glu Gly Leu Ile Arg Tyr

580 585 590

Ile Gly Val Ser Asn Phe Asp Leu Glu Leu Leu Lys Arg Ser Gln Glu

595 600 605

Ala Met Lys Lys Tyr Glu Ile Val Ala Asn Glu Val Lys Tyr Ser Leu

610 615 620

Lys Asp Arg Trp Pro Glu Thr Thr Gly Leu Leu Asp Tyr Met Lys Arg

625 630 635 640

Glu Gly Ile Ala Leu Ile Ala Tyr Thr Pro Leu Glu Lys Gly Thr Leu

645 650 655

Ala Arg Asn Glu Cys Leu Ala Glu Ile Gly Lys Lys Tyr Gly Lys Thr

660 665 670

Ala Ala Gln Val Ala Leu Asn Tyr Leu Ile Trp Glu Glu Asn Val Ile

675 680 685

Ala Ile Pro Lys Ala Gly Asn Lys Ala His Leu Glu Glu Asn Phe Gly

690 695 700

Ala Met Gly Trp Arg Leu Ser Lys Glu Asp Arg Glu Asn Ala Arg Gly

705 710 715 720

Cys Val

<210> 15

<211> 727

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 15

Met Lys Ile Val Val Val Gly Ser Gly Thr Ala Gly Ser Asn Phe Ala

1 5 10 15

Leu Phe Met Arg Lys Leu Asp Arg Lys Ala Glu Ile Thr Val Ile Gly

20 25 30

Lys Glu Pro Thr Met Gln Tyr Ser Pro Cys Ala Leu Pro His Val Val

35 40 45

Ser Gly Thr Ile Glu Lys Pro Glu Asp Ile Ile Val Phe Pro Asn Glu

50 55 60

Phe Tyr Glu Lys Gln Lys Ile Asn Leu Met Leu Asn Thr Glu Ala Lys

65 70 75 80

Ala Ile Asp Arg Glu Arg Lys Val Val Val Thr Asp Lys Gly Glu Val

85 90 95

Pro Tyr Asp Lys Leu Val Leu Ala Val Gly Ser Lys Ala Phe Ile Pro

100 105 110

Pro Ile Lys Gly Val Glu Asn Glu Gly Val Phe Thr Leu Lys Ser Leu

115 120 125

Asp Asp Val Arg Arg Ile Lys Ala Tyr Ile Ala Glu Arg Lys Pro Lys

130 135 140

Lys Ala Val Val Ile Gly Ala Gly Leu Ile Gly Leu Glu Gly Ala Glu

145 150 155 160

Ala Phe Ala Lys Leu Gly Met Glu Val Leu Ile Val Glu Leu Met Asp

165 170 175

Arg Leu Met Pro Thr Met Leu Asp Lys Asp Thr Ala Lys Leu Val Gln

180 185 190

Ala Glu Met Glu Lys Tyr Gly Val Ser Phe Arg Phe Gly Val Gly Val

195 200 205

Ser Glu Ile Ile Gly Ser Pro Val Arg Ala Val Lys Ile Gly Asp Glu

210 215 220

Glu Val Pro Ala Asp Leu Val Leu Val Ala Thr Gly Val Arg Ala Asn

225 230 235 240

Thr Asp Leu Ala Lys Gln Ala Gly Leu Glu Val Asn Arg Gly Ile Val

245 250 255

Val Asn Glu His Leu Gln Thr Ser Asp Pro Glu Val Tyr Ala Ile Gly

260 265 270

Asp Cys Ala Glu Val Ile Asp Ala Val Thr Gly Lys Arg Thr Leu Ser

275 280 285

Gln Leu Gly Thr Ser Ala Val Arg Met Ala Lys Val Ala Ala Glu His

290 295 300

Ile Ala Gly Lys Asp Val Ser Phe Arg Pro Val Phe Asn Thr Ala Ile

305 310 315 320

Thr Glu Leu Phe Gly Leu Glu Ile Gly Thr Phe Gly Ile Thr Glu Glu

325 330 335

Arg Ala Lys Lys Glu Asp Ile Glu Val Ala Val Gly Lys Phe Lys Gly

340 345 350

Ser Thr Lys Pro Glu Tyr Tyr Pro Gly Gly Lys Pro Ile Thr Val Lys

355 360 365

Leu Ile Phe Arg Lys Ser Asp Arg Lys Leu Ile Gly Gly Gln Ile Val

370 375 380

Gly Gly Glu Arg Val Trp Gly Arg Ile Met Thr Leu Ser Ala Leu Ala

385 390 395 400

Gln Lys Gly Ala Thr Val Glu Asp Val Ala Tyr Leu Glu Thr Ala Tyr

405 410 415

Ala Pro Pro Ile Ser Pro Thr Ile Asp Pro Ile Thr Val Ala Ala Glu

420 425 430

Met Ala Gln Arg Lys Leu Arg Glu Ala Ala Ala Lys Glu Ala Ala Ala

435 440 445

Lys Met Lys Lys Val Arg Ile Phe Asn Asp Leu Lys Trp Ile Gly Asp

450 455 460

Asp Lys Val Thr Ala Ile Gly Met Gly Thr Trp Gly Ile Gly Gly Tyr

465 470 475 480

Glu Ser Pro Asp Tyr Ser Lys Asp Asn Glu Ser Val Glu Val Leu Arg

485 490 495

His Gly Leu Glu Leu Gly Ile Asn Leu Ile Asp Thr Ala Glu Phe Tyr

500 505 510

Gly Ala Gly His Ser Glu Glu Leu Val Gly Glu Ala Ile Lys Glu Phe

515 520 525

Glu Arg Asp Asp Ile Phe Ile Ile Ser Lys Val Trp Pro Thr His Phe

530 535 540

Gly Tyr Glu Glu Ala Lys Arg Ala Ala Arg Ala Ser Ala Lys Arg Leu

545 550 555 560

Gly Thr Tyr Ile Asp Leu Tyr Leu Leu His Trp Pro Gly Asp Ser Trp

565 570 575

Glu Lys Ile Lys Glu Thr Leu His Ala Leu Glu Glu Leu Val Asp Glu

580 585 590

Gly Leu Ile Arg Tyr Ile Gly Val Ser Asn Phe Asp Leu Glu Leu Leu

595 600 605

Lys Arg Ser Gln Glu Ala Met Lys Lys Tyr Glu Ile Val Ala Asn Glu

610 615 620

Val Lys Tyr Ser Leu Lys Asp Arg Trp Pro Glu Thr Thr Gly Leu Leu

625 630 635 640

Asp Tyr Met Lys Arg Glu Gly Ile Ala Leu Ile Ala Tyr Thr Pro Leu

645 650 655

Glu Lys Gly Thr Leu Ala Arg Asn Glu Cys Leu Ala Glu Ile Gly Lys

660 665 670

Lys Tyr Gly Lys Thr Ala Ala Gln Val Ala Leu Asn Tyr Leu Ile Trp

675 680 685

Glu Glu Asn Val Ile Ala Ile Pro Lys Ala Gly Asn Lys Ala His Leu

690 695 700

Glu Glu Asn Phe Gly Ala Met Gly Trp Arg Leu Ser Lys Glu Asp Arg

705 710 715 720

Glu Asn Ala Arg Gly Cys Val

725

<210> 16

<211> 732

<212> PRT

<213> Artificial Sequence

<220>

<223> Artificial

<400> 16

Met Lys Ile Val Val Val Gly Ser Gly Thr Ala Gly Ser Asn Phe Ala

1 5 10 15

Leu Phe Met Arg Lys Leu Asp Arg Lys Ala Glu Ile Thr Val Ile Gly

20 25 30

Lys Glu Pro Thr Met Gln Tyr Ser Pro Cys Ala Leu Pro His Val Val

35 40 45

Ser Gly Thr Ile Glu Lys Pro Glu Asp Ile Ile Val Phe Pro Asn Glu

50 55 60

Phe Tyr Glu Lys Gln Lys Ile Asn Leu Met Leu Asn Thr Glu Ala Lys

65 70 75 80

Ala Ile Asp Arg Glu Arg Lys Val Val Val Thr Asp Lys Gly Glu Val

85 90 95

Pro Tyr Asp Lys Leu Val Leu Ala Val Gly Ser Lys Ala Phe Ile Pro

100 105 110

Pro Ile Lys Gly Val Glu Asn Glu Gly Val Phe Thr Leu Lys Ser Leu

115 120 125

Asp Asp Val Arg Arg Ile Lys Ala Tyr Ile Ala Glu Arg Lys Pro Lys

130 135 140

Lys Ala Val Val Ile Gly Ala Gly Leu Ile Gly Leu Glu Gly Ala Glu

145 150 155 160

Ala Phe Ala Lys Leu Gly Met Glu Val Leu Ile Val Glu Leu Met Asp

165 170 175

Arg Leu Met Pro Thr Met Leu Asp Lys Asp Thr Ala Lys Leu Val Gln

180 185 190

Ala Glu Met Glu Lys Tyr Gly Val Ser Phe Arg Phe Gly Val Gly Val

195 200 205

Ser Glu Ile Ile Gly Ser Pro Val Arg Ala Val Lys Ile Gly Asp Glu

210 215 220

Glu Val Pro Ala Asp Leu Val Leu Val Ala Thr Gly Val Arg Ala Asn

225 230 235 240

Thr Asp Leu Ala Lys Gln Ala Gly Leu Glu Val Asn Arg Gly Ile Val

245 250 255

Val Asn Glu His Leu Gln Thr Ser Asp Pro Glu Val Tyr Ala Ile Gly

260 265 270

Asp Cys Ala Glu Val Ile Asp Ala Val Thr Gly Lys Arg Thr Leu Ser

275 280 285

Gln Leu Gly Thr Ser Ala Val Arg Met Ala Lys Val Ala Ala Glu His

290 295 300

Ile Ala Gly Lys Asp Val Ser Phe Arg Pro Val Phe Asn Thr Ala Ile

305 310 315 320

Thr Glu Leu Phe Gly Leu Glu Ile Gly Thr Phe Gly Ile Thr Glu Glu

325 330 335

Arg Ala Lys Lys Glu Asp Ile Glu Val Ala Val Gly Lys Phe Lys Gly

340 345 350

Ser Thr Lys Pro Glu Tyr Tyr Pro Gly Gly Lys Pro Ile Thr Val Lys

355 360 365

Leu Ile Phe Arg Lys Ser Asp Arg Lys Leu Ile Gly Gly Gln Ile Val

370 375 380

Gly Gly Glu Arg Val Trp Gly Arg Ile Met Thr Leu Ser Ala Leu Ala

385 390 395 400

Gln Lys Gly Ala Thr Val Glu Asp Val Ala Tyr Leu Glu Thr Ala Tyr

405 410 415

Ala Pro Pro Ile Ser Pro Thr Ile Asp Pro Ile Thr Val Ala Ala Glu

420 425 430

Met Ala Gln Arg Lys Leu Arg Glu Ala Ala Ala Lys Glu Ala Ala Ala

435 440 445

Lys Glu Ala Ala Ala Lys Met Lys Lys Val Arg Ile Phe Asn Asp Leu

450 455 460

Lys Trp Ile Gly Asp Asp Lys Val Thr Ala Ile Gly Met Gly Thr Trp

465 470 475 480

Gly Ile Gly Gly Tyr Glu Ser Pro Asp Tyr Ser Lys Asp Asn Glu Ser

485 490 495

Val Glu Val Leu Arg His Gly Leu Glu Leu Gly Ile Asn Leu Ile Asp

500 505 510

Thr Ala Glu Phe Tyr Gly Ala Gly His Ser Glu Glu Leu Val Gly Glu

515 520 525

Ala Ile Lys Glu Phe Glu Arg Asp Asp Ile Phe Ile Ile Ser Lys Val

530 535 540

Trp Pro Thr His Phe Gly Tyr Glu Glu Ala Lys Arg Ala Ala Arg Ala

545 550 555 560

Ser Ala Lys Arg Leu Gly Thr Tyr Ile Asp Leu Tyr Leu Leu His Trp

565 570 575

Pro Gly Asp Ser Trp Glu Lys Ile Lys Glu Thr Leu His Ala Leu Glu

580 585 590

Glu Leu Val Asp Glu Gly Leu Ile Arg Tyr Ile Gly Val Ser Asn Phe

595 600 605

Asp Leu Glu Leu Leu Lys Arg Ser Gln Glu Ala Met Lys Lys Tyr Glu

610 615 620

Ile Val Ala Asn Glu Val Lys Tyr Ser Leu Lys Asp Arg Trp Pro Glu

625 630 635 640

Thr Thr Gly Leu Leu Asp Tyr Met Lys Arg Glu Gly Ile Ala Leu Ile

645 650 655

Ala Tyr Thr Pro Leu Glu Lys Gly Thr Leu Ala Arg Asn Glu Cys Leu

660 665 670

Ala Glu Ile Gly Lys Lys Tyr Gly Lys Thr Ala Ala Gln Val Ala Leu

675 680 685

Asn Tyr Leu Ile Trp Glu Glu Asn Val Ile Ala Ile Pro Lys Ala Gly

690 695 700

Asn Lys Ala His Leu Glu Glu Asn Phe Gly Ala Met Gly Trp Arg Leu

705 710 715 720

Ser Lys Glu Asp Arg Glu Asn Ala Arg Gly Cys Val

725 730

<210> 17

<211> 2163

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 17

atgaagaagg ttaggatttt taacgacctt aagtggatag gtgacgacaa agttacggcc 60

ataggcatgg gcacgtgggg aataggcggc tacgagagtc cagactattc aaaggataat 120

gagagcgttg aggttctaag gcatggcctc gagctcggaa taaacctcat agacaccgct 180

gagttctacg gggcaggaca ctcggaggag ctcgtaggag aggccataaa ggagttcgag 240

cgcgatgata ttttcatcat cagcaaagtg tggccgacac acttcggcta cgaggaagca 300

aagagggccg caagagcgag cgcaaagaga ctaggcactt atattgacct ttatctcctc 360

cactggcctg gcgacagttg ggagaagatc aaggagacgc tccacgcgct agaggagctc 420

gtcgacgagg ggctgatcag gtacatcggc gtcagcaact tcgacctcga gcttctcaag 480

agaagccagg aggcgatgaa gaagtacgag atagtcgcca acgaggtcaa gtactccctc 540

aaagaccgct ggccagaaac tacaggtctg ctcgactaca tgaagcgtga ggggattgcg 600

ctgatagcct acacgccgct tgaaaaggga accctcgcga gaaacgaatg tttggccgag 660

atcgggaaga aatacggtaa gacagccgct caggttgcgc tcaactacct catctgggag 720

gagaacgtca tagccatccc aaaggctgga aacaaggctc acctagagga gaacttcggt 780

gctatgggat ggagactctc aaaggaggat agagagaacg caagggggtg tgtcgcggcc 840

gcgatgaaaa tcgtcgtggt cggttctgga acagccggaa gcaacttcgc cctcttcatg 900

cgcaagcttg acaggaaggc cgagataacc gtcataggaa aggaaccaac gatgcagtac 960

tccccctgcg ccctgccgca cgtggtaagc ggcactatcg agaagcctga ggacattata 1020

gtctttccca acgagttcta cgagaagcag aagataaacc tcatgctgaa cacggaagca 1080

aaggcgatag acagagaaag gaaggttgta gtcacggata agggcgaagt cccgtacgac 1140

aagcttgttt tggccgttgg ttcaaaggca ttcattccgc cgattaaggg agttgagaac 1200

gagggggtct tcacactcaa gagcctcgac gacgttagga ggataaaagc ctacatagcc 1260

gagagaaagc cgaagaaggc cgtcgttatc ggagctggtc tcatcggcct tgagggcgcc 1320

gaggcctttg caaaacttgg aatggaagtt ctgattgtag agctgatgga caggcttatg 1380

cccacaatgc tcgacaagga cacggcaaag ctcgtccagg ctgagatgga gaagtacggc 1440

gtttccttcc gcttcggcgt cggcgtgagt gagatcatcg gaagccccgt cagggctgtc 1500

aaaataggcg acgaagaagt tcccgcagac ctcgtcttgg ttgcaaccgg ggtgagagcc 1560

aacaccgacc tcgccaaaca ggcagggctt gaagtgaaca ggggcatagt ggttaatgag 1620

cacctccaga cgagcgaccc ggaggtctac gcaataggcg actgtgctga agttatagac 1680

gccgtaactg gaaaaagaac tctcagtcag ctcggaactt ccgccgttag gatggccaag 1740

gtggccgcgg agcacatagc gggtaaggac gtctccttca gaccagtctt caacaccgct 1800

ataaccgagc tgtttggcct tgaaatcggc accttcggaa tcaccgagga gagggcaaag 1860

aaggaggaca tcgaggtagc ggtcggaaag ttcaaaggct cgaccaagcc agagtactat 1920

cccggaggca agcccataac cgtaaagctc atcttcagaa agtcagacag aaagcttatc 1980

ggcggccaga tagtcggcgg cgagagggtc tggggcagga taatgacgct ttctgccctc 2040

gctcaaaaag gcgcaacggt tgaggacgtt gcctacctgg aaacggccta cgccccgccg 2100

ataagtccga ccatagaccc gataacggtc gcggcagaga tggcccagag aaagctccgc 2160

tga 2163

<210> 18

<211> 2169

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 18

atgaagaagg ttaggatttt taacgacctt aagtggatag gtgacgacaa agttacggcc 60

ataggcatgg gcacgtgggg aataggcggc tacgagagtc cagactattc aaaggataat 120

gagagcgttg aggttctaag gcatggcctc gagctcggaa taaacctcat agacaccgct 180

gagttctacg gggcaggaca ctcggaggag ctcgtaggag aggccataaa ggagttcgag 240

cgcgatgata ttttcatcat cagcaaagtg tggccgacac acttcggcta cgaggaagca 300

aagagggccg caagagcgag cgcaaagaga ctaggcactt atattgacct ttatctcctc 360

cactggcctg gcgacagttg ggagaagatc aaggagacgc tccacgcgct agaggagctc 420

gtcgacgagg ggctgatcag gtacatcggc gtcagcaact tcgacctcga gcttctcaag 480

agaagccagg aggcgatgaa gaagtacgag atagtcgcca acgaggtcaa gtactccctc 540

aaagaccgct ggccagaaac tacaggtctg ctcgactaca tgaagcgtga ggggattgcg 600

ctgatagcct acacgccgct tgaaaaggga accctcgcga gaaacgaatg tttggccgag 660

atcgggaaga aatacggtaa gacagccgct caggttgcgc tcaactacct catctgggag 720

gagaacgtca tagccatccc aaaggctgga aacaaggctc acctagagga gaacttcggt 780

gctatgggat ggagactctc aaaggaggat agagagaacg caagggggtg tgtcgaagcg 840

gccgcgaaaa tgaaaatcgt cgtggtcggt tctggaacag ccggaagcaa cttcgccctc 900

ttcatgcgca agcttgacag gaaggccgag ataaccgtca taggaaagga accaacgatg 960

cagtactccc cctgcgccct gccgcacgtg gtaagcggca ctatcgagaa gcctgaggac 1020

attatagtct ttcccaacga gttctacgag aagcagaaga taaacctcat gctgaacacg 1080

gaagcaaagg cgatagacag agaaaggaag gttgtagtca cggataaggg cgaagtcccg 1140

tacgacaagc ttgttttggc cgttggttca aaggcattca ttccgccgat taagggagtt 1200

gagaacgagg gggtcttcac actcaagagc ctcgacgacg ttaggaggat aaaagcctac 1260

atagccgaga gaaagccgaa gaaggccgtc gttatcggag ctggtctcat cggccttgag 1320

ggcgccgagg cctttgcaaa acttggaatg gaagttctga ttgtagagct gatggacagg 1380

cttatgccca caatgctcga caaggacacg gcaaagctcg tccaggctga gatggagaag 1440

tacggcgttt ccttccgctt cggcgtcggc gtgagtgaga tcatcggaag ccccgtcagg 1500

gctgtcaaaa taggcgacga agaagttccc gcagacctcg tcttggttgc aaccggggtg 1560

agagccaaca ccgacctcgc caaacaggca gggcttgaag tgaacagggg catagtggtt 1620

aatgagcacc tccagacgag cgacccggag gtctacgcaa taggcgactg tgctgaagtt 1680

atagacgccg taactggaaa aagaactctc agtcagctcg gaacttccgc cgttaggatg 1740

gccaaggtgg ccgcggagca catagcgggt aaggacgtct ccttcagacc agtcttcaac 1800

accgctataa ccgagctgtt tggccttgaa atcggcacct tcggaatcac cgaggagagg 1860

gcaaagaagg aggacatcga ggtagcggtc ggaaagttca aaggctcgac caagccagag 1920

tactatcccg gaggcaagcc cataaccgta aagctcatct tcagaaagtc agacagaaag 1980

cttatcggcg gccagatagt cggcggcgag agggtctggg gcaggataat gacgctttct 2040

gccctcgctc aaaaaggcgc aacggttgag gacgttgcct acctggaaac ggcctacgcc 2100

ccgccgataa gtccgaccat agacccgata acggtcgcgg cagagatggc ccagagaaag 2160

ctccgctga 2169

<210> 19

<211> 2184

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 19

atgaagaagg ttaggatttt taacgacctt aagtggatag gtgacgacaa agttacggcc 60

ataggcatgg gcacgtgggg aataggcggc tacgagagtc cagactattc aaaggataat 120

gagagcgttg aggttctaag gcatggcctc gagctcggaa taaacctcat agacaccgct 180

gagttctacg gggcaggaca ctcggaggag ctcgtaggag aggccataaa ggagttcgag 240

cgcgatgata ttttcatcat cagcaaagtg tggccgacac acttcggcta cgaggaagca 300

aagagggccg caagagcgag cgcaaagaga ctaggcactt atattgacct ttatctcctc 360

cactggcctg gcgacagttg ggagaagatc aaggagacgc tccacgcgct agaggagctc 420

gtcgacgagg ggctgatcag gtacatcggc gtcagcaact tcgacctcga gcttctcaag 480

agaagccagg aggcgatgaa gaagtacgag atagtcgcca acgaggtcaa gtactccctc 540

aaagaccgct ggccagaaac tacaggtctg ctcgactaca tgaagcgtga ggggattgcg 600

ctgatagcct acacgccgct tgaaaaggga accctcgcga gaaacgaatg tttggccgag 660

atcgggaaga aatacggtaa gacagccgct caggttgcgc tcaactacct catctgggag 720

gagaacgtca tagccatccc aaaggctgga aacaaggctc acctagagga gaacttcggt 780

gctatgggat ggagactctc aaaggaggat agagagaacg caagggggtg tgtcgaagcc 840

gcggcgaaag aagcggccgc gaaaatgaaa atcgtcgtgg tcggttctgg aacagccgga 900

agcaacttcg ccctcttcat gcgcaagctt gacaggaagg ccgagataac cgtcatagga 960

aaggaaccaa cgatgcagta ctccccctgc gccctgccgc acgtggtaag cggcactatc 1020

gagaagcctg aggacattat agtctttccc aacgagttct acgagaagca gaagataaac 1080

ctcatgctga acacggaagc aaaggcgata gacagagaaa ggaaggttgt agtcacggat 1140

aagggcgaag tcccgtacga caagcttgtt ttggccgttg gttcaaaggc attcattccg 1200

ccgattaagg gagttgagaa cgagggggtc ttcacactca agagcctcga cgacgttagg 1260

aggataaaag cctacatagc cgagagaaag ccgaagaagg ccgtcgttat cggagctggt 1320

ctcatcggcc ttgagggcgc cgaggccttt gcaaaacttg gaatggaagt tctgattgta 1380

gagctgatgg acaggcttat gcccacaatg ctcgacaagg acacggcaaa gctcgtccag 1440

gctgagatgg agaagtacgg cgtttccttc cgcttcggcg tcggcgtgag tgagatcatc 1500

ggaagccccg tcagggctgt caaaataggc gacgaagaag ttcccgcaga cctcgtcttg 1560

gttgcaaccg gggtgagagc caacaccgac ctcgccaaac aggcagggct tgaagtgaac 1620

aggggcatag tggttaatga gcacctccag acgagcgacc cggaggtcta cgcaataggc 1680

gactgtgctg aagttataga cgccgtaact ggaaaaagaa ctctcagtca gctcggaact 1740

tccgccgtta ggatggccaa ggtggccgcg gagcacatag cgggtaagga cgtctccttc 1800

agaccagtct tcaacaccgc tataaccgag ctgtttggcc ttgaaatcgg caccttcgga 1860

atcaccgagg agagggcaaa gaaggaggac atcgaggtag cggtcggaaa gttcaaaggc 1920

tcgaccaagc cagagtacta tcccggaggc aagcccataa ccgtaaagct catcttcaga 1980

aagtcagaca gaaagcttat cggcggccag atagtcggcg gcgagagggt ctggggcagg 2040

ataatgacgc tttctgccct cgctcaaaaa ggcgcaacgg ttgaggacgt tgcctacctg 2100

gaaacggcct acgccccgcc gataagtccg accatagacc cgataacggt cgcggcagag 2160

atggcccaga gaaagctccg ctga 2184

<210> 20

<211> 2199

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 20

atgaagaagg ttaggatttt taacgacctt aagtggatag gtgacgacaa agttacggcc 60

ataggcatgg gcacgtgggg aataggcggc tacgagagtc cagactattc aaaggataat 120

gagagcgttg aggttctaag gcatggcctc gagctcggaa taaacctcat agacaccgct 180

gagttctacg gggcaggaca ctcggaggag ctcgtaggag aggccataaa ggagttcgag 240

cgcgatgata ttttcatcat cagcaaagtg tggccgacac acttcggcta cgaggaagca 300

aagagggccg caagagcgag cgcaaagaga ctaggcactt atattgacct ttatctcctc 360

cactggcctg gcgacagttg ggagaagatc aaggagacgc tccacgcgct agaggagctc 420

gtcgacgagg ggctgatcag gtacatcggc gtcagcaact tcgacctcga gcttctcaag 480

agaagccagg aggcgatgaa gaagtacgag atagtcgcca acgaggtcaa gtactccctc 540

aaagaccgct ggccagaaac tacaggtctg ctcgactaca tgaagcgtga ggggattgcg 600

ctgatagcct acacgccgct tgaaaaggga accctcgcga gaaacgaatg tttggccgag 660

atcgggaaga aatacggtaa gacagccgct caggttgcgc tcaactacct catctgggag 720

gagaacgtca tagccatccc aaaggctgga aacaaggctc acctagagga gaacttcggt 780

gctatgggat ggagactctc aaaggaggat agagagaacg caagggggtg tgtcgaagcc 840

gcggcgaaag aagcggccgc gaaagaagcc gcggcgaaaa tgaaaatcgt cgtggtcggt 900

tctggaacag ccggaagcaa cttcgccctc ttcatgcgca agcttgacag gaaggccgag 960

ataaccgtca taggaaagga accaacgatg cagtactccc cctgcgccct gccgcacgtg 1020

gtaagcggca ctatcgagaa gcctgaggac attatagtct ttcccaacga gttctacgag 1080

aagcagaaga taaacctcat gctgaacacg gaagcaaagg cgatagacag agaaaggaag 1140

gttgtagtca cggataaggg cgaagtcccg tacgacaagc ttgttttggc cgttggttca 1200

aaggcattca ttccgccgat taagggagtt gagaacgagg gggtcttcac actcaagagc 1260

ctcgacgacg ttaggaggat aaaagcctac atagccgaga gaaagccgaa gaaggccgtc 1320

gttatcggag ctggtctcat cggccttgag ggcgccgagg cctttgcaaa acttggaatg 1380

gaagttctga ttgtagagct gatggacagg cttatgccca caatgctcga caaggacacg 1440

gcaaagctcg tccaggctga gatggagaag tacggcgttt ccttccgctt cggcgtcggc 1500

gtgagtgaga tcatcggaag ccccgtcagg gctgtcaaaa taggcgacga agaagttccc 1560

gcagacctcg tcttggttgc aaccggggtg agagccaaca ccgacctcgc caaacaggca 1620

gggcttgaag tgaacagggg catagtggtt aatgagcacc tccagacgag cgacccggag 1680

gtctacgcaa taggcgactg tgctgaagtt atagacgccg taactggaaa aagaactctc 1740

agtcagctcg gaacttccgc cgttaggatg gccaaggtgg ccgcggagca catagcgggt 1800

aaggacgtct ccttcagacc agtcttcaac accgctataa ccgagctgtt tggccttgaa 1860

atcggcacct tcggaatcac cgaggagagg gcaaagaagg aggacatcga ggtagcggtc 1920

ggaaagttca aaggctcgac caagccagag tactatcccg gaggcaagcc cataaccgta 1980

aagctcatct tcagaaagtc agacagaaag cttatcggcg gccagatagt cggcggcgag 2040

agggtctggg gcaggataat gacgctttct gccctcgctc aaaaaggcgc aacggttgag 2100

gacgttgcct acctggaaac ggcctacgcc ccgccgataa gtccgaccat agacccgata 2160

acggtcgcgg cagagatggc ccagagaaag ctccgctga 2199

<210> 21

<211> 2163

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 21

atgaaaatcg tcgtggtcgg ttctggaaca gccggaagca acttcgccct cttcatgcgc 60

aagcttgaca ggaaggccga gataaccgtc ataggaaagg aaccaacgat gcagtactcc 120

ccctgcgccc tgccgcacgt ggtaagcggc actatcgaga agcctgagga cattatagtc 180

tttcccaacg agttctacga gaagcagaag ataaacctca tgctgaacac ggaagcaaag 240

gcgatagaca gagaaaggaa ggttgtagtc acggataagg gcgaagtccc gtacgacaag 300

cttgttttgg ccgttggttc aaaggcattc attccgccga ttaagggagt tgagaacgag 360

ggggtcttca cactcaagag cctcgacgac gttaggagga taaaagccta catagccgag 420

agaaagccga agaaggccgt cgttatcgga gctggtctca tcggccttga gggcgccgag 480

gcctttgcaa aacttggaat ggaagttctg attgtagagc tgatggacag gcttatgccc 540

acaatgctcg acaaggacac ggcaaagctc gtccaggctg agatggagaa gtacggcgtt 600

tccttccgct tcggcgtcgg cgtgagtgag atcatcggaa gccccgtcag ggctgtcaaa 660

ataggcgacg aagaagttcc cgcagacctc gtcttggttg caaccggggt gagagccaac 720

accgacctcg ccaaacaggc agggcttgaa gtgaacaggg gcatagtggt taatgagcac 780

ctccagacga gcgacccgga ggtctacgca ataggcgact gtgctgaagt tatagacgcc 840

gtaactggaa aaagaactct cagtcagctc ggaacttccg ccgttaggat ggccaaggtg 900

gccgcggagc acatagcggg taaggacgtc tccttcagac cagtcttcaa caccgctata 960

accgagctgt ttggccttga aatcggcacc ttcggaatca ccgaggagag ggcaaagaag 1020

gaggacatcg aggtagcggt cggaaagttc aaaggctcga ccaagccaga gtactatccc 1080

ggaggcaagc ccataaccgt aaagctcatc ttcagaaagt cagacagaaa gcttatcggc 1140

ggccagatag tcggcggcga gagggtctgg ggcaggataa tgacgctttc tgccctcgct 1200

caaaaaggcg caacggttga ggacgttgcc tacctggaaa cggcctacgc cccgccgata 1260

agtccgacca tagacccgat aacggtcgcg gcagagatgg cccagagaaa gctccgcgcg 1320

gccgcgatga agaaggttag gatttttaac gaccttaagt ggataggtga cgacaaagtt 1380

acggccatag gcatgggcac gtggggaata ggcggctacg agagtccaga ctattcaaag 1440

gataatgaga gcgttgaggt tctaaggcat ggcctcgagc tcggaataaa cctcatagac 1500

accgctgagt tctacggggc aggacactcg gaggagctcg taggagaggc cataaaggag 1560

ttcgagcgcg atgatatttt catcatcagc aaagtgtggc cgacacactt cggctacgag 1620

gaagcaaaga gggccgcaag agcgagcgca aagagactag gcacttatat tgacctttat 1680

ctcctccact ggcctggcga cagttgggag aagatcaagg agacgctcca cgcgctagag 1740

gagctcgtcg acgaggggct gatcaggtac atcggcgtca gcaacttcga cctcgagctt 1800

ctcaagagaa gccaggaggc gatgaagaag tacgagatag tcgccaacga ggtcaagtac 1860

tccctcaaag accgctggcc agaaactaca ggtctgctcg actacatgaa gcgtgagggg 1920

attgcgctga tagcctacac gccgcttgaa aagggaaccc tcgcgagaaa cgaatgtttg 1980

gccgagatcg ggaagaaata cggtaagaca gccgctcagg ttgcgctcaa ctacctcatc 2040

tgggaggaga acgtcatagc catcccaaag gctggaaaca aggctcacct agaggagaac 2100

ttcggtgcta tgggatggag actctcaaag gaggatagag agaacgcaag ggggtgtgtc 2160

tga 2163

<210> 22

<211> 2169

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 22

atgaaaatcg tcgtggtcgg ttctggaaca gccggaagca acttcgccct cttcatgcgc 60

aagcttgaca ggaaggccga gataaccgtc ataggaaagg aaccaacgat gcagtactcc 120

ccctgcgccc tgccgcacgt ggtaagcggc actatcgaga agcctgagga cattatagtc 180

tttcccaacg agttctacga gaagcagaag ataaacctca tgctgaacac ggaagcaaag 240

gcgatagaca gagaaaggaa ggttgtagtc acggataagg gcgaagtccc gtacgacaag 300

cttgttttgg ccgttggttc aaaggcattc attccgccga ttaagggagt tgagaacgag 360

ggggtcttca cactcaagag cctcgacgac gttaggagga taaaagccta catagccgag 420

agaaagccga agaaggccgt cgttatcgga gctggtctca tcggccttga gggcgccgag 480

gcctttgcaa aacttggaat ggaagttctg attgtagagc tgatggacag gcttatgccc 540

acaatgctcg acaaggacac ggcaaagctc gtccaggctg agatggagaa gtacggcgtt 600

tccttccgct tcggcgtcgg cgtgagtgag atcatcggaa gccccgtcag ggctgtcaaa 660

ataggcgacg aagaagttcc cgcagacctc gtcttggttg caaccggggt gagagccaac 720

accgacctcg ccaaacaggc agggcttgaa gtgaacaggg gcatagtggt taatgagcac 780

ctccagacga gcgacccgga ggtctacgca ataggcgact gtgctgaagt tatagacgcc 840

gtaactggaa aaagaactct cagtcagctc ggaacttccg ccgttaggat ggccaaggtg 900

gccgcggagc acatagcggg taaggacgtc tccttcagac cagtcttcaa caccgctata 960

accgagctgt ttggccttga aatcggcacc ttcggaatca ccgaggagag ggcaaagaag 1020

gaggacatcg aggtagcggt cggaaagttc aaaggctcga ccaagccaga gtactatccc 1080

ggaggcaagc ccataaccgt aaagctcatc ttcagaaagt cagacagaaa gcttatcggc 1140

ggccagatag tcggcggcga gagggtctgg ggcaggataa tgacgctttc tgccctcgct 1200

caaaaaggcg caacggttga ggacgttgcc tacctggaaa cggcctacgc cccgccgata 1260

agtccgacca tagacccgat aacggtcgcg gcagagatgg cccagagaaa gctccgcgaa 1320

gcggccgcga aaatgaagaa ggttaggatt tttaacgacc ttaagtggat aggtgacgac 1380

aaagttacgg ccataggcat gggcacgtgg ggaataggcg gctacgagag tccagactat 1440

tcaaaggata atgagagcgt tgaggttcta aggcatggcc tcgagctcgg aataaacctc 1500

atagacaccg ctgagttcta cggggcagga cactcggagg agctcgtagg agaggccata 1560

aaggagttcg agcgcgatga tattttcatc atcagcaaag tgtggccgac acacttcggc 1620

tacgaggaag caaagagggc cgcaagagcg agcgcaaaga gactaggcac ttatattgac 1680

ctttatctcc tccactggcc tggcgacagt tgggagaaga tcaaggagac gctccacgcg 1740

ctagaggagc tcgtcgacga ggggctgatc aggtacatcg gcgtcagcaa cttcgacctc 1800

gagcttctca agagaagcca ggaggcgatg aagaagtacg agatagtcgc caacgaggtc 1860

aagtactccc tcaaagaccg ctggccagaa actacaggtc tgctcgacta catgaagcgt 1920

gaggggattg cgctgatagc ctacacgccg cttgaaaagg gaaccctcgc gagaaacgaa 1980

tgtttggccg agatcgggaa gaaatacggt aagacagccg ctcaggttgc gctcaactac 2040

ctcatctggg aggagaacgt catagccatc ccaaaggctg gaaacaaggc tcacctagag 2100

gagaacttcg gtgctatggg atggagactc tcaaaggagg atagagagaa cgcaaggggg 2160

tgtgtctga 2169

<210> 23

<211> 2184

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 23

atgaaaatcg tcgtggtcgg ttctggaaca gccggaagca acttcgccct cttcatgcgc 60

aagcttgaca ggaaggccga gataaccgtc ataggaaagg aaccaacgat gcagtactcc 120

ccctgcgccc tgccgcacgt ggtaagcggc actatcgaga agcctgagga cattatagtc 180

tttcccaacg agttctacga gaagcagaag ataaacctca tgctgaacac ggaagcaaag 240

gcgatagaca gagaaaggaa ggttgtagtc acggataagg gcgaagtccc gtacgacaag 300

cttgttttgg ccgttggttc aaaggcattc attccgccga ttaagggagt tgagaacgag 360

ggggtcttca cactcaagag cctcgacgac gttaggagga taaaagccta catagccgag 420

agaaagccga agaaggccgt cgttatcgga gctggtctca tcggccttga gggcgccgag 480

gcctttgcaa aacttggaat ggaagttctg attgtagagc tgatggacag gcttatgccc 540

acaatgctcg acaaggacac ggcaaagctc gtccaggctg agatggagaa gtacggcgtt 600

tccttccgct tcggcgtcgg cgtgagtgag atcatcggaa gccccgtcag ggctgtcaaa 660

ataggcgacg aagaagttcc cgcagacctc gtcttggttg caaccggggt gagagccaac 720

accgacctcg ccaaacaggc agggcttgaa gtgaacaggg gcatagtggt taatgagcac 780

ctccagacga gcgacccgga ggtctacgca ataggcgact gtgctgaagt tatagacgcc 840

gtaactggaa aaagaactct cagtcagctc ggaacttccg ccgttaggat ggccaaggtg 900

gccgcggagc acatagcggg taaggacgtc tccttcagac cagtcttcaa caccgctata 960

accgagctgt ttggccttga aatcggcacc ttcggaatca ccgaggagag ggcaaagaag 1020

gaggacatcg aggtagcggt cggaaagttc aaaggctcga ccaagccaga gtactatccc 1080

ggaggcaagc ccataaccgt aaagctcatc ttcagaaagt cagacagaaa gcttatcggc 1140

ggccagatag tcggcggcga gagggtctgg ggcaggataa tgacgctttc tgccctcgct 1200

caaaaaggcg caacggttga ggacgttgcc tacctggaaa cggcctacgc cccgccgata 1260

agtccgacca tagacccgat aacggtcgcg gcagagatgg cccagagaaa gctccgcgaa 1320

gccgcggcga aagaagcggc cgcgaaaatg aagaaggtta ggatttttaa cgaccttaag 1380

tggataggtg acgacaaagt tacggccata ggcatgggca cgtggggaat aggcggctac 1440

gagagtccag actattcaaa ggataatgag agcgttgagg ttctaaggca tggcctcgag 1500

ctcggaataa acctcataga caccgctgag ttctacgggg caggacactc ggaggagctc 1560

gtaggagagg ccataaagga gttcgagcgc gatgatattt tcatcatcag caaagtgtgg 1620

ccgacacact tcggctacga ggaagcaaag agggccgcaa gagcgagcgc aaagagacta 1680

ggcacttata ttgaccttta tctcctccac tggcctggcg acagttggga gaagatcaag 1740

gagacgctcc acgcgctaga ggagctcgtc gacgaggggc tgatcaggta catcggcgtc 1800

agcaacttcg acctcgagct tctcaagaga agccaggagg cgatgaagaa gtacgagata 1860

gtcgccaacg aggtcaagta ctccctcaaa gaccgctggc cagaaactac aggtctgctc 1920

gactacatga agcgtgaggg gattgcgctg atagcctaca cgccgcttga aaagggaacc 1980

ctcgcgagaa acgaatgttt ggccgagatc gggaagaaat acggtaagac agccgctcag 2040

gttgcgctca actacctcat ctgggaggag aacgtcatag ccatcccaaa ggctggaaac 2100

aaggctcacc tagaggagaa cttcggtgct atgggatgga gactctcaaa ggaggataga 2160

gagaacgcaa gggggtgtgt ctga 2184

<210> 24

<211> 2199

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 24

atgaaaatcg tcgtggtcgg ttctggaaca gccggaagca acttcgccct cttcatgcgc 60

aagcttgaca ggaaggccga gataaccgtc ataggaaagg aaccaacgat gcagtactcc 120

ccctgcgccc tgccgcacgt ggtaagcggc actatcgaga agcctgagga cattatagtc 180

tttcccaacg agttctacga gaagcagaag ataaacctca tgctgaacac ggaagcaaag 240

gcgatagaca gagaaaggaa ggttgtagtc acggataagg gcgaagtccc gtacgacaag 300

cttgttttgg ccgttggttc aaaggcattc attccgccga ttaagggagt tgagaacgag 360

ggggtcttca cactcaagag cctcgacgac gttaggagga taaaagccta catagccgag 420

agaaagccga agaaggccgt cgttatcgga gctggtctca tcggccttga gggcgccgag 480

gcctttgcaa aacttggaat ggaagttctg attgtagagc tgatggacag gcttatgccc 540

acaatgctcg acaaggacac ggcaaagctc gtccaggctg agatggagaa gtacggcgtt 600

tccttccgct tcggcgtcgg cgtgagtgag atcatcggaa gccccgtcag ggctgtcaaa 660

ataggcgacg aagaagttcc cgcagacctc gtcttggttg caaccggggt gagagccaac 720

accgacctcg ccaaacaggc agggcttgaa gtgaacaggg gcatagtggt taatgagcac 780

ctccagacga gcgacccgga ggtctacgca ataggcgact gtgctgaagt tatagacgcc 840

gtaactggaa aaagaactct cagtcagctc ggaacttccg ccgttaggat ggccaaggtg 900

gccgcggagc acatagcggg taaggacgtc tccttcagac cagtcttcaa caccgctata 960

accgagctgt ttggccttga aatcggcacc ttcggaatca ccgaggagag ggcaaagaag 1020

gaggacatcg aggtagcggt cggaaagttc aaaggctcga ccaagccaga gtactatccc 1080

ggaggcaagc ccataaccgt aaagctcatc ttcagaaagt cagacagaaa gcttatcggc 1140

ggccagatag tcggcggcga gagggtctgg ggcaggataa tgacgctttc tgccctcgct 1200

caaaaaggcg caacggttga ggacgttgcc tacctggaaa cggcctacgc cccgccgata 1260

agtccgacca tagacccgat aacggtcgcg gcagagatgg cccagagaaa gctccgcgaa 1320

gccgcggcga aagaagcggc cgcgaaagaa gccgcggcga aaatgaagaa ggttaggatt 1380

tttaacgacc ttaagtggat aggtgacgac aaagttacgg ccataggcat gggcacgtgg 1440

ggaataggcg gctacgagag tccagactat tcaaaggata atgagagcgt tgaggttcta 1500

aggcatggcc tcgagctcgg aataaacctc atagacaccg ctgagttcta cggggcagga 1560

cactcggagg agctcgtagg agaggccata aaggagttcg agcgcgatga tattttcatc 1620

atcagcaaag tgtggccgac acacttcggc tacgaggaag caaagagggc cgcaagagcg 1680

agcgcaaaga gactaggcac ttatattgac ctttatctcc tccactggcc tggcgacagt 1740

tgggagaaga tcaaggagac gctccacgcg ctagaggagc tcgtcgacga ggggctgatc 1800

aggtacatcg gcgtcagcaa cttcgacctc gagcttctca agagaagcca ggaggcgatg 1860

aagaagtacg agatagtcgc caacgaggtc aagtactccc tcaaagaccg ctggccagaa 1920

actacaggtc tgctcgacta catgaagcgt gaggggattg cgctgatagc ctacacgccg 1980

cttgaaaagg gaaccctcgc gagaaacgaa tgtttggccg agatcgggaa gaaatacggt 2040

aagacagccg ctcaggttgc gctcaactac ctcatctggg aggagaacgt catagccatc 2100

ccaaaggctg gaaacaaggc tcacctagag gagaacttcg gtgctatggg atggagactc 2160

tcaaaggagg atagagagaa cgcaaggggg tgtgtctga 2199

<210> 25

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 25

gccgtcgcat atgaagaagg ttaggatttt taacg 35

<210> 26

<211> 36

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 26

ttatttcagc ggccgcgaca cacccccttg cgttct 36

<210> 27

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 27

aaatatatgc ggccgcgatg aaaatcgtcg tggtcggtt 39

<210> 28

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 28

ctggaattct cagcggagct ttctctgggc cat 33

<210> 29

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 29

ttatttcagc ggccgcttcg acacaccccc ttgcgttct 39

<210> 30

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 30

aaatatatgc ggccgcgaaa atgaaaatcg tcgtggtcgg tt 42

<210> 31

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 31

ttatttcagc ggccgcttct ttcgccgcgg cttcgacaca cccccttgcg ttct 54

<210> 32

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 32

aaatatatgc ggccgcgaaa atgaaaatcg tcgtggtcgg tt 42

<210> 33

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 33

ttatttcagc ggccgcttct ttcgccgcgg cttcgacaca cccccttgcg ttct 54

<210> 34

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 34

aaatatatgc ggccgcgaaa gaagccgcgg cgaaaatgaa aatcgtcgtg gtcggtt 57

<210> 35

<211> 35

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 35

gccgtcgcat atgaaaatcg tcgtggtcgg ttctg 35

<210> 36

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 36

ttatttcagc ggccgcgcgg agctttctct gggccatct 39

<210> 37

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 37

aaatatatgc ggccgcgatg aagaaggtta ggatttttaa cg 42

<210> 38

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 38

ctggaattct cagacacacc ccctt 25

<210> 39

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 39

ttatttcagc ggccgcttcg cggagctttc tctgggccat ct 42

<210> 40

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 40

aaatatatgc ggccgcgaaa atgaagaagg ttaggatttt taacg 45

<210> 41

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 41

ttatttcagc ggccgcttct ttcgccgcgg cttcgcggag ctttctctgg gccatct 57

<210> 42

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 42

aaatatatgc ggccgcgaaa atgaagaagg ttaggatttt taacg 45

<210> 43

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 43

ttatttcagc ggccgcttct ttcgccgcgg cttcgcggag ctttctctgg gccatct 57

<210> 44

<211> 60

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial

<400> 44

aaatatatgc ggccgcgaaa gaagccgcgg cgaaaatgaa gaaggttagg atttttaacg 60