阅读说明：本技术 用于减少atxn2表达的化合物和方法 (Compounds and methods for reducing expression of ATXN2 ) 是由 苏珊·M·弗赖尔 P·辛格 F·里戈 P·杰法尔-内贾德 H·柯达赛维茨 于 2019-07-25 设计创作，主要内容包括：提供了用于减少细胞或动物中的ATXN2RNA的量或活性以及在某些情况下减少细胞或动物中的Ataxin-2蛋白的量的化合物、方法和药物组合物。这类化合物、方法和药物组合物可用于改善神经退行性疾病的至少一种症状或标志。这类症状和标志包括共济失调、神经病变和聚集体形成。这类神经退行性疾病包括脊髓小脑性共济失调2型(SCA2)、肌萎缩侧索硬化(ALS)和帕金森综合征。(Compounds, methods and pharmaceutical compositions are provided for reducing the amount or activity of ATXN2RNA, and in some cases the amount of Ataxin-2 protein, in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or marker of a neurodegenerative disease. Such symptoms and markers include ataxia, neuropathy, and aggregate formation. Such neurodegenerative diseases include spinocerebellar ataxia type 2 (SCA2), Amyotrophic Lateral Sclerosis (ALS), and parkinsonism.)

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an ATXN2 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar and a modified internucleoside linkage.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID NOs 30-3319.

3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein said portion is complementary to:

an equivalent length portion of nucleobase 2,455-2,483 of SEQ ID NO: 1;

an equivalent length portion of nucleobase 4,393-4,424 of SEQ ID NO. 1;

an equivalent length portion of nucleobase 4,413-4,437 of SEQ ID NO. 1;

an equivalent length portion of nucleobase 4,525-4,554 of SEQ ID NO 2;

an equivalent length portion of nucleobase 4,748-4,771 of SEQ ID NO 2;

an equivalent length portion of nucleobase 9,927-9,954 of SEQ ID NO 2;

an equivalent length portion of nucleobase 10,345-10,368 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 17,153-17,182 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 18,680-18,702 of SEQ ID NO 2;

an equivalent length portion of nucleobase 23,251-23,276 of SEQ ID NO 2;

an equivalent length portion of the nucleobase 28,081-28,105 of SEQ ID NO 2;

an equivalent length portion of nucleobase 28,491-28,526 of SEQ ID NO 2;

an equivalent length portion of nucleobase 28,885-28,912 of SEQ ID NO 2;

an equivalent length portion of nucleobase 32,328-32,352 of SEQ ID NO 2;

an equivalent length portion of nucleobase 32,796-32,824 of SEQ ID NO 2;

an equivalent length portion of nucleobase 32,809-32,838 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 36,308-36,334 of SEQ ID NO 2;

the equivalent length portion of nucleobase 36,845-36,872 of SEQ ID NO 2;

an equivalent length portion of nucleobase 49,147-49,173 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 57,469-57,494 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 82,848-82,874 of SEQ ID NO: 2;

an equivalent length portion of nucleobase 83,784-83,813 of SEQ ID NO 2;

an equivalent length portion of nucleobase 84,743-84,782 of SEQ ID NO 2;

an equivalent length portion of nucleobase 84,813-84,839 of SEQ ID NO. 2;

an equivalent length portion of the nucleobase 85,051-85,076 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 97,618-97,643 of SEQ ID NO: 2;

an equivalent length portion of nucleobase 119,023-119,048 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 132,161-132,195 of SEQ ID NO 2;

an equivalent length portion of nucleobase 139,271-139,303 of SEQ ID NO 2; or

1, nucleobase 1,075-1,146.

4. The oligomeric compound of any of claims 1-3 wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequence of SEQ ID No. 1 or SEQ ID No. 2 when measured across its entire nucleobase sequence.

5. The oligomeric compound of any of claims 1-4 wherein the modified oligonucleotide comprises at least one modified nucleoside.

6. The oligomeric compound of claim 5 wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

7. The oligomeric compound of claim 6 wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

8. The oligomeric compound of claim 7, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from-O-CH₂and-O-CH (CH)₃)-。

9. The oligomeric compound of any of claims 5-8 wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

10. The oligomeric compound of claim 9 wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2'-MOE modified sugar or a 2' -OMe modified sugar.

11. The oligomeric compound of any of claims 5-10 wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar substitute.

12. The oligomeric compound of claim 11 wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a sugar substitute selected from morpholinyl and PNA.

13. The oligomeric compound of any of claims 1-12 wherein the modified oligonucleotide has a sugar moiety comprising:

a 5 '-region consisting of 1-5 linked 5' -region nucleosides;

a central region consisting of 6-10 nucleotides linked to the central region; and

a 3 '-region consisting of 1-5 linked 3' -region nucleosides; wherein

Each of the 5' -region nucleosides and each of the 3' -region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2' -deoxyribosyl sugar moiety.

14. The oligomeric compound of any of claims 1-13 wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

15. The oligomeric compound of claim 14, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

16. The oligomeric compound of claim 14 or 15 wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

17. The oligomeric compound of claim 14 or 16, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

18. The oligomeric compound of any of claims 14, 16 or 17, wherein each internucleoside linkage is a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

19. The oligomeric compound of any of claims 1-18 wherein the modified oligonucleotide comprises at least one modified nucleobase.

20. The oligomeric compound of claim 19 wherein the modified nucleobase is a 5-methylcytosine.

21. The oligomeric compound of any of claims 1-20 wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.

22. The oligomeric compound of any of claims 1-21 wherein the modified oligonucleotide consists of 18 or 20 linked nucleosides.

23. The oligomeric compound of any of claims 1-22 consisting of the modified oligonucleotide.

24. The oligomeric compound of any of claims 1-22 comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

25. The oligomeric compound of claim 24, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

26. The oligomeric compound of claim 24 or 25, wherein the conjugate linker consists of a single bond.

27. The oligomeric compound of claim 25, wherein the conjugate linker is cleavable.

28. The oligomeric compound of claim 27, wherein the conjugate linker comprises 1-3 linker-nucleosides.

29. The oligomeric compound of any of claims 24-28, wherein the conjugate group is attached to the modified oligonucleotide at the 5' -end of the modified oligonucleotide.

30. The oligomeric compound of any of claims 24-28, wherein the conjugate group is attached to the modified oligonucleotide at the 3' -end of the modified oligonucleotide.

31. The oligomeric compound of any of claims 1-30 comprising terminal groups.

32. The oligomeric compound of any of claims 1-31, wherein the oligomeric compound is a single-stranded oligomeric compound.

33. The oligomeric compound of any of claims 1-27 or 29-31, wherein the oligomeric compound does not comprise a linker-nucleoside.

34. An oligomeric duplex comprising the oligomeric compound of any one of claims 1-31 or 33.

35. An antisense compound comprising or consisting of the oligomeric compound of any of claims 1-33 or the oligomeric duplex of claim 34.

36. A pharmaceutical composition comprising the oligomeric compound of any one of claims 1-33 or the oligomeric duplex of claim 34 and a pharmaceutically acceptable carrier or diluent.

37. A modified oligonucleotide according to the formula:

(SEQ ID NO:1714)

or a salt thereof.

38. A modified oligonucleotide according to the formula:

(SEQ ID NO:1255)

or a salt thereof.

39. A modified oligonucleotide according to the formula:

(SEQ ID NO:1185)

or a salt thereof.

40. A modified oligonucleotide according to the formula:

(SEQ ID NO:3235)

or a salt thereof.

41. A modified oligonucleotide according to the formula:

(SEQ ID NO:158)

or a salt thereof.

42. A modified oligonucleotide according to the formula:

SEQ ID NO:2544

or a salt thereof.

43. The modified oligonucleotide of any one of claims 37-42, which is a sodium salt of the formula (la).

44. A modified oligonucleotide according to the formula:

SEQ ID NO:1714。

45. a modified oligonucleotide according to the formula:

SEQ ID NO:1255。

46. a modified oligonucleotide according to the formula:

SEQ ID NO:1185。

47. a modified oligonucleotide according to the formula:

SEQ ID NO:3235。

48. a modified oligonucleotide according to the formula:

SEQ ID NO:158。

49. a modified oligonucleotide according to the formula:

SEQ ID NO:2544。

50. a chirally enriched population of modified oligonucleotides of any of claims 37-49, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

51. The chirally enriched population of claim 50, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Sp) configuration.

52. The chirally enriched population of claim 50 or 51, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a (Rp) configuration.

53. The chirally enriched population of claim 50, wherein the population is enriched for modified oligonucleotides having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

54. The chirally enriched population of claim 53, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage.

55. The chirally enriched population of claim 53, wherein the population is enriched for modified oligonucleotides having a (Rp) configuration at each phosphorothioate internucleoside linkage.

56. The chirally enriched population of claim 50 or claim 53, wherein the population is enriched for modified oligonucleotides having at least 3 consecutive phosphorothioate internucleoside linkages in the Sp-Sp-Rp configuration in the 5 'to 3' direction.

57. A population of modified oligonucleotides of any one of claims 37-49, wherein all of said phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.

58. A pharmaceutical composition comprising the modified oligonucleotide of any one of claims 37-49 and a pharmaceutically acceptable diluent or carrier.

59. The pharmaceutical composition according to claim 36 or 58, wherein the pharmaceutically-acceptable diluent is artificial cerebrospinal fluid.

60. The pharmaceutical composition of claim 59, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

61. A method comprising administering to an animal the pharmaceutical composition of any one of claims 36 or 58-60.

62. A method of treating a disease associated with ATXN2, the method comprising administering to an individual having or at risk of developing a disease associated with ATXN2 a therapeutically effective amount of the pharmaceutical composition of any one of claims 36 or 58-60; and thereby treating the ATXN 2-related disease.

63. The method of claim 62, wherein the disease associated with ATXN2 is a neurodegenerative disease.

64. The method of claim 63, wherein the neurodegenerative disease is any one of spinocerebellar ataxia type 2 (SCA2), Amyotrophic Lateral Sclerosis (ALS), and Parkinson's syndrome.

65. The method of claim 64, wherein at least one symptom or marker of the neurodegenerative disease is improved.

66. The method of claim 65, wherein the symptom or marker is any one of ataxia, neuropathy, and aggregate formation.

67. An oligomeric compound comprising a modified oligonucleotide according to the formula:

ges Teo Aeo mCeo Teo Tds Tds Tds mCDs Ads Tds Tds Tds Geo mCeo Ges mCE (SEQ ID NO: 1714); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

68. An oligomeric compound comprising a modified oligonucleotide according to the formula: mCES Teo Geo mCEO Tds Ads Ads mCDS Tds Gds Tds Tds Tds Geo mCEO mCES Tes Te (SEQ ID NO: 1255); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

69. An oligomeric compound comprising a modified oligonucleotide according to the formula: tes Geo Teo Aeo mCoo Teo Tds mCDs Ads Tds Tds Gds Gds Aeo Ges mCos mCE (SEQ ID NO: 1185); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

70. An oligomeric compound comprising a modified oligonucleotide according to the formula: tes Geo Teo Teo Teo mCDs Tds Tds Tds Tds Ads mCos Tes mCos Ae (SEQ ID NO: 3235); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

71. An oligomeric compound comprising a modified oligonucleotide according to the formula: mCES mCEO Teo Aeo Teo mCEO Ads Tds mCDS Ads Tds Tds Tds mCDS Aeo Ges Ge (SEQ ID NO: 158); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

72. An oligomeric compound comprising a modified oligonucleotide according to the formula: tes mCeo Teo Tes Ads mCDs Tds Tds Tds Tds mCDs Tds Tds Teo Geo Tes mCs mC (SEQ ID NO: 2544); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

73. The oligomeric compound of claim 3, wherein the modified oligonucleotide is an RNAi compound.

74. The oligomeric compound of claim 73 wherein the RNAi compound is ssRNA or siRNA.

Technical Field

Compounds, methods and pharmaceutical compositions are provided for reducing the amount or activity of ATXN2RNA and in some cases the amount of Ataxin-2 protein in a cell or animal. Such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or marker of a neurodegenerative disease. Such symptoms and markers include ataxia, neuropathy, and aggregate formation. Such neurodegenerative diseases include spinocerebellar ataxia type 2 (SCA2), Amyotrophic Lateral Sclerosis (ALS), and parkinsonism (parkinsonism).

Background

Spinocerebellar ataxia type 2 (SCA2) is an autosomal dominant neurodegenerative disease characterized by progressive loss of function and neuronal cells in the cerebellum, brainstem and spinal cord. The cause of SCA2 is CAG amplification in the ATXN2 gene, resulting in polyglutamine (polyQ) amplification of the ataxin-2 protein. SCA2 patients are characterized by progressive cerebellar ataxia, bradysaccadic Movement and other neurological features such as neuropathy (Pulst, S.M. (eds.), Genetics of motion disorders, Elsevier, Amsterdam,2003, pages 19-34). Moderate CAG amplification in the ATXN2 gene is also associated with Parkinson's disease or Amyotrophic Lateral Sclerosis (ALS) and is indistinguishable from the idiopathic form of these diseases (Kim et al, Arch. neuron., 2007,64: 1510-.

The pathogenic function of polyQ disease proteins that accompany polyQ amplification can be attributed to increased toxicity associated with the appearance of nuclear inclusion bodies or with soluble toxic oligomers (Lajoie et al, PLoS One,2011,5: e 15245). Although the brain of the SCA2 patient was characterized by loss of Purkinje cells (Purkinje cells), the lack of inclusion bodies in SCA2 Purkinje cells suggests that polyQ-amplified ataxin-2 causes toxicity unrelated to inclusion body formation (Huynh et al, Ann. neuron., 1999,45: 232-. The functions obtained in polyaxin-2 for polyQ amplification may include abnormal accumulation in the Golgi body (Huynh et al, hum. mol. Genet.,2003,12: 1485-. Some of the normal functions of ataxin-2 have been characterized. Ataxin-2 is present in stress particles and treated bodies, suggesting a function in sequestering mRNA and regulating protein translation during stress (Nonhoff et al, mol.biol.cell,2007,18: 1385-1396). Ataxin-2 overexpression interferes with the processing of small body assembly, while underexpression interferes with stress particle assembly (Nonhoff et al, mol.biol.cell,2007,18: 1385-. Interaction with polyA-binding protein 1, RNA splicing factor A2BP1/Fox1 and polysomes further supports the role of ataxin-2 in RNA metabolism (Shibata et al, hum. mol. Gene., 2000,9: 1303-. By virtue of interaction with SRC kinase and the endocytic protein CIN85, Ataxin-2 becomes a regulator of EGF receptor internalization and signaling (Nonis et al, Cell Signal.,2008,20: 1725-1739). Ataxin-2 also interacts with the ALS-associated protein TDP-43 in an RNA-dependent manner, and familial and sporadic ALS are associated with the presence of long normal CAG repeat amplified ATXN2 (Elden et al, Nature,2010,466: 1069-.

There is currently a lack of acceptable options for treating such neurodegenerative diseases. It is therefore an object herein to provide methods for treating such diseases.

Disclosure of Invention

Provided herein are compounds, methods and pharmaceutical compositions for reducing the amount or activity of ATXN2RNA and, in certain embodiments, the amount of Ataxin-2 protein in a cell or animal. In certain embodiments, the animal has a neurodegenerative disease. In certain embodiments, the animal has spinocerebellar ataxia type 2 (SCA2), Amyotrophic Lateral Sclerosis (ALS), or parkinsonism. In certain embodiments, the compounds useful for reducing the expression of ATXN2RNA are oligomeric compounds. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide.

Also provided are methods useful for ameliorating at least one symptom or marker of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is SCA2, ALS, or parkinsonism. In certain embodiments, symptoms and markers include ataxia, neuropathy, and aggregate formation. In certain embodiments, improvement of these symptoms can improve motor function, reduce neuropathy, and reduce the number of aggregates.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. In addition, unless specifically stated otherwise, terms such as "element" or "component" encompass elements and components comprising one unit as well as elements and components comprising more than one subunit.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treatises, and portions of the documents discussed herein, are hereby expressly incorporated by reference, as well as in their entirety.

Definition of

Unless specific definitions are provided, nomenclature that pertains to, and procedures and techniques for, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. All patents, applications, published applications and other publications, and other data referred to throughout this disclosure are incorporated herein by reference in their entirety where appropriate.

Unless otherwise indicated, the following terms have the following meanings:

as used herein, "2 '-deoxynucleoside" means a nucleoside comprising a 2' -h (h) deoxyribosyl sugar moiety as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2' -deoxynucleoside can comprise a modified nucleobase or can comprise an RNA nucleobase (uracil).

As used herein, "2 'substituted nucleoside" means a nucleoside comprising a 2' substituted sugar moiety. As used herein, "2 '-substituted" with respect to a sugar moiety means that the sugar moiety comprises at least one 2' -substituted group other than H or OH.

As used herein, "5-methylcytosine" means cytosine modified by a methyl group attached at the 5-position. 5-methyl cytosine is a modified nucleobase.

As used herein, "administering" means providing an agent to an animal.

As used herein, "animal" means a human or non-human animal.

As used herein, "antisense activity" means any detectable and/or measurable change attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid as compared to the level of the target nucleic acid or the level of the target protein in the absence of the antisense compound.

As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

As used herein, "improvement" with respect to treatment means an improvement in at least one symptom relative to the same symptom in the absence of treatment. In certain embodiments, the improvement is a decrease in the severity or frequency of the symptoms, or a delay in the onset of the symptoms or a decrease in the progression or frequency of the severity. In certain embodiments, the symptom or marker is ataxia, neuropathy, and aggregate formation. In certain embodiments, improvement of these symptoms can improve motor function, reduce neuropathy, or reduce the number of aggregates.

As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.

As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

As used herein, "cleavable moiety" means a bond or a group of atoms that is cleaved under physiological conditions, such as in a cell, animal or human.

As used herein, "complementary" with respect to an oligonucleotide means an oligonucleotide in which at least 70% of the nucleobases, or one or more regions thereof, of the oligonucleotide and the nucleobases, or one or more regions thereof, of another nucleic acid are capable of hydrogen bonding to each other when the nucleobase sequence of the oligonucleotide is aligned in an opposing orientation with the other nucleic acid. Complementary nucleobases means nucleobases capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatch is tolerated. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

As used herein, "conjugate group" means a group of atoms directly attached to an oligonucleotide. The conjugate group includes a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide.

As used herein, "conjugate linker" means a single bond or a group of atoms comprising at least one bond that connects the conjugate moiety to the oligonucleotide.

As used herein, "conjugate moiety" means a set of atoms that are attached to an oligonucleotide via a conjugate linker.

As used herein, "linked" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

As used herein, "constrained ethyl" or "cEt-modified sugar" means a β -D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4' -carbon and the 2' -carbon of the β -D ribosyl sugar moiety, wherein the bridge has the formula 4' -CH (CH)₃) -O-2', and wherein the methyl group of the bridge is in the S configuration.

As used herein, "cEt nucleoside" means a nucleoside comprising a cEt-modified sugar.

As used herein, a "chirally enriched population" means a plurality of molecules of uniform molecular formula, wherein if a particular chiral center is stereorandom, the number or percentage of molecules within the population that contain a particular stereochemical configuration at that particular chiral center exceeds the number or percentage of molecules within the population that are expected to contain the same particular stereochemical configuration at the same particular chiral center. A chirally enriched population of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.

As used herein, "gapmer" means a modified oligonucleotide comprising an inner region having a plurality of nucleosides that support rnase H cleavage located between outer regions having one or more nucleosides, wherein the nucleosides comprising the inner region are chemically distinct from the nucleosides comprising the outer region. The inner region may be referred to as a "notch" and the outer region may be referred to as a "wing". Unless otherwise indicated, "gapmer" refers to a sugar moiety. Unless otherwise indicated, the sugar moiety of the gapped nucleoside of the gapmer is an unmodified 2' -deoxyribosyl group. Thus, the term "MOE gapmer" indicates a gapmer having the sugar member of a 2'-MOE nucleoside in both wings and having a gap of a 2' -deoxynucleoside. Unless otherwise indicated, the MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases, and such modifications need not follow the gapmer pattern of sugar modifications.

As used herein, a "hot spot region" is a series of nucleobases on a target nucleic acid that enables an oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

As used herein, "hybridization" means the pairing or bonding of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases, which may be Watson-Crick (Watson-Crick), mustine (Hoogsteen), or reverse mustine hydrogen bonding.

As used herein, the term "internucleoside linkage" is a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced by a sulfur atom.

As used herein, "linker-nucleoside" means a nucleoside that connects an oligonucleotide directly or indirectly to a conjugate moiety. A "linker-nucleoside" is located within the conjugated linker of the oligomeric compound. Even if a linker-nucleoside is linked to an oligonucleotide, it is not considered that the linker-nucleoside is part of the oligonucleotide moiety of the oligomeric compound.

As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety comprising a modification, e.g., a substituent, that does not form a bridge between two atoms of the sugar and thus does not form a second ring.

As used herein, "mismatch" or "non-complementary" means that the nucleobase of a first oligonucleotide is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first oligonucleotide is aligned with the second oligonucleotide.

As used herein, "MOE" means methoxyethyl. "2 ' -MOE" or "sugar modified with 2' -MOE" means 2' -OCH₂CH₂OCH₃The group replaces the 2' -OH group of the ribosyl sugar moiety. As used herein, "2 '-MOE nucleoside" means a nucleoside comprising a sugar modified by 2' -MOE.

As used herein, "motif" means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages in an oligonucleotide.

As used herein, "neurodegenerative disease" means a condition characterized by gradual loss of function or structure, including loss of motor function and neuronal death. In certain embodiments, the neurodegenerative disease is spinocerebellar ataxia type 2 (SCA2), Amyotrophic Lateral Sclerosis (ALS), or parkinsonism.

As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a set of atoms other than unmodified A, T, C, U or G that is capable of pairing with at least one unmodified nucleobase. "5-methyl cytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of five unmodified nucleobases. As used herein, "nucleobase sequence" means a contiguous nucleobase sequence in a nucleic acid or oligonucleotide that is not associated with any sugar or internucleoside linkage modifications.

As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently unmodified or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. A "linked nucleoside" is a nucleoside linked in the order of linkage (i.e., no other nucleosides are present between the linked nucleosides).

As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more other features, such as a conjugate group or a terminal group. The oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" means a duplex formed from two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomerized duplex may be referred to as a "duplex oligomeric compound".

As used herein, "oligonucleotide" means a chain of linked nucleosides via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for administration to an animal. Certain such carriers enable the pharmaceutical compositions to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and lozenges for oral administration to a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffered solution, or sterile artificial cerebrospinal fluid.

As used herein, "pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of a compound. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects.

As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, the pharmaceutical composition may comprise the oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in certain cell lines in a free uptake assay.

As used herein, "prodrug" means a therapeutic agent that is in one form in vitro, converted to a different form in an animal or in an animal cell. Typically, the conversion of the prodrug in the animal is driven by the action of an enzyme (endogenous or viral), or a chemical and/or physiological condition present in the cell or tissue.

As used herein, "reduce or inhibit an amount or activity" refers to a decrease or blocking of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate that transcriptional expression or activity is completely eliminated.

As used herein, "RNAi compounds" means antisense compounds that modulate a target nucleic acid and/or a protein encoded by the target nucleic acid, at least in part, by RISC or Ago 2. RNAi compounds include, but are not limited to, double stranded siRNA, single stranded RNA (ssRNA), and microRNA, including microRNA mimetics. In certain embodiments, the RNAi compounds modulate the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through rnase H.

As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that is at least partially hybridized to itself.

As used herein, "standard cellular assay" means the assay described in example 3 and reasonable variants thereof.

As used herein, "standard in vivo assay" means the experiment described in example 15 and reasonable variations thereof.

As used herein, "stereorandom chiral centers" in the context of a population of molecules having a consistent molecular formula means chiral centers having a random stereochemical configuration. For example, in a population of molecules comprising stereorandom chiral centers, the number of molecules having the (S) configuration of stereorandom chiral centers may be, but need not be, the same as the number of molecules having the (R) configuration of stereorandom chiral centers. The stereochemical configuration of a chiral center is considered random when produced by a synthetic method that is not designed to control stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-oh (h) ribosyl moiety as found in RNA ("unmodified RNA sugar moiety") or a 2' -h (h) deoxyribosyl moiety as found in DNA ("unmodified DNA sugar moiety"). The unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or sugar substitute.

As used herein, "sugar substitute" means a modified sugar moiety other than a furanosyl moiety that can link a nucleobase to another group in an oligonucleotide, such as an internucleoside linkage, a conjugate group, or a terminal group. Modified nucleosides comprising sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.

As used herein, "target nucleic acid" and "target RNA" mean a nucleic acid for which an antisense compound is designed to affect.

As used herein, "target region" means a portion of a target nucleic acid for which an oligomeric compound is designed to hybridize.

As used herein, "terminal group" means a chemical group or set of atoms covalently attached to the end of an oligonucleotide.

As used herein, "therapeutically effective amount" means the amount of an agent that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount will provide a good conversion of the symptoms of the disease.

Certain embodiments

The present disclosure provides the following non-limiting numbered embodiments:

embodiment 1 an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 90% complementary to an equal length portion of an ATXN2 nucleic acid, and wherein said modified oligonucleotide comprises at least one modification selected from the group consisting of a modified sugar, a sugar substitute, and a modified internucleoside linkage.

Embodiment 2. an oligomeric compound comprising a modified oligonucleotide consisting of 12-50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19 or at least 20 consecutive nucleobases of any one of the nucleobase sequences of SEQ ID Nos. 30-3319.

Embodiment 3. an oligomeric compound comprising a modified oligonucleotide consisting of 12-50 linked nucleosides and having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases, wherein said portion is complementary to:

an equivalent length portion of nucleobase 2,455-2,483 of SEQ ID NO: 1;

an equivalent length portion of nucleobase 4,393-4,424 of SEQ ID NO. 1;

an equivalent length portion of nucleobase 4,413-4,437 of SEQ ID NO. 1;

an equivalent length portion of nucleobase 4,525-4,554 of SEQ ID NO 2;

an equivalent length portion of nucleobase 4,748-4,771 of SEQ ID NO 2;

an equivalent length portion of nucleobase 9,927-9,954 of SEQ ID NO 2;

an equivalent length portion of nucleobase 10,345-10,368 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 17,153-17,182 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 18,680-18,702 of SEQ ID NO 2;

an equivalent length portion of nucleobase 23,251-23,276 of SEQ ID NO 2;

an equivalent length portion of the nucleobase 28,081-28,105 of SEQ ID NO 2;

an equivalent length portion of nucleobase 28,491-28,526 of SEQ ID NO 2;

an equivalent length portion of nucleobase 28,885-28,912 of SEQ ID NO 2;

an equivalent length portion of nucleobase 32,328-32,352 of SEQ ID NO 2;

an equivalent length portion of nucleobase 32,796-32,824 of SEQ ID NO 2;

an equivalent length portion of nucleobase 32,809-32,838 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 36,308-36,334 of SEQ ID NO 2;

the equivalent length portion of nucleobase 36,845-36,872 of SEQ ID NO 2;

an equivalent length portion of nucleobase 49,147-49,173 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 57,469-57,494 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 82,848-82,874 of SEQ ID NO: 2;

an equivalent length portion of nucleobase 83,784-83,813 of SEQ ID NO 2;

an equivalent length portion of nucleobase 84,743-84,782 of SEQ ID NO 2;

an equivalent length portion of nucleobase 84,813-84,839 of SEQ ID NO. 2;

an equivalent length portion of the nucleobase 85,051-85,076 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 97,618-97,643 of SEQ ID NO: 2;

an equivalent length portion of nucleobase 119,023-119,048 of SEQ ID NO. 2;

an equivalent length portion of nucleobase 132,161-132,195 of SEQ ID NO 2;

an equivalent length portion of nucleobase 139,271-139,303 of SEQ ID NO 2; or

1, nucleobase 1,075-1,146.

Embodiment 4 the oligomeric compound of any of embodiments 1 to 3, wherein said modified oligonucleotide has a nucleobase sequence which is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to any of the nucleobase sequences of SEQ ID No. 1 or SEQ ID No. 2, when measured across its entire nucleobase sequence.

Embodiment 5 the oligomeric compound of any of embodiments 1 to 4, wherein said modified oligonucleotide comprises at least one modified nucleoside.

Embodiment 6 the oligomeric compound of embodiment 5, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

Embodiment 7 the oligomeric compound of embodiment 6, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

Embodiment 8 the oligomeric compound of embodiment 7, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein said 2'-4' bridge is selected from the group consisting of-O-CH 2-and-O-CH (CH3) -.

Embodiment 9 the oligomeric compound of any of embodiments 5-8, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety.

Embodiment 10 the oligomeric compound of embodiment 9, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a non-bicyclic modified sugar moiety comprising a 2'-MOE modified sugar or a 2' -OMe modified sugar.

Embodiment 11 the oligomeric compound of any of embodiments 5-10, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar substitute.

Embodiment 12 the oligomeric compound of embodiment 11, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar substitute selected from the group consisting of N-morpholinyl and PNA.

Embodiment 13 the oligomeric compound of any of embodiments 1 to 12, wherein said modified oligonucleotide has a sugar moiety comprising:

a 5 '-region consisting of 1-5 linked 5' -region nucleosides;

a central region consisting of 6-10 nucleotides linked to the central region; and

a 3 '-region consisting of 1-5 linked 3' -region nucleosides; wherein

Each of the 5' -region nucleosides and each of the 3' -region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2' -deoxyribosyl sugar moiety.

Embodiment 14 the oligomeric compound of any of embodiments 1-13, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

Embodiment 15 the oligomeric compound of embodiment 14, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

Embodiment 16 the oligomeric compound of embodiment 14 or 15, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 17 the oligomeric compound of embodiment 14 or 16, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

Embodiment 18 the oligomeric compound of any of embodiments 14, 16 or 17, wherein each internucleoside linkage is a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

Embodiment 19 the oligomeric compound of any of embodiments 1-18, wherein said modified oligonucleotide comprises at least one modified nucleobase.

Embodiment 20 the oligomeric compound of embodiment 19, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 21 the oligomeric compound of any of embodiments 1 to 20, wherein said modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22, or 18-20 linked nucleosides.

Embodiment 22 the oligomeric compound of any of embodiments 1 to 21, wherein said modified oligonucleotide consists of 18 or 20 linked nucleosides.

Embodiment 23. the oligomeric compound of any of embodiments 1-22, consisting of said modified oligonucleotide.

Embodiment 24 the oligomeric compound of any of embodiments 1-22, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

Embodiment 25 the oligomeric compound of embodiment 24, wherein said conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.

Embodiment 26 the oligomeric compound of embodiment 24 or 25, wherein said conjugate linker consists of a single bond.

Embodiment 27 the oligomeric compound of embodiment 25, wherein the conjugate linker is cleavable.

Embodiment 28 the oligomeric compound of embodiment 27, wherein said conjugated linker comprises 1-3 linker-nucleosides.

Embodiment 29 the oligomeric compound of any of embodiments 24-28, wherein said conjugate group is attached to said modified oligonucleotide at the 5' -end of said modified oligonucleotide.

Embodiment 30 the oligomeric compound of any of embodiments 24 to 28, wherein said conjugate group is attached to said modified oligonucleotide at the 3' -end of said modified oligonucleotide.

Embodiment 31 the oligomeric compound of any of embodiments 1-30, comprising terminal groups.

Embodiment 32 the oligomeric compound of any of embodiments 1-31, wherein the oligomeric compound is a single-stranded oligomeric compound.

Embodiment 33 the oligomeric compound of any of embodiments 1-27 or 29-31, wherein the oligomeric compound does not comprise a linker-nucleoside.

Embodiment 34. an oligomeric duplex comprising an oligomeric compound according to any of embodiments 1 to 31 or 33.

Embodiment 35. an antisense compound comprising or consisting of the oligomeric compound of any of embodiments 1 to 33 or the oligomeric duplex of embodiment 34.

Embodiment 36. a pharmaceutical composition comprising the oligomeric compound of any one of embodiments 1 to 33 or the oligomeric duplex of embodiment 34 and a pharmaceutically acceptable carrier or diluent.

Embodiment 37. a modified oligonucleotide according to the formula:

(SEQ ID NO:1714)

or a salt thereof.

Embodiment 38 a modified oligonucleotide according to the formula:

(SEQ ID NO:1255)

or a salt thereof.

Embodiment 39. a modified oligonucleotide according to the formula:

(SEQ ID NO:1185)

or a salt thereof.

Embodiment 40 a modified oligonucleotide according to the formula:

(SEQ ID NO:3235)

or a salt thereof.

Embodiment 41. a modified oligonucleotide according to the formula:

(SEQ ID NO:158)

or a salt thereof.

Embodiment 42. a modified oligonucleotide according to the formula:

SEQ ID NO:2544

or a salt thereof.

Embodiment 43 the modified oligonucleotide of any one of embodiments 37-42 which is a sodium salt of said formula.

Embodiment 44. a modified oligonucleotide according to the formula:

SEQ ID NO:1714。

embodiment 45 a modified oligonucleotide according to the formula:

SEQ ID NO:1255。

embodiment 46. a modified oligonucleotide according to the formula:

SEQ ID NO:1185。

embodiment 47. a modified oligonucleotide according to the formula:

SEQ ID NO:3235。

embodiment 48. a modified oligonucleotide according to the formula:

SEQ ID NO:158。

embodiment 49. a modified oligonucleotide according to the formula:

SEQ ID NO:2544。

embodiment 50 a chirally enriched population of modified oligonucleotides of any of embodiments 37-49, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

Embodiment 51 the chirally enriched population of embodiment 50, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

Embodiment 52 the chirally enriched population of embodiment 50 or 51, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a (Rp) configuration.

Embodiment 53 the chirally enriched population of embodiment 50, wherein the population is enriched for modified oligonucleotides having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

Embodiment 54 the chirally enriched population of embodiment 53, wherein the population is enriched for modified oligonucleotides having (Sp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 55 the chirally enriched population of embodiment 53, wherein the population is enriched for modified oligonucleotides having (Rp) configuration at each phosphorothioate internucleoside linkage.

Embodiment 56 the chirally enriched population of embodiment 50 or embodiment 53, wherein the population is enriched for modified oligonucleotides having at least 3 consecutive phosphorothioate internucleoside linkages in the Sp-Sp-Rp configuration in the 5 'to 3' direction.

Embodiment 57. a population of modified oligonucleotides of any one of embodiments 37-49, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

Embodiment 58. a pharmaceutical composition comprising the modified oligonucleotide of any one of embodiments 37-49 and a pharmaceutically acceptable diluent or carrier.

Embodiment 59 the pharmaceutical composition of embodiment 58, wherein said pharmaceutically acceptable diluent is artificial cerebrospinal fluid.

Embodiment 60 the pharmaceutical composition of embodiment 59, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and artificial cerebrospinal fluid.

Embodiment 61 a method comprising administering to an animal a pharmaceutical composition of any one of embodiments 36 or 58-60.

Embodiment 62. a method of treating a disease associated with ATXN2, the method comprising administering to an individual having or at risk of developing a disease associated with ATXN2 a therapeutically effective amount of a pharmaceutical composition according to any one of embodiments 36 or 58-60; thereby treating the ATXN 2-associated disease.

Embodiment 63 the method of embodiment 62, wherein the disease associated with ATXN2 is a neurodegenerative disease.

Embodiment 64 the method of embodiment 63, wherein said neurodegenerative disease is any one of spinocerebellar ataxia type 2 (SCA2), Amyotrophic Lateral Sclerosis (ALS), and parkinsonism.

Embodiment 65 the method of embodiment 64, wherein at least one symptom or marker of the neurodegenerative disease is improved.

Embodiment 66 the method of embodiment 65, wherein said symptom or marker is any one of ataxia, neuropathy, and aggregate formation.

Embodiment 67. an oligomeric compound comprising a modified oligonucleotide according to the formula:

ges Teo Aeo mCeo Teo Tds Tds Tds mCDs Ads Tds Tds Tds Geo mCeo Ges mCE (SEQ ID NO: 1714); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5' -methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Embodiment 68. an oligomeric compound comprising a modified oligonucleotide according to the formula: mCES Teo Geo mCEO Tds Ads Ads mCDS Tds Gds Tds Tds Tds Geo mCEO mCES Tes Te (SEQ ID NO: 1255); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5' -methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Embodiment 69. an oligomeric compound comprising a modified oligonucleotide according to the formula: tes Geo Teo Aeo mCoo Teo Tds mCDs Ads Tds Tds Gds Gds Aeo Ges mCos mCE (SEQ ID NO: 1185); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5' -methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Embodiment 70. an oligomeric compound comprising a modified oligonucleotide according to the formula: tes Geo Teo Teo Teo mCDs Tds Tds Tds Tds Ads mCos Tes mCos Ae (SEQ ID NO: 3235); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5' -methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Embodiment 71 an oligomeric compound comprising a modified oligonucleotide according to the formula: mCES mCEO Teo Aeo Teo mCEO Ads Tds mCDS Ads Tds Tds Tds mCDS Aeo Ges Ge (SEQ ID NO: 158); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5' -methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Embodiment 72 an oligomeric compound comprising a modified oligonucleotide according to the formula: tes mCeo Teo Tes Ads mCDs Tds Tds Tds Tds mCDs Tds Tds Teo Geo Tes mCs mC (SEQ ID NO: 2544); wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5' -methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Embodiment 73 the oligomeric compound of embodiment 3, wherein said modified oligonucleotide is an RNAi compound.

Embodiment 74 the oligomeric compound of embodiment 73, wherein said RNAi compound is ssRNA or siRNA.

I.Certain oligonucleotides

In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide consisting of linked nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or may be a modified oligonucleotide. The modified oligonucleotide comprises at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotide comprises at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

A.Certain modified nucleosides

The modified nucleoside comprises a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1.Certain sugar moieties

In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may comprise one or more substitutions corresponding to other types of modified sugar moieties.

In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituent groups, none of which groups bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position on the furanosyl group, including but not limited to substituents at the 2', 4' and/or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of 2' -substituent groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: 2'-F, 2' -OCH₃("OMe" or "O-methyl") and 2' -O (CH)₂)₂OCH₃("MOE"). In certain embodiments, the 2' -substituent group is selected from: halogen, allyl, amino, azido, SH, CN, OCN, CF₃、OCF₃、O-C₁-C₁₀Alkoxy, O-C₁-C₁₀Substituted alkoxy, O-C₁-C₁₀Alkyl, O-C₁-C₁₀Substituted alkyl, S-alkyl, N (R)_m) Alkyl, O-alkenyl, S-alkenyl, N (R)_m) Alkenyl, O-alkynyl, S-alkynyl, N (R)_m) Alkynyl, O-alkenyl-O-alkyl, alkynyl, alkylaryl, arylalkyl, O-alkylaryl, O-arylalkyl, O (CH)₂)₂SCH₃、O(CH₂)₂ON(R_m)(R_n) Or OCH₂C(＝O)-N(R_m)(R_n) Wherein each R is_mAnd R_nIndependently is H, an amino protecting group or a substituted or unsubstituted C₁-C₁₀Alkyl, and 2' -substituted groups described in: cook et al, U.S.6,531,584; cook et al, U.S.5,859, 221; and Cook et al, U.S.6,005,087. Certain embodiments of these 2' -substituent groups may be further substituted with one or more substituent groups independently selected from: hydroxy, amino, alkoxy, carboxy, benzyl, phenyl, Nitro (NO)₂) Thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl groups. Examples of 4' -substituent groups suitable for non-bicyclic modified sugar moieties include, but are not limited to: alkoxy (e.g., methoxy), alkyl, and those substituents described in Manoharan et al, WO 2015/106128. Examples of suitable 5' -substituent groups for non-bicyclic modified sugar moieties include, but are not limited to: 5-methyl (R or S), 5 '-vinyl and 5' -methoxy. In certain embodiments, the non-bicyclic modified sugar moiety comprises more than one non-bridging sugar substituent, such as a 2'-F-5' -methyl sugar moiety, as well as modified sugar moieties and modified nucleosides described in Migawa et al, WO 2008/101157 and Rajeev et al, US 2013/0203836.

In certain embodiments, the 2 '-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising an unbridged 2' -substitution group selected from the group consisting of: F. NH (NH)₂、N₃、OCF₃、OCH₃、O(CH₂)₃NH₂、CH₂CH＝CH₂、OCH₂CH＝CH₂、OCH₂CH₂OCH₃、O(CH₂)₂SCH₃、O(CH₂)₂ON(R_m)(R_n)、O(CH₂)₂O(CH₂)₂N(CH₃)₂And N-substituted acetamides (OCH)₂C(＝O)-N(R_m)(R_n) Each R) of which_mAnd R_nIndependently is H, an amino protecting group or a substituted or unsubstituted C₁-C₁₀An alkyl group.

In certain embodiments, the 2 '-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising an unbridged 2' -substitution group selected from the group consisting of: F. OCF₃、OCH₃、OCH₂CH₂OCH₃、O(CH₂)₂SCH₃、O(CH₂)₂ON(CH₃)₂、O(CH₂)₂O(CH₂)₂N(CH₃)₂And OCH₂C(＝O)-N(H)CH₃(“NMA”)。

In certain embodiments, the 2 '-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising an unbridged 2' -substitution group selected from the group consisting of: F. OCH (OCH)₃And OCH₂CH₂OCH₃。

Certain modified sugar moieties comprise substituents that bridge two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4 'and 2' furanose ring atoms. Examples of such 4 'to 2' bridging sugar substituents include, but are not limited to: 4' -CH₂-2'、4'-(CH₂)₂-2'、4'-(CH₂)₃-2'、4'-CH₂-O-2'(“LNA”)、4'-CH₂-S-2'、4'-(CH₂)₂-O-2'(“ENA”)、4'-CH(CH₃) -O-2 '(referred to as "constrained ethyl" or "cEt"), 4' -CH₂-O-CH₂-2'、4'-CH₂-N(R)-2'、4'-CH(CH₂OCH₃) -O-2' ("constrained MOE" or "cMOE") and analogs thereof (see e.g. Seth et al, u.s.7,399, 845; bhat et al, U.S.7,569, 686; swayze et al, U.S.7,741,457; and Swayze et al, U.S.8,022,193), 4' -C (CH)₃)(CH₃) -O-2 'and analogs thereof (see, e.g., Seth et al, U.S.8,278,283), 4' -CH₂-N(OCH₃) -2' and the likeMaterials (see, e.g., Prakash et al, U.S.8,278,425), 4' -CH₂-O-N(CH₃) -2 '(see, e.g., Allerson et al, U.S.7,696,345 and Allerson et al, U.S.8,124,745), 4' -CH₂-C(H)(CH₃) -2' (see, e.g., Zhou, et al, J.org.chem.,2009,74,118-₂-C(＝CH₂) -2 'and analogs thereof (see, e.g., Seth et al, U.S.8,278,426), 4' -C (R)_aR_b)-N(R)-O-2'、4'-C(R_aR_b)-O-N(R)-2'、4'-CH₂-O-N (R) -2 'and 4' -CH₂-N (R) -O-2', each of which R, R_aAnd R_bIndependently is H, a protecting group or C₁-C₁₂Alkyl (see, e.g., Imanishi et al, U.S.7,427, 672).

In certain embodiments, such 4 'to 2' bridges independently comprise 1 to 4 linking groups independently selected from: - [ C (R)_a)(R_b)]_n-、-[C(R_a)(R_b)]_n-O-、-C(R_a)＝C(R_b)-、-C(R_a)＝N-、-C(＝NR_a)-、-C(＝O)-、-C(＝S)-、-O-、-Si(R_a)₂-、-S(＝O)_x-and-N (R)_a)-；

Wherein:

x is 0,1 or 2;

n is 1,2, 3 or 4;

each R_aAnd R_bIndependently is H, a protecting group, hydroxyl, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₅-C₂₀Aryl, substituted C₅-C₂₀Aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, substituted heteroaryl, C₅-C₇Alicyclic radical, substituted C₅-C₇Alicyclic radical, halogen, OJ₁、NJ₁J₂、SJ₁、N₃、COOJ₁Acyl (C ═ O) -H), substituted acyl, CN, sulfonyl (S ═ O)₂-J₁) Or sulfinyl (S (═ O) -J)₁) (ii) a And is

Each J₁And J₂Independently H, C₁-C₁₂Alkyl, substituted C₁-C₁₂Alkyl radical, C₂-C₁₂Alkenyl, substituted C₂-C₁₂Alkenyl radical, C₂-C₁₂Alkynyl, substituted C₂-C₁₂Alkynyl, C₅-C₂₀Aryl, substituted C₅-C₂₀Aryl, acyl (C (═ O) -H), substituted acyl, heterocyclic, substituted heterocyclic, C₁-C₁₂Aminoalkyl, substituted C₁-C₁₂Aminoalkyl groups or protecting groups.

Other bicyclic sugar moieties are known in the art, see, for example: freier et al, Nucleic Acids Research,1997,25(22), 4429-4443; albaek et al, j.org.chem.,2006,71, 7731-; singh et al, chem. Commun.,1998,4, 455-456; koshkin et al, Tetrahedron,1998,54, 3607-; kumar et al, bioorg.med.chem.lett.,1998,8, 2219-; singh et al, J.org.chem.,1998,63, 10035-10039; srivastava et al, J.Am.chem.Soc.,2007,129, 8362-8379; wengel et al, U.S.7,053,207; imanishi et al, U.S.6,268,490; imanishi et al U.S.6,770, 748; imanishi et al, u.s.re44, 779; wengel et al, U.S.6,794,499; wengel et al, U.S.6,670,461; wengel et al, U.S.7,034, 133; wengel et al, U.S.8,080, 644; wengel et al, U.S.8,034, 909; wengel et al, U.S.8,153, 365; wengel et al, U.S.7,572, 582; and Ramasamy et al, U.S.6,525, 191; torsten et al, WO 2004/106356; wengel et al, WO 1999/014226; seth et al, WO 2007/134181; seth et al, U.S. Pat. No. 7,547,684; seth et al, U.S. Pat. No. 7,666,854; seth et al, U.S.8,088, 746; seth et al, U.S.7,750, 131; seth et al, U.S.8,030,467; seth et al, U.S.8,268, 980; seth et al, U.S.8,546,556; seth et al, U.S.8,530, 640; migawa et al, U.S.9,012,421; seth et al, U.S.8,501, 805; and Allerson et al, U.S. patent publication No US2008/0039618 and Migawa et al, U.S. patent publication No US 2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporated into such bicyclic sugar moieties are further defined by isomeric configurations. For example, LNA nucleosides (described herein) can be in the alpha-L configuration or in the beta-D configuration.

alpha-L-methyleneoxy (4' -CH)₂-O-2') or α -L-LNA bicyclic nucleosides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al, Nucleic Acids Research,2003,21, 6365-. The summary of bicyclic nucleosides herein includes two isomeric configurations. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is determined in the exemplary embodiments herein, it is in the β -D configuration unless otherwise specified.

In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., substituted on the 5' and 4' -2' bridging sugars).

In certain embodiments, the modified sugar moiety is a sugar substitute. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, for example, with a sulfur atom, a carbon atom, or a nitrogen atom. In certain such embodiments, such modified sugar moieties further comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar substitutes comprise a 4' -sulfur atom and a substitution at the 2' -position (see, e.g., Bhat et al, u.s.7,875,733 and Bhat et al, u.s.7,939,677) and/or the 5' -position.

In certain embodiments, the sugar substitute comprises a ring having a number of atoms other than 5. For example, in certain embodiments, the sugar substitute comprises six-membered tetrahydrofuran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), alkanol (anitol) nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, cj. bioorg. & med. chem.2002,10,841-854), fluoro HNA:

("F-HNA", see, e.g., Swayze et al, U.S.8,088, 904; Swayze et al, U.S.8,440, 803; Swayze et al, U.S.8,796, 437; and Swayze et al, U.S.9,005,906; F-HNA may also be referred to as F-THP or 3' -fluorotetrahydropyran) and nucleosides containing other modified THP compounds having the formula:

wherein for each of the modified THP nucleosides:

bx is a nucleobase moiety;

T₃and T₄Each independently is an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide, or T₃And T₄One of which is an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide and T₃And T₄Is H, a hydroxyl protecting group, a linked conjugate group or a 5 'or 3' -end group;

q₁、q₂、q₃、q₄、q₅、q₆and q is₇Each independently is H, C₁-C₆Alkyl, substituted C₁-C₆Alkyl radical, C₂-C₆Alkenyl, substituted C₂-C₆Alkenyl radical, C₂-C₆Alkynyl or substituted C₂-C₆An alkynyl group; and is

R₁And R₂Each of which is independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ₁J₂、SJ₁、N₃、OC(＝X)J₁、OC(＝X)NJ₁J₂、NJ₃C(＝X)NJ₁J₂And CN, wherein X is O, S or NJ₁And each J₁、J₂And J₃Independently is H or C₁-C₆An alkyl group.

In certain embodiments, modified THP nucleosides are provided wherein q is₁、q₂、q₃、q₄、q₅、q₆And q is₇Each is H. In certain embodiments, q is₁、q₂、q₃、q₄、q₅、q₆And q is₇Is not H. In certain embodiments, q is₁、q₂、q₃、q₄、q₅、q₆And q is₇At least one of which is methyl. In certain embodiments, modified THP nucleosides are provided, wherein R is₁And R₂Is F. In certain embodiments, R₁Is F and R₂Is H, in certain embodiments, R₁Is methoxy and R₂Is H, and in certain embodiments, R₁Is methoxyethoxy and R₂Is H.

In certain embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than one heteroatom. For example, nucleosides containing N-morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al, Biochemistry,2002,41,4503-4510 and Summerton et al, U.S.5,698, 685; Summerton et al, U.S.5,166, 315; Summerton et al, U.S.5,185, 444; and Summerton et al, U.S.5,034, 506). As used herein, the term "N-morpholinyl" means a sugar substitute having the structure:

in certain embodiments, the N-morpholinyl may be modified, for example, by the addition or alteration of various substituent groups from the above N-morpholinyl structure. Such sugar substitutes are referred to herein as "modified N-morpholinyl".

In certain embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include, but are not limited to: peptide nucleic acids ("PNAs"), non-cyclic butyl nucleic acids (see, e.g., Kumar et al, org.biomol. chem.,2013,11,5853-5865) and nucleosides and oligonucleotides described in Manoharan et al, WO 2011/133876.

Many other bicyclic and tricyclic sugar and sugar substitute ring systems that can be used in modified nucleosides are known in the art.

2.Certain modified nucleobases

In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising an unmodified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not comprise a nucleobase, referred to as abasic nucleosides.

In certain embodiments, the modified nucleobase is selected from: 5 substituted pyrimidines, 6-azapyrimidines, alkyl-or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2-, N-6-, and O-6-substituted purines. In certain embodiments, the modified nucleobase is selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C.ident.C-CH)₃) Uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-sulfanyl, 8-hydroxy, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzyladenine, 2-N-isobutyrylguanine, 4-N-benzylcytosine, 4-N-benzyluracil, 5-methyl-4-N-benzylcytosine, 5-methyl-4-N-benzyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines such as 1, 3-diazaphenoxazin-2-one, 1, 3-diazaphenothiazin-2-one, and 9- (2-aminoethoxy) -1, 3-bisAzaphenoxazin-2-one (G-clip). Modified nucleobases may also include nucleobases in which purine or pyrimidine bases are replaced with other heterocycles, such as 7-deaza-adenine, 7-deaza-guanosine, 2-aminopyridine and 2-pyridone. Other nucleobases include those disclosed in: merigan et al, U.S.3,687,808; the circumcise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I. ed, John Wiley&Sons,1990, 858-; englisch et al, Angewandte Chemie, International edition, 1991,30, 613; sanghvi, Y.S., Chapter 15, Antisense Research and Applications, crook, S.T. and Lebleu, editions B., CRC Press,1993, 273-288; and chapters 6 and 15, Antisense Drug Technology, edited by crook s.t., CRC Press,2008, 163-.

Publications teaching the preparation of certain of the above-proposed modified nucleobases, as well as other modified nucleobases, include, but are not limited to: manohara et al, US 2003/0158403; manoharan et al, US 2003/0175906; dinh et al, U.S.4,845,205; spielmogel et al, U.S.5,130, 302; rogers et al, U.S.5,134,066; bischofberger et al, U.S.5,175,273; urdea et al, U.S.5,367,066; benner et al, U.S.5,432, 272; matteucci et al, U.S.5,434,257; gmeiner et al, U.S.5,457,187; cook et al, U.S.5,459,255; froehler et al, U.S.5,484, 908; matteucci et al, U.S.5,502, 177; hawkins et al, U.S.5,525, 711; haralambidis et al, U.S.5,552,540; cook et al, U.S.5,587, 469; froehler et al, U.S.5,594, 121; switzer et al, U.S.5,596, 091; cook et al, U.S.5,614,617; froehler et al, u.s.5,645, 985; cook et al, U.S.5,681, 941; cook et al, U.S.5,811, 534; cook et al, U.S.5,750,692; cook et al, U.S.5,948, 903; cook et al, U.S.5,587,470; cook et al, U.S.5,457,191; matteucci et al, U.S.5,763,588; froehler et al, U.S.5,830,653; cook et al, U.S.5,808,027; cook et al, 6,166,199; and Matteucci et al, U.S.6,005,096.

3.Certain modified internucleoside linkages

In certain embodiments, the nucleosides of the modified oligonucleotides can be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. RepresentsExemplary phosphorus-containing internucleoside linkages include, but are not limited to, phosphate esters, phosphotriesters, methylphosphonates, phosphoramidates and phosphorothioates ("P ═ S") and phosphorodithioates ("HS-P ═ S") containing phosphodiester linkages ("P ═ O") (also known as unmodified or naturally occurring linkages). Representative phosphorus-free internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH)₂-N(CH₃)-O-CH₂-), thiodiester, thiocarbamate (-O-C (═ O) (NH) -S-); siloxane (-O-SiH)₂-O-); and N, N' -dimethylhydrazine (-CH)₂-N(CH₃)-N(CH₃) -). Modified internucleoside linkages can be used to alter, typically increase, nuclease resistance of oligonucleotides compared to naturally occurring phosphate linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free internucleoside linkages are well known to those skilled in the art.

Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides comprising stereorandom internucleoside linkages, or as a population of modified oligonucleotides comprising phosphorothioate linkages in a particular stereochemical configuration. In certain embodiments, the population of modified oligonucleotides comprises phosphorothioate internucleoside linkages, wherein all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthesis methods that can randomly select the stereochemical configuration of each phosphorothioate bond. However, as is well understood by those skilled in the art, each phosphorothioate of each oligonucleotide molecule has a defined steric configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular independently selected stereochemical configuration. In certain embodiments, the particular configuration of a particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of a particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of a particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthesis methods known in the art, for example, as described in: oka et al, JACS 125,8307 (2003); wan et al nuc.acid.res.42,13456 (2014); and WO 2017/015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulae, respectively, wherein "B" indicates a nucleobase:

unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral internucleoside linkages include, but are not limited to, phosphotriesters, methylphosphonates, MMI (3' -CH)₂-N(CH₃) -O-5'), amide-3 (3' -CH)₂-C (═ O) -n (h) -5'), amide-4 (3' -CH₂-n (h) -C (═ O) -5'), methylal (3' -O-CH)₂-O-5'), methoxypropyl and thiometals (3' -S-CH)₂-O-5'). Other neutral internucleoside linkages include nonionic linkages comprising siloxanes (dialkylsiloxanes), carboxylic acid esters, carboxylic acid amides, sulfides, sulfonic acid esters and amides (see, e.g., Carbohydrate modifiers in Antisense Research; edited by Y.S.Sanghvi and P.D.Cook., ACS Symposium Series580; chapter 3 and chapter 4, 40-65). Other neutral internucleoside linkages include N, O, S and CH₂A non-ionic bond forming part.

B.Some primitives

In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, the modified oligonucleotide comprises one or more modified internucleoside linkages. In such embodiments, the modified, unmodified and variously modified sugar moieties, nucleobases and/or internucleoside linkages of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, a nucleobase motif describes a modification of a nucleobase independent of the nucleobase sequence).

1.Certain glycosyl units

In certain embodiments, the oligonucleotide comprises one or more types of modified and/or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar moieties. In certain instances, such sugar moieties include, but are not limited to, any of the sugar modifications discussed herein.

In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two outer regions or "wings" and a central or inner region or "gap". The three regions of the gapmer motif (5 '-wing, gap, and 3' -wing) form a contiguous sequence of nucleosides, wherein at least some sugar moieties of each wing nucleoside are different from at least some sugar moieties of the gapped nucleoside. Specifically, at least the sugar portion of each of the flanking nucleosides closest to the notch (the 3 '-most nucleoside of the 5' -wing and the 5 '-most nucleoside of the 3' -wing) is different from the sugar portion of the adjacent notched nucleoside, thus defining the boundary between the wing and the notch (i.e., the wing/notch junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, a notch comprises one or more nucleosides having a sugar moiety that is different from the sugar moiety of one or more other nucleosides of the notch. In certain embodiments, the glycosyl units of the two wings are identical to each other (symmetrical gapmer). In certain embodiments, the 5 '-flanking sugar moiety is different from the 3' -flanking sugar moiety (asymmetric gapmer).

In certain embodiments, the wings of the gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of the gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of the gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of the gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of the gapmer are modified nucleosides.

In certain embodiments, the nicks of the gapmer comprise 7-12 nucleosides. In certain embodiments, each nucleoside of the notch polymer is an unmodified 2' -deoxynucleoside. In certain embodiments, at least one nucleoside of the notch of the gapmer is a modified nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleoside on the notch side of each wing/notch junction is an unmodified 2' -deoxynucleoside and the nucleoside on the wing side of each wing/notch junction is a modified nucleoside. In certain embodiments, each nucleoside of the gap is an unmodified 2' -deoxynucleoside. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside.

In certain embodiments, the modified oligonucleotide comprises or consists of a region having a substantially modified sugar motif. In such embodiments, each nucleoside of the substantially modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a substantially modified sugar motif, wherein each nucleoside within the substantially modified region comprises the same modified sugar moiety, referred to herein as a uniform modified sugar motif. In certain embodiments, a substantially modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified oligonucleotide comprises the same 2' -modification.

Herein, the length of the three regions of the gapmer (number of nucleosides) can be provided using the following notation: [ number of nucleosides in the 5 '-wing ] - [ number of nucleosides in the notch ] - [ number of nucleosides in the 3' -wing ]. Thus, the 5-10-5 gapmer consists of 5 linked nucleosides per wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by specific modifications, the modifications are in each sugar moiety of each wing and the gapped nucleoside comprises an unmodified deoxynucleoside sugar. Thus, the 5-10-5MOE gapmer consists of 5 linked MOE modified nucleosides in the 5 '-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3' -wing.

In certain embodiments, the modified oligonucleotide is a 5-10-5MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3LNA gapmer.

2.Certain nucleobase motifs

In certain embodiments, the oligonucleotide comprises modified and/or unmodified nucleobases in a defined pattern or motif arranged along the oligonucleotide or a region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' -end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3' -end of the oligonucleotide. In certain embodiments, the block is at the 5' -end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5' -end of the oligonucleotide.

In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central notch of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2' -deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: 2-thiopyrimidine and 5-propynylpyrimidine.

3.Certain internucleoside linkage elements

In certain embodiments, the oligonucleotide comprises modified and/or unmodified internucleoside linkages in a defined pattern or motif arranged along the oligonucleotide or a region thereof. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P ═ O). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P ═ S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from the group consisting of stereorandom phosphorothioates, (Sp) phosphorothioates, and (Rp) phosphorothioates. In certain embodiments, the sugar moiety of the modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar moiety of the modified oligonucleotide is a gapmer and the internucleoside linkage moiety comprises at least one phosphodiester internucleoside linkage in at least one of the wings, wherein at least one phosphodiester linkage is not a terminal internucleoside linkage and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage elements.

C.Certain length

The length of the oligonucleotide can be increased or decreased without abolishing activity. For example, in Woolf et al (Proc. Natl. Acad. Sci. USA 89:7305-7309,1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides of 25 nucleobases length with 8 or 11 mismatched bases near the end of the oligonucleotide are capable of directing specific cleavage of the target mRNA, but to a lesser extent than oligonucleotides that do not contain mismatches. Similarly, target-specific cleavage is achieved using 13 nucleobase oligonucleotides, including oligonucleotides with 1 or 3 mismatches.

In certain embodiments, oligonucleotides (including modified oligonucleotides) may have any of a variety of ranges of lengths. In certain embodiments, the oligonucleotide consists of X to Y linked nucleosides, wherein X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8,9, 10,11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; the limiting condition is that X is less than or equal to Y. For example, in certain embodiments, the oligonucleotide consists of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 23, 14 to 14, 14 to 19, 14 to 20, 14 to 23, 14 to 14, 14 to 25, 14 to 14, 14 to 27, 14 to 14, 14 to 23, 14 to 14, 14 to 23, 14 to 27, 14 to 14, 14 to 23, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17,15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 23, 17 to 29, 17 to 18, 18 to 23, 18 to 20, 18 to 18, 18 to 23, 18 to 24, 18 to 24, or more than 18 to 24 or more than 18 or more than one or, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22,19 to 23, 19 to 24, 19 to 25,19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 27, 22 to 28, 22 to 29, 23 to 23, 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 23, 26, 23 to 23, 23 to 23, 23, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.

D.Certain modified oligonucleotides

In certain embodiments, the above modifications (sugars, nucleobases, internucleoside linkages) are incorporated into modified oligonucleotides. In certain embodiments, the modified oligonucleotide is characterized by its modification motif and full length. In certain embodiments, each of such parameters is independent of the other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar moiety may or may not be modified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of the sugar gapmer can be the same or different from each other, and can be the same or different from the internucleoside linkages of the gapped regions of the sugar motif. Likewise, such sugar gapmer oligonucleotides can comprise one or more modified nucleobases that are not associated with a sugar modified gapmer pattern. Unless otherwise indicated, all modifications are not related to the nucleobase sequence.

E.Certain modified oligonucleotide populations

The population of modified oligonucleotides in which all modified oligonucleotides of the population have the same molecular formula may be a stereorandom population or a chirally enriched population. All chiral centers of all modified oligonucleotides in a stereorandom population are stereorandom. In a chirally enriched population, at least one particular chiral center in the modified oligonucleotides of the population is not stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for β -D ribosyl sugar moieties, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for β -D ribosyl sugar moieties and at least one particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

F.Nucleobase sequences

In certain embodiments, the oligonucleotide (unmodified or modified oligonucleotide) is further described by its nucleobase sequence. In certain embodiments, the oligonucleotide has a nucleobase sequence complementary to a second oligonucleotide or a defined reference nucleic acid, e.g., a target nucleic acid. In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence complementary to a second oligonucleotide or a defined reference nucleic acid, e.g., a target nucleic acid. In certain embodiments, a region or the entire length of the nucleobase sequence of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid, e.g., a target nucleic acid.

II.Certain oligomeric compounds

In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or end groups. The conjugate group consists of one or more conjugate moieties and a conjugate linker connecting the conjugate moieties to the oligonucleotide. The conjugate group may be attached to either or both ends and/or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is attached to the nucleoside 2' -position of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or end group is attached at the 3 'and/or 5' -end of the oligonucleotide. In certain such embodiments, a conjugate group (or end group) is attached at the 3' -end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' -end of the oligonucleotide. In certain embodiments, a conjugate group (or end group) is attached at the 5' -end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' -end of the oligonucleotide.

Examples of end groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides.

A.Certain conjugate groups

In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate group confers a new property to the attached oligonucleotide, such as a fluorophore or reporter group that enables the oligonucleotide to be detected. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moieties (Letsinger et al, Proc. Natl. Acad. Sci. USA,1989,86,6553-6556), cholic acid (Manoharan et al, bioorg. Med. chem. Lett.,1994,4, 1053-a 1060), thioethers (e.g. hexyl-S-tritylthiol) (Manoharan et al, Ann. N.Y. Acad. Sci.,1992,660, 306-a 309; Manoharan et al, bioorg. Med. chem. Lett.,1993,3, 2765-a 2770), mercaptocholesterol (Ohaberuser et al, Nucl. Acids Res.,1992,20, 533-a 538), fatty chains (e.g. dodecanediol or undecyl residues) (Saison-Behmoars et al, EMJ. Manohuas., 1991,10, 1111; FEnov. phosphonic acid, 1990, 533-a), cetyl alcohol, 235-a racemic phospholipid (Skoshibara-K et al, Skoshikaohuat et al, Skojin. K-a, Skojin et al, Skojin, tetrahedron lett, 1995,36, 3651-; shear et al, Nucleic Acids res, 1990,18, 3777-containing 3783), polyamine or polyethylene glycol chains (Manoharan et al, Nucleic Acids & Nucleic Acids, 1995,14, 969-containing 973) or adamantane acetic acid or palmityl moieties (Mishra et al, biochim. biophysis. acta,1995,1264, 229-containing 237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (crooo et al, j.pharmacol. exp. ther. 1996,277, 923-containing 937), tocopheryl groups (Nishina et al, Molecular Therapy Nucleic Acids,2015,4, e 220; and Nishina et al, Molecular Therapy,2008,16, 734-.

1.Conjugation moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, mercaptocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarins, fluorophores, and dyes.

In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin (aspirin), warfarin (warfarin), phenylbutazone (phenylbutazone), ibuprofen (ibuprol), suprofen (suprofen), fenbufen (fen-bufen), ketoprofen (ketoprofen), (S) - (+) -pranoprofen ((S) - (+) -pranoprofen), carprofen (carprofen), dansylsarcosine (dansylsarcosine), 2,3, 5-triiodobenzoic acid, fingolimod (fingolimod), flufenamic acid (flufenamic acid), folinic acid (folinic acid), benthiazine (benthiazide), chlorothiazide (chlorothiazide), diazepine (diazepine), indomethacin (indo-methicin), barbiturate (barbiturate), subphalazone (sulbactam), or an antibiotic.

2.Conjugated linkers

The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide by a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In certain such embodiments, the conjugate linker comprises a group selected from the group consisting of an alkyl group, an amino group, an oxo group, an amide, and an ether group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an amide group. In certain embodiments, the conjugate linker comprises a group selected from an alkyl group and an ether group. In certain embodiments, the conjugate linker comprises at least one phosphorous-containing moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

In certain embodiments, a conjugate linker, including those described above, is a bifunctional linking moiety, such as those known in the art to be useful for linking a conjugate group to a parent compound, such as an oligonucleotide provided herein. Generally, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected for reaction with a specific site on the parent compound and the other is selected for reaction with the conjugate group. Examples of functional groups for use in the bifunctional linking moiety include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3, 6-dioxaoctanoic Acid (ADO), 4- (N-maleimidomethyl) cyclohexane-1-carboxylic acid succinimidyl ester (SMCC), and 6-aminocaproic acid (AHEX or AHA). Other conjugated linkers include, but are not limited to, substituted or unsubstituted C₁-C₁₀Alkyl, substituted or unsubstituted C₂-C₁₀Alkenyl or substituted or unsubstituted C₂-C₁₀Alkynyl, wherein a non-limiting list of preferred substituent groups includes hydroxy, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugated linker comprises exactly 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine, or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from the group consisting of uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. Cleavage of the linker-nucleoside from the oligomeric compound is typically required after the oligomeric compound reaches the target tissue. Thus, linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound through a cleavable bond. In certain embodiments, such cleavable linkage is a phosphodiester linkage.

Herein, linker-nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where the oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or having a specified percentage of complementarity to a reference nucleic acid, and the oligomeric compound further comprises a conjugate group comprising a linker-nucleoside conjugated linker, those linker-nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, the oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides attached to the nucleosides of the modified oligonucleotide. The total number of linked nucleosides in such oligomeric compounds is greater than 30. Alternatively, the oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of linked nucleosides in such oligomeric compounds is at most 30. Unless otherwise indicated, the conjugate linker comprises up to 10 linker-nucleosides. In certain embodiments, the conjugate linker comprises up to 5 linker-nucleosides. In certain embodiments, the conjugate linker comprises up to 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises up to 2 linker-nucleosides. In certain embodiments, the conjugate linker comprises up to 1 linker-nucleoside.

In certain embodiments, cleavage of the conjugate group from the oligonucleotide is desired. For example, in certain instances, oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound is taken up, it is desirable that the conjugate group be cleaved to release unbound or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cellular or subcellular compartment, such as the lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

In certain embodiments, the cleavable bond is selected from: one or two of amide, ester, ether, phosphodiester, phosphate, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both of the esters of phosphodiesters. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate ester bond between the oligonucleotide and the conjugate moiety or conjugate group.

In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to each other and to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable linkages are unmodified phosphodiester linkages. In certain embodiments, the cleavable moiety is a 2' -deoxynucleoside that is linked to the 3' -or 5' -terminal nucleoside of the oligonucleotide by a phosphate internucleoside linkage and covalently linked to the conjugate linker or the remainder of the conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2' -deoxyadenosine.

B.Certain end groups

In certain embodiments, the oligomeric compounds comprise one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stable 5' -phosphate ester. Stable 5' -phosphates include, but are not limited to, 5' -phosphonates including, but not limited to, 5' -vinyl phosphonates. In certain embodiments, the end group comprises one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, the end group comprises one or more 2' -linked nucleosides. In certain such embodiments, the 2' -linked nucleoside is an abasic nucleoside.

III.Oligomeric duplexes

In certain embodiments, the oligomeric compounds described herein comprise oligonucleotides having nucleobase sequences complementary to a target nucleic acid. In certain embodiments, the oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomerized duplex comprises or consists of: (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise non-complementary pendant nucleosides.

IV.Antisense Activity

In certain embodiments, the oligomeric compounds and the oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity when it reduces or inhibits the amount or activity of a target nucleic acid by 25% or more in a standard cellular assay. In certain embodiments, the antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids resulting in one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids or hybridize to one or more non-target nucleic acids in a manner that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of an antisense compound to a target nucleic acid recruits proteins that cleave the target nucleic acid. For example, certain antisense compounds cause RNase H-mediated cleavage of a target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA-DNA duplex. Such RNA the DNA in the DNA duplex need not be unmodified DNA. In certain embodiments, there is a need herein for antisense compounds that are sufficiently "DNA-like" to cause rnase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the nicks of the gapmer are tolerated.

In certain antisense activities, the antisense compound or a portion of the antisense compound is loaded into the RNA-induced silencing complex (RISC), ultimately causing cleavage of the target nucleic acid. For example, certain antisense compounds cause cleavage of a target nucleic acid by Argonaute. The antisense compound loaded into RISC is an RNAi compound. The RNAi compounds can be double stranded (siRNA) or single stranded (ssRNA).

In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not recruit proteins that cleave the target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid alters splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid inhibits binding interactions between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid alters translation of the target nucleic acid.

Antisense activity can be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity involves observation or detection of a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a change in the phenotype of the cell or animal.

V.Certain target nucleic acids

In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from the group consisting of: mature mRNA and pre-mRNA, including introns, exons and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a countergene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: long non-coding RNA, short non-coding RNA, intron RNA molecules.

A.Complementarity/mismatch with target nucleic acid

Mismatched bases can be introduced without abolishing activity. For example, Gautschi et al (J.Natl. cancer Inst.93:463-471, month 3 2001) demonstrated the ability of oligonucleotides 100% complementary to bcl-2mRNA and having 3 mismatches to bcl-xL mRNA to reduce expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent antitumor activity in vivo. Maher and Dolnick (Nuc.acid. Res.16:3341-3358,1988) tested a series of tandem 14 nucleobase oligonucleotides and 28 nucleobase and 42 nucleobase oligonucleotides, respectively, consisting of sequences of two or three tandem oligonucleotides, for their ability to inhibit translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, but at a lower level than either the 28 nucleobase or 42 nucleobase oligonucleotides.

In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprises a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the fully complementary region is 6 to 20, 10 to 18, or 18 to 20 nucleobases long.

In certain embodiments, the oligonucleotide comprises one or more nucleobases that are mismatched relative to the target nucleic acid. In certain embodiments, such mismatches reduce antisense activity against a target, but reduce activity against a non-target by a greater amount. Thus, in certain embodiments, the selectivity of the oligonucleotide is increased. In certain embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1,2, 3, 4,5, 6,7, or 8 from the 5' -end of the notch region. In certain embodiments, the mismatch is at positions 9,8, 7,6, 5,4, 3,2, 1 from the 3' -end of the notch region. In certain embodiments, the mismatch is at position 1,2, 3 or 4 from the 5' -end of the wing region. In certain embodiments, the mismatch is at position 4,3, 2 or 1 from the 3' -end of the wing region.

B.ATXN2

In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is ATXN 2. In certain embodiments, the ATXN2 nucleic acid has the sequence shown in SEQ ID NO:1(GENBANK accession No.: NM-002973.3) and SEQ ID NO:2 (the complement of GENBANK accession No.: NT-009775.17 truncated from nucleotide 2465000 to 2616000).

In certain embodiments, contacting the cell with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of ATXN2mRNA, and in certain embodiments, reduces the amount of Ataxin-2 protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting the cell with an oligomeric compound complementary to SEQ ID NO. 1 or SEQ ID NO. 2 improves one or more symptoms or markers of a neurodegenerative disease. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the symptom or marker is ataxia, neuropathy, or aggregate formation. In certain embodiments, contacting a cell with a modified oligonucleotide complementary to SEQ ID No. 1 or SEQ ID No. 2 improves motor function, reduces neuropathy, and reduces aggregate number. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.

C.Certain target nucleic acids in certain tissues

In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is cells and tissues that make up the Central Nervous System (CNS). Such tissues include brain tissue, such as cortex, spinal cord, hippocampus, pons, cerebellum, substantia nigra, nucleus rubra, medulla, optic colliculus, and dorsal root ganglion.

VI.Certain pharmaceutical compositions

In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and Phosphate Buffered Saline (PBS). In certain embodiments, the sterile PBS is a pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is of pharmaceutical grade.

In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and the artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and the artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is of pharmaceutical grade.

In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipient is selected from the group consisting of water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylases, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.

In certain embodiments, the oligomeric compounds may be mixed with pharmaceutically acceptable active and/or inert substances to prepare pharmaceutical compositions or preparations. The compositions and methods used to formulate pharmaceutical compositions depend on a number of criteria including, but not limited to, the route of administration, the extent of the disease, or the dosage to be administered.

In certain embodiments, a pharmaceutical composition comprising an oligomeric compound encompasses any pharmaceutically acceptable salt of an oligomeric compound, an ester of an oligomeric compound, or a salt of such an ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric compound comprising one or more oligonucleotides is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof upon administration to an animal, including a human. Thus, for example, the invention also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents of the oligomeric compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups attached to an oligonucleotide, wherein the conjugate group is cleaved in vivo by an endogenous nuclease.

Lipid moieties have been used in nucleic acid therapy in a variety of methods. In certain such methods, nucleic acids, such as oligomeric compounds, are incorporated into preformed liposomes or lipid complexes made from mixtures of cationic and neutral lipids. In certain methods, complexes of DNA with mono-or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, the lipid moiety is selected to increase the distribution of the agent to a particular cell or tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the drug to the adipose tissue. In certain embodiments, the lipid moiety is selected to increase the distribution of the agent to muscle tissue.

In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including pharmaceutical compositions comprising hydrophobic compounds. In certain embodiments, certain organic solvents are used, such as dimethyl sulfoxide.

In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents of the present invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Some such cosolvent systems comprise, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a mixture comprising 3% w/v benzyl alcohol, 8% w/v non-polar surfactant Polysorbate 80^TMAnd 65% w/v polyethylene glycol 300 in absolute ethanol. The ratio of such co-solvent systems can be varied significantly without significantly altering the solubility and toxicity characteristics. Furthermore, the nature of the co-solvent component may vary: for example, other surfactants may be used in place of Polysorbate 80^TM(ii) a The polyethylene glycol may vary in size; other biocompatible polymers may be substituted for polyethyleneGlycols, such as polyvinylpyrrolidone; and other sugars or polysaccharides may be substituted for dextrose.

In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, Intrathecal (IT), Intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients to aid in dissolution or to act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using suitable liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.

Under certain conditions, certain compounds disclosed herein act as acids. While such compounds may be drawn or described in protonated (free acid) form, ionized (anionic) form, or ionized and associated with cationic (salt) form, aqueous solutions of such compounds exist in equilibrium in such forms. For example, the phosphate ester linkages of oligonucleotides in aqueous solution exist in equilibrium as the free acid, anion and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. In addition, some oligonucleotides have several such linkages, each in equilibrium. Thus, the oligonucleotides in solution are present in a set that is in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The depicted architecture necessarily depicts a single form. However, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. Herein, the structure of the free acid depicting the compound followed by the term "or salt thereof" specifically includes all such forms that can be fully or partially protonated/deprotonated/associated with a cation. In some cases, one or more specific cations are identified.

In certain embodiments, the oligomeric compounds disclosed herein are in an aqueous solution with sodium. In certain embodiments, the oligomeric compound is in an aqueous solution with potassium. In certain embodiments, the oligomeric compound is in an artificial CSF. In certain embodiments, the oligomeric compound is in PBS. In certain embodiments, the oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve the desired pH.

VII.Certain compositions

1.Compound number: 874218

Compound number: 874218 can be characterized as a 5-10-5MOE gapmer, having a sequence (from 5 'to 3') GTACTTTTCTCATGTGCGGC (incorporated herein as SEQ ID NO:1714), wherein each of nucleosides 1-5 and 16-20 (from 5 'to 3') comprises a 2'-MOE modification and each of nucleosides 6-15 is a 2' -deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3,3 to 4,4 to 5,5 to 6,16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2,6 to 7,7 to 8,8 to 9,9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

Compound number: 780241 may be characterized by the following chemical symbols: ges Teo Aeo mCeo Teo Tds Tds Tds mCDs Ads Tds Tds Tds Geo mCeo Ges mCE; wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Compound number: 874218 can be represented by the following chemical structure:

SEQ ID NO:1714

structure 1 Compound No. 874218

In certain embodiments, the compound is numbered: 874218 the sodium salt can be represented by the following chemical structure:

SEQ ID NO:1714

structure 2 sodium salt of Compound No. 874218

2.Compound number: 1008854

Compound number: 1008854 can be characterized as a 4-10-6MOE gapmer, having a sequence (from 5 'to 3') CTGCTAACTGGTTTGCCCTT (incorporated herein as SEQ ID NO:1255) wherein each of nucleosides 1-4 and 15-20 (from 5 'to 3') comprises a 2'-MOE modification and each of nucleosides 5-14 is a 2' -deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3,3 to 4,4 to 5, 15 to 16, 16 to 17, 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2,5 to 6,6 to 7,7 to 8,8 to 9,9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

Compound number: 1008854 may be characterized by the following chemical symbols: mCES Teo Geo mCEO Tds Ads Ads mCES Tds Gds Tds Tds Tds Geo mCEO mCES Tes Te; wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Compound number: 1008854 can be represented by the following chemical structure:

SEQ ID NO:1255

structure 3 Compound No. 1008854

In certain embodiments, the compound is numbered: 1008854 the sodium salt can be represented by the following chemical structure:

SEQ ID NO:1255

structure 4 sodium salt of Compound No. 1008854

3.Compound number: 1008862

Compound number: 1008862 can be characterized as a 6-10-4MOE gapmer, having a sequence (from 5 'to 3') TGTACTTCACATTTGGAGCC (incorporated herein as SEQ ID NO:1185), wherein each of nucleosides 1-6 and 17-20 (from 5 'to 3') comprises a 2'-MOE modification and each of nucleosides 7-16 is a 2' -deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3,3 to 4,4 to 5,5 to 6,6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2,7 to 8,8 to 9,9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17,18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

Compound number: 1008862 may be characterized by the following chemical symbols: tes Geo Teo Aeo mCoo Teo Tds mCDs Ads mCDs Tds Tds Gds Gds Aeo Ges mCE; wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Compound number: 1008862 can be represented by the following chemical structure:

SEQ ID NO:1185

structure 5 Compound No. 1008862

In certain embodiments, the compound is numbered: 1008862 the sodium salt can be represented by the following chemical structure:

(SEQ ID NO:1185)

structure 6 sodium salt of Compound No. 1008862

4.Compound number: 1008870

Compound number: 1008870 can be characterized as a 6-10-4MOE gapmer, having a sequence (from 5 'to 3') TGGATTCTGTACTTTTCTCA (incorporated herein as SEQ ID NO:3235), wherein each of nucleosides 1-6 and 17-20 (from 5 'to 3') comprises a 2'-MOE modification and each of nucleosides 7-16 is a 2' -deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3,3 to 4,4 to 5,5 to 6,6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2,7 to 8,8 to 9,9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17,18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

Compound number: 1008870 may be characterized by the following chemical symbols: tes Geo Teo Teo mCDs Tds Tds Tds Ads mCDs Tds Tds mCoo Tes mCES Ae; wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Compound number: 1008870 can be represented by the following chemical structure:

SEQ ID NO:3235

structure 7, Compound No. 1008870

In certain embodiments, the compound is numbered: 1008870 the sodium salt can be represented by the following chemical structure:

SEQ ID NO:3235

structure 8, sodium salt of Compound No. 1008870

5.Compound number: 1008874

Compound number: 1008874 can be characterized as a 6-10-4MOE gapmer, having a sequence (from 5 'to 3') CCTATCATCATTTTCCAGGG (incorporated herein as SEQ ID NO:158), wherein each of nucleosides 1-6 and 17-20 (from 5 'to 3') comprises a 2'-MOE modification and each of nucleosides 7-16 is a 2' -deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3,3 to 4,4 to 5,5 to 6,6 to 7, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2,7 to 8,8 to 9,9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17,18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

Compound number: 1008874 may be characterized by the following chemical symbols: mCES mCEO Teo Aeo Teo mCEO Ads Tds mCDS Ads Tds Tds Tds mCDS Aeo Ges Ge; wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Compound number: 1008874 can be represented by the following chemical structure:

SEQ ID NO:158

structure 9 Compound No. 1008874

In certain embodiments, the compound is numbered: 1008874 the sodium salt can be represented by the following chemical structure:

SEQ ID NO:158

structure 10 sodium salt of Compound No. 1008874

6.Compound number: 1008910

Compound number: 1008910 can be characterized as a 5-10-5MOE gapmer, having a sequence (from 5 'to 3') TCTGTACTTTTCTCATGTGC (incorporated herein as SEQ ID NO:2544), wherein each of nucleosides 1-5 and 16-20 (from 5 'to 3') comprises a 2'-MOE modification and each of nucleosides 6-15 is a 2' -deoxynucleoside, wherein the internucleoside linkages between nucleosides 2 to 3,3 to 4,4 to 5,16 to 17, and 17 to 18 are phosphodiester internucleoside linkages and the internucleoside linkages between nucleosides 1 to 2,5 to 6,6 to 7,7 to 8,8 to 9,9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate internucleoside linkages, and wherein each cytosine is a 5-methylcytosine.

Compound number: 1008910 may be characterized by the following chemical symbols: tes mCeo Teo Tes Ads mCDs Tds Tds Tds Tds mCDs Tds Tds mCos Ads Teo Geo Tes mCs; wherein the content of the first and second substances,

a is an adenine nucleobase,

mC-5-methylcytosine nucleobase,

g is a guanine nucleobase,

t-thymidylate nucleobase,

e-sugars modified with 2' -MOE,

d is 2' -deoxyribose,

s ═ phosphorothioate internucleoside linkages, and

o ═ phosphodiester internucleoside linkages.

Compound number: 1008910 can be represented by the following chemical structure:

SEQ ID NO:2544

structure 11, Compound number 1008910

In certain embodiments, the compound is numbered: 1008910 the sodium salt can be represented by the following chemical structure:

SEQ ID NO:2544

structure 12 sodium salt of Compound No. 1008910

Certain comparative compositions

In certain embodiments, compound No. 564122 is a comparative composition, previously described in WO 2015/143246 and Scoles et al, Nature,2017,544(7650):362-366 (all incorporated herein by reference). Compound number 564122 is a 5-10-5MOE gapmer, having the sequence (from 5' to 3') TGCATAGATTCCATCAAAAG (incorporated herein as SEQ ID NO: 67) wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 comprises 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564127 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound number 564127 is a 5-10-5MOE gapmer, having the sequence (from 5' to 3') CTCTCCATTATTTCTTCACG (incorporated herein as SEQ ID NO: 33), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 comprises 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564133 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound number 564133 is a 5-10-5MOE gapmer, having the sequence (from 5' to 3') GCTAACTGGTTTGCCCTTGC (incorporated herein as SEQ ID NO: 32), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 comprises 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564143 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound No. 564143 is a 5-10-5MOE gapmer having the sequence (from 5 'to 3') GGAGCTGGAGAACCATGAGC (as SEQ ID NO:188 andas used herein), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each of nucleosides 1-5 and 16-20 comprises a 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564150 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound number 564150 is a 5-10-5MOE gapmer, having the sequence (from 5' to 3') CTGGTACAGTTGCTGCTGCT (incorporated herein as SEQ ID NO: 330), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 comprises 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564188 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound number 564188 is a 5-10-5MOE gapmer, having the sequence (from 5' to 3') CCCAAAGGGTTAATTAGGAT (incorporated herein as SEQ ID NO: 2901), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 comprises 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564210 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound number 564210 is a 5-10-5MOE gapmer, having the sequence (from 5' to 3') CCCATACGCGGTGAATTCTG (incorporated herein as SEQ ID NO: 112), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 comprises 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, compound No. 564216 is a comparative composition, previously described in WO 2015/143246 and Scoles, 2017. Compound number 564216 is a 5-10-5MOE gapmer, having the sequence (from 5 'to 3') GTGGGATACAAATTCTAGGC (incorporated herein as SEQ ID NO: 190), wherein each cytosine is a 5-methylcytosine, each internucleoside linkage is a phosphorothioate internucleoside linkage and each of nucleosides 1-5 and 16-20 is a phosphodiester internucleoside linkageOne comprising 2' -OCH₂CH₂OCH₃A group.

In certain embodiments, the compounds described herein are superior to the compounds described in WO 2015/143246 and Scoles,2017 in that these compounds exhibit one or more improved properties.

Compound 874218

For example, as provided in example 13 (below), compound 874218 displayed a functional observation combination (FOB) score of 1.00 in wild-type mice, while composition numbers were compared: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 each exhibited a FOB score of 7.00. Thus, compound 874218 is clearly more numbered in this assay than the comparative composition: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 are each more tolerant.

Compound 1008854

For example, as provided in example 13 (below), compound 1008854 displayed a functional observation combination (FOB) score of 1.00 in wild-type mice, while composition numbers were compared: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 each exhibited a FOB score of 7.00. Thus, compound 1008854 is clearly more numbered in this assay than the comparative composition: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 are each more tolerant.

Compound 1008862

For example, as provided in example 13 (below), compound 1008862 displayed a functional observation combination (FOB) score of 2.50 in wild-type mice, while composition numbers were compared: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 each exhibited a FOB score of 7.00. Thus, compound 1008862 is clearly more numbered in this assay than the comparative composition: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 are each more tolerant.

Compound 1008870

For example, as provided in example 13 (below), compound 1008870 displayed a functional observation combination (FOB) score of 1.00 in wild-type mice, while composition numbers were compared: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 each exhibited a FOB score of 7.00. Thus, compound 1008870 is clearly more numbered in this assay than the comparative composition: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 are each more tolerant.

Compound 1008874

For example, as provided in example 13 (below), compound 1008874 displayed a functional observation combination (FOB) score of 1.25 in wild-type mice, while composition numbers were compared: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 each exhibited a FOB score of 7.00. Thus, compound 1008874 is clearly more numbered in this assay than the comparative composition: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 are each more tolerant.

Compound (I)1008910

For example, as provided in example 13 (below), compound 1008910 displayed a functional observation combination (FOB) score of 0.00 in wild-type mice, while composition numbers were compared: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 each exhibited a FOB score of 7.00. Thus, compound 1008910 is clearly more numbered in this assay than the comparative composition: 564122, 564127, 564133, 564143, 564150, 564188, 564210, and 564216 are each more tolerant.

IX. certain hot spot areas

1.Nucleobase 2,455-2,483 of SEQ ID NO:1

In certain embodiments, nucleobase 2,455-2,483 of SEQ ID NO:1 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 2,455-2,483 of SEQ ID NO 1. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NOS 286, 287, 1113, 1188, 1260, 1336, 1412, 2391, 2468 and 3002 are complementary to the nucleobases 2,455-2,483 of SEQ ID NO. 1.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 2,455-2,483 of SEQ ID NO:1 achieves at least a 67% reduction in ATXN2RNA in vitro in a standard cellular assay.

2.Nucleobase 4,393-4,424 of SEQ ID NO. 1

In certain embodiments, the nucleobase 4,393-4,424 of SEQ ID NO. 1 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 4,393-4,424 of SEQ ID NO. 1. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO:1945, 2020, 2316, 2392, 2469, 2546, 2623, 2697, 2926, 3003, 3080 and 3157 are complementary to the nucleobase 4,393 4,424 of SEQ ID NO: 1.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 4,393-4,424 of SEQ ID NO:1 achieves at least a 64% reduction in ATXN2RNA in vitro in a standard cellular assay.

3.Nucleobase 4,413-4,437 of SEQ ID NO:1

In certain embodiments, nucleobase 4,413-4,437 of SEQ ID NO:1 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 4,413-4,437 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2247, 2317, 2393, 2470, 2927 and 3004 are complementary to the nucleobases 4,413-4,437 of SEQ ID NO 1.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 4,413-4,437 of SEQ ID NO:1 achieves at least a 68% reduction of ATXN2RNA in vitro in a standard cellular assay.

4.Nucleobase 4,525-4,554 of SEQ ID NO:2

In certain embodiments, nucleobase 4,525-4,554 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 4,525-4,554 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO:1948, 2319, 2549, 2625, 2701, 2777, 2853, 2929, 3006, 3083 and 3160 are complementary to the nucleobase 4,525-4,554 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 4,525-4,554 of SEQ ID NO 2 achieves at least a 79% reduction in ATXN2RNA in vitro in a standard cellular assay.

5.Nucleobase 4,748-4,771 of SEQ ID NO. 2

In certain embodiments, nucleobase 4,748-4,771 of SEQ ID NO 2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 4,748-4,771 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2175, 2626, 2702, 2778 and 3161 are complementary to the nucleobases 4,748-4,771 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 4,748-4,771 of SEQ ID NO 2 achieves at least a 70% reduction in ATXN2RNA in vitro in a standard cellular assay.

6.Nucleobase 9, 927-one 9,954 of SEQ ID NO. 2

In certain embodiments, nucleobase 9,927-9,954 of SEQ ID NO 2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 9,927-9,954 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2177, 2399, 2476, 2553, 2629, 2705, 3010, 3087 and 3164 are complementary to the nucleobases 9,927-9,954 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 9,927-9,954 of SEQ ID NO 2 achieves at least a 62% reduction in ATXN2RNA in vitro in a standard cellular assay.

7.Nucleobase 10,345-10,368 of SEQ ID NO. 2

In certain embodiments, the nucleobase 10,345-10,368 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 10,345-10,368 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NOS 2323, 2400, 2477, 2933 and 3011 are complementary to the nucleobases 10,345-10,368 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 10,345-10,368 of SEQ ID NO. 2 achieves at least an 87% reduction in ATXN2RNA in vitro in a standard cellular assay.

8.Nucleobase 17,153-17,182 of SEQ ID NO 2

In certain embodiments, nucleobase 17,153-17,182 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 17,153-17,182 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 973, 2479, 2556, 2632, 2708, 2784, 2860, 2936, 3013, 3090 and 3167 are complementary to the nucleobases 17,153-17,182 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 17,153-17,182 of SEQ ID NO 2 achieves at least a 68% reduction of ATXN2RNA in vitro in a standard cellular assay.

9.Nucleobase 18,680-18,702 of SEQ ID NO 2

In certain embodiments, nucleobase 18,680-18,702 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 18,680-18,702 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2256, 2557, 3014 and 3091 are complementary to the nucleobases 18,680-18,702 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 18,680-18,702 of SEQ ID NO 2 achieves at least a 65% reduction of ATXN2RNA in vitro in a standard cellular assay.

10.Nucleobase 23,251-23,276 of SEQ ID NO 2

In certain embodiments, nucleobase 23,251-23,276 of SEQ ID NO 2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 23,251-23,276 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 1805, 2635, 2711, 2787, 2863, 2939 and 3170 are complementary to the nucleobases 23,251-23,276 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 23,251-23,276 of SEQ ID NO 2 achieves at least a 64% reduction of ATXN2RNA in vitro in a standard cellular assay.

11.The nucleobase 28,081-28,105 of SEQ ID NO 2

In certain embodiments, the nucleobase 28,081-28,105 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 28,081-28,105 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2259, 2331, 2713, 2789, 2865 and 2941 are complementary to the nucleobases 28,081-28,105 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 28,081-28,105 of SEQ ID NO 2 achieves at least a 62% reduction in ATXN2RNA in standard cellular assays.

12.Nucleobase 28,491-28,526 of SEQ ID NO 2

In certain embodiments, the nucleobase 28,491-28,526 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 28,491-28,526 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequence of SEQ ID NO 669, 746, 2562, 2638, 2714, 2790, 2866, 3019, 3096 and 3173 is complementary to the nucleobase 28,491 and 28,526 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 28,491-28,526 of SEQ ID NO 2 achieves at least a 67% reduction in ATXN2RNA in vitro in a standard cellular assay.

13.Nucleobase 28,885-28,912 of SEQ ID NO. 2

In certain embodiments, nucleobase 28,885-28,912 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 28,885-28,912 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 977, 2486, 2563, 2639, 2715, 2791, 3020, 3097 and 3174 are complementary to the nucleobases 28,885 and 28,912 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 28,885-28,912 of SEQ ID NO 2 achieves at least a 75% reduction in ATXN2RNA in vitro in a standard cellular assay.

14.Nucleobase 32,328-32,352 of SEQ ID NO 2

In certain embodiments, the nucleobase 32,328-32,352 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 32,328-32,352 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2109, 2334, 2411, 2488, 2565 and 3022 are complementary to the nucleobases 32,328-32,352 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 32,328-32,352 of SEQ ID NO 2 achieves at least a 66% reduction in ATXN2RNA in vitro in a standard cellular assay.

15.Nucleobase 32,796-32,824 of SEQ ID NO. 2

In certain embodiments, the nucleobase 32,796-32,824 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 32,796-32,824 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 902, 2335, 2412, 2489, 2566, 2869, 2945, 3023, 3100 and 3177 are complementary to the nucleobases 32,796-32,824 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 32,796-32,824 of SEQ ID NO 2 achieves at least a 72% reduction in ATXN2RNA in vitro in a standard cellular assay.

16.Nucleobase 32,809-32,838 of SEQ ID NO. 2

In certain embodiments, the nucleobase 32,809-32,838 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 32,809-32,838 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 979, 2336, 2413, 2490, 2567, 2643, 2870, 2946, 3024, 3101 and 3178 are complementary to the nucleobases 32,809-32,838 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 32,809-32,838 of SEQ ID NO. 2 achieves at least a 60% reduction of ATXN2RNA in vitro in a standard cellular assay.

17.Nucleobase 36,308-36,334 of SEQ ID NO 2

In certain embodiments, the nucleobases 36,308-36,334 of SEQ ID NO 2 comprise a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 36,308-36,334 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 1280, 2338, 2415, 2644, 2720, 2796, 2872 and 2948 are complementary to the nucleobases 36,308-36,334 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 36,308-36,334 of SEQ ID NO 2 achieves at least a 69% reduction of ATXN2RNA in vitro in a standard cellular assay.

18.The nucleobase 36,845-36,872 of SEQ ID NO 2

In certain embodiments, the nucleobase 36,845-36,872 of SEQ ID NO 2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 36,845-36,872 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2035, 2339, 2645, 2721, 2797, 2873, 2949, 3103 and 3180 are complementary to the nucleobases 36,845-36,872 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 36,845-36,872 of SEQ ID NO. 2 achieves at least a 63% reduction of ATXN2RNA in vitro in a standard cellular assay.

19.Nucleobase 49,147-49,173 of SEQ ID NO. 2

In certain embodiments, nucleobases 49,147-49,173 of SEQ ID NO. 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 49,147-49,173 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequence of SEQ ID NO:1439, 2575, 2651, 2727, 2803, 3032, 3109 and 3186 is complementary to the nucleobase 49,147-49,173 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 49,147-49,173 of SEQ ID NO. 2 achieves at least a 69% reduction of ATXN2RNA in vitro in a standard cellular assay.

20.Nucleobase 57,469-57,494 of SEQ ID NO. 2

In certain embodiments, the nucleobases 57,469-57,494 of SEQ ID NO. 2 comprise a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 57,469-57,494 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2045, 2121, 2426, 2503, 2580, 3037 and 3114 are complementary to the nucleobases 57,469-57,494 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 57,469-57,494 of SEQ ID NO. 2 achieves at least a 49% reduction in ATXN2RNA in vitro in a standard cellular assay.

21.Nucleobase 82,848-82,874 of SEQ ID NO. 2

In certain embodiments, the nucleobase 82,848-82,874 of SEQ ID NO:2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 82,848-82,874 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 1982, 2359, 2436, 2513, 2590, 2969, 3047 and 3124 are complementary to the nucleobases 82,848-82,874 of SEQ ID NO 2.

In certain embodiments, a modified oligonucleotide complementary to nucleobase 82,848-82,874 of SEQ ID NO:2 achieves at least a 57% reduction in ATXN2RNA in vitro in a standard cellular assay.

22, nucleobase 83,784-83,813 of SEQ ID NO 2

In certain embodiments, the nucleobases 83,784-83,813 of SEQ ID NO 2 comprise a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 83,784-83,813 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 849, 2361, 2438, 2515, 2592, 2668, 2744, 2971, 3049, 3126 and 3203 are complementary to the nucleobases 83,784-83,813 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 83,784-83,813 of SEQ ID NO 2 achieves at least a 76% reduction in ATXN2RNA in vitro in a standard cellular assay.

23.Nucleobase 84,743-84,782 of SEQ ID NO. 2

In certain embodiments, the nucleobases 84,743-84,782 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 84,743-84,782 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 2210, 2441, 2518, 2595, 2671, 2747, 2823, 2899, 2975, 3052, 3129 and 3206 are complementary to the nucleobases 84,743,782 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 84,743-84,782 of SEQ ID NO 2 achieves at least a 58% reduction of ATXN2RNA in vitro in a standard cellular assay.

24.Nucleobase 84,813-84,839 of SEQ ID NO. 2

In certain embodiments, the nucleobases 84,813-84,839 of SEQ ID NO 2 comprise a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 84,813-84,839 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 542, 2286, 2672, 2748, 2824, 2900, 3130 and 3207 are complementary to the nucleobases 84,813-84,839 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 84,813-84,839 of SEQ ID NO. 2 achieves at least a 69% reduction in ATXN2RNA in vitro in a standard cellular assay.

25.The nucleobase 85,051-85,076 of SEQ ID NO. 2

In certain embodiments, the nucleobase 85,051-85,076 of SEQ ID NO 2 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 85,051-85,076 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO. 773, 850, 2673, 2749, 2825, 3131 and 3208 are complementary to the nucleobases 85,051-85,076 of SEQ ID NO. 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 85,051-85,076 of SEQ ID NO. 2 achieves at least a 57% reduction in ATXN2RNA in vitro in a standard cellular assay.

26.Nucleobases 97,618-97,643 of SEQ ID NO:2

In certain embodiments, the nucleobases 97,618-97,643 of SEQ ID NO:2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 97,618-97,643 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 1839, 2370, 2447, 2524, 2904, 2980 and 3058 are complementary to the nucleobases 97,618-97,643 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 97,618-97,643 of SEQ ID NO:2 achieves at least a 72% reduction of ATXN2RNA in vitro in a standard cellular assay.

27.The nucleobase 119,023-119,048 of SEQ ID NO. 2

In certain embodiments, the nucleobases 119,023-119,048 of SEQ ID NO. 2 comprises a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 119,023-119,048 of SEQ ID NO. 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO:2072, 2606, 2682, 2758, 2834, 3140 and 3217 are complementary to the nucleobases 119,023-119,048 of SEQ ID NO: 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 119,023-119,048 of SEQ ID NO. 2 achieves at least a 69% reduction in ATXN2RNA in vitro in a standard cellular assay.

28.Nucleobase 132,161-132,195 of SEQ ID NO 2

In certain embodiments, the nucleobases 132,161-132,195 of SEQ ID NO 2 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 132,161-132,195 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 1927, 2002, 2381, 2458, 2763, 2839, 2915 and 2991 are complementary to the nucleobases 132,161-132,195 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobase 132,161-132,195 of SEQ ID NO 2 achieves at least a 78% reduction in ATXN2RNA in vitro in a standard cellular assay.

29.The nucleobase 139,271-139,303 of SEQ ID NO 2

In certain embodiments, the nucleobases 139,271-139,303 of SEQ ID NO 2 comprise a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 139,271-139,303 of SEQ ID NO 2. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

The nucleobase sequences of SEQ ID NO 795, 872, 2540, 2617, 3074 and 3151 are complementary to the nucleobases 139,271-139,303 of SEQ ID NO 2.

In certain embodiments, the modified oligonucleotide complementary to nucleobases 139,271-139,303 of SEQ ID NO 2 achieves at least a 61% reduction of ATXN2RNA in vitro in a standard cellular assay.

30.Nucleobase 1,075-1,146 of SEQ ID NO. 1

In certain embodiments, the nucleobase 1,075-1,146 of SEQ ID NO:1 comprises a hot spot region. In certain embodiments, the modified oligonucleotide is complementary to nucleobase 1,075-1,146 of SEQ ID NO. 1. In certain embodiments, the modified oligonucleotide is 20 nucleobases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer. In certain embodiments, the gapmer is a 6-10-4MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: in certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged from 5 'to 3' in the following order: sooossssssssoss.

33, 1485, 1561, 1637, 1714, 1788, 1861, 1936, 2013, 2088, 2164, 2467, 2544, 3001, 3232, 3233, 3234, 3235, 3237, 3238, 3239, 3298, 3299, 3300 and 3301 of SEQ ID NO. 1 are complementary to nucleobase 1,075-1,146 of SEQ ID NO. 1.

In certain embodiments, a modified oligonucleotide complementary to nucleobase 1,075-1,146 of SEQ ID NO:1 achieves at least a 49% reduction in ATXN2mRNA in standard cellular assays in vitro.

Non-limiting disclosure and incorporation by reference

Each of the documents and patent publications listed herein is incorporated by reference in its entirety.

While certain compounds, compositions, and methods described herein have been described with specificity in accordance with certain embodiments, the following examples are intended only to illustrate the compounds described herein and are not intended to be limiting thereof. Each reference, GenBank accession number, etc., recited in this application is incorporated herein by reference in its entirety.

Although the sequence listing accompanying this application identifies each sequence as "RNA" or "DNA" as appropriate, in practice, those sequences may be modified by any combination of chemical modifications. One skilled in the art will readily appreciate that the names describing modified oligonucleotides, such as "RNA" or "DNA", are in some cases arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2' -OH sugar moiety and a thymine base can be referred to as DNA having a modified sugar (2' -OH in place of one 2' -H of the DNA) or as RNA having a modified base (thymine (methylated uracil) in place of uracil of the RNA). Thus, nucleic acid sequences provided herein, including (but not limited to) sequences in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including (but not limited to) such nucleic acids having modified nucleobases. By way of further example and without limitation, oligomeric compounds having a nucleobase sequence "ATCGATCG" encompass any oligomeric compound having such nucleobase sequence, whether modified or unmodified, including (but not limited to) compounds of this type that contain RNA bases, e.g., compounds having the sequence "auckucg", and compounds having some DNA bases and some RNA bases, e.g., "aucgacgatcg", and compounds having other modified nucleobases, e.g., "AT^mOligomeric compounds of CGAUCG ″, wherein^mC indicates a cytosine base containing a methyl group at position 5.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined according to absolute stereochemistry, such as (R) or (S), such as, for example, α or β of a sugar tautomer, or such as, for example, (D) or (L) of an amino acid, and the like. Compounds provided herein that are depicted or described as having certain stereoisomeric configurations include only the indicated compounds. Unless otherwise specified, compounds provided herein depicted or described without stereochemistry include all such possible isomers, including stereostructurally random and optically pure forms thereof. Likewise, unless otherwise indicated, tautomeric forms of the compounds herein are also included. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

The compounds described herein include variants in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, a compound containing a hydrogen atom herein encompasses each¹All possible deuterium substitutions of H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to:²h or³H is substituted for¹H，¹³C or¹⁴Substitution of C¹²C，¹⁵Substitution of N¹⁴N，¹⁷O or¹⁸Substitution of O for¹⁶O, and³³S、³⁴S、³⁵s or³⁶S substitution³²And S. In certain embodiments, non-radioactive isotopic substitution can confer novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioisotope substitution may render the compound suitable for research or diagnostic purposes, such as imaging.

Examples

The following examples illustrate certain embodiments of the present disclosure and are not limiting. Further, where specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for other oligonucleotides having the same or similar motif. And for example, unless otherwise indicated, where a particular high affinity modification occurs at a particular position, other high affinity modifications at the same position are deemed suitable.

Example 1: effect of 5-10-5MOE gapmers with Mixed internucleoside linkages on human ATXN2RNA in vitro, Single dose

Modified oligonucleotides complementary to human ATXN2 nucleic acid were designed and tested for their effect on ATXN2RNA in SCA2-04 cells. SCA2-04 is a patient fibroblast cell line with 34 CAG repeat units. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

Cultured SCA2-04 cells at a density of 20,000 cells/well were transfected using electroporation with modified oligonucleotides at 2,000 or 7,000nM concentrations, as indicated in the table below, or against untreated controls, without modified oligonucleotides. After approximately 24 hours, RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human primer probe set hAlaxin _ LTS01321 (forward sequence ATATGGACTCCAGTTATGCAAAAAGA, referred to herein as SEQ ID NO: 10; reverse sequence TCGCCATTCACTTTAGCACTGA, referred to herein as SEQ ID NO: 11; probe sequence ATGCTTTTACTGACTCTGC, referred to herein as SEQ ID:12) was used to measure RNA levels. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as a percentage of ATXN2RNA levels relative to untreated control cells.

The modified oligonucleotide labeled with an asterisk targets the amplicon region of the primer probe set. Other assays can be used to measure the potency and efficacy of oligonucleotides targeted to the amplicon region.

The modified oligonucleotides in the following table are 5-10-5MOE gapmers. The gapmer is 20 nucleobases long, with the central gap segment comprising ten 2 '-deoxynucleosides and flanked on the 5' and 3 'ends by wing segments comprising five 2' -MOE nucleosides. The sugar moiety of the gapmer is (from 5 'to 3'): eeeeededdddddddddddeeeee, wherein'd' represents 2 '-deoxyribose and' e 'represents a sugar modified with 2' -MOE. Internucleoside linkages are mixed phosphodiester and phosphorothioate internucleoside linkages. The internucleoside linkage elements of the gapmer are (from 5 'to 3'): sooossssssssssoss; wherein 'o' represents a phosphodiester internucleoside linkage and's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. The "start site" indicates the most 5' -nucleoside of the human nucleic acid sequence that is complementary to the gapmer. A "termination site" indicates the most 3' -nucleoside of a human nucleic acid sequence that is complementary to a gapmer.

Each of the modified oligonucleotides listed in the table below is complementary to the human ATXN2 nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:2, as indicated. 'N/A' indicates that the modified oligonucleotide is not complementary to the particular nucleic acid with 100% complementarity. As shown below, modified oligonucleotides complementary to the nucleobase sequence of human ATXN2 reduced the amount of human ATXN2 RNA.

TABLE 1

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages at a concentration of 7,000nM

TABLE 2

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages at a concentration of 2,000nM

TABLE 3

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages at a concentration of 2,000nM

TABLE 4

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages at a concentration of 2,000nM

TABLE 5

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages at a concentration of 2,000nM

TABLE 6

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages at a concentration of 2,000nM

Example 2: effect of 5-10-5MOE gapmers with Mixed internucleoside linkages on human ATXN2RNA expression in vitro, Single dose

Modified oligonucleotides complementary to human ATXN2 nucleic acids were designed and tested for their effect on ATXN2RNA in vitro.

Cultured a431 cells at a density of 10,000 cells/well were transfected at a concentration of 5,000nM of modified oligonucleotide or against untreated controls via free uptake without the use of modified oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human primer probe set RTS5049 (forward sequence CTACAGTCCTCAGCAGTTCC, referred to herein as SEQ ID NO: 13; reverse sequence GCCATCATTCTAGCATTACCCT, referred to herein as SEQ ID NO: 14; probe sequence ATCAGCCCCTTGTTCAGCATGTG, referred to herein as SEQ ID:15) was used to measure RNA levels. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as control percentages of ATXN2RNA levels relative to untreated control cells.

The modified oligonucleotides in the following table are 5-10-5MOE gapmers. The gapmer is 20 nucleobases long, with the central gap segment comprising ten 2 '-deoxynucleosides and flanked on the 5' and 3 'ends by wing segments comprising five 2' -MOE nucleosides. The sugar moiety of the gapmer is (from 5 'to 3'): eeeeededdddddddddddeeeee, wherein'd' represents 2 '-deoxyribose and' e 'represents a sugar modified with 2' -MOE. Internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage elements of the gapmer are (from 5 'to 3'): sooossssssssssoss; wherein 'o' represents a phosphodiester internucleoside linkage and's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. The "start site" indicates the most 5' -nucleoside of the human nucleic acid sequence that is complementary to the gapmer. A "termination site" indicates the most 3' -nucleoside of a human nucleic acid sequence that is complementary to a gapmer.

Each of the modified oligonucleotides listed in the table below is complementary to the human ATXN2 nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:2, as indicated. 'N/A' indicates that the modified oligonucleotide is not complementary to the particular nucleic acid with 100% complementarity. As shown below, modified oligonucleotides complementary to the nucleobase sequence of human ATXN2RNA reduced the amount of human ATXN2 RNA.

TABLE 8

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 9

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Example 3: effect of 5-10-5MOE gapmers with Mixed internucleoside linkages on human ATXN2RNA expression in vitro, Single dose

Modified oligonucleotides complementary to human ATXN2 nucleic acids were designed and tested for their effect on ATXN2RNA in vitro.

Cultured a431 cells at a density of 10,000 cells/well were transfected with the modified oligonucleotide at a concentration of 6,000nM or against untreated controls, using electroporation without the modified oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR as described in example 2. The results are presented in the table below as a percentage of ATXN2RNA levels relative to untreated control cells. The modified oligonucleotide labeled with an asterisk targets the amplicon region of the primer probe set. Other assays can be used to measure the potency and efficacy of oligonucleotides targeted to the amplicon region.

The modified oligonucleotides in the following table are 5-10-5MOE gapmers. The gapmer is 20 nucleobases long, with the central gap segment comprising ten 2 '-deoxynucleosides and flanked on the 5' and 3 'ends by wing segments comprising five 2' -MOE nucleosides. The sugar moiety of the gapmer is (from 5 'to 3'): eeeeededdddddddddddeeeee, wherein'd' represents 2 '-deoxyribose and' e 'represents a sugar modified with 2' -MOE. Internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage elements of the gapmer are (from 5 'to 3'): sooossssssssssoss; wherein 'o' represents a phosphodiester internucleoside linkage and's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. The "start site" indicates the most 5' -nucleoside of the human nucleic acid sequence that is complementary to the gapmer. A "termination site" indicates the most 3' -nucleoside of a human nucleic acid sequence that is complementary to a gapmer.

Each of the modified oligonucleotides listed in the table below is complementary to the human ATXN2 nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:2, as indicated. 'N/A' indicates that the modified oligonucleotide is not complementary to the particular nucleic acid with 100% complementarity. As shown below, modified oligonucleotides complementary to the nucleobase sequence of human ATXN2 reduced the amount of human ATXN2 RNA.

Watch 10

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 11

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 12

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 13

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 14

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 15

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 16

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 17

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 18

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 19

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 20

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 21

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 22

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 23

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 24

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 25

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 26

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 27

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 28

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 29

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 30

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 31

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 32

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

TABLE 33 control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 34

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 35

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 36

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 37

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 38

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 39

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 40

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Table 41

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 42

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Watch 43

Control percentage of human ATXN2RNA under 5-10-5MOE gapmer with mixed internucleoside linkages

Example 4: effect of 5-10-5MOE gapmers having mixed internucleoside linkages on human ATXN2RNA expression in vitro, multiple doses

Various doses of modified oligonucleotides selected from the above examples were tested in SCA2-04 cells. Cells were plated at a density of 20,000 cells/well and transfected using electroporation with modified oligonucleotides at concentrations of 31.25nM, 125.00nM, 500.00nM and 2,000.00nM, as indicated in the table below. Treatment at about 24 hoursAfter this period, all RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human ATXN2 primer probe set hAtaxin _ LTS01321 (described in example 1 above) was used to measure RNA levels. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as the percent expression of ATXN2RNA relative to untreated control cells. As illustrated in the table below, ATXN2RNA levels decreased in a dose-dependent manner in modified oligonucleotide-treated cells. IC was calculated using the "log (inhibitor) vs. reaction-variable slope (4 parameters)" equation using Prism6 software₅₀。

Watch 44

Dose-dependent reduction of human ATXN2RNA expression in SCA2-04 cells

TABLE 45

Dose-dependent reduction of human ATXN2RNA expression in SCA2-04 cells

TABLE 46

Dose-dependent reduction of human ATXN2RNA expression in SCA2-04 cells

Example 5: effect of 5-10-5MOE gapmers having mixed internucleoside linkages on human ATXN2RNA expression in vitro, multiple doses

Various doses of modified oligonucleotides selected from the above examples were tested in a431 cells. Cells were plated at a density of 10,000 cells/well and transfected by free uptake using modified oligonucleotides at concentrations of 0.44 μ M, 1.33 μ M, 4.00 μ M and 12.00 μ M as illustrated in the table below. After a treatment period of approximately 24 hours, all RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human ATXN2 primer probe set RTS5049 (described in example 2 above) was used to measure RNA levels. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as the percent expression of ATXN2RNA relative to untreated controls. As illustrated in the table below, ATXN2RNA levels decreased in a dose-dependent manner in modified oligonucleotide-treated cells. IC was calculated using the "log (inhibitor) vs. reaction-variable slope (4 parameters)" equation using Prism6 software₅₀。

Watch 47

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 48

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 49

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 50

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 51

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Table 52

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 53

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 54

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 55

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Example 6: effect of 5-10-5MOE gapmers having mixed internucleoside linkages on human ATXN2 in vitro, multiple doses

Various doses of modified oligonucleotides selected from the above examples were tested in a431 cells. Cells were plated at a density of 10,000 cells/well and transfected by free uptake using modified oligonucleotides at concentrations of 0.094 μ M, 0.375 μ M, 1.500 μ M and 6.000 μ M as specified in the table below. After a treatment period of approximately 24 hours, all RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human ATXN2 primer probe set RTS5049 (described in example 2 above) was used to measure RNA levels. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as the percent expression of ATXN2RNA relative to untreated control cells. As illustrated in the table below, ATXN2RNA levels decreased in a dose-dependent manner in modified oligonucleotide-treated cells. Using "log (inhibitor) versus response-variable slope (4 parameters)) "formula, using Prism6 software, calculate IC₅₀。

Watch 56

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 57

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 58

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 59

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 60

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Watch 61

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Example 7: design of gapmer with mixed internucleoside linkages complementary to human ATXN2RNA

Modified oligonucleotides complementary to human ATXN2 nucleic acids were designed. The modified oligonucleotides in the table below are gapmers. The gapmer has a central gapped segment comprising ten 2 '-deoxynucleosides and flanked on the 5' and 3 'ends by wing segments comprising 2' -MOE nucleosides. Internucleoside linkages are mixed phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages. Each cytosine residue is a 5-methylcytosine. Sequence and chemical notes column specifies sequences, including 5-methylcytosine, sugar chemistry, and internucleoside linkage chemistry, wherein the subscript'd ' represents 2' -deoxyribose; the subscript ' e ' represents a sugar modified by 2' -MOE; the subscript 'o' represents a phosphodiester internucleoside linkage; the subscript's' represents a phosphorothioate internucleoside linkage; and the ` m ` superscript preceding the cytosine residue indicates 5-methylcytosine. The "start site" indicates the most 5' -nucleoside of the human nucleic acid sequence that is complementary to the gapmer. A "termination site" indicates the most 3' -nucleoside of a human nucleic acid sequence that is complementary to a gapmer.

Each of the modified oligonucleotides listed in the table below is complementary to the human ATXN2 nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:2, as indicated. 'N/A' indicates that the modified oligonucleotide is not complementary to the particular nucleic acid with 100% complementarity.

Watch 62

Modified oligonucleotides complementary to human ATXN2RNA

Example 8: effect of MOE gapmers having mixed internucleoside linkages in vitro on human ATXN2, multiple doses

Various doses of modified oligonucleotides selected from the above examples were tested in a431 cells. Cells were plated at a density of 11,000 cells/well and free uptake was achieved using modified oligonucleotides at concentrations of 0.023 μ M, 0.094 μ M, 0.375 μ M, 1.500 μ M or 6.000 μ M as described in the table belowTransfection was performed. After a treatment period of approximately 48 hours, all RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. The human ATXN2 primer probe set RTS5051 (forward sequence TCCAGTAGCAAGGACCAGT, referred to herein as SEQ ID NO: 16; reverse sequence CAATACTGTTCTGTCTGGGAGA, referred to herein as SEQ ID NO: 17; probe sequence ACTGACCACTGATGACCACGTTCC, referred to herein as SEQ ID:18) was used to measure RNA levels. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as the percent expression of ATXN2RNA relative to untreated control cells. As illustrated in the table below, ATXN2RNA levels decreased in a dose-dependent manner in modified oligonucleotide-treated cells. IC was calculated using the "log (inhibitor) vs. reaction-variable slope (4 parameters)" equation using Prism6 software₅₀。

Table 63

Dose-dependent reduction of human ATXN2RNA expression in A431 cells

Example 9: effect of modified oligonucleotides on human ATXN2 in vitro, multiple doses

Various doses of modified oligonucleotides selected from the above examples were tested in SH-SY5Y cells. Cells were plated at a density of 35,000 cells/well and transfected by free uptake using modified oligonucleotides at concentrations of 0.023 μ M, 0.094 μ M, 0.375 μ M, 1.500 μ M or 6.000 μ M as specified in the table below. After a treatment period of approximately 24 hours, all RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human ATXN2 primer probe set RTS5051 (described in example 8 herein) was used to measureRNA level. According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as percent ATXN2RNA relative to untreated controls. As illustrated in the table below, ATXN2RNA levels decreased in a dose-dependent manner in modified oligonucleotide-treated cells. IC was calculated using the "log (inhibitor) vs. reaction-variable slope (4 parameters)" equation using Prism6 software₅₀。

Table 64

Dose-dependent reduction of human ATXN2RNA expression in SH-SY5Y cells

Table 65

Dose-dependent reduction of human ATXN2RNA expression in SH-SY5Y cells

Example 10: effect of modified oligonucleotides on rhesus ATXN2RNA expression in vitro, multiple doses

Various doses of modified oligonucleotides selected from the above examples, also complementary to rhesus ATXN2, were tested in LLC-MK2 monkey cells. Cells were plated at a density of 20,000 cells/well and transfected by free uptake using modified oligonucleotides at concentrations of 0.023 μ M, 0.094 μ M, 0.375 μ M, 1.500 μ M or 6.000 μ M as specified in the table below. After a treatment period of approximately 24 hours, all RNA was isolated from the cells and ATXN2RNA levels were measured by quantitative real-time PCR. Human ATXN2 primer probe set RTS5051 (described in example 8 herein) was used to measure RNA levels.According to e.g. passingTotal RNA content measured, ATXN2RNA levels were adjusted. The results are presented in the table below as the percent expression of ATXN2RNA relative to untreated control cells. As illustrated in the table below, ATXN2RNA levels decreased in a dose-dependent manner in modified oligonucleotide-treated cells. IC was calculated using the "log (inhibitor) vs. reaction-variable slope (4 parameters)" equation using Prism6 software₅₀。

TABLE 66

Dose-dependent reduction of human ATXN2RNA expression in LLC-MK2 rhesus cells

Oligonucleotide containing a mismatch to rhesus monkey

Watch 67

Dose-dependent reduction of human ATXN2RNA expression in LLC-MK2 rhesus cells

Example 11: design of 5-8-5MOE gapmer with mixed internucleoside linkages complementary to human ATXN2RNA

Modified oligonucleotides complementary to human ATXN2 nucleic acids were designed. The modified oligonucleotides in the following table are 5-8-5MOE gapmers. The gapmer was 18 nucleobases long, with the central gapmer segment comprising eight 2 '-deoxynucleosides and flanked on the 5' and 3 'ends by wing segments comprising five 2' -MOE nucleosides. The sugar moiety of the gapmer is (from 5 'to 3'): eeeeeeedddddddddeeeeee, wherein'd' represents 2 '-deoxyribose and' e 'represents a sugar modified by 2' -MOE. Internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage elements of the gapmer are (from 5 'to 3'): soossssssssoss; wherein 'o' represents a phosphodiester internucleoside linkage and's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. The "start site" indicates the most 5' -nucleoside of the human nucleic acid sequence that is complementary to the gapmer. A "termination site" indicates the most 3' -nucleoside of a human nucleic acid sequence that is complementary to a gapmer.

Each of the modified oligonucleotides listed in the table below is complementary to the human ATXN2 nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:2, as indicated. 'N/A' indicates that the modified oligonucleotide is not complementary to the particular nucleic acid with 100% complementarity.

Table 68

5-8-5MOE gapmer with mixed internucleoside linkages complementary to human ATXN2RNA

Example 12: design of 4-10-6MOE gapmer with mixed internucleoside linkages complementary to human ATXN2RNA

Modified oligonucleotides complementary to human ATXN2 nucleic acids were designed. The modified oligonucleotides in the following table are 4-10-6MOE gapmers. The gapmer is 20 nucleobases long, with the central gapmer segment comprising eight 2 '-deoxynucleosides and flanked on the 5' and 3 'ends by wing segments comprising five 2' -MOE nucleosides. The sugar moiety of the gapmer is (from 5 'to 3'): eeeeeddddddddddddeeeee, wherein'd' represents 2 '-deoxyribose and' e 'represents a sugar modified with 2' -MOE. Internucleoside linkages are mixed phosphodiester and phosphorothioate linkages. The internucleoside linkage elements of the gapmer are (from 5 'to 3'): sooossssossossosos; wherein 'o' represents a phosphodiester internucleoside linkage and's' represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. The "start site" indicates the most 5' -nucleoside of the human nucleic acid sequence that is complementary to the gapmer. A "termination site" indicates the most 3' -nucleoside of a human nucleic acid sequence that is complementary to a gapmer.

Each of the modified oligonucleotides listed in the table below is complementary to the human ATXN2 nucleic acid sequence SEQ ID NO:1 or SEQ ID NO:2, as indicated. 'N/A' indicates that the modified oligonucleotide is not complementary to the particular nucleic acid with 100% complementarity.

Watch 69

4-10-6MOE gapmer with mixed internucleoside linkages complementary to human ATXN2RNA

Example 13: tolerance of modified oligonucleotides complementary to human ATXN2RNA in wild-type mice, 3 hour FOB assessment

The modified oligonucleotides described above were tested in wild type mice to assess tolerance of the oligonucleotides. Comparative oligonucleotides 564122, 564127, 564133, 564143, 564150, 564188, 564210, 564216 as described above and in WO 2015/143246 were also tested. Wild type C57/Bl6 mice each received a single dose of ICV 700 μ g of the modified oligonucleotides listed in the table below. Each treatment group consisted of 4 mice. One group of 3 mice received PBS as a negative control for each experiment (identified in a separate table below). Mice were evaluated 3 hours after injection according to 7 different criteria. The criteria are (1) mouse waring, vigilance and response; (2) the mice stand or bow without stimulation; (3) mice showed any movement without stimulation; (4) the mouse was shown to move forward after being lifted; (5) the mice exhibited any movement after lifting; (6) the mice responded to the pinched tail; (7) the breathing is uniform. For each of the 7 criteria, the mice were given a score of 0 if the criteria were met, and a score of 1 (functional observation combination score or FOB) if they were not met. After evaluating all 7 criteria, the scores for each mouse were summed and averaged within each treatment group. The results are presented in the table below as the average score for each treatment group.

Watch 70

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		564122	7.00
564127	7.00
		564133	7.00
564143	7.00
		564150	7.00
564188	7.00
		564210	7.00
564216	7.00

Watch 71

Tolerance score in wild-type mice

Watch 72

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		874211	2.00
874251	3.00
		874216	5.00
874217	3.75
		874280	4.50
874249	6.50
		874282	4.50
874212	2.25
		874279	6.25
874288	6.00
		874281	4.50
874327	5.00
		874388	1.00
874384	4.50
		874246	0.25
874247	0
		874250	6.75
874277	7.00
		874283	7.00
874334	5.00
		874335	6.25
874385	4.50

TABLE 73

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		874771	6.25
874754	0
		874702	1.00
874745	2.50
		874748	5.25
874752	3.00
		874753	2.00
874501	0
		874503	6.00
874669	0
		874706	5.00
874738	5.25
		874782	5.00

Table 74

Tolerance score in wild-type mice

TABLE 75

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		875485	3.50
875680	6.00
		875650	3.75
875804	2.00
		875764	4.00
875427	6.25
		875966	0
875803	2.25
		875477	4.00
875799	4.00
		875807	3.00
875822	4.00
		875398	6.50
875452	2.50

Watch 76

Tolerance score in wild-type mice

Watch 77

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		937680	4.00
937639	0
		937794	3.00
937792	0
		937547	0
937739	3.75
		937633	2.00
937754	4.00
		937620	3.00
937611	0
		937725	0
937795	4.75
		937579	1.00
937591	6.00
		937510	0
937572	0
		937511	1.00
937738	3.00
		937593	3.75
937592	4.50
		937748	4.50
937578	0
		937618	0
937619	0

Watch 78

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		937936	4.00
937939	4.00
		937989	0
937938	6.00
		937934	1.00
938163	0
		937796	0
937987	3.00
		938004	1.00
937991	0
		938174	0
938173	0
		938237	4.00
937983	0
		937940	6.50
937942	5.00
		937972	2.50
938170	0
		938172	0
938221	0
		937973	4.50
938043	1.00
		938136	3.00
938210	2.00

TABLE 79

Tolerance score in wild-type mice

Watch 80

Tolerance score in wild-type mice

Watch 81

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		874239	1.00
874252	1.00
		874219	1.25
874237	1.00
		874221	2.25
1008793	1.00
		1008792	3.25
1008794	3.50
		937364	6.25
1008795	5.50
		1008796	5.50
1008797	3.25
		874236	4.75
874238	3.75
		875033	4.25
937472	5.00
		937473	4.00
1008791	6.00
		937361	5.00
874549	6.50

Table 82

Tolerance score in wild-type mice

Watch 83

Tolerance score in wild-type mice

Watch 84

Tolerance score in wild-type mice

Watch 85

Tolerance score in wild-type mice

Watch 86

Tolerance score in wild-type mice

Watch 87

Tolerance score in wild-type mice

Compound numbering	3 hours FOB
		1008910	0
1008899	1.00
		1008901	0
1008908	3.00
		1008911	1.00
1008902	0
		1008915	2.00
1008900	0
		1008909	3.00
1008905	3.00
		1008916	4.00
1008917	4.00
		1008898	3.50
1008903	4.00
		1008912	4.75
1008913	4.00
		1008914	4.75
1008904	4.00
		1008906	4.50
1008907	6.25

Example 14: tolerance of modified oligonucleotides complementary to human ATXN2RNA in wild-type rats, FOB assessment

The modified oligonucleotides described above were tested in Stapogostyle rats (Sprague Dawley rat) to assess tolerance of the oligonucleotides. The Stapogoni rats each received a single Intrathecal (IT)3mg dose of the oligonucleotides listed in the table below. Each treatment group consisted of 4 rats. One group of 4 rats received PBS as a negative control for each experiment (identified in a separate table below). At 3 hours post-injection, the movement of 7 different parts of each rat body was evaluated. 7 body parts are (1) rat tails; (2) rat back posture; (3) rat hind limb; (4) rat hind paw; (5) rat forepaw; (6) rat frontal posture; (7) rat head. For each of 7 different body parts, a score of 0 was given to each rat if the body part was moving, or a score of 1 (functional observation combination score or FOB) if the body part was not moving. After evaluation of all 7 criteria, the scores for each rat were summed and averaged within each treatment group. The results are presented in the table below.

Watch 88

Tolerance score in wild-type rats

Compound numbering	3 hours FOB
		708151	2.00
708154	3.00
		755235	3.00
756978	3.00
		757130	3.75
757089	2.00

Watch 89

Tolerance score in wild-type rats

Watch 90

Tolerance score in wild-type rats

Compound numbering	3 hours FOB
		875650	4.00
875804	1.75
		875764	2.00
875966	0.25
		875803	1.50
875799	4.00
		875807	1.50
875822	3.75

Watch 91

Tolerance score in wild-type rats

Compound numbering	3 hours FOB
		937481	3.00
937480	1.25
		937508	5.25
937468	2.50
		937467	3.00
937456	2.50
		937383	1.00
937385	2.75
		937437	1.25
937436	2.25

Watch 92

Tolerance score in wild-type rats

This treatment group included 3 rats.

Watch 93

Tolerance score in wild-type rats

Table 94

Tolerance score in wild-type rats

Compound numbering	3 hours FOB
		1008806	1.50
1008800	0
		1008819	2.00
1008829	1.50
		1008811	0
1008830	0.25
		1008825	0
1008817	0.75
		1008810	0
1008818	2.00

Watch 95

Tolerance score in wild-type rats

Watch 96

Tolerance score in wild-type rats

Compound numbering	3 hours FOB
		1008870	1.25
1008874	3.00
		1008865	1.50
1008888	1.00
		1008889	1.00
1008872	2.50
		1008871	1.00
1008875	1.75
		1008881	2.25
1008884	3.00
		1008887	1.25
1008882	2.75
		1008867	2.50

Watch 97

Tolerance score in wild-type rats

Example 15: activity of modified oligonucleotides complementary to human ATXN2RNA in transgenic mice

The above modified oligonucleotides were tested in a BAC-ATXN2-Q22 transgenic mouse model generated by using 169kb human BAC (bacterial artificial chromosome) RP11-798L5, which contains the entire 150kb human ATXN2 locus with 22 CAG repeats in the coding sequence, 16kb 5 'flanking genomic sequence and 3kb 3' flanking genomic sequence (dansitihong et al, PLoS Genetics, 2015).

hATXN2 mice were divided into groups of 3-4 mice each. Two groups were tested with each compound. hATXN2 mice each received a single Intracerebroventricular (ICV) 350. mu.g dose of the modified oligonucleotide. The PBS-injected group was used as a control group for comparison with the oligonucleotide-treated group. After two weeks, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for real-time PCR analysis, RNA expression of human ATXN2 was measured using primer probe set hAtaxin _ LTS01321 described in example 1 above. Results are presented in the table below as percent ATXN2RNA expression relative to the PBS control, normalized to GADPH. As shown in the table below, treatment with the modified oligonucleotides resulted in significant ATXN2RNA compared to the PBS control.

Watch 98

Reduction of human ATXN2RNA in transgenic mice

TABLE 99

Reduction of human ATXN2RNA in transgenic mice

Watch 100

Reduction of human ATXN2RNA in transgenic mice

Watch 101

Reduction of human ATXN2RNA in transgenic mice

Watch 102

Reduction of human ATXN2RNA in transgenic mice

Watch 103

Reduction of human ATXN2RNA in transgenic mice

Table 104

Reduction of human ATXN2RNA in transgenic mice

Watch 105

Reduction of human ATXN2RNA in transgenic mice

Table 106

Reduction of human ATXN2RNA in transgenic mice

Table 107

Reduction of human ATXN2RNA in transgenic mice