阅读说明：本技术 用于操纵核酸的方法和组合物 (Methods and compositions for manipulating nucleic acids ) 是由 A·罗森鲍姆 C·西格 J·格雷 余华 于 2018-11-07 设计创作，主要内容包括：本公开提供用于操纵核酸的方法、组合物和试剂盒以及系统,其包含使用预植入的固体载体实施对核酸模板的等温扩增,诸如重组酶-聚合酶扩增(recombinase-polymerase amplification；RPA)。提供用于产生与固体载体结合的包括特定核苷酸序列的模板核酸分子的快速且有效的方法。此类方法可用于,例如操纵核酸来为利用单克隆核酸群体的分析方法做准备。(The present disclosure provides methods, compositions, and kits and systems for manipulating nucleic acids, comprising performing isothermal amplification of a nucleic acid template, such as recombinase-polymerase amplification (RPA), using a pre-implanted solid support. A rapid and efficient method for generating a template nucleic acid molecule comprising a specific nucleotide sequence bound to a solid support is provided. Such methods can be used, for example, to manipulate nucleic acids in preparation for analytical methods that utilize a monoclonal nucleic acid population.)

1. A method for generating a nucleic acid template comprising a specific nucleotide sequence, comprising:

(a) obtaining a population of nucleic acid molecules, each molecule in the population of nucleic acid molecules comprising a first contiguous nucleotide sequence at the 5 'end of the molecule, a second contiguous nucleotide sequence at the 3' end of the molecule, and a third nucleotide sequence located between the first nucleotide sequence and the second nucleotide sequence, wherein the first nucleotide sequence and the second nucleotide sequence are different from each other, and wherein the first nucleotide sequence of the nucleic acid molecules is substantially identical and the second nucleotide sequence of the nucleic acid molecules is substantially identical in the population;

(b) subjecting the population of nucleic acid molecules to a nucleic acid amplification cycle in the presence of a forward primer and a reverse primer, wherein the forward primer comprises an oligonucleotide sequence substantially identical to the first nucleotide sequence and the reverse primer comprises an oligonucleotide sequence complementary to a subsequence 5 'of the second nucleotide sequence linked at the 3' end of the subsequence to a fourth nucleotide sequence that is not complementary to the second nucleotide sequence; and

(c) subjecting the products of the amplification cycle of (b) to an amplification cycle in the presence of the forward primer and the reverse primer to produce a plurality of different nucleic acid products;

wherein:

the reverse primer comprises a nucleotide sequence complementary to the 5 'end of the second nucleotide sequence but does not comprise a nucleotide sequence complementary to the 3' end of the second nucleotide sequence, and

only one of the products comprises a nucleotide sequence complementary to the fourth nucleotide sequence.

2. The method of claim 1, wherein the forward primer comprises a modified nucleotide comprising a linker attached thereto.

3. The method of claim 2, wherein the linker to which the modified nucleotide is linked comprises biotin.

4. The method of claim 1, further comprising combining single-stranded nucleic acid of the product of (c) with a single-stranded oligonucleotide substantially identical to the fourth nucleotide sequence under annealing conditions, thereby hybridizing the product of (c) comprising a nucleotide sequence complementary to the fourth nucleotide sequence with the single-stranded oligonucleotide substantially identical to the fourth nucleotide sequence to produce a partially double-stranded oligonucleotide binding product.

5. The method of claim 4, wherein the single stranded oligonucleotide substantially identical to the fourth nucleotide sequence is linked to a vector.

6. The method of claim 5, wherein the support is a solid support.

7. The method of claim 5, wherein the support is a particle or bead.

8. The method of claim 4, further comprising extending the 3' end of the oligonucleotide hybridized to the product comprising a nucleotide sequence complementary to the fourth nucleotide sequence, thereby generating a double-stranded nucleic acid by synthesizing a nucleic acid strand comprising the single-stranded oligonucleotide substantially identical to the fourth nucleotide sequence and having a nucleotide sequence complementary to the product hybridized thereto.

9. The method of claim 8, further comprising separating strands of the double stranded nucleic acid.

10. The method of claim 9, wherein said nucleic acid strand comprising said single-stranded oligonucleotide substantially identical to said fourth nucleotide sequence is linked at the 5' end of said strand to a carrier by said oligonucleotide sequence portion of said strand.

11. The method of claim 10, further comprising separating the strand of nucleic acid linked to the carrier by removing the carrier from any other nucleic acid not bound to the carrier.

12. A method for producing a nucleic acid molecule comprising a specific nucleotide sequence, comprising:

(a) obtaining a population of nucleic acid molecules, each molecule in the population of nucleic acid molecules comprising a first contiguous nucleotide sequence at the 5 'end of the molecule, a second contiguous nucleotide sequence at the 3' end of the molecule, and a third nucleotide sequence located between the first nucleotide sequence and the second nucleotide sequence, wherein the first nucleotide sequence and the second nucleotide sequence are different from each other, and wherein the first nucleotide sequence of the nucleic acid molecules is substantially identical and the second nucleotide sequence of the nucleic acid molecules is substantially identical in the population;

and

(b) subjecting the population of nucleic acid molecules to two or more nucleic acid amplification cycles in the presence of one or more forward primers comprising an oligonucleotide sequence substantially identical to the first nucleotide sequence and a reverse primer comprising an oligonucleotide sequence complementary to the second nucleotide sequence that is linked at the 5' end of the oligonucleotide sequence to the fourth nucleotide sequence that is not complementary to the second nucleotide sequence, to produce a nucleic acid product in which substantially all of the product comprises a nucleotide sequence complementary to the fourth nucleotide sequence.

13. The method of claim 12, wherein the forward primer comprises a modified nucleotide comprising a linker attached thereto.

14. The method of claim 13, wherein the linker to which the modified nucleotide is linked comprises biotin.

15. The method of claim 12, further comprising exposing under annealing conditions single-stranded nucleic acid of the product of (b) to a single-stranded oligonucleotide substantially identical to the fourth nucleotide sequence, thereby hybridizing the product of (b) comprising a nucleotide sequence complementary to the fourth nucleotide sequence to the single-stranded oligonucleotide substantially identical to the fourth nucleotide sequence to produce a partially double-stranded oligonucleotide binding product.

16. The method of claim 15, wherein the single stranded oligonucleotide substantially identical to the fourth nucleotide sequence is linked to a vector.

17. The method of claim 16, wherein the support is a solid support.

18. The method of claim 16, wherein the support is a particle or bead.

19. The method of claim 15, further comprising extending the 3' end of the oligonucleotide hybridized to the product comprising a nucleotide sequence complementary to the fourth nucleotide sequence, thereby generating a double-stranded nucleic acid by synthesizing a nucleic acid strand comprising the single-stranded oligonucleotide substantially identical to the fourth nucleotide sequence and having a nucleotide sequence complementary to the product hybridized thereto.

20. The method of claim 19, further comprising separating strands of the double stranded nucleic acid.

21. The method of claim 20, wherein said nucleic acid strand comprising said single-stranded oligonucleotide substantially identical to said fourth nucleotide sequence is linked at the 5' end of said strand to a carrier by said oligonucleotide sequence portion of said strand.

22. The method of claim 21, further comprising separating the strand of nucleic acid linked to the carrier by removing the carrier from any other nucleic acid not bound to the carrier.

23. A method for producing one or more templated solid supports, comprising:

a) forming a template reaction mixture by combining one or more pre-implanted solid supports, nucleotides, a recombinase, and a polymerase, wherein the one or more pre-implanted solid supports comprise an attached population of substantially identical first primers and have substantially monoclonal template nucleic acid molecules attached thereto, wherein the one or more pre-implanted solid supports are formed in separate pre-implant reactions that are performed prior to a template reaction and that comprise a pre-implant reaction mixture, wherein the substantially monoclonal template nucleic acid molecules comprise a proximal segment comprising the first primer, and the first primers do not comprise 100 or more identical nucleotides, wherein the proximal segment links a template nucleic acid segment to a pre-implanted solid support, and wherein the pre-implanted solid support further comprises an attached first primer that is linked to the pre-implanted solid support and is not bound to a template nucleic acid molecule, wherein the template reaction mixture further comprises a population of substantially identical soluble second primers, and wherein the template nucleic acid molecule comprises a primer binding site of the second primers at or near the opposite end of the proximal segment; and

b) performing the templating reaction by adding cations to the templating reaction mixture and incubating the reaction mixture under isothermal conditions for at least 10 minutes to amplify the template nucleic acid molecules in the template reactants to produce one or more templated solid supports, wherein each of the templated solid supports comprises at least 100,000 substantially monoclonal template nucleic acid molecules, and wherein when the templating reaction is initiated, template nucleic acid molecules are not present in solution in the reaction mixture, thereby producing one or more templated solid supports.

24. A method for producing one or more templated solid supports, comprising:

a) generating a population of pre-implanted solid supports comprising a population of ligated identical first primers, wherein the pre-implanted solid supports are generated using a pre-implantation reaction mixture under pre-implantation conditions, and wherein each of the pre-implanted solid supports has between 10 and 100,000 substantially monoclonal template nucleic acid molecules comprising the first primers ligated thereto, and comprises ligated first primers ligated to the pre-implanted solid supports and not bound to template nucleic acid molecules;

b) forming a template reaction mixture by combining the pre-implanted population of solid supports, nucleotides, a recombinase, a polymerase, and a uniform population of second primers in a solution not linked to any substrate, wherein the template nucleic acid molecule comprises a primer binding site of the second primers at or near the end opposite to the proximal segment comprising the first primers;

c) initiating a template reaction by adding a cation to the template reaction mixture, wherein when the template reaction is initiated, template nucleic acid molecules are not present in solution in the reaction mixture;

d) incubating the initiated template reaction mixture under isothermal conditions for at least 10 minutes to amplify the substantially monoclonal template nucleic acid molecules in a template reaction to produce one or more templated solid supports comprising thereon at least 10 times more attached substantially monoclonal template nucleic acid molecules than present on the pre-implanted solid support, thereby producing one or more templated solid supports.

25. A method for producing one or more templated solid supports, comprising:

a) performing a pre-implant reaction by incubating a pre-implant reaction mixture comprising a population of template nucleic acid molecules and a population of solid supports comprising a population of linked identical first primers under pre-implant reaction conditions to produce a population of pre-implanted solid supports, wherein the pre-implant reaction conditions comprise incubating the pre-implant reaction mixture under isothermal conditions, and wherein the pre-implanted solid supports each have between 10 and 100,000 substantially monoclonal nucleic acid molecules linked thereto, and/or the pre-implant reaction conditions comprise incubating the pre-implant reaction mixture under isothermal conditions for 2 to 5 minutes, wherein the pre-implanted solid supports comprise:

i. a substantially monoclonal population of template nucleic acid molecules attached to the solid support by the first primer, and

an attached first primer attached to the pre-implanted solid support and not bound to a template nucleic acid molecule;

b) by amplifying a recombinase-polymerase (recombinase-polymerase amplification; RPA) comprising the one or more pre-implanted solid supports in a reaction mixture to form a template reaction mixture, wherein template nucleic acid molecules not bound to the pre-implanted solid supports are not comprised in the template reaction mixture, wherein the template reaction mixture further comprises a uniform population of second primers in solution that are not linked to any substrate, and wherein the template nucleic acid molecules comprise primer binding sites for the second primers at or near the ends opposite the proximal segment comprising the first primers;

c) initiating a template reaction by adding a cation to the template reaction mixture;

d) incubating the initiated template reaction mixture under isothermal conditions for at least 10 minutes to amplify the template nucleic acid molecules in a template reaction to produce one or more templated solid supports comprising at least 10 times more substantially monoclonal template nucleic acid molecules than are present on the pre-implanted solid supports, thereby producing one or more templated solid supports.

26. The method of any one of claims 23-25, further comprising sequencing the template nucleic acid molecules on the one or more templated solid supports.

27. The method of any one of claims 23-26, wherein the template nucleic acid molecules comprise two or more template nucleic acid molecules having different sequences.

28. The method of any one of claims 23-26, wherein said substantially monoclonal template nucleic acid molecule comprises said proximal segment of 20 to 50 identical nucleotides linking the template nucleic acid molecule to a solid support.

29. The method of any one of claims 23-26, wherein the substantially monoclonal template nucleic acid molecule comprises less than 100 identical nucleotides at the proximal segment that connects the template nucleic acid molecule to a solid support.

30. The method of any one of claims 24-26, wherein the templated solid support is a templated bead, and wherein the sequencing comprises dispensing the templated bead into a well of a second solid support prior to performing a sequencing reaction.

31. The method of claim 30, wherein at least 40% of the wells in the second solid support comprise one templated bead comprising a substantially monoclonal population of template nucleic acid molecules.

32. The method of claim 30, wherein at least 50% of the wells in the second solid support comprise one templated bead comprising a substantially monoclonal population of template nucleic acid molecules.

33. The method of claim 30, wherein at least 60% of the templated beads comprise substantially monoclonal template nucleic acid molecules.

34. The method of claim 23, wherein the template reaction mixture comprises a population of pre-implanted solid supports.

35. The method of any one of claims 24, 25 or 34, wherein each pre-implanted solid support of the population of pre-implanted solid supports has between 10 and 50,000 substantially monoclonal template nucleic acid molecules attached thereto, and the population of pre-implanted solid supports are beads.

36. The method of any one of claims 24, 25 or 34, wherein each pre-implanted solid support of the population of pre-implanted solid supports has between 10 and 10,000 substantially monoclonal template nucleic acid molecules attached thereto, and the population of pre-implanted solid supports are beads.

37. The method of claim 27, wherein the substantially monoclonal template nucleic acid molecules attached to each pre-implanted solid support comprises at least 60% of the template nucleic acid molecules attached to the pre-implanted solid support.

38. The method of claim 27, wherein the substantially monoclonal template nucleic acid molecules attached to each pre-implanted solid support comprises at least 70% of all template nucleic acid molecules attached to each pre-implanted solid support.

39. The method of any one of claims 23 to 25, wherein less than 10% of the substantially monoclonal template nucleic acid molecules on each templated solid support comprises 50-100 identical nucleotides that are attached to the templated solid support.

40. The method of any one of claims 23-25, wherein the pre-implanted reaction mixture and/or the template reaction mixture further comprises a recombinase helper protein.

41. The method of claim 40, wherein the recombinase helper protein is a single-chain binding protein and/or a recombinase load protein.

42. The method of any one of claims 23 to 25, wherein the template reaction mixture is incubated at a temperature between 35 ℃ and 45 ℃.

43. The method according to any one of claims 23 to 25, wherein the pre-implant reaction mixture is incubated at a temperature between 35 ℃ and 45 ℃.

44. The method of any one of claims 23 to 25, wherein the template reaction mixture is incubated for 10 to 60 minutes.

45. The method of claim 24, wherein the pre-implanted solid support is produced using a first recombinase-polymerase amplification (RPA) reaction and the template reaction is a second RPA reaction.

46. The method of claim 45, wherein said first RPA reaction is carried out by incubating the RPA reaction mixture at a temperature between 35 ℃ and 45 ℃ for 2 to 5 minutes.

47. The method of any one of claims 23-25, wherein the pre-implant reaction mixture further comprises a uniform population of second primers in solution, and wherein the template nucleic acid molecule comprises a primer binding site of the first primer at or near the first end.

48. The method of any one of claims 23, 24, 25, or 34, wherein the substantially monoclonal template nucleic acid molecule present on the templated solid support is at least 100-fold greater than the substantially monoclonal template nucleic acid molecule present on the pre-implanted solid support.

49. The method of claim 25, wherein the pre-implant reaction conditions comprise incubating the pre-implant reaction mixture under isothermal conditions for 2 to 5 minutes.

50. The method of any one of claims 24 to 26, wherein the sequencing is performed on template nucleic acid molecules on the one or more templated solid supports when the solid support is within a well of a sequencing wafer, and wherein less than 5% of the wells are determined to be low quality wells for the sequencing.

51. A template reaction mixture comprising a population of pre-implanted solid supports, nucleotides, a recombinase, and a polymerase, wherein the population of pre-implanted solid supports comprises between 10 and 50,000 substantially monoclonal template nucleic acid molecules comprising a first primer attached thereto, and further comprising the attached first primer not bound to a template nucleic acid molecule, wherein the reaction mixture does not comprise a cation capable of initiating a recombinase-polymerase amplification reaction, and wherein at least 95% of the template nucleic acid molecules in the reaction mixture are attached to the one or more pre-implanted solid supports.

52. The template reaction mixture of claim 51, wherein said template nucleic acid molecules comprise two or more template nucleic acid molecules having different sequences.

53. The template reaction mixture of claim 51, wherein said substantially monoclonal template nucleic acid molecule comprises a proximal segment of 20 to 50 identical nucleotides linking the template nucleic acid molecule to a solid support.

54. The template reaction mixture of claim 51, wherein the substantially monoclonal template nucleic acid molecule comprises less than 100 identical nucleotides at a proximal segment that connects the template nucleic acid molecule to the solid support.

55. The template reaction mixture of claim 51, wherein the pre-implanted solid support is a pre-implanted bead.

56. The template reaction mixture of claim 51, wherein each pre-implanted solid support of the population of pre-implanted solid supports has between 10 and 10,000 substantially monoclonal template nucleic acid molecules attached thereto, and wherein the one or more pre-implanted solid supports are beads.

57. The template reaction mixture of claim 51, wherein less than 10% of the substantially monoclonal template nucleic acid molecules on each pre-implanted solid support comprise 50-100 identical nucleotides that are linked to the pre-implanted solid support.

58. The template reaction mixture of claim 51, further comprising a recombinase helper protein.

59. The template reaction mixture of claim 58, wherein the recombinase helper protein is a single-chain binding protein and/or a recombinase-loading protein.

60. The template reaction mixture of claim 51, wherein said pre-implanted solid support is produced using a first recombinase-polymerase amplification (RPA) reaction.

61. The template reaction mixture of claim 60, wherein said first RPA reaction is carried out by incubating the RPA reaction mixture at a temperature between 35 ℃ and 45 ℃ for 2 to 5 minutes.

62. The template reaction mixture of claim 51, wherein the pre-implant reaction mixture further comprises a uniform population of second primers in solution, and wherein the template nucleic acid molecule comprises a primer binding site of the first primer at or near a first end.

63. The template reaction mixture of claim 51, further comprising a cation capable of initiating the recombinase-polymerase amplification reaction.

64. A method of producing one or more populations of template nucleic acids on a solid support comprising:

(a) obtaining a population of nucleic acid molecules, wherein each molecule comprises a first contiguous nucleotide adaptor sequence at the 5 'end of the molecule, a second contiguous nucleotide adaptor sequence at the 3' end of the molecule, and a third nucleotide sequence located between the first and second nucleotide sequences, wherein the first and second adaptor nucleotide sequences are different; wherein in the population the first adaptor nucleotide sequence of the nucleic acid molecules is substantially identical, the second adaptor nucleotide sequence of the nucleic acid molecules is substantially identical, and the nucleotide sequences located between the first and second nucleotide sequences are different; and wherein the first adaptor nucleotide sequence comprises a first linker moiety ligated thereto;

(b) generating single strands of the population of nucleic acid molecules and contacting the single-stranded nucleic acids with a solid support under annealing conditions to generate a solid support having single-stranded nucleic acids ligated thereto by hybridization to the second adaptor sequence of the nucleic acids, wherein the solid support comprises a plurality of primer oligonucleotides having nucleotide sequences complementary to the second adaptor sequence of the nucleic acids immobilized thereon;

(c) extending the immobilized primer of the solid support hybridized to a nucleic acid strand to produce a double-stranded nucleic acid bound to the solid support;

(d) subjecting the nucleic acid molecules bound to the solid supports to a nucleic acid amplification cycle in the presence of a first primer comprising an oligonucleotide sequence substantially identical to the first adaptor nucleotide sequence and a linker portion ligated thereto, wherein a limited number of single stranded nucleic acids are ligated to each solid support and the nucleic acids ligated to individual supports are substantially monoclonal;

(e) combining the solid support with the nucleic acid bound thereto with a magnetic bead comprising a second linking moiety linked to the first linking moiety to produce a solid support-magnetic bead assembly;

(f) applying a magnetic field to the assembly of beads, thereby separating the assembly of beads from elements that do not include magnetic beads;

(g) releasing the solid support having the nucleic acid attached thereto from the magnetic beads;

(h) combining the solid support having the nucleic acid attached thereto with a magnetic bead, wherein the nucleic acid on the solid support will not be attached to the magnetic bead;

(i) delivering the solid support with the combination of nucleic acids and magnetic beads attached thereto to a surface comprising microwells and applying a magnetic field to the surface, thereby loading the solid support with nucleic acids attached thereto into individual microwells; and

(j) subjecting the nucleic acid molecules bound to the solid support in the microwells to at least one nucleic acid amplification cycle in the presence of a first primer in solution form, wherein the first primer comprises an oligonucleotide sequence substantially identical to the first adaptor nucleotide sequence, and wherein the amplification produces at least 10-fold more nucleic acid attached to the solid support than is attached after the amplification set forth in (d);

wherein the reverse primer comprises a nucleotide sequence that is complementary to the 5 'end of the second nucleotide sequence but does not comprise a nucleotide sequence that is complementary to the 3' end of the second nucleotide sequence.

65. The method of claim 64, wherein the number of solid supports in (b) exceeds the number of nucleic acid molecules by at least a factor of 2.

66. The method of claim 64, wherein the number of solid supports in (b) exceeds the number of nucleic acid molecules by at least a factor of 5.

67. The method of any one of claims 64-66, wherein the amplifying in (j) produces at least 100,000 times more nucleic acid attached to the solid support than is attached after the amplifying in (d).

68. The method of any one of claims 64-66, wherein the amplifying in (j) produces at least 1,000,000 times more nucleic acid attached to the solid support than is attached after the amplifying in (d).

69. The method of claim 64, further comprising subjecting the amplified nucleic acids attached to the solid support to nucleic acid sequencing.

70. The method of claim 64, wherein the sequencing method produces at least 6000 million sequence reads that are at least 300 nucleotides in length.

71. The method of claim 64, wherein the sequencing method produces at least 8000 ten thousand sequence reads that are at least 100 nucleotides in length.

72. The method of claim 64, wherein the sequencing process produces at least 8000 ten thousand sequence reads that are between about 100 and about 400 nucleotides in length.

73. A method of producing one or more populations of template nucleic acids on a solid support comprising:

(a) obtaining a population of nucleic acid molecules, wherein each molecule comprises a first contiguous nucleotide adaptor sequence at the 5 'end of the molecule, a second contiguous nucleotide adaptor sequence at the 3' end of the molecule, and a third nucleotide sequence located between the first nucleotide sequence and the second nucleotide sequence, wherein the first adaptor nucleotide sequence and the second adaptor nucleotide sequence are different, and the first adaptor nucleotide sequence of the nucleic acid molecule is substantially identical, and the second adaptor nucleotide sequence of the nucleic acid molecule is substantially identical, and wherein the first adaptor nucleotide sequence is modified to comprise a first linker moiety linked thereto;

(b) generating single strands of the population of nucleic acid molecules, and contacting the single-stranded nucleic acids with a solid support under annealing conditions to generate a solid support having single-stranded nucleic acids attached thereto by hybridization to the second adaptor sequence of the nucleic acids, wherein the solid support comprises a plurality of primer oligonucleotides having nucleotide sequences complementary to the second adaptor sequence of the nucleic acids immobilized thereon, and the number of solid supports exceeds the number of nucleic acid molecules by at least a factor of 5.

(c) Transferring the solid supports having the nucleic acids attached thereto to a surface including microwells, thereby loading the solid supports having the nucleic acids attached thereto into the individual microwells, respectively;

(d) extending the immobilized primer of the solid support hybridized to a nucleic acid strand to produce a double-stranded nucleic acid bound to the solid support;

(e) subjecting the nucleic acid molecule bound to the solid support to a nucleic acid amplification cycle in the presence of a first primer in solution form, wherein (1) the first primer comprises an oligonucleotide sequence substantially identical to the first adaptor nucleotide sequence and is modified to comprise a linker moiety ligated thereto, (2) by hybridization between the primer oligonucleotide having a nucleotide sequence complementary to the second adaptor sequence immobilized on the solid support and the second adaptor sequence of the nucleic acid, the amplification produces a limited number of additional single-stranded nucleic acids attached to the solid support, (3) the nucleic acids attached to individual supports are substantially monoclonal, and (4) the amplification is performed in the presence of a composition that ligates to the linker portion of the first adaptor;

(f) terminating the amplification of (e) and removing the composition ligated to the linker portion of the first adapter from the microwell; and

(g) subjecting the nucleic acid molecules bound to the solid support in the microwells to at least one nucleic acid amplification cycle in the presence of a first primer in solution form, wherein the first primer comprises an oligonucleotide sequence substantially identical to the first adaptor nucleotide sequence, and wherein the amplification produces at least 1000-fold more nucleic acid attached to the solid support than is attached after the amplification in step (e);

wherein the reverse primer comprises a nucleotide sequence that is complementary to the 5 'end of the second nucleotide sequence but does not contain a nucleotide sequence that is complementary to the 3' end of the second nucleotide sequence, and the nucleic acids attached to the respective vectors are substantially monoclonal.

74. A method of preparing a device for nucleic acid analysis, the method comprising:

generating a template nucleic acid comprising a capture sequence portion, a template portion, and a primer portion modified with a linker portion;

capturing said template nucleic acid on a bead support having a plurality of capture primers complementary to said capture sequence portion of said template nucleic acid, said capture primers hybridizing to said capture sequence portion of said template nucleic acid;

ligating the captured template nucleic acids to magnetic beads having a second linker moiety, the second linker moiety being ligated to the first linker moiety, to form a bead assembly; and

using a magnetic field, the bead assembly is loaded into a well of a sequencing device.

75. The method of claim 70, further comprising extending the capture primer complementary to the template nucleic acid to form a target nucleic acid sequence attached to the bead support.

76. The method of claim 71, further comprising denaturing the template nucleic acid and the target nucleic acid sequence to release the magnetic beads from the bead carriers.

77. The method of claim 72, wherein denaturing comprises enzymatic denaturation.

78. The method of claim 72, wherein denaturing comprises denaturing in the presence of an ionic solution.

79. The method of claim 72, further comprising washing the magnetic beads from the sequencing device.

80. The method of claim 71, further comprising amplifying the target nucleic acid sequence to form a population of target nucleic acid sequences on the bead vector in the well.

81. The method of claim 75, wherein amplifying comprises performing Recombinase Polymerase Amplification (RPA).

82. The method of claim 77, wherein performing RPA comprises performing RPA for a first period of time, washing, and performing RPA for a second period of time, the first period of time being shorter than the second period of time.

83. The method of claim 70, wherein generating a primer extension comprises modifying a linker complementary to the target nucleic acid.

84. The method of claim 71, wherein generating comprises amplifying a target nucleic acid in the presence of a bead support having a first primer portion, a target portion, and a second primer portion, the bead support having a capture primer, a linker-modified first primer complementary to the first primer portion, and a second primer having a portion complementary to at least a portion of the second primer portion, the second primer having a capture primer portion joined to the portion and complementary to the capture primer, wherein the bead support capture primer is extended to comprise a sequence of the target nucleic acid.

85. The method of claim 80, wherein amplifying comprises performing three Polymerase Chain Reaction (PCR) cycles.

86. A method of making a sequencing device, the method comprising:

generating a template nucleic acid comprising a capture sequence portion, a template portion, and a primer portion;

capturing said template nucleic acid on a bead support coupled to a capture primer complementary to said capture sequence portion, said capture primer hybridizing to said capture sequence portion of said template nucleic acid;

extending the capture primer complementary to the template nucleic acid to form a target nucleic acid complementary to and hybridized to the template nucleic acid;

denaturing to separate the hybridized template nucleic acid from the target nucleic acid;

hybridizing a linker modified primer to the target nucleic acid on the bead support, the linker modified primer comprising a linker moiety;

extending the linker modified primer complementary to the target nucleic acid;

coupling a magnetic bead to the linker moiety, the magnetic bead having a second linker moiety linked to the linker moiety; and

using a magnetic field, the bead carrier is placed in a well of a sequencing device.

87. The method of claim 86, further comprising denaturing the template nucleic acid and the target nucleic acid sequence to release the magnetic beads from the bead carriers.

88. The method of claim 87, wherein denaturing comprises enzymatic denaturation.

89. The method of claim 87, wherein denaturing comprises denaturing in the presence of an ionic solution.

90. The method of claim 87, further comprising washing the magnetic beads from the sequencing device.

91. The method of claim 86, further comprising amplifying the target nucleic acid sequences to form a population of target nucleic acid sequences on the bead vectors in the wells.

92. The method of claim 91, wherein amplifying comprises performing Recombinase Polymerase Amplification (RPA).

93. The method of claim 92, wherein performing RPA comprises performing RPA for a first period of time, washing, and performing RPA for a second period of time, the first period of time being shorter than the second period of time.

94. The method of claim 86, wherein generating a primer extension comprises modifying a linker complementary to the target nucleic acid.

95. The method of claim 86, wherein extending comprises performing a Polymerase Chain Reaction (PCR).

Technical Field

The present disclosure generally relates to methods for manipulating and analyzing nucleic acids and compositions and kits for performing the same.

Background

Manipulation of nucleic acid samples, such as nucleic acid amplification, is extremely useful in molecular biology and has wide applicability in virtually every aspect of biology, therapy, diagnosis, forensics, and research. Biological and medical research is increasingly turning to nucleic acid sequencing for enhanced biological research and medicine. For example, biologists and zoologists are turning to sequencing to study animal migration, species evolution, and trait sources. Sequencing is being used by the medical community to study the cause of disease, susceptibility to drugs, and the cause of infection. The use of sequencing may be limited by the insufficient amount and/or quality of nucleic acid in the sample. In addition, sequencing has historically been an expensive method, thus limiting its practice.

Generally, to increase the amount of nucleic acid available for analysis, one or more primers are used to generate amplicons from a nucleic acid molecule, wherein the amplicons are complementary to all or a portion of the template from which they were generated. Multiplex amplification may also simplify the process and reduce overhead. For some downstream applications, monoclonal is desirable because the different characteristics of the diverse nucleic acid molecules within a polyclonal population may complicate interpretation of the analytical data. In instances where a monoclonal population of nucleic acids is suitable for use in an analytical method, challenges also exist in containing the monoclonal nucleic acid population and maintaining it as isolated and free or relatively free of substantial amounts of other nucleic acid impurities that are not identical to those in the monoclonal population. This is particularly a problem when attempting to perform analysis (e.g., sequencing) on multiple samples of different nucleic acids in a high-throughput, automated, cost-effective manner. In nucleic acid sequencing applications, the presence of a polyclonal population may complicate interpretation of sequencing data; however, many sequencing systems are not sufficiently sensitive to detect nucleotide sequence data from a single template nucleic acid molecule, and thus amplification of the template nucleic acid molecule prior to sequencing is necessary.

An example of such amplification is recombinase-polymerase amplification (RPA), a DNA amplification method that uses an enzyme to bind oligonucleotide primers to their complementary partners in duplex DNA, followed by isothermal amplification. RPA offers a number of advantages over traditional amplification methods, including, for example, the need for initial heat or chemical melting (melt), the ability to run at low constant temperatures without absolute temperature control, and the possibility to store the reaction mixture (e.g., in the absence of the target polynucleotide) under dry conditions. These advantages indicate that RPA is a powerful and convenient tool for amplifying nucleic acid molecules. However, attempts to prepare template nucleic acid molecules using RPA prior to sequencing have resulted in undesirable polyclonal populations and/or insufficient preparations. Thus, there remains a need for improved methods that result in the preparation of improved template nucleic acid molecules for use in molecular characterization, e.g., sequencing.

Disclosure of Invention

In some embodiments, the present disclosure relates generally to methods of manipulating nucleic acids and systems, compositions, kits, and devices for performing the same.

In some embodiments, provided herein are rapid and efficient methods for producing nucleic acid molecules comprising specific nucleotide sequences. Such methods can be used, for example, in manipulating nucleic acids for analytical preparation in methods that use a monoclonal population of nucleic acids. Some embodiments of the clonal amplification methods disclosed herein for generating a population of monoclonal nucleic acids begin with a constrained nucleic acid molecule template. The method of constraining the nucleic acid molecules provided herein comprises capturing a single nucleic acid molecule by binding to a specific nucleotide sequence common to the different nucleic acids to be amplified and analyzed. To produce different nucleic acid molecules having a common specific nucleotide available for easy confinement, one method disclosed herein comprises: (a) obtaining a population of nucleic acid molecules, such as a double-stranded adaptor-containing DNA library, wherein for one strand of the molecule, each molecule comprises a first contiguous nucleotide sequence at the 5 'end of the molecule, a second contiguous nucleotide sequence at the 3' end of the molecule, and a third nucleotide sequence located between the first nucleotide sequence and the second nucleotide sequence, wherein the first nucleotide sequence and the second nucleotide sequence are different, the first nucleotide sequence of a nucleic acid molecule is substantially identical, and the second nucleotide sequence of a nucleic acid molecule is substantially identical; (b) subjecting a population of nucleic acid molecules to a nucleic acid amplification cycle in the presence of a forward primer comprising an oligonucleotide sequence substantially identical to a first nucleotide sequence and a reverse primer comprising an oligonucleotide sequence complementary to a 5 'terminal sequence of a second nucleotide sequence linked at the 3' end of the subsequence to a fourth nucleotide sequence that is not complementary to the second nucleotide sequence; and (c) subjecting the products of the amplification cycle of step (b) to an amplification cycle in the presence of forward and reverse primers to produce a plurality of different nucleic acid products, wherein only one of the products comprises a nucleotide sequence complementary to a fourth nucleotide sequence. In some embodiments of this method, the reverse primer comprises a nucleotide sequence that is complementary to the 5 'end of the second nucleotide sequence but does not contain a nucleotide sequence that is complementary to the 3' end of the second nucleotide sequence.

Other embodiments of methods provided herein for generating different nucleic acid molecules having a common specific nucleotide that can be used, for example, for ease of confinement, include: (a) obtaining a population of nucleic acid molecules, such as a double-stranded adaptor-containing DNA library, wherein for one strand of the molecule, each molecule comprises a first contiguous nucleotide sequence at the 5 'end of the molecule, a second contiguous nucleotide sequence at the 3' end of the molecule, and a third nucleotide sequence located between the first nucleotide sequence and the second nucleotide sequence, wherein the first nucleotide sequence and the second nucleotide sequence are different, the first nucleotide sequence of a nucleic acid molecule is substantially identical, and the second nucleotide sequence of a nucleic acid molecule is substantially identical; (b) subjecting a population of nucleic acid molecules to two or more nucleic acid amplification cycles in the presence of one or more forward primers containing an oligonucleotide sequence substantially identical to a first nucleotide sequence and a reverse primer blocked at the 3 'end and containing an oligonucleotide sequence complementary to a second nucleotide sequence, the oligonucleotide sequence being linked at the 5' end of the oligonucleotide sequence to a fourth nucleotide sequence that is not complementary to the second nucleotide sequence to produce a nucleic acid product, wherein substantially all of the product comprises a nucleotide sequence complementary to the fourth nucleotide sequence.

In some embodiments, provided herein are methods for producing one or more templated supports, e.g., solid supports. Such methods include, for example: a) forming a template reaction mixture by combining one or more pre-implanted carriers, nucleotides, a recombinase, and a polymerase, wherein the one or more pre-implanted solid carriers comprise an attached population of substantially identical first primers and have substantially single-clone template nucleic acid molecules attached thereto, wherein the one or more pre-implanted solid carriers are formed in separate pre-implant reactions that are performed prior to a template reaction, wherein the substantially single-clone template nucleic acid molecules comprise a proximal segment comprising a first primer that, in some embodiments, does not comprise 100 or more identical nucleotides, wherein the proximal segment connects the template nucleic acid segment to the pre-implanted solid carrier, and wherein the pre-implanted solid carrier further comprises an attached first primer that is connected to the pre-implanted solid carrier and is not bound to the template nucleic acid molecules, wherein the template reaction mixture further comprises a substantially uniform population of soluble second primers, and wherein the template nucleic acid molecule comprises a primer binding site of the second primer at or near the opposite end of the proximal segment; and b) performing a templating reaction by adding cations to the templating reaction mixture and incubating the reaction mixture under isothermal conditions for at least 10 minutes to amplify the template nucleic acid molecules in the templating reaction to produce one or more templated solid supports, wherein each of the templated solid supports comprises at least 100,000 substantially monoclonal template nucleic acid molecules, and wherein the template nucleic acid molecules are not present in solution in the reaction mixture when the templating reaction is initiated, thereby producing one or more templated solid supports. In some embodiments, one or more templated solid supports are used in a sequencing reaction to determine the sequence of a template nucleic acid molecule. In other embodiments, the templated solid support is a templated bead, and sequencing comprises dispensing the bead into a well of the solid support prior to performing the sequencing reaction. In some embodiments, the one or more templated solid supports comprise: a first templated solid support attached to a substantially monoclonal population of template nucleic acid molecules having a first sequence; and at least one other templated solid support attached to a substantially monoclonal population of template nucleic acid molecules having a second sequence, wherein the sequence of the first attached template nucleic acid molecule is different from the sequence of the second attached template nucleic acid molecule. In other embodiments, the substantially monoclonal template nucleic acid molecules attached to each pre-implanted solid support comprise at least 70% of all template nucleic acid molecules attached to each pre-implanted solid support. In some embodiments, the template reaction mixture comprises a population of pre-implanted solid supports. In other embodiments, each pre-implanted solid support of the population of solid supports has between 10 and 50,000 substantially monoclonal template nucleic acid molecules attached thereto, and the one or more solid supports are beads. In some embodiments, the pre-implanted reaction mixture and/or the template reaction mixture further comprises a recombinase helper protein. In other embodiments, the recombinase helper protein is a single-chain binding protein and/or a recombinase load protein. In some embodiments, the template reaction mixture and/or the pre-implant reaction mixture is incubated at a temperature between 35 ℃ and 45 ℃. In some embodiments, the template reaction mixture is incubated for 10 to 60 minutes. In some embodiments, the substantially monoclonal template nucleic acid molecule present on the templated solid support is at least 100-fold greater than the substantially monoclonal template nucleic acid molecule present on the pre-implanted solid support.

In some embodiments, the present disclosure relates generally to methods, and systems, compositions, kits, and apparatuses for performing the methods, wherein the methods are for determining the sequence of a template nucleic acid molecule and comprise: a pre-implant reaction and a subsequent template reaction are performed. In some embodiments, the pre-implant reaction produces a plurality of pre-implanted solid supports, wherein individual pre-implanted supports of the plurality of pre-implanted solid supports comprise a plurality of first primers attached to the solid supports, wherein the plurality of first primers have a substantially identical sequence, and wherein some of the plurality of first primers are ligated to a template nucleic acid molecule and some of the plurality of first primers are not ligated to a template nucleic acid molecule. In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices for determining the sequence of a template nucleic acid molecule, comprising: a) generating a population of pre-implanted solid supports comprising a population of ligated identical first primers, wherein the pre-implanted solid supports are generated under pre-implantation conditions, and wherein each of the pre-implanted solid supports has between 10 and 100,000 substantially monoclonal template nucleic acid molecules comprising first primers ligated thereto and comprises ligated first primers that are ligated to the pre-implanted solid supports and do not bind to the template nucleic acid molecules; b) forming a template reaction mixture by combining a pre-implanted population of solid supports, nucleotides, a recombinase, a polymerase, and a uniform population of second primers in solution that are not linked to any substrate, wherein the template nucleic acid molecule comprises a primer binding site of the second primer at or near the end opposite the proximal segment comprising the first primer; c) initiating a template reaction by adding a cation to the template reaction mixture, wherein when the template reaction is initiated, the template nucleic acid molecule is not present in solution in the reaction mixture; d) incubating the initiated template reaction mixture under isothermal conditions for at least 10 minutes to amplify template molecules in a template reaction to produce one or more templated solid supports comprising attached substantially monoclonal template nucleic acid molecules thereon at least 10-fold as present on the pre-implanted solid supports; and e) sequencing the template nucleic acid molecules on the one or more templated solid supports, thereby determining the sequence of the template nucleic acid molecules. In some embodiments, the template nucleic acid molecule comprises two or more template nucleic acid molecules having different sequences. In some embodiments, the substantially monoclonal template nucleic acid molecule attached to the pre-implanted solid support and/or attached to the templated solid support comprises template nucleic acid molecules having two or more different sequences. In other embodiments, the substantially monoclonal template nucleic acid molecules attached to each pre-implanted solid support comprise at least 70% of all template nucleic acid molecules attached to each pre-implanted solid support. In some embodiments, the templated solid support is a templated bead, and sequencing comprises dispensing the bead into a well of the solid support prior to performing the sequencing reaction. In some embodiments, each pre-implanted solid support of the population of solid supports has between 10 and 50,000 substantially monoclonal template nucleic acid molecules attached thereto, and the one or more solid supports are beads. In some embodiments, the pre-implanted reaction mixture and/or the template reaction mixture further comprises a recombinase helper protein. In other embodiments, the recombinase helper protein is a single-chain binding protein and/or a recombinase load protein. In some embodiments, the template reaction mixture and/or the pre-implant reaction mixture is incubated at a temperature between 35 ℃ and 45 ℃. In some embodiments, the template reaction mixture is incubated for 10 to 60 minutes. In some embodiments, the pre-implanted solid support is produced using a first recombinase-polymerase amplification (RPA) reaction, and the template reaction is a second RPA reaction. In other embodiments, the first RPA reaction is carried out by incubating the RPA reaction mixture for 2 to 5 minutes at a temperature between 35 ℃ and 45 ℃. In some embodiments, the substantially monoclonal template nucleic acid molecule present on the templated solid support is at least 100-fold greater than the substantially monoclonal template nucleic acid molecule present on the pre-implanted solid support.

In some embodiments, the present disclosure relates generally to methods, and systems, compositions, kits, and apparatuses for performing the methods, wherein the methods are for determining the sequence of a template nucleic acid molecule and comprise: a) performing a pre-implant reaction by incubating a first recombinase-polymerase amplification (RPA) reaction mixture under pre-implant reaction conditions to produce one or more pre-implanted solid supports, the first recombinase-polymerase amplification reaction mixture comprising a population of template nucleic acid molecules and a population of solid supports comprising a population of ligated consensus first primers, wherein the pre-implant reaction conditions comprise incubating the RPA reaction mixture under isothermal conditions, and wherein the pre-implanted solid supports each have between 10 and 100,000 substantially monoclonal nucleic acid molecules ligated thereto, and/or the pre-implant reaction conditions comprise incubating the RPA reaction mixture for 2 to 5 minutes under isothermal conditions, wherein the pre-implanted solid supports comprise: (ii) a substantially monoclonal population of template nucleic acid molecules attached to a solid support by a first primer, and (ii) an attached first primer that is attached to a pre-implanted solid support and does not bind to a template nucleic acid molecule; b) forming a template reaction mixture by including one or more pre-implanted solid supports in a second RPA reaction mixture, wherein the template nucleic acid molecule is not bound to the pre-implanted solid supports that are not included in the template reaction mixture, wherein the template reaction mixture further comprises a uniform population of second primers in solution that are not linked to any substrate, and wherein the template nucleic acid molecule comprises a primer binding site for the second primer at or near the end opposite the proximal segment that includes the first primer; c) initiating a template reaction by adding a cation to the template reaction mixture; d) incubating the initiated template reaction mixture under isothermal conditions for at least 10 minutes to amplify template nucleic acid molecules in a template reaction to produce one or more templated solid supports comprising substantially monoclonal template nucleic acid molecules thereon at least 10-fold as present on the pre-implanted solid supports; and e) sequencing the template nucleic acid molecules on the one or more templated solid supports, thereby determining the sequence of the template nucleic acid molecules. In some embodiments, the template nucleic acid molecule comprises two or more template nucleic acid molecules having different sequences. In some embodiments, the substantially monoclonal template nucleic acid molecule attached to the pre-implanted solid support and/or attached to the templated solid support comprises template nucleic acid molecules having two or more different sequences. In other embodiments, the substantially monoclonal template nucleic acid molecules attached to each pre-implanted solid support comprise at least 70% of all template nucleic acid molecules attached to each pre-implanted solid support. In some embodiments, the templated solid support is a templated bead, and sequencing comprises dispensing the bead into a well of the solid support prior to performing the sequencing reaction. In some embodiments, each pre-implanted solid support of the population of solid supports has between 10 and 50,000 substantially monoclonal template nucleic acid molecules attached thereto, and the one or more solid supports are beads. In some embodiments, the pre-implanted reaction mixture and/or the template reaction mixture further comprises a recombinase helper protein. In other embodiments, the recombinase helper protein is a single-chain binding protein and/or a recombinase load protein. In some embodiments, the template reaction mixture and/or the pre-implant reaction mixture is incubated at a temperature between 35 ℃ and 45 ℃. In some embodiments, the template reaction mixture is incubated for 10 to 60 minutes. In some embodiments, the substantially monoclonal template nucleic acid molecule present on the templated solid support is at least 100-fold greater than the substantially monoclonal template nucleic acid molecule present on the pre-implanted solid support.

In some embodiments, the present disclosure relates generally to compositions, and systems, methods, kits, and devices related to compositions, wherein the compositions comprise a template reaction mixture comprising a pre-implanted solid support population, nucleotides, a recombinase, and a polymerase, wherein the pre-implanted solid support population has between 10 and 50,000 substantially monoclonal template nucleic acid molecules comprising first primers linked thereto, and further comprises linked first primers linked to the pre-implanted solid support and not bound to the template nucleic acid molecules, wherein the reaction mixture does not comprise cations capable of initiating a recombinase-polymerase amplification reaction, and wherein at least 95% of the template nucleic acid molecules in the reaction mixture are linked to one or more solid supports. In some embodiments, the template nucleic acid molecule comprises two or more template nucleic acid molecules having different sequences. In some embodiments, the substantially monoclonal template nucleic acid molecule attached to the pre-implanted solid support and/or attached to the templated solid support comprises template nucleic acid molecules having two or more different sequences. In some embodiments, the pre-implanted solid support is a pre-implanted bead. In some embodiments, the template reaction mixture comprises a recombinase helper protein. In other embodiments, the recombinase helper protein is a single-chain binding protein and/or a recombinase load protein. In some embodiments, a first recombinase-polymerase amplification (RPA) reaction is used to generate the pre-implanted solid support. In other embodiments, the first RPA reaction is carried out by incubating the RPA reaction mixture for 2 to 5 minutes at a temperature between 35 ℃ and 45 ℃. In some embodiments, the pre-implant reaction mixture further comprises a uniform population of second primers in solution, and the template nucleic acid molecule comprises a primer binding site of the first primer at or near the first end. In some embodiments, the template reaction mixture further comprises a cation capable of initiating a recombinase-polymerase amplification reaction.

In some embodiments of the methods for producing one or more templated supports, e.g., solid supports provided herein, at least some, most, or all of the nucleic acids attached to the templated supports or supports produced in the methods contain at least one modified nucleotide comprising a linker, e.g., a first linker moiety, attached thereto. Such methods may further comprise attaching the templated support to a magnetic bead having a portion (e.g., a binding partner or a second linker portion) to which the modified nucleotides of the nucleic acid attached to the templated support may be bound, linked or attached (link) by a linker or linker of the modified nucleotides, thereby forming a bead assembly of templated support and magnetic bead. In some embodiments of these methods, the assembly of beads is separated from any elements that do not comprise magnetic beads by applying a magnetic field to the assembly of beads, thereby separating the assembly of beads from any such elements and forming an enriched population of templated supports. In some embodiments of the method, the separate bead assemblies are further subjected to conditions that release the templated carriers from the magnetic beads and analyzed in other methods, such as sequencing methods.

Also provided herein are methods of preparing a device for analyzing nucleic acids, e.g., sequencing nucleic acids. In some embodiments, the method comprises: generating a nucleic acid comprising a capture sequence portion, a template portion, and a primer portion comprising a first linker portion; capturing nucleic acids, e.g., by hybridization, on a support, e.g., a solid support, such as a bead, having a plurality of capture primers that are partially complementary to capture sequences of the nucleic acids; ligating the first linker moiety of the captured nucleic acids to the second linker moiety contained on the magnetic beads to form a bead assembly of captured nucleic acids and magnetic beads on the support; applying a magnetic field to the bead assembly, thereby separating the bead assembly from any elements that do not contain magnetic beads; releasing the captured nucleic acids on the carrier from the magnetic beads; mixing the released captured nucleic acids on the carrier with magnetic beads, the captured nucleic acids on the carrier not being linked (attached/link) or bound to said magnetic beads; and incorporating the mixture into a device for analyzing the captured nucleic acids. In some embodiments, the mixture of captured nucleic acids and magnetic beads on the support is coated on a surface, e.g., a chip, such as a semiconductor chip, and a magnetic field is applied to the surface. The surface may contain microwells into which captured nucleic acids on the support are loaded by moving magnetic beads on the surface when a magnetic field is applied to the surface. In some such embodiments, the magnetic beads are of a size such that the magnetic beads cannot enter the microwells.

In some embodiments of methods of making a device for analyzing nucleic acids, the method comprises: generating a nucleic acid comprising a capture sequence portion, a template portion, and a primer portion comprising a first linker portion; capturing nucleic acids on a support, e.g., a solid support, such as a bead, having a plurality of capture primers that are partially complementary to capture sequences of the nucleic acids; ligating the captured nucleic acids with magnetic beads having a second linker moiety to form a bead assembly such that the first and second linker moieties are ligated; and loading the bead assembly into the well of the device using a magnetic field.

Drawings

FIGS. 1A to 1D are frequency distribution diagrams showing read lengths in high-throughput sequencing after bulk isothermal amplification.

FIG. 1A shows the read lengths using Ion Spherical Particles (ISP) without pre-implanted template (no template control (NTC)).

FIG. 1B shows read segment lengths using an ISP pre-seeded with-70 copies/ISP.

FIG. 1C shows the read segment length using an ISP pre-populated with-665 copies/ISP.

FIG. 1D shows the read lengths using an ISP pre-implanted with 4,170 copies/ISP (FIG. 1D).

FIGS. 2A-2F are bar graphs showing various metrics of high-throughput sequencing after bulk isothermal amplification using NTC P1ISP and ISP pre-implanted with 70, -665 and-4,170 copies/ISP.

Fig. 2A shows the percentage of ISP load for NTC ISP and ISP pre-implanted with different template copy numbers.

Fig. 2B shows the percentage of usable reads from NTC ISP and ISP pre-implanted with different template copy numbers.

Fig. 2C shows the number of total reads from NTC ISP and pre-implanted with different template copy numbers.

Fig. 2D shows the mean, median and mode of read lengths from NTC ISP and ISP pre-implanted with different template copy numbers.

Fig. 2E shows the percentage of empty wells for NTC ISP and ISP pre-implanted with different template copy numbers.

Fig. 2F shows the percentage of low quality wells for NTC ISP and ISP pre-implanted with different template copy numbers.

FIGS. 3A-3F are bar graphs showing various metrics of high throughput sequencing after a preimplantation amplification reaction using an ISP without a template control (NTC) and an ISP preimplantation with 82, 775, and 5,400 copies/ISP.

Fig. 3A shows the percentage of ISP load for NTC ISP and ISP pre-implanted with different template copy numbers.

Fig. 3B shows the percentage of usable reads from NTC ISP and ISP pre-implanted with different template copy numbers.

Fig. 3C shows the number of total reads from NTC ISP and pre-implanted with different template copy numbers.

Fig. 3D shows the mean, median and mode of the read segment lengths from NTC ISP and ISP pre-implanted with different template copy numbers.

Figure 3E shows the percentage of empty wells pre-implanted with ISPs of different template copy numbers.

Figure 3F shows the percentage of low quality wells pre-implanted with ISPs of different template copy numbers.

FIG. 4 is a schematic diagram showing a primer extension reaction of the upper and lower strands of a template nucleic acid molecule.

Fig. 5,6 and 7 illustrate example protocols for attaching nucleic acids to beads.

FIG. 8 is a schematic representation of an example method for preparing a sequencing device.

Figure 9 illustrates a schematic representation of an example protocol for attaching nucleic acids to beads.

FIG. 10 is a graph of the results of a sequencing run performed on the generated nucleic acid templates using several different methods.

The above identified figures are provided to be representative and non-limiting.

Definition of

As used in this disclosure, the following terms are understood to have the following meanings:

the term "monoclonal" and variations thereof, when used in reference to one or more populations of polynucleotides, refers to a population of polynucleotides in which, at the nucleotide sequence level, about 50-99% or up to 100% of the population members share at least 80% identity. As used herein, the phrase "substantially monoclonal" and variations thereof when used in reference to one or more polynucleotide populations refers to one or more polynucleotide populations in which the amplified template polynucleotide molecule is the single most prevalent polynucleotide in the population. Thus, all members of a monoclonal or substantially monoclonal population are not necessarily identical or complementary to each other. For example, different portions of a polynucleotide template may be amplified or replicated to generate members of the resulting monoclonal population; similarly, some number of "errors" and/or incomplete extensions may occur during amplification of the initial template, resulting in a monoclonal or substantially monoclonal population whose individual members may exhibit sequence variability in themselves. In some embodiments, mixing of low or non-substantially levels of non-homologous polynucleotides may occur during a nucleic acid amplification reaction of the present teachings, and thus substantially a monoclonal population may contain a minority of one or more polynucleotides (e.g., less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, or less than 0.001% of a diverse polynucleotide). In certain examples, at least 90% of the polynucleotides in the population are at least 90% identical to the initial single template used as a basis for amplification to produce a substantially monoclonal population. In certain embodiments, the methods for amplifying produce a population of polynucleotides, wherein at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the members of the population of polynucleotides share at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the template nucleic acid of the production population. In certain embodiments, the method for amplifying produces a population of polynucleotides in which a sufficient majority of the polynucleotides share sufficient sequence identity to allow sequencing of at least a portion of the amplification template using a high throughput sequencing system.

In some embodiments, at least 50%, 60%, 70%, 75%, 80%, 90%, 95%, or 99% of the members of the template nucleic acid molecule attached to the templated vector will share greater than 90%, 95%, 97%, 99%, or 100% identity with the template nucleic acid molecule. In some embodiments, members of a population of nucleic acids generated using any one of the amplification methods hybridize to each other under high stringency hybridization conditions.

In some embodiments, the amplification method produces a population of substantially monoclonal nucleic acid molecules that comprise sufficiently few polyclonal impurities such that they are successfully sequenced in a high throughput sequencing method. For example, amplification methods can generate a population of substantially monoclonal nucleic acid molecules that produce signals (e.g., sequencing signals, nucleotide incorporation signals, and analogs thereof) that are detected using a particular sequencing system. Optionally, the signal can then be analyzed to correctly determine the sequence and/or base identity of any one or more nucleotides present within any nucleic acid molecule of the population. Examples of suitable sequencing systems for detecting and/or analyzing such signals include Ion Torrent sequencing systems, such as Ion Torrent PGM^TMSequence systems, including 314, 316, and 318 systems; ion Torrent Proton^TMA sequencing system comprising Proton I (Thermo Fisher Scientific, waltham, massachusetts); and Ion Torrent Proton^TMSequencing system, comprising Ion S5 and S5XL (Thermo fisher scientific, waltham, massachusetts). In some embodiments, the monoclonal amplicons permit accurate sequencing of at least 5 contiguous nucleotide residues on an Ion Torrent sequencing system.

As used herein, the term "clonal amplification" and variations thereof refers to any method whereby a substantially monoclonal polynucleotide population is generated by amplifying a polynucleotide template. In some embodiments of clonal amplification, two or more polynucleotide templates are amplified to generate at least two substantially monoclonal polynucleotide populations.

As used herein, the terms "comprises," "comprising," "includes," "including," "has/having," or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, method, article, or apparatus that comprises a list of features is not necessarily limited to only those features but may include other features not expressly listed or inherent to such process, method, article, or apparatus. Furthermore, unless expressly stated to the contrary, "or" means an inclusive or, and not an exclusive or. For example, any of the following satisfies condition a or B: a is true (or present) and B is false (or not present), a is false (or not present) and B is true (or present), and both a and B are true (or present).

In addition, the use of "a" or "an" is used to describe elements and components described herein. This is done merely for convenience and to give a general sense of the scope of the invention. This description should be read to include one or at least one and the singular also includes the plural unless it is obvious that it is meant otherwise.

Other features and advantages of the disclosure will be apparent from the following description, and from the claims.

Detailed Description

In some embodiments, the present disclosure relates generally to methods of manipulating nucleic acids and systems, compositions, kits, and devices for performing the same. In some embodiments, the methods comprise nucleotide polymerization, nucleotide sequence modification (e.g., ligation of an adaptor and/or primer sequence, e.g., a cleavable primer), nucleotide modification (e.g., addition of a label or linker molecule (e.g., biotin) to one or more nucleotides in a nucleic acid molecule), nucleic acid amplification, nucleic acid capture, nucleic acid containment (containment), and/or nucleic acid transfer. The methods and compositions provided herein can be used, for example, to generate a monoclonal or substantially monoclonal population of nucleic acids. In some embodiments, the methods are used to generate a population of monoclonal or substantially monoclonal nucleic acids, wherein the nucleic acids are linked to a vector, such as a solid support. In some embodiments, the method is used to link nucleic acids to two or more vectors. In such embodiments, the two or more carriers may be the same or different, including, for example, polymeric and/or magnetic carriers. In some embodiments, the methods are used to transfer nucleic acids attached to one or more vectors to a reaction chamber. In some embodiments, the methods are used to generate a monoclonal or substantially monoclonal population of nucleic acids in a reaction chamber or chambers. The methods provided herein can be performed alone or in any combination for any one or more of the uses and provide advantages in nucleic acid analysis. For example, use of the methods and/or compositions disclosed herein provides nucleic acid analysis results, such as nucleic acid sequencing results, of improved quality, quantity, and/or accuracy. In another example, the methods and/or compositions disclosed herein are used, alone and/or in any combination, to enhance nucleic acid manipulation methods to significantly facilitate workflow automation of nucleic acid analysis, such as nucleic acid sequencing.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices that improve the results of high-throughput nucleic acid sequencing. The methods, systems, compositions, kits and apparatus incorporate methods and compositions for generating, containing, isolating, transferring, replicating and/or manipulating substantially monoclonal populations of nucleic acids that are fast, efficient and cost effective while achieving a significant increase in the production of high quality reads of longer length and a reduction in the number and run time of duplicate, non-information and/or library reads compared to existing methods. In some embodiments, the methods, as well as systems, compositions, kits, and devices, comprise a support, such as a solid support, to confine, enrich, mask, isolate, localize, amplify, and/or transfer nucleic acids that can be used in an analytical method. In some embodiments, the vector is pre-implanted with one or a limited number of predominantly substantially identical nucleic acids from a larger collection of nucleic acids (e.g., a nucleic acid library or sample) to provide an isolated single nucleic acid molecule or a localized substantially monoclonal population. Such pre-implanted vectors are easily manipulated and used as a clean source of uniform nucleic acids that can be clonally amplified, for example, in a template reaction to produce a relatively pure set of templates for use in a high throughput sequencing workflow to improve sequencing results. In some embodiments, the pre-implanted vector can be at least partially produced and amplified using isothermal amplification, particularly recombinase-mediated amplification reactions, such as recombinase-polymerase amplification (RPA). Thus, in an illustrative aspect of the method, a pre-implant reaction is performed prior to a template reaction in a high throughput sequencing workflow.

In a typical high throughput sequencing workflow, nucleic acid molecules in a sample are used to prepare a library of template nucleic acid molecules suitable for downstream sequencing. The nucleic acid molecules can optionally be subjected to multiplex amplification before, during or after library preparation. Subsequently, the library of template nucleic acid molecules is amplified onto one or more vectors for use in a sequencing reaction. In some embodiments of the present disclosure, amplification of the template on the solid support is typically performed in two or more reactions, including, for example, one or more pre-implantation reactions that produce one or more pre-implanted supports having a population of substantially monoclonal template nucleic acid molecules linked; followed by a template reaction on the pre-implanted carrier that produces more copies (e.g., at least 10 x more copies) of the ligated template nucleic acid molecule on one or more carriers. An advantage of performing the pre-implant reaction and the template reaction is that this workflow results in higher quality sequencing reads in a high throughput sequencing reaction. In some embodiments, the pre-implant reaction is performed with blocked primers to prevent primer dimer amplicons from forming during the pre-implant reaction. In previous methods, primer dimer amplicons may be generated during the template, which may result in lower quality sequencing reads and reduce the number of sequencing reads from the template nucleic acid molecule. Thus, the addition of a separate pre-implant reaction provides this and numerous other advantages over previous approaches.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices for amplifying a template nucleic acid molecule comprising a template reaction mixture using a pre-implanted carrier. In various aspects, the templated vector is used to perform downstream sequencing methods. The template reaction is typically performed using a recombinase to denature the double-stranded template nucleic acid molecule and is performed with a polymerase suitable for the RPA reaction at isothermal temperatures. In some aspects, the pre-implanted carrier is produced in a separate pre-implant reaction mixture.

Preimplantation, also referred to herein as implantation, involves attaching one or more nucleic acid molecules to a vector. In some embodiments, the ligation is designed to produce a single vector having a single nucleic acid molecule ligated thereto. In some embodiments, the linkage is designed to link it to multiple copies of a nucleic acid molecule and/or to multiple different nucleic acids. In some embodiments, the ligation is designed to ligate it with a limited number of multiple copies of substantially the same nucleic acid to generate a substantially monoclonal population of nucleic acids.

In some embodiments, the pre-implantation (or implantation) methods provided herein comprise hybridizing a single-stranded nucleic acid molecule to a complementary nucleic acid, e.g., an oligonucleotide, bound to and immobilized on a carrier. Such processes are carried out under annealing conditions for generally short periods of time. In some embodiments, the implantation method involves hybridization under conditions in which a solid support, e.g., a bead, will be attached to only one single-stranded nucleic acid molecule. Such conditions comprise contacting a population of single stranded nucleic acids (e.g., from a nucleic acid library or sample) with a large excess of vector under annealing conditions.

In some embodiments, the pre-implantation (or implantation) methods provided herein comprise a combined process of ligating nucleic acids to a vector by hybridization and simultaneously amplifying the ligated nucleic acids to a low level, e.g., about 20 copies. In these embodiments, the pre-implant reaction mixture typically comprises a population of template nucleic acid molecules, a polymerase, nucleotides, a first primer population, and a cofactor, such as a divalent cation. One skilled in the art will appreciate that various methods can be used to pre-implant the solid support with a substantially monoclonal template nucleic acid molecule. As non-limiting examples, the pre-implant reaction mixture may be performed using RPA reaction, template walking reaction, PCR, emulsion PCR, or bridge PCR. The pre-implant reaction and/or template reaction may be performed in bulk in solution. In addition, the pre-implant reaction mixture and/or the template reaction mixture may comprise: a first universal primer linked to one or more vectors; a second universal primer in solution (soluble second universal primer); and a plurality of template nucleic acid molecules, wherein individual template nucleic acid molecules are joined to at least one universal primer binding sequence that can be added during library preparation, and wherein the universal primer binding sequence binds to the first and optionally the second universal primer. In some embodiments, a pre-implant reaction and/or a template reaction is performed in the wells. In an illustrative example, the pre-implant reaction and the template reaction are performed using a sequential RPA reaction, wherein the template nucleic acid molecules are washed away after the pre-implant reaction before performing the template reaction.

The vectors modified with nucleic acid molecules, e.g., beads, are loaded into confined areas or containers (receptacles), such as microwells or wells, to form arrays that exhibit several nucleic acid sequencing advantages. Placing nucleic acid coated beads in an organized, tightly packed fashion, such as into small microwells, can increase throughput per cycle and reduce customer costs. As the density of micropores increases or as the micropore size decreases, bead loading becomes difficult, creating many empty micropores and reducing bead counts in the wells. Too many empty microwells reduce the number of base reads and therefore poor sequencing performance. In some embodiments, provided herein are methods of introducing a carrier, such as a solid carrier, e.g., a bead, into a microwell or a reaction chamber, and systems, compositions, kits, and devices for use in the methods. In some embodiments, the method comprises attaching a bead support having a captured template nucleic acid modified with a linker moiety to a magnetic bead having a complementary linker moiety to form a bead assembly, and loading the bead assembly into the well using a magnetic field. The bead assembly can be denatured to release the magnetic beads, allowing the bead carriers to attach to the target nucleic acids in the wells. Such methods can be used, for example, in the preparation of devices for nucleic acid sequencing. In one embodiment, the reaction performed in the well may be an analytical reaction used to identify or determine a characteristic or characteristic of an analyte of interest. Such reactions may directly or indirectly produce by-products that provide a signal that may indicate whether the analyte is reacting in a characteristic manner. If such byproducts are produced in small amounts or decay rapidly or react with other components, multiple copies of the same analyte can be analyzed in the well simultaneously in order to increase the output signal produced. In one embodiment of the methods provided herein, multiple copies of an analyte, e.g., a nucleic acid, can be attached to a solid support either before or after placement in a well. For example, a target nucleic acid can be amplified in a microwell to provide a clonal population of target nucleic acids suitable for target nucleic acid sequencing. The solid support may be, for example, microparticles, nanoparticles, beads, solids or porous including gels or the like. For simplicity and ease of illustration, the solid support is also referred to herein as a particle or bead. For nucleic acid analytes, multiple linked copies can be prepared by Rolling Circle Amplification (RCA), exponential RCA, or similar techniques to produce amplicons without the need for a solid support.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and apparatuses for producing one or more templated solid supports, comprising: a) forming a template reaction mixture by combining one or more pre-implanted solid supports, nucleotides, a recombinase, and a polymerase, wherein the one or more pre-implanted solid supports comprise an attached substantially identical first primer population and have a substantially monoclonal template nucleic acid molecule attached thereto, wherein the substantially monoclonal template nucleic acid molecule comprises a proximal segment comprising a first primer, wherein the proximal segment connects the template nucleic acid segment to the solid support at the first primer, and wherein the pre-implanted solid support further comprises an attached first primer that is attached to the pre-implanted solid support and does not bind to the template nucleic acid molecule, wherein the template reaction mixture further comprises a substantially uniform population of soluble second primers, and wherein the template nucleic acid molecule comprises a primer binding site of the second primer at or near the opposite end of the proximal segment; and b) performing a template reaction by adding cations to the template reaction mixture, and incubating the reaction mixture under isothermal conditions for at least 10 minutes to amplify the template nucleic acid molecules in the template reaction to produce one or more templated solid supports. In some embodiments, the methods provide templated solid supports, wherein each support comprises at least 100,000 substantially monoclonal template nucleic acid molecules. Typically, the template nucleic acid molecule is not contained in solution in the template reaction mixture. Thus, when the template reaction is initiated, the template nucleic acid molecule is typically present in solution in the reaction mixture. The pre-implanted solid support is typically produced in a pre-implant reaction separate from the template reaction. In some embodiments, the template nucleic acid is attached to the solid support by a proximal segment that does not comprise 100 or more identical nucleotides. In some embodiments, the proximal segment does not comprise a contiguous sequence of greater than 2, 3,4, 5,6, 7, 8, 9, or 10 identical nucleotides. In some embodiments of the above aspects, one or more templated solid supports are used in a sequencing reaction to determine the sequence of a template nucleic acid molecule.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices for determining the sequence of a template nucleic acid molecule, comprising: a) generating a population of pre-implanted solid supports comprising a population of linked, substantially identical first primers, wherein the pre-implanted solid supports are generated under pre-implantation conditions, and wherein each of the pre-implanted solid supports has between 10 and 100,000 substantially monoclonal template nucleic acid molecules comprising the first primers linked thereto, and further comprises linked first primers linked to the pre-implanted solid supports and not bound to the template nucleic acid molecules; b) forming a template reaction mixture by combining the pre-implanted population of solid supports, nucleotides, a recombinase, and a polymerase; c) initiating a template reaction by adding a cation to the template reaction mixture, wherein when the template reaction is initiated, the template nucleic acid molecule is not present in solution in the reaction mixture; d) incubating the initiated template reaction mixture under isothermal conditions for at least 10 minutes to amplify template molecules in a template reaction to produce one or more templated solid supports comprising attached substantially monoclonal template nucleic acid molecules thereon at least 10-fold as present on the pre-implanted solid supports; and d) sequencing the template nucleic acid molecules on the one or more templated solid supports, thereby determining the sequence of the template nucleic acid molecules.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices for determining the sequence of a template nucleic acid molecule, comprising: a) performing a pre-implant reaction by incubating a recombinase-polymerase amplification (RPA) reaction mixture comprising a population of template nucleic acid molecules and a population of solid supports comprising a population of linked substantially identical first primers under pre-implant reaction conditions, to produce one or more pre-implanted solid supports comprising a substantially monoclonal population of template nucleic acid molecules linked to the solid supports by first primers and the linked first primers, the attached first primer is attached to the pre-implanted solid support and does not bind to the template nucleic acid molecule, wherein the pre-implant reaction conditions comprise incubating the RPA reaction mixture under isothermal conditions, wherein the pre-implanted solid supports each have between 10 and 100,000 substantially monoclonal nucleic acid molecules attached thereto, and/or the pre-implant reaction conditions comprise incubating the RPA reaction mixture under isothermal conditions for 2 to 5 minutes; b) forming a template reaction mixture by including one or more pre-implanted solid supports in the RPA reaction mixture, wherein template nucleic acid molecules not bound to the pre-implanted solid supports are not included in the template reaction mixture; c) initiating a template reaction by adding a cation to the template reaction mixture; d) incubating the initiated template reaction mixture under isothermal conditions for at least 10 minutes to amplify template nucleic acid molecules in a template reaction to produce one or more templated solid supports comprising substantially monoclonal template nucleic acid molecules thereon at least 10-fold as present on the pre-implanted solid supports; and e) sequencing the template nucleic acid molecules on the one or more templated solid supports, thereby determining the sequence of the template nucleic acid molecules.

In some embodiments, the plurality of template nucleic acid molecules comprises two or more template nucleic acid molecules having different sequences. In some embodiments, the substantially monoclonal template nucleic acid molecule attached to the pre-implanted solid support and/or attached to the templated solid support comprises template nucleic acid molecules having two or more different sequences. A substantially monoclonal template nucleic acid molecule is typically attached to a solid support by primers that may comprise consecutive identical nucleotides, or no more than 2, 3,4, 5,6, 7, 8, 9, or 10 consecutive nucleotides; or attached to a solid support by a primer comprising consecutive non-identical nucleotides. However, the proximal segment of the template nucleic acid, which is the segment attached to the solid support and typically a primer, contains less than 100 identical nucleotides. In some embodiments, the templated solid support is a templated bead, and sequencing comprises dispensing the bead into a well of the solid support prior to performing the sequencing reaction. In illustrative examples, each pre-implanted solid support in a population of solid supports can have, for example, between 10 and 50,000 or between 100 and 25,000 substantially monoclonal template nucleic acid molecules attached thereto. In illustrative examples, the pre-implant reaction mixture and/or the template reaction mixture further comprises a uniform second primer population in solution. In these examples, the template nucleic acid molecule typically comprises a primer binding site of a first primer at or near a first end and a primer binding site of a second primer at or near the other end.

In another aspect, the template reaction mixture comprises a pre-implanted population of solid supports, nucleotides, a recombinase, and a polymerase, wherein the pre-implanted population of solid supports has between 10 and 50,000 substantially monoclonal template nucleic acid molecules comprising a first primer attached thereto and further comprises an attached first primer that does not bind to a template nucleic acid molecule, wherein the reaction mixture does not comprise a cation capable of initiating a recombinase-polymerase amplification reaction, and wherein at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% of the template nucleic acid molecules in the reaction mixture are attached to one or more solid supports.

In some embodiments, a pre-implant reaction mixture is used, and one or more pre-implanted carriers are formed during the pre-implant reaction. In some embodiments, the pre-implant reaction mixture comprises some or all of: a population of template nucleic acid molecules, one or more vectors, a polymerase, a first primer population, nucleotides, and a divalent cation. In some embodiments, the first population of primers is linked to one or more vectors. In any embodiment of the present teachings, the pre-implant reaction mixture further comprises a second primer and optionally a diffusion limiting agent. In an illustrative embodiment, the second primer is in solution. In illustrative embodiments, the pre-implant reaction mixture comprises a recombinase and optionally a recombinase helper protein.

In some embodiments, by employing nucleic acid amplification, the following are used to perform the preimplantation and/or template reaction: (i) a plurality of nucleic acid molecules comprising a target sequence and one or more universal adaptor sequences; (ii) a plurality of soluble forward primers; (iii) a plurality of soluble reverse-terminated tailed primers; and (iv) a plurality of solid supports having capture primers immobilized thereon, the capture primers hybridizing to the universal adaptor sequences. In some embodiments, the preimplantation and/or template reaction is performed in a single reaction mixture having a plurality of nucleic acid molecules with the same or different target sequences. In some embodiments, individual nucleic acid molecules generated from the sample comprise target sequences joined at ends to at least one universal adaptor sequence (e.g., a-adaptor and/or P1-adaptor sequences). In some embodiments, the nucleic acid molecule is a double-stranded molecule having complementary upper and lower strands. In some embodiments, a pre-implant reaction is performed using forward and reverse soluble primers that hybridize to the adaptor sequences to amplify the nucleic acid molecule and ligate a substantially monoclonal copy of the nucleic acid molecule to a solid support (see fig. 4). Although fig. 4 depicts a series of reactions of a single double-stranded nucleic acid molecule and a single bead within a single reaction mixture, it will be appreciated by those skilled in the art that the same single reaction mixture contains multiple double-stranded nucleic acid molecules and multiple beads that undergo the same series of reactions to produce at least two beads that are each linked to a substantially monoclonal population of target sequences. In addition, one skilled in the art will appreciate that a bead can be attached to multiple B capture primers. Furthermore, the lower side of fig. 4 depicts biotin-labeled primer extension products bound to the B capture primer, but those skilled in the art will appreciate that non-biotin-labeled primer extension products can bind to the B capture primer. It will also be appreciated by those skilled in the art that a mixture of biotin-labeled and non-biotin-labeled primer extension products can be linked to a plurality of B capture primers linked to beads. In some embodiments, a single reaction mixture contains a plurality of nucleic acid molecules, wherein individual nucleic acid molecules having the same or different target sequences are linked to at least one universal adaptor sequence. Referring now to FIG. 4, nucleic acid molecules having upper and lower strands are denatured and separate upper and lower strands are used in a primer extension reaction using a soluble primer (e.g., a soluble A primer) and a soluble blocked tailed primer (e.g., a soluble blocked tailed P1/B primer) to produce a plurality of primer extension products having adaptor sequences that can bind to the immobilized B primer during the preimplantation and/or template reaction. As shown in FIG. 4, the primer extension reaction produces different products for the two strands due to differences in the different sequences and orientations of the upper and lower strands and the primers used.

In some embodiments, in the first primer extension reaction, a soluble primer that binds to the a primer binding site is used to generate the complementary strand of the lower strand. For illustration purposes, in fig. 4 (left), the soluble a' primer is complementary to the a adaptor sequence. In some embodiments, the first primer extension reaction is performed using a mixture of soluble a' primers of varying lengths. The length of the mixture of soluble a ' primers at their 5' end, 3' end, or both 5' and 3' ends can vary. For example, a mixture of a ' primers of primer mixture S (with or without a 5' biotin adduct (depicted as "Bio" in fig. 4), which may include 5' non-complementary sequences of various lengths, and which may be used in a primer extension reaction to produce one of several possible first extension products (left side of fig. 4) depending on which soluble a ' primer is used to perform the first primer extension reaction, for example, in the 5' to 3' direction, the first extension product contains a complementary a-adaptor sequence (shown as a ' in the left side of fig. 4), a complementary lower sequence (shown as lower ' (bottom ') in the left side of fig. 4), and a complementary P1 sequence (shown as P1' in the left side of fig. 4) and, in some embodiments, the newly synthesized P1' sequence in the first extension product may bind to the soluble P1 primer, to allow primer extension from the 3 'end of the P1' sequence of the first primer extension product. The soluble P1 primer may be a tailed primer. The soluble P1 primer can carry a capping moiety at its 3 'end, wherein the capping moiety can inhibit primer extension from the 3' end of the primer. The soluble P1 primer may be a reverse tailed P1 primer comprising a ligated 5' B adaptor sequence such that primer extension of the first extension product results in addition of the complementary sequence of the B sequence (depicted as B ' in the left side of fig. 4) to the 3' end using tailed primer P1 as a template. In illustrative embodiments, the soluble P1 primer may have a3 'terminal end (shown as a circled "X" in the left side of fig. 4) to prevent extension from the 3' end of the soluble P1 primer (left side of fig. 4). Depending on which soluble A' primer is used in the first extension reaction, the second primer extension reaction can produce a plurality of second extension products of various lengths. In the 5 'to 3' direction, the plurality of second extension products contain a complementary a-adaptor sequence (shown as a 'in the left side of fig. 4), a complementary down-strand sequence (shown as down' in the left side of fig. 4), a complementary P1 sequence (shown as P1 'in the left side of fig. 4), and a complementary B adaptor sequence (shown as B' in the left side of fig. 4). The second primer extension product may comprise or lack the 5' biotin adduct (left side of FIG. 4). The second extension reaction can produce a plurality of second extension products having different lengths and can include or lack biotin adducts and include B' adaptor sequences. Any of these second extension products can bind/hybridize to the B capture sequence immobilized on the solid surface (bead). The immobilized B primer can undergo a third primer extension reaction, resulting in a third extension product (fig. 4 bottom) that is immobilized to the bead and complementary to the second extension product.

Reference is now made to FIG. 4 (right), which depicts a series of reactions for denaturing and winding a double-stranded nucleic acid. In some embodiments, the top strand P1' adaptor sequence can bind to the soluble P1 primer and perform a first primer extension reaction to generate a first extension product (right side of fig. 4). In some embodiments, the soluble P1 primer is a tailed primer. The soluble P1 primer can carry a capping moiety at its 3 'end, wherein the capping moiety can inhibit primer extension from the 3' end of the primer (right side of fig. 4). The soluble P1 primer may be a tailed P1 primer comprising a 5' B adaptor sequence ligated such that primer extension results in the addition of the complementary sequence of the B sequence (B ') to the 3' end of the first extension product using the tailed primer P1 as a template (fig. 4 right). In illustrative embodiments, the soluble P1 primer may have a3 'blocked end (shown as a circled "X" in the right side of fig. 4) to prevent extension from the 3' end of the P1 primer (right side of fig. 4). The first primer extension reaction produces a plurality of first extension products comprising an a ' adaptor sequence, a top strand sequence, a P1' adaptor sequence, and a B ' adaptor sequence in the 5' to 3' direction (right side of fig. 4). The first extension product comprising the B' adaptor sequence may bind/hybridize to the B capture sequence immobilized on a solid surface (bead). The immobilized B primer can undergo a second primer extension reaction, resulting in a second extension product (fig. 4 bottom) that is immobilized to the bead and complementary to the first extension product.

In some embodiments, a pre-implant (or implant) reaction may be performed as illustrated in fig. 5. In this example, the target polynucleotide B-A 'and its complementary sequence template polynucleotide (A-B') are amplified in the presence of a bead vector with capture primers. The target polynucleotide has a capture moiety (B) that is identical or substantially similar to the sequence of the capture primer coupled to the bead support. A substantially similar sequence is a sequence whose complement can hybridize to each of the substantially similar sequences. The bead vector may have a capture primer of the same sequence or substantially similar sequence to that of the B portion of the target polynucleotide to permit hybridization of the complementary sequence of the capture portion (B) of the target polynucleotide to the capture primer attached to the bead vector. Optionally, the target polynucleotide may comprise a second primer position (P1) adjacent to the capture portion (B) of the target polynucleotide, and may further comprise a target region adjacent to the primer and bound to the sequencing primer portion (a) of the target polynucleotide by a complementary sequence portion (a'). A template polynucleotide complementary to the target polynucleotide can hybridize to the capture primer (B) when amplified in the presence of a bead support comprising the capture primer. The target polynucleotide may remain in solution. The system can be extended in which the capture primer B, which is complementary to the template polynucleotide, is extended to obtain the target sequence bound to the bead support. Additional amplifications can be performed in the presence of free primer (B), bead support, and free modified sequencing primer (a) with linker moiety (L) attached thereto. Primer (B) and modified primer (L-A) can interfere with the free floating target and template polynucleotides, preventing them from binding to the bead support and to each other. In particular, a modified sequencing primer (a) having a linker moiety attached thereto can hybridize to a complementary moiety (a') of a target polynucleotide attached to a bead support. Optionally, a linker modified sequencing primer L-A that hybridizes to the target polynucleotide can be extended to form a linker modified template polynucleotide. Such linker modified template polynucleotides hybridize to target nucleic acids attached to the bead support, which can then be captured by magnetic beads and used for magnetic loading of a sequencing device. Amplification or extension may be performed using Polymerase Chain Reaction (PCR) amplification, Recombinase Polymerase Amplification (RPA), or other amplification techniques. In a specific example, each step of the protocol illustrated in fig. 5 is performed using PCR amplification.

In some embodiments, a pre-implant (or implant) reaction may be performed as illustrated in fig. 6. In this example, the alternative comprises a target polynucleotide (P1-A ') and its complementary sequence template polynucleotide (A-P1'). The target and template polynucleotides were amplified in a solution comprising a linker modified sequencing primer (L-a) and a truncated P1 primer (trP1) having a portion containing the sequence of the capture primer (B). In an example, the truncated P1 primer (trP1) comprises a subset of the P1 sequence or all of the sequence P1. The single species 702 subsequently comprises a linker modified template polynucleotide (L-A-B') operable to hybridize to a bead support with a capture primer (B) during amplification in the presence of a linker modified sequencing primer (L-A) and a truncated P1 primer (trP 1-B). Thus, the linker modified template polynucleotide (L-A-B ') hybridizes to the capture primer (B) on the bead and is extended to form the target polynucleotide (B-A') attached to the bead support. The magnetic beads can be linked using linker-modified template polynucleotides that hybridize to the bead-linked target polynucleotides, which can be used, for example, to perform magnetic loading of the beads into a sequencing device and/or to enrich for nucleic acids linked to the beads. The linker moiety of the linker modified template polynucleotide may take various forms, such as biotin, which may be bound to a linker moiety attached to a magnetic bead, such as streptavidin. Each of the amplification reactions may be performed using PCR, RPA, or other amplification techniques. In the example shown in FIG. 6, three Polymerase Chain Reaction (PCR) cycles may be used to implement the embodiment. This series of PCR reactions produces a higher percentage of bead vectors with a single target polynucleotide attached thereto. Thus, more monoclonal populations can be generated in the wells in the sequencing device.

In some embodiments, a pre-implant (or implant) reaction may be performed as illustrated in fig. 7. In this example, the reaction is designed to produce the desired bead-linked nucleic acid molecule from a series of amplification cycles, wherein only one amplification product (which is the desired target nucleic acid) will be linked to the bead. The desired target contains a linker moiety, such as biotin (labeled with the letter "L" in fig. 7), attached to the 5' end of the nucleic acid; and an adaptor nucleotide sequence (labeled with the letter "B '" in fig. 7) complementary at the 3' end to the primer (labeled with the letter "B" in fig. 7) immobilized on the bead. In contrast, the method shown in FIG. 6 produces two nucleic acid amplification products hybridized to beads, only one of which has the desired linker moiety. In producing only one amplification product to be ligated to a bead, this method avoids producing beads that do not contain nucleic acids of the desired target nucleic acid (e.g., lacking a linker moiety that will not be used for downstream analysis). Thus, this approach avoids wasting beads and nucleic acids, and ensures that only a single nucleic acid target molecule will hybridize to the beads required for maintaining a high level of single clones, followed by template amplification using beads having only one nucleic acid template bound thereto. As shown in FIG. 7, the double stranded library nucleic acids contained an A adaptor sequence at the 5 'end and a P1 adaptor sequence at the 3' end (standard Ion Torrent A and P1 library adaptors; Thermo Fisher scientific). The primers used in the amplification were biotin-labeled primer A (forward primer) and reverse primer, which is a fusion of trP1 and B primers (trP 1is a 23 mer segment of the Ion P1 adaptor with sequence CCTCTC TAT GGG CAG TCG GTG AT; SEQ ID NO: 1). The B primer sequence is identical to the sequence of the B primer immobilized on the bead. trP1-B fusion primers will hybridize and prime at the inner portion of the P1 adaptor sequence of the library nucleic acid molecules proximal to the library insert sequence and not hybridize to the remainder of the P1 adaptor sequence at the extreme 3' end of the library nucleic acid. This formed a mismatched end between the trP1-B primer sequence and the extreme 3' end portion of the P1 adaptor on the library nucleic acids. As shown in fig. 7, after two cycles of amplification (e.g., PCR), although four amplification products are produced, only one product will be able to implant (or hybridize) beads (e.g., ion spherical particles). Thus, after subsequent denaturation of the amplification products, only a single strand of one product will hybridize to the B primer on the bead. This primer can be extended to form a double stranded template nucleic acid, wherein one strand contains a linker moiety that can be used, for example, to bind bead-bound nucleic acids to magnetic beads for enrichment and/or magnetic loading of wells.

In some embodiments, streptavidin beads are used to enrich beads attached to a target nucleic acid molecule carrying a biotin adduct after pre-implantation and/or template reaction using a soluble-capped tailed P1/B primer (e.g., as depicted in fig. 4). In some embodiments, for example in massively parallel sequencing reactions, beads (enriched or not) attached to a target nucleic acid and produced according to a series of reactions depicted in fig. 4 are sequenced. In some embodiments, beads (enriched or not) attached to a target nucleic acid molecule are placed on an array of reaction chambers coupled to a Field Effect Transistor (FET) or ion-sensitive field effect sensor (ISFE), and the target nucleic acid molecule is sequenced.

In some embodiments, the template nucleic acid molecule is derived from a sample from a natural or non-natural source. In some embodiments, the nucleic acid molecules in the sample are derived from living organisms or cells. Any nucleic acid molecule may be used, for example, a sample may comprise genomic DNA covering part or all of the genome, mRNA, or miRNA from a living organism or cell. In other embodiments, the template nucleic acid molecule is synthetic or recombinant. In some embodiments, the sample contains nucleic acid molecules having substantially identical sequences or a mixture of different sequences. Illustrative embodiments are generally performed using nucleic acid molecules produced within and by living cells. Such nucleic acid molecules are typically isolated directly from a natural source, such as a cell or body fluid, without any ex vivo amplification. Thus, the sample nucleic acid molecules are directly used in the subsequent steps. In some embodiments, the nucleic acid molecules in the sample can comprise two or more nucleic acid molecules having different sequences.

Various methods of preparing a template nucleic acid molecule from a sample are known in the art and may be used in any aspect of the pre-implantation and/or templating methods, as well as systems, compositions, kits, and/or devices. In some embodiments, the nucleic acid molecules are present in the sample in a fragmented or non-fragmented form. In any of the disclosed embodiments, the nucleic acid molecules in the sample are fragmented, or further fragmented prior to use in the pre-implant reaction to produce nucleic acid molecules of any selected length. One of skill in the art will recognize methods for performing such fragmentation to obtain fragments within a selected length range. For example, the following methods may be used to fragment nucleic acid molecules: physical methods such as sonication; enzymatic methods, such as digestion by DNase I or restriction endonucleases; or chemical means, such as heating in the presence of divalent metal cations. In some embodiments, the nucleic acid molecules in the sample are fragmented to produce nucleic acid molecules of any selected length. One skilled in the art will recognize methods for performing such fragmentation to achieve a range of selected lengths. In other embodiments, nucleic acids within the range selection length are selected using methods known in the art. In some aspects, nucleic acid molecules or nucleic acid fragments of a particular size range are selected using methods known in the art. In some embodiments, the nucleic acid molecule or fragment is between about 2 and 10,000 nucleotides in length, for example between about 2 and 5,000 nucleotides in length, between about 2 and 3,000 nucleotides in length, or between about 2 and 2,000 nucleotides in length.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices, for use of nucleic acid molecules from a sample as part of a high throughput sequencing workflow in order to generate a library of template nucleic acid molecules. In some embodiments, the population of different template nucleic acid molecules amplified using any one of the amplification methods of the present teachings comprises a library of template nucleic acid molecules having nucleic acid adaptor sequences at one or both ends. For example, the template nucleic acid molecules in the library can comprise first and second ends, wherein the first end is ligated to a first nucleic acid adaptor. The template nucleic acid molecules in the library may further comprise a second end that is ligated to a second nucleic acid adaptor. The first and second nucleic acid adaptors can be ligated or otherwise introduced into the template nucleic acid molecule. Adapters may be ligated or otherwise introduced to the ends of a linear template or into the body of a linear or circular template nucleic acid molecule. Optionally, the template nucleic acid molecule may be circularized after ligation or introduction of an adaptor. In some embodiments, a first adaptor is ligated or introduced to a first end of the linear template and a second adaptor is ligated or introduced to a second end of the template. The first and second adaptors may have the same or different sequences. The first and second adaptors may have the same or different primer binding sequences. In some embodiments, at least a portion of the first or second nucleic acid adaptors (i.e., as part of the template nucleic acid molecules in the library) can hybridize to a first primer, which is a universal primer.

The nucleic acid molecules may have 5 'and/or 3' overhangs that can be repaired prior to further library preparation. In illustrative embodiments, template nucleic acid molecules having 5 'and 3' overhangs are repaired to produce blunt-ended sample nucleic acid molecules using methods known in the art. For example, in an appropriate buffer, the polymerase and exonuclease activities of Klenow large fragment polymerase can be used to fill in 5 'overhangs and remove 3' overhangs on nucleic acid molecules. In some embodiments, a phosphate is added to the 5' end of the repaired nucleic acid molecule using a Polynucleotide Kinase (PNK) and reaction conditions that will be understood by those skilled in the art. In other illustrative embodiments, a single nucleotide or multiple nucleotides are added to one strand of a double-stranded molecule to create a "sticky end". For example, adenosine (a) may be attached to the 3' end of the nucleic acid molecule (with an a tail). In some embodiments, sticky ends other than A overhangs may be used. In some embodiments, additional adapters are added, such as circular adapter adapters. In some embodiments, adapters are added during the PCR step. In any embodiment of the present teachings, all or any combination of these modifications are not made, are made. Many kits and methods for generating a population of template nucleic acid molecules for subsequent sequencing are known in the art. Such kits will typically be modified to include adapters tailored for the amplification and sequencing steps of the methods and compositions of the present teachings. Adapter ligation can also be performed using commercially available kits, such as the ligation kit present in the Agilent SureSelect kit (Agilent).

In some embodiments, the amplification method optionally comprises a target enrichment step before, during, or after library preparation and before the preimplantation reaction. Target nucleic acid molecules comprising a target locus or region of interest can be enriched, for example, by multiplex nucleic acid amplification or hybridization. Various methods of performing multiplex nucleic acid amplification to generate amplicons, such as multiplex PCR, are known in the art and may be used in any of the embodiments of the present teachings. Enrichment may be performed by any method prior to adding the template nucleic acid molecule to the pre-implant reaction mixture, followed by a general amplification reaction. Any embodiment of the present teachings comprises enriching a plurality of at least 2, 3,4, 5,6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000 target nucleic acid molecules, target loci, or regions of interest. In any of the disclosed embodiments, the target locus or region of interest is at least 1, 2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75, 100, 125, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, or 1,000 nucleotides in length and comprises a portion or all of a template nucleic acid molecule. In other embodiments, the target locus or region of interest is between about 1 and 10,000 nucleotides in length, for example between about 2 and 5,000 nucleotides in length, between about 2 and 3,000 nucleotides in length, or between about 2 and 2,000 nucleotides in length. In any embodiment of the present teachings, multiplex nucleic acid amplification comprises generating at least 2, 3,4, 5,6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000 copies of each target nucleic acid molecule, target locus, or region of interest. In any of the disclosed embodiments, the methods for pre-implantation, and related compositions, systems, kits, and devices, comprise generating a population of pre-implanted solid supports using amplicons from multiple nucleic acid amplifications in a pre-implantation reaction.

In some embodiments, after the library preparation and optional enrichment steps, the library of template nucleic acid molecules is templated onto one or more vectors. In the present disclosure, one or more supports are typically templated in two reactions: a pre-implant reaction to produce a pre-implanted solid support; and performing a template reaction using the one or more pre-implanted carriers to further amplify the ligated template nucleic acid molecule. The pre-implant reaction is typically an amplification reaction and may be performed using various methods as will be understood by those skilled in the art. For example, the pre-implant reaction can be performed in an RPA reaction, a template walking reaction, or PCR. In the RPA reaction, a template nucleic acid molecule is amplified using a recombinase, a polymerase, and optionally a recombinase helper protein, in the presence of primers and nucleotides. The recombinase and optionally the recombinase helper protein can dissociate at least a portion of the double-stranded template nucleic acid molecule, allowing primer hybridization, followed by polymerase binding to initiate replication. In some embodiments, the recombinase helper protein is a single-stranded binding protein (SSB) that prevents rehybridization of the dissociated template nucleic acid molecule. Typically, the RPA reaction is carried out at isothermal temperatures. In a template walking reaction, a polymerase is used to amplify a template nucleic acid molecule in the presence of primers and nucleotides, under reaction conditions that allow at least a portion of the double-stranded template nucleic acid molecule to dissociate such that the primers can hybridize and the polymerase can subsequently bind to initiate replication. In PCR, a double-stranded template nucleic acid molecule is dissociated by thermal cycling. After cooling, the primer binds to the complementary sequence and is available for replication by a polymerase. In any of the aspects of the present teachings, the pre-implant reaction is performed in a pre-implant reaction mixture formed from components necessary for amplification of the template nucleic acid molecule. In any of the aspects disclosed, the pre-implant reaction mixture comprises some or all of: a population of template nucleic acid molecules, a polymerase, one or more solid supports with attached first primer population, nucleotides, and a cofactor (e.g., divalent cation). In some embodiments, the pre-implant reaction mixture further comprises a second primer and optionally a diffusion limiting agent. In some embodiments, the population of template nucleic acid molecules comprises a template nucleic acid molecule joined to at least one adaptor sequence that hybridizes to the first or second primer. In some embodiments, such as in emulsion RPA or emulsion PCR, the reaction mixture forms an emulsion. In the pre-implant reaction by the RPA reaction, the pre-implant reaction mixture comprises the recombinase and optionally a recombinase helper protein. The various components of the reaction mixture are discussed in further detail herein.

In some embodiments, the pre-implant reaction mixture comprises a population of template nucleic acid molecules typically derived from library preparation or target enrichment. In some embodiments, the template nucleic acid molecule or population of template nucleic acid molecules is at least some and typically all members of a library of template nucleic acid molecules. In some embodiments, the pre-implant reaction mixture comprises at least one template nucleic acid molecule. In some embodiments, the pre-implant reaction mixture comprises at least two template nucleic acid molecules having different sequences. In illustrative embodiments, the pre-implant reaction mixture comprises a population of template nucleic acid molecules having different sequences. In some embodiments, the pre-implant reaction mixture comprises a population of substantially monoclonal template nucleic acid molecules. In any embodiment of the present teachings, when a template nucleic acid molecule is alternatively referred to herein, the template nucleic acid molecule is a polynucleotide, (the template nucleic acid molecule is interchangeably referred to herein as a template or a nucleic acid template or a polynucleotide template). In various embodiments, the template nucleic acid molecule is a polymer of deoxyribonucleotides, ribonucleotides, and/or analogs thereof. In some embodiments, the polynucleotide is in a naturally occurring, synthetic, recombinant, cloned, amplified, unamplified, or archived (e.g., deposited) form. In some embodiments, the polynucleotide is DNA, cDNA, RNA, or chimeric RNA/DNA and nucleic acid analogs.

The template nucleic acid molecule to be amplified may be double stranded or may be at least partially double stranded using suitable procedures prior to the pre-implantation reaction. In some embodiments, the template is a linear chain. Alternatively, the template may be cyclic, or comprise a combination of linear and cyclic regions. In some embodiments, amplifying comprises forming a partially denatured template. For example, amplification may comprise partially denaturing the double-stranded template nucleic acid molecule. Optionally, partially denaturing comprises subjecting the double stranded template nucleic acid molecule to partially denaturing conditions. In some embodiments, the partially denatured template comprises a single-stranded portion and a double-stranded portion. In some embodiments, the single stranded portion comprises a first primer binding sequence. In some embodiments, the single-stranded portion comprises a second primer binding sequence. In some embodiments, the single-stranded portion comprises a first primer binding sequence and a second primer binding sequence.

Optionally, the double-stranded template nucleic acid molecule comprises a forward strand. The double-stranded template nucleic acid molecule may further comprise a reverse strand. The forward strand optionally comprises a first primer binding sequence. The reverse strand optionally comprises a second primer binding sequence. As disclosed above, the ligation primer binding sequence is typically attached during library preparation. In some embodiments, the template nucleic acid molecule already comprises a first primer binding sequence and optionally a second primer binding sequence. Alternatively, the template nucleic acid molecule optionally does not initially comprise a primer binding sequence, and library preparation may optionally comprise ligating or introducing a primer binding sequence to the template, as disclosed above.

In some embodiments, the template nucleic acid molecule comprises a single-stranded or double-stranded polynucleotide, or a mixture of both. In some embodiments, the template nucleic acid molecule comprises polynucleotides having the same or different nucleotide sequences. In some embodiments, the template nucleic acid molecules comprise polynucleotides of the same or different lengths. In various embodiments, the pre-implant reaction mixture is comprised between about 2 and 10¹²Between different template nucleic acid molecules, e.g. between about 2 and 10¹¹Between about 2 and 10 different template nucleic acid molecules¹⁰Between about 2 and 10 different template nucleic acid molecules⁹Between about 2 and 10 different template nucleic acid molecules⁸Between about 2 and 10 different template nucleic acid molecules⁷Between about 2 and 10 different template nucleic acid molecules⁶Between about 2 and 500,000 different template nucleic acid molecules in any of the disclosed embodiments, the reaction mixture is comprised of 5 × 10⁶And 10¹⁰A solid support in between. The solid support can have a minimum cross-sectional length (e.g., diameter) of 50 microns or less, preferably 10 microns or less, 3 microns or less, approximately 1 micron or less, approximately 0.5 microns or less, such as approximately 0.1, 0.2, 0.3, or 0.4 microns or less (e.g., less than 1 nanometer, about 1-10 nanometers, about 10-100 nanometers, or about 100-500 nanometers). In any of the embodiments of the present teachings, the volume of the pre-implant reaction mixture and/or template reaction mixture is between about 50 and 2,000 μ Ι, such as between about 50 and 1,500 μ Ι, between about 50 and 1,000 μ Ι, between about 50 and 500 μ Ι, between about 50 and 250 μ Ι, or between about 50 and 150 μ Ι.

A pre-implant reaction is performed to produce one or more pre-implanted carriers. Thus, in any of the disclosed aspects, the pre-implant reaction mixture may comprise one or more solid or semi-solid carriers linked to a template nucleic acid molecule. As used herein, a solid or semi-solid carrier may also refer to a carrier having a ligation site that can be clearly analyzed in downstream sequencing methods. In illustrative embodiments, the one or more vectors comprise a first population of substantially identical primers attached. In some embodiments, at least one template nucleic acid molecule in the reaction mixture comprises a first primer binding sequence. The first primer binding sequence can be substantially identical to or substantially complementary to the sequence of the first primer. In some embodiments, at least one, some, or all of the vectors comprise a first population of primers that are substantially identical to each other. In some embodiments, all of the primers on the vector are substantially identical to each other, or all comprise a first primer sequence that is substantially identical. In some embodiments, at least one of the vectors comprises two or more different primers attached thereto. For example, the at least one vector may comprise a first primer population and a second primer population. The vector may be linked to a universal primer. The universal primer optionally hybridizes (or is capable of hybridizing) to all or substantially all of the template nucleic acid molecules within the reaction mixture. The reaction mixture may comprise a first support covalently linked to a first target-specific primer and a second support covalently linked to a second target-specific primer, wherein the first and second target-specific primers are different from each other. Optionally, the first target-specific primer is substantially complementary to the first target nucleic acid sequence and the second target-specific primer is substantially complementary to the second target nucleic acid sequence, and wherein the first and second target nucleic acid sequences are different.

In some embodiments, two or more different template nucleic acid molecules having a first primer binding sequence are included in the pre-implant reaction mixture. In some embodiments, at least two different template nucleic acid molecules are amplified directly onto a support, such as a site on a support comprising a plurality of sites, a bead or microparticle, or a reaction chamber of an array. The template nucleic acid molecules may be pre-implanted in bulk in solution and subsequently dispensed into a well array or reaction site on a solid support. Alternatively, a solid support may be dispensed into the array of wells, and the template nucleic acid molecule may be pre-implanted on the solid support while it remains in situ in the array of wells. In some embodiments, the method for nucleic acid amplification comprises one or more surfaces.

In some embodiments, the surface has attached thereto a first population of primers, the first primers in the population sharing a common first primer sequence. In some embodiments, the surface has attached thereto a first population of primers and a second population of primers, the first primers in the populations sharing a common first primer sequence, and the second primers in the second population of primers sharing a common second primer sequence. In some embodiments, a first population of primers has been immobilized on a surface. In other embodiments, the first primer population and the second primer population have been immobilized on a surface.

The support or surface may be coated with an acrylamide, carboxylic acid, or amine compound for attaching a nucleic acid molecule (e.g., the first primer or the second primer). In some embodiments, an amino-modified nucleic acid molecule (e.g., a primer) is attached to a carboxylic acid-coated support. In some embodiments, the amino-modified nucleic acid molecule is reacted with EDC (or EDAC) to attach to a carboxylic acid-coated surface (with or without NHS). The first primer may be attached to the acrylamide compound coated on the surface. The particles may be coated with an avidin-like compound (e.g., streptavidin) to bind the biotin-labeled nucleic acid.

In some embodiments, the reaction mixture comprises a plurality of different surfaces, e.g., the pre-implant reaction mixture comprises one or more beads (e.g., particles, nanoparticles, microparticles, and the like), and the at least two different template nucleic acid molecules are amplified onto the different beads, thereby forming at least two different beads, each of which is linked to a different template nucleic acid molecule. In some embodiments, the pre-implant reaction mixture comprises a single surface (e.g., a planar-like surface, a flow cell, or an array of reaction chambers), and at least two different template nucleic acid molecules are amplified onto two different regions or locations on the surface, thereby forming a single surface linked to two or more template nucleic acid molecules.

In some embodiments, the surface of the solid support is porous, semi-porous, or non-porous. In some embodiments, the surface is a planar surface, and is concave, convex, or any combination thereof. In some embodiments, the surface is the inner wall of a bead, particle, microparticle, sphere, filter, flow cell, well, groove, channel reservoir, gel, or capillary. In some embodiments, the surface includes texture (e.g., etching, forming voids, holes, three-dimensional structures, or bumps).

In some embodiments, the surface of the solid support is a magnetic or paramagnetic bead (e.g., a magnetic or paramagnetic nanoparticle or microparticle). In some embodiments, the paramagnetic microparticles are paramagnetic beads (e.g., Dynabeads) linked to streptavidin^TMM-270, Invitrogen, Calsbad, Calif.). The particles may have iron cores, or may be hydrogel or agarose (e.g., Sepharose)^TM)。

In some embodiments, the surface comprises a surface of a bead. In some embodiments, the beads are polymeric materials. For example, the beads may be gels, hydrogels, or acrylamide polymers. The beads may be porous. The particles may have voids or pores, or may comprise a three-dimensional architecture. In some embodiments, the particle is Ion Sphere^TMParticles (ThermoFisher scientific, Waltham, Mass.).

Typically, the polymeric particle or bead carrier may be treated to comprise biomolecules, including nucleosides, nucleotides, nucleic acids (oligonucleotides and polynucleotides), polypeptides, saccharides, polysaccharides, lipids, or derivatives or analogs thereof. For example, the polymer particles may be bound or linked to biomolecules. The ends or any internal portion of the biomolecule may be bound or linked to the polymer particle. The polymer particles may be bound or linked to biomolecules using linkage chemistry. The linkage chemistry methods include covalent or non-covalent bonds, including ionic, hydrogen, affinity, dipole-dipole, van der Waals (van der Waals) bonds, and hydrophobic bonds. The linking chemistry method comprises affinity between binding partners, for example between: an avidin moiety and a biotin moiety; an epitope and an antibody or immunoreactive fragment thereof; antibodies and haptens; digoxin moiety (digoxigen motif) and anti-digoxin antibody; a fluorescein moiety and an anti-fluorescein antibody; an operon and a suppressor; nucleases and nucleotides; lectins and polysaccharides; steroids and steroid binding proteins; active compounds and active compound receptors; hormones and hormone receptors; an enzyme and a substrate; immunoglobulins and protein a; or an oligonucleotide or polynucleotide and its corresponding complementary sequence.

In particular, a solid support, such as a bead support, can comprise copies of the polynucleotide. In particular examples, the polymer particles can be used as carriers for polynucleotides during sequencing techniques. For example, such hydrophilic particles can immobilize a polynucleotide for sequencing using fluorescent sequencing techniques. In another example, hydrophilic particles may be immobilized for multiple copies of a polynucleotide sequenced using ion sensing techniques. Alternatively, the treatment described above may improve the adhesion of the polymer matrix to the sensor array surface. The polymer matrix may capture an analyte, such as a polynucleotide for sequencing.

In some embodiments, one or more nucleic acid templates are immobilized onto one or more supports. The template nucleic acid molecule may be immobilized on the support by any method, including but not limited to physical adsorption, by ionic or covalent bond formation, or a combination thereof. The solid support may comprise a polymeric, glass or metallic material. Examples of solid supports include membranes, planar surfaces, microtiter plates, beads, filters, test strips, slides, coverslips, and tubes. By solid support is meant any solid phase material on which an oligomer is synthesized, attached, conjugated or otherwise immobilized. The support may optionally comprise a "resin", "phase", "surface", and "support". The support may comprise organic polymers such as polystyrene, polyethylene, polypropylene, polyvinyl fluoride, polyethyleneoxy and polyacrylamide as well as copolymers and grafts thereof. The support may also be inorganic, such as glass, silica, controlled-pore glass (CPG), or reverse phase silica. The configuration of the carrier may be in the form of beads, spheres, particles, granules, gels or surfaces. The surface may be planar, substantially planar or non-planar. The support may be porous or non-porous and may have swelling or non-swelling characteristics. The carrier may be shaped to include one or more holes, recesses or other receptacles (containers), receptacles (vessel), features or locations. One or more carriers may be disposed at different locations in the array. The carrier is optionally addressable (e.g., for mechanical delivery of the agent), or by detection means, including scanning with laser illumination and confocal or polarized focusing. The carrier (e.g., bead) can be placed in or on another carrier (e.g., within a well of a second carrier). In some embodiments, the carrier is an ionic spherical particle.

In some embodiments, the solid support is a "microparticle", "bead", "microbead", or the like, (optionally but not necessarily spherical in shape), having a minimum cross-sectional length (e.g., diameter) of 50 microns or less, preferably 10 microns or less, 3 microns or less, approximately 1 micron or less, approximately 0.5 microns or less, such as approximately 0.1, 0.2, 0.3, or 0.4 microns or less (e.g., less than 1 nanometer, about 1-10 nanometers, about 10-100 nanometers, or about 100-500 nanometers). Microparticles (e.g., Dynabead, Dynal, oslo norwegian) can be made from a variety of inorganic or organic materials including, but not limited to, glass (e.g., controlled pore glass), silica, zirconia, crosslinked polystyrene, polyacrylate, polymethylmethacrylate, titanium dioxide, latex, polystyrene, and the like. Magnetization can facilitate aggregation and concentration of microparticle-attached reagents (e.g., polynucleotides or ligases) after amplification, and can also facilitate additional steps (e.g., washing, reagent removal, etc.). In certain embodiments, populations of microparticles having different shapes sizes and/or colors are used. The microparticles may optionally be encoded, for example with quantum dots, such that each microparticle or group of microparticles can be individually or uniquely identified.

In some embodiments, the bead surface is functionalized for ligation of a first population of primers. In some embodiments, the beads are of any size that can be placed into the reaction chamber. For example, a bead can be placed into the reaction chamber. In some embodiments, more than one bead is placed in the reaction chamber. In some embodiments, the beads have a minimum cross-sectional length (e.g., diameter) of about 50 microns or less, or about 10 microns or less, or about 3 microns or less, about 1 micron or less, about 0.5 microns or less, such as about 0.1, 0.2, 0.3, or 0.4 microns or less (e.g., less than 1 nanometer, about 1-10 nanometers, about 10-100 nanometers, or about 100-500 nanometers).

In some embodiments, two or more different template nucleic acid molecules are positioned, placed, or placed at different sites prior to the pre-implant reaction. In some embodiments, two or more different template nucleic acid molecules are pre-implanted in a solution, optionally within a single pre-implant reaction mixture, and the resulting two or more populations of substantially monoclonal template nucleic acid molecules are subsequently located, placed, or placed at different sites following such amplification. The different sites are optionally members of an array site. The array may comprise a two-dimensional array of sites on a surface (e.g., the surface of a flow cell, electronic device, transistor chip, reaction chamber, channel, and the like), or a three-dimensional array of sites within a matrix or other medium (e.g., solid, semi-solid, liquid, fluid, and the like).

In some embodiments, methods and template reactions for pre-implanting a template nucleic acid molecule onto one or more carriers typically employ one or more enzymes capable of undergoing polymerization. In any of the embodiments of the present teachings, the one or more enzymes capable of performing polymerization comprise at least one polymerase. In some embodiments, the at least one polymerase comprises a thermostable or thermolabile polymerase. In some embodiments, the at least one polymerase comprises a biologically active fragment of a DNA or RNA polymerase that retains sufficient catalytic activity to polymerize or incorporate at least one nucleotide under any suitable conditions. In various embodiments, the at least one polymerase comprises a mutant DNA or RNA polymerase that retains sufficient catalytic activity to perform nucleotide polymerization under any suitable conditions. In various embodiments, the at least one polymerase comprises one or more amino acid mutations that retain sufficient catalytic activity to effect polymerization. The polymerase optionally may have or lack exonuclease activity. In some embodiments, the polymerase has 5 'to 3' exonuclease activity, 3 'to 5' exonuclease activity, or both. Optionally, the polymerase lacks any one or more of such exonuclease activities. In some embodiments, the polymerase has strand displacement activity. Examples of suitable strand displacement polymerases include bacteriophage Φ 29DNA polymerase and Bst DNA polymerase.

In some embodiments, the polymerase comprises any enzyme or fragment or subunit thereof that can catalyze the polymerization of nucleotides and/or nucleotide analogs. In some embodiments, the polymerase requires an extendable 3' end. For example, polymerases require the terminal 3' OH of a nucleic acid primer to initiate nucleotide polymerization. The polymerase may be other than a heat stable polymerase. For example, the polymerase can be active at 37 ℃, and/or more active at 37 ℃ than at 50 ℃, 60 ℃, 70 ℃ or higher. In various embodiments, the polymerase may be active at 42 ℃, 45 ℃,50 ℃, 55 ℃, or 60 ℃, and/or more active at these temperatures than at 37 ℃.

The polymerase may comprise any enzyme that can catalyze the polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Typically, but not necessarily, such nucleotide polymerizations may be performed in a template-dependent manner. In some embodiments, the polymerase is a high fidelity polymerase. Such polymerases can include, but are not limited to, naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, fused or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives, or fragments thereof that retain the ability to catalyze such polymerizations. Optionally, the polymerase is a mutant polymerase having one or more mutations involving the substitution of one or more amino acids with other amino acids, insertion or deletion of one or more amino acids from the polymerase, or ligation of two or more portions of the polymerase. As used herein, the term "polymerase" and variations thereof also refer to fusion proteins comprising at least two moieties linked to each other, wherein a first moiety may comprise a peptide that can catalyze the polymerization of nucleotides into a nucleic acid strand and is linked to a second moiety that may comprise a second polypeptide, such as a reporter enzyme or a domain that enhances processivity. Typically, the polymerase contains one or more active sites that can undergo nucleotide binding and/or nucleotide polymerization catalysis. In some embodiments, the polymerase may comprise or lack other enzymatic activities, such as 3 'to 5' exonuclease activity or 5 'to 3' exonuclease activity. In some embodiments, the polymerase is isolated from the cell, or produced using recombinant DNA techniques or chemical synthesis methods. In any of the embodiments of the present teachings, the polymerase is expressed in a prokaryotic organism, a eukaryotic organism, a virus, or a phage organism. In various embodiments, the polymerase is a DNA polymerase and includes, but is not limited to, bacterial DNA polymerases, eukaryotic DNA polymerases, archaeal DNA polymerases, viral DNA polymerases, and bacteriophage DNA polymerases. In various embodiments, the expressed polymerase is purified using methods known in the art. In some embodiments, the polymerase is a post-translationally modified protein or fragment thereof.

In some embodiments, the polymerase comprises any one or more polymerases or biologically active fragments of polymerases as described in: U.S. patent publication No. 2011/0262903, published by Davidson et al, 2011/10/27; and/or international PCT publication No. WO 2013/023176, published by Vander Horn et al, 2013/2/14, which is incorporated herein by reference in its entirety.

In some embodiments, the polymerase is a replicase, a DNA-dependent polymerase, a primase, an RNA-dependent polymerase (including an RNA-dependent DNA polymerase, e.g., a reverse transcriptase), a heat-labile polymerase, or a heat-stable polymerase. In some embodiments, the polymerase is any a or B family type polymerase. Many types of A (e.g., E.coli) Pol I, B (e.g., E.coli Pol II), C (e.g., E.coli Pol III), D (e.g., euryalchaeotic (Euryarchaeotic) Pol II), X (e.g., human Pol. beta.), and Y families (e.g., E.coli Umuc/DinB and the eukaryotes RAD 30/xeroderma pigmentosum variant) polymerases are described in Rothwell and Watsman 2005, Advances in protein chemistry 71: 401-. In some embodiments, the polymerase is T3, T5, T7, or SP6 RNA polymerase.

In some embodiments, the nucleic acid amplification reaction is performed with one type of polymerase and/or ligase, or a mixture of polymerases and/or ligases. In some embodiments, the nucleic acid amplification reaction is performed with a low fidelity or high fidelity polymerase, or without regard to fidelity.

An exemplary polymerase is Bst DNA polymerase (Exonuclease Minus), a 67kDa Bacillus stearothermophilus DNA polymerase protein (large fragment) exemplified in accession number 2BDP _ a, having 5 'to 3' polymerase activity and strand displacement activity but lacking 3 'to 5' Exonuclease activity. Other polymerases include Taq DNA polymerase I (exemplified by accession number 1 TAQ) from Thermus aquaticus (Thermus aquaticus), Eco DNA polymerase I (accession number P00582) from Escherichia coli (Escherichia coli), Aea DNA polymerase I (accession number 067779) from hyperthermophiles (Aquifexaolicus), or functional fragments or variants thereof having at least 80%, 85%, 90%, 95%, or 99% sequence identity at the nucleotide level, for example.

In an illustrative example, the DNA polymerase is Bsu DNA polymerase (large fragment (NEB)). Bsu DNA polymerase I large fragment retains the 5 'to 3' polymerase activity of Bacillus subtilis DNA polymerase I (1) but lacks the 5 'to 3' exonuclease domain. In certain embodiments, the Bsu DNA polymerase large fragment lacks 3 'to 5' exonuclease activity. In various embodiments, Bsu DNA polymerase large fragment has optimal activity at 37 ℃.

In certain illustrative embodiments, particularly when the pre-implant reaction is an RPA reaction, the one or more enzymes capable of performing polymerization comprise T5 or T7 DNA polymerase. In some embodiments, the one or more enzymes capable of undergoing polymerization comprise T5 or T7 DNA polymerase having one or more amino acid mutations that reduce 3 'to 5' exonuclease activity. In some embodiments, the T5 or T7 DNA polymerase having one or more amino acid mutations that reduce 3 to 5' exonuclease activity does not contain amino acid mutations that interfere with the processivity of the T5 or T7 DNA polymerase. In some embodiments, the T5 or T7 DNA polymerase comprises one or more amino acid mutations that eliminate detectable 3 'to 5' exonuclease activity; and wherein the one or more amino acid mutations do not interfere with the processive capacity of T5 or T7 DNA polymerase. In certain illustrative embodiments, the pre-implant reaction mixture comprises Sau polymerase, T7 DNA polymerase with reduced 3 'to 5' exonuclease activity, Bsu polymerase, or a combination thereof. These polymerases, which are particularly well suited for the RPA reaction, are not only very suitable for the pre-implant reaction, but also for the template reaction.

In some embodiments, the one or more enzymes capable of performing polymerization comprise any suitable RNA polymerase. Suitable RNA polymerases include, but are not limited to, T3, T5, T7, and SP6 RNA polymerases.

In various embodiments, a template nucleic acid molecule used in any of the methods of the present teachings, including a pre-implant reaction and a template reaction, typically comprises a first primer binding sequence ("forward") and optionally a second primer binding sequence ("reverse"). Thus, the pre-implant reaction mixture and the template reactant comprise a first primer population and optionally a second primer population that bind to the forward primer binding sequence and the reverse primer binding sequence, respectively. In some embodiments, the first and second primers are referred to as a primer pair. In some embodiments, the first primer and/or the second primer is/are typically a universal primer. The first primer can bind to the forward primer binding sequence or the reverse primer binding sequence, and the second primer can bind to the forward primer binding sequence or the reverse primer binding sequence.

In any of the disclosed embodiments, the reaction mixture comprises a first primer population and a second primer population that bind to a sequence within a template nucleic acid molecule. The first primer population may be identical copies or different sequences. The second primer population may be identical copies or different sequences. However, the first primer population and the optional second primer population are typically universal primers and all copies are identical. Thus, in an illustrative embodiment, both the first primer population and the second primer population are universal primers that bind to a universal primer binding sequence on a template nucleic acid molecule. In other embodiments, both the first population of primers and the second population of primers are target-specific primers. The first primer population and the second primer population may have the same or different sequences. In any of the embodiments of the present teachings, the first primer population and/or the second primer population are ligated to one or more vectors prior to incubation with the pre-implant reaction mixture. In other embodiments, the first primer population and/or the second primer population are in solution during incubation with the preimplantation reaction mixture. In illustrative embodiments, the first primer population is ligated to one or more vectors prior to incubation with the preimplantation reaction mixture; and the second primer population is typically in solution during incubation with the preimplantation reaction mixture.

Thus, in these illustrative embodiments comprising the immobilized first primer population and second primer population in solution, without being limited by theory, during the pre-implant reaction, the template nucleic acid is at least partially denatured and the first primer binding site on the template is bound to the first template attached to the solid support. The polymerase uses the first primer to generate a complementary strand to one strand of the template nucleic acid. That complementary strand is now covalently linked to the solid support via the primer. The second primer in solution is in the form of a complex with the recombinase and binds to the primer binding site on the complementary strand, thereby partially denaturing the bound template nucleic acid molecule. The polymerase uses the primer to synthesize a new strand identical to the original template nucleic acid strand. It is believed that this strand will then be partially denatured by the complex binding the recombinase and the nearby first primer attached to the solid support, and the polymerase will synthesize the other complementary strand. By repeating steps of this method, a substantially monoclonal population of template nucleic acid molecules is generated during the pre-implantation reaction, and is further amplified during the template reaction.

In some embodiments, the present disclosure relates generally to methods, as well as systems, compositions, kits, and devices, wherein the primer typically has a free 3' hydroxyl group. In some embodiments, the primer is a polymer of ribonucleotides, deoxyribonucleotides, or analogs thereof. In some embodiments, the primer is in a naturally occurring, synthetic, recombinant, cloned, amplified, or unamplified form. In some embodiments, the primer comprises phosphodiester bonds between all nucleotides. In any of the embodiments of the present teachings, the primer is between about 5 and 100 nucleotides in length, for example between about 5 and 80 nucleotides in length, between about 5 and 60 nucleotides in length, between about 5 and 40 nucleotides in length, between about 10 and 75 nucleotides in length, between about 15 and 75 nucleotides in length, or between about 20 and 50 nucleotides in length.

In some embodiments, at least one primer has a modification. For example, a ribonucleotide, deoxyribonucleotide or analog thereof can have biotin or azide attached thereto. In some embodiments, the ribonucleotide, deoxyribonucleotide or analog thereof has an attached fluorophore, phosphorylation or spacer. In some embodiments, the primer is blocked and/or is a fusion primer or fusion polynucleotide, wherein different regions of the primer or polynucleotide are designed to bind to and/or are designed to be bound by one of the two primer binding sites.

In some embodiments, the primer is a blocked primer to prevent extension of the 3' end of the primer. In some embodiments, the capped primer is a tailed primer, wherein the 5' end comprises a sequence that is non-complementary to the template nucleic acid molecule. The 5' sequence can be used as a template for a primer extension reaction. In some embodiments, the primer is blocked, wherein the 5' domain is between 15 and 30 nucleotides in length. In some embodiments, the primer comprises a blocking moiety at its 5 'or 3' end or at both the 5 'and 3' ends. In reactions involving primer extension (e.g., preimplantation amplification), a capping moiety at the 3' end of a capped fusion primer can reduce the level of primer dimer formation. In certain embodiments, the pre-implant reaction mixture comprises blocked primers, wherein the 3' domain is between 14 and 25 nucleotides in length. In other embodiments, the 3' domain is between 15 and 25 nucleotides in length. In yet other embodiments, the 5 'domain is at least 15 nucleotides and the 3' domain is at least 10 nucleotides, wherein the primer is no more than 100, 90, 80, 75, 70, 60, or 50 nucleotides in length. In embodiments, the 3 'nucleotide of the 3' domain of the forward primer is mismatched to the forward primer binding sequence. In an example, the ribobase (ribobase) separating the 5 'domain and the 3' domain of the capping primer comprises rU, rG, rC, or rA. In certain embodiments, the nucleobases separating the 5 'domain and the 3' domain of the capping primer comprise rC. In any embodiment of the present teachings, the 3' domain of the capping primer is 14 to 20 nucleotides in length and the nucleobase is rU, rG, rC or rA.

In any of the embodiments of the present teachings, the reaction mixture comprises an enzyme that removes a portion of the blocked primer to leave a free 3' OH. After removing the end-cap of the primer, the polymerase can initiate replication from the free 3' OH to begin replicating the template strand. In some embodiments, such an enzyme is an rnase, in particular rnase H. One skilled in the art will recognize other compositions of blocked primers used and aptamers used to remove a portion of the blocked primers.

The pre-implant reaction mixture, as well as any other amplification reactants (including the template reaction mixture) in the methods provided herein, typically comprises a source of nucleotides or analogs thereof that are used as substrates for the extension reaction by a polymerase. In any of the embodiments of the present teachings, the pre-implant reaction mixture typically comprises nucleotides (dntps) for chain extension of a template nucleic acid molecule to produce a substantially monoclonal population of template nucleic acid molecule sequences linked to one or more vectors. In some embodiments, the nucleotide is not externally labeled. For example, a nucleotide may be a naturally occurring nucleotide or a synthetic analog that does not include a fluorescent moiety, dye, or other extraneous optically detectable label. Optionally, the nucleotide does not contain a group that terminates nucleic acid synthesis (e.g., dideoxy groups, reversible terminators, and the like). In other embodiments, the nucleotide comprises a label or tag.

In some embodiments, the method for nucleic acid amplification comprises at least one cofactor, e.g., a cofactor that enhances DNA or RNA polymerase activity. In some embodiments, the cofactor comprises one or more divalent cations. Examples of divalent cations include magnesium, manganese, and calcium. In various embodiments, the pre-implant reaction mixture comprises a buffer comprising one or more divalent cations. In illustrative embodiments, the buffer contains magnesium or manganese ions. In any of the embodiments of the present teachings, the pre-implant reaction or template reaction is initiated by the addition of a cofactor, particularly a divalent cation. In some embodiments, the pre-implant reaction mixture used herein for nucleic acid amplification may comprise at least one cofactor for recombinant enzyme assembly on nucleic acids or for homologous nucleic acid pairing. In some embodiments, the cofactor comprises any form of ATP, including ATP and ATP γ S. In some embodiments, the method for nucleic acid amplification comprises at least one cofactor that regenerates ATP. For example, the cofactor may comprise an enzyme system that converts ADP to ATP. In some embodiments, the cofactor enzyme system is phosphocreatine and creatine kinase.

In any aspect of the present teachings, the pre-implant reaction mixture comprises a component that partially denatures the template nucleic acid molecule. In some embodiments, the partially denaturing conditions comprise treating or contacting the template nucleic acid molecule to be amplified with one or more enzymes capable of partially denaturing the nucleic acid template, optionally in a sequence-specific or sequence-directed manner (such as in an RPA reaction). In some embodiments, at least one enzyme catalyzes strand invasion and/or unwinding, optionally in a sequence-specific manner. Optionally, the one or more enzymes comprise one or more enzymes selected from the group consisting of: recombinase, topoisomerase and helicase. In some embodiments, partially denaturing the template comprises contacting the template with a recombinase and forming a nucleoprotein complex comprising the recombinase. Optionally, the template nucleic acid molecule is contacted with the recombinase in the presence of the first and optionally the second primer. Partially denaturing may comprise catalyzing strand exchange using a recombinase and hybridizing a first primer to a first primer binding sequence (or hybridizing a second primer to a second primer binding sequence). In some embodiments, partially denaturing comprises strand exchange using a recombinase, and hybridizing a first primer to a first primer binding sequence and a second primer to a second primer binding sequence.

In some embodiments, partially denaturing the template nucleic acid molecule comprises contacting the template with one or more recombinase or nucleoprotein complexes. At least one of the nucleoprotein complexes may comprise a recombinase. At least one of the nucleoprotein complexes can comprise a primer (e.g., a first primer or a second primer, or a primer comprising a sequence complementary to a corresponding primer binding sequence in the template). In some embodiments, partially denaturing the template comprises contacting the template with a nucleoprotein complex comprising a primer. Partially denaturing may comprise hybridizing a primer of the nucleoprotein complex to a corresponding primer binding sequence in the template, thereby forming a primer-template duplex. In some embodiments, partially denaturing the template nucleic acid molecule comprises contacting the template with a first nucleoprotein complex comprising a first primer. Partially denaturing may comprise hybridizing a first primer of a first nucleoprotein complex to a first primer binding sequence of the forward strand, thereby forming a first primer-template duplex. In some embodiments, partially denaturing the template comprises contacting the template with a second nucleoprotein complex comprising a second primer. Partially denaturing may comprise hybridizing a second primer of a second nucleoprotein complex to a second primer binding sequence of the reverse strand, thereby forming a second primer-template duplex.

Thus, the pre-implant reaction mixtures of the present disclosure and the template reactants of the present disclosure comprise a recombinase, and are partially denatured and/or amplified, comprising any one or more of the steps or methods described herein, can be achieved using the recombinase and optionally a recombinase helper protein. The recombinase may comprise any agent capable of inducing or increasing the frequency of recombination events. Recombination events include any event whereby two different polynucleotide strands recombine with each other. The recombination may comprise homologous recombination. The recombinase optionally can bind (e.g., bind) to the first primer. In some embodiments, an enzyme that catalyzes homologous recombination can form a nucleoprotein complex by binding to a single-stranded template nucleic acid molecule. In some embodiments, a cognate recombinase as part of a nucleoprotein complex can bind to a cognate portion of a double-stranded polynucleotide. In some embodiments, a homologous portion of the polynucleotide hybridizes to at least a portion of the first primer. In some embodiments, the homologous portion of the polynucleotide is partially or fully complementary to at least a portion of the first primer. Suitable recombinases comprise RecA and its prokaryotic or eukaryotic homologues, or functional fragments or variants thereof, optionally in combination with one or more single-strand binding proteins (SSBs). In certain embodiments, the recombinase optionally coats the ssDNA to form a nucleoprotein filament that invades the homologous double-stranded region on the template.

In some embodiments, homologous recombinases catalyze strand invasion by forming a nucleoprotein complex and combining with homologous portions of a double-stranded polynucleotide to form a recombinant intermediate with a three-strand structure (D-loop formation) (U.S. Pat. No. 5,223,414 to Zarling; U.S. Pat. Nos. 5,273,881 and 5,670,316 to Sena; and U.S. Pat. Nos. 7,270,981, 7,399,590, 7,435,561, 7,666,598, 7,763,427, 8,017,339, 8,030,000, 8,062,850, and 8,071,308, incorporated herein by reference in their entirety).

The recombinase of the reaction mixture, composition, and kit comprises any suitable agent that can promote recombination between polynucleotide molecules. The recombinase may be an enzyme that catalyzes homologous recombination. For example, the reaction mixture may comprise a recombinase comprising or derived from a bacterial, eukaryotic, or viral (e.g., phage) recombinase.

In any embodiment of the present teachings, the homologous recombinase is a wild-type, mutant, recombinant, fusion, or fragment thereof. In some embodiments, the cognate recombinase comprises an enzyme from any organism comprising the family myoviridae (myoviridae) (e.g., uvsX, RB69, and analogs thereof from bacteriophage T4), escherichia coli (e.g., recA), or human (e.g., RAD 51). In embodiments, the reaction mixture comprises one or more recombinant enzymes selected from the group consisting of: uvsX, RecA, RadA, RadB, Rad51, homologues thereof, functional analogues thereof, or combinations thereof. In an illustrative embodiment, the recombinase is uvsX. UvsX protein may be present, for example, at 50-1000 ng/. mu.l, 100-750 ng/. mu.l, 200-600 ng/. mu.l or 250-500 ng/. mu.l.

In some embodiments, methods, kits, and compositions for nucleic acid amplification comprise a preimplantation reaction mixture comprising one or more recombinase helper proteins. For example, the helper protein may increase the activity of the recombinase. In some embodiments, the helper protein may bind to a single strand of the template nucleic acid molecule, or the recombinase may be loaded onto the template nucleic acid molecule. In some embodiments, the helper protein is a wild type, mutant, recombinant, fusion, or fragment thereof. In some embodiments, the helper protein may be derived from any combination of the same or different species as the recombinase used to perform the nucleic acid amplification reaction. The helper protein may be derived from any bacteriophage, including a myoviral bacteriophage. Examples of myoviral phages include T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter (Acinetobacter) phage 133, Aeromonas (Aeromonas) phage 65, phycophage (cyanphage) P-SSM2, phycophage PSSM4, phycophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ 2. The helper protein may be derived from any bacterial species, including escherichia coli, Sulfolobus (Sulfolobus), such as Sulfolobus solfataricus, or Methanococcus (Methanococcus), such as Methanococcus jannaschii (m.jannaschii). In some embodiments, the method for nucleic acid amplification may comprise a single-stranded binding protein. The single-chain binding proteins comprise myoviral gp32 (e.g., T4 or RB69), Sso SSB from sulfolobus solfataricus, MjA SSB from Methanococcus jannaschii, and E.coli SSB proteins.

In some embodiments, the method for nucleic acid amplification comprises increasing the protein loading of the recombinase onto the nucleic acid. For example, the UvsY protein is a recombinase load protein. In some embodiments, the reaction mixture comprises a recombinase helper protein. In an illustrative embodiment, the recombinase helper protein is uvsY. UvsY may be between about 20 and 500ng/μ l, for example between about 20 and 250ng/μ l or between about 20 and 125ng/μ l. In a non-limiting example, UvsY is between 75 and 125 ng/. mu.l.

In any of the embodiments of the present teachings, diffusion within the pre-implant reaction mixture or template reaction mixture is limited by the addition of a diffusion limiting agent effective to prevent or slow diffusion of one or more of the polynucleotide templates and/or one or more of the amplification reaction products in the pre-implant reaction mixture. When amplifying two or more template nucleic acid molecules within a single continuous liquid phase of a reaction mixture, it may be advantageous to include a diffusion limiting agent. For example, the diffusion limiting agent can prevent or slow diffusion of the template nucleic acid molecule or amplified polynucleotide produced by replication of at least some portion of the template nucleic acid molecule within the pre-implant reaction mixture, thus preventing formation of polyclonal impurities without the need to compartmentalize the pre-implant reaction mixture during amplification by physical means or encapsulation means (e.g., an emulsion). Such methods of amplifying templates within a single continuous liquid phase of a single reaction mixture without compartmentalization greatly reduce the cost, time, and effort associated with generating libraries suitable for high throughput methods, such as digital PCR, next generation sequencing, and the like.

In some embodiments, the diffusion-limiting agent is a sieving agent. The screening agent can be any agent effective to screen one or more template nucleic acid molecules or polynucleotides present in the pre-implant reaction mixture, such as amplification reaction products and/or template nucleic acid molecules. In some embodiments, the sieving agent limits or slows the migration of the polynucleotide amplification product in the pre-implant reaction mixture. In some embodiments, the average pore size of the sieving agent is a pore size that selectively retards or prevents movement of a target component (e.g., a polynucleotide) within the pre-implant reaction mixture. In one example, the sieving agent comprises any compound that provides a matrix with a plurality of pores that are small enough to slow or retard the movement of a polynucleotide or template nucleic acid molecule in a reaction mixture containing the sieving agent. Thus, the sieving agent may reduce Brownian motion (Brownian motion) of the polynucleotide.

In some embodiments, the sieving agent is a polymeric compound. In some embodiments, the sieving agent is a crosslinked or non-crosslinked polymer compound. By way of non-limiting example, the sieving agent may comprise a polysaccharide, a polypeptide, an organic polymer, or any other suitable polymer. In any embodiment, the sieving agent is a polymer that is linear or branched. In some embodiments, the sieving agent is a charged or neutral polymer. In some embodiments, the sieving agent may comprise a blend of one or more polymers each having an average molecular weight and a viscosity. In some embodiments, the sieving agent is a polymer having an average molecular weight between about 10,000 and 2,000,000 Da: for example between about 10,000 and 1,000,000Da, between about 10,000 and 500,000Da, between about 10,000 and 250,000Da, or between about 10,000 and 100,000 Da. In certain embodiments, the polymer has an average molecular weight of between about 12,000 and 95,000Da or between about 13,000 and 95,000 Da.

In some embodiments, the sieving agent exhibits an average viscosity range of about 5 centipoise to about 15,000 centipoise when measured at about 25 ℃ when dissolved in water at 2 weight percent; or an average viscosity range of about 10 centipoise to about 10,000 centipoise when measured as a 2% aqueous solution at about 25 ℃; or an average viscosity range of about 15 centipoise to about 5,000 centipoise when measured as a 2% aqueous solution at about 25 ℃.

In some embodiments, the sieving agent has about 25 to about 1,5000kM_vOr about 75 to 1,000kM_vOr about 85-800kM_vViscosity average molecular weight (M) of_v). In some embodiments, the reaction mixture comprises a sieving agent at about 0.1 to about 20% weight/volume (w/v), or about 1-10% w/v, or about 2-5% w/v.

In some embodiments, the sieving agent is a polysaccharide polymer. In some embodiments, the sieving agent is a polymer of glucose or galactose. In some embodiments, the sieving agent is one or more of the following polymers: cellulose, dextran, starch, glycogen, agar, chitin, pectin or agarose. In some embodiments, the sieving agent is a glucopyranose polymer. In some embodiments, the sieving agent comprises a cellulose derivative, such as sodium carboxymethyl cellulose, sodium carboxymethyl 2-hydroxyethyl cellulose, methyl cellulose, hydroxyethyl cellulose, 2-hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxyethyl methyl cellulose, hydroxybutyl methyl cellulose, (hydroxypropyl) methyl cellulose, or hydroxyethyl ethyl cellulose, or a mixture comprising any one or more of such polymers.

In some embodiments, the pre-implant reaction mixture and/or the template reaction mixture comprises a mixture of different sieving agents, such as a mixture of different cellulose derivatives, starch, polyacrylamide, and the like. In some embodiments, the pre-implant reaction mixture comprises a crowding agent (growing agent). In some embodiments, the pre-implant reaction mixture comprises both the crowding agent and the sieving agent.

In some embodiments, the diffusion-limiting agent is a diffusion-reducing agent. A diffusion reducing agent comprises any compound that reduces the migration of a template nucleic acid molecule or polynucleotide from a region of higher concentration to a region of lower concentration. In some embodiments, the diffusion reducing agent comprises any compound that reduces the migration of any component of a nucleic acid amplification reaction regardless of size.

It should be noted that the concepts of sieving agents and diffusion reducing agents are not necessarily mutually exclusive; the sieving agent can often be effective in reducing diffusion of the target compound in the reaction mixture, while the diffusion reducing agent can often have a sieving effect on the reaction components. In some embodiments, the same compound or pre-implant reaction mixture additive may be used as a sieving agent and/or a diffusion reducing agent. In some embodiments, any of the sieving agents of the present teachings may be capable of acting as a diffusion reducing agent, and vice versa.

In some embodiments, the diffusion reducing agent and/or sieving agent comprises polyacrylamide, agar, agarose, or a cellulose polymer, such as hydroxyethyl cellulose (HEC), Methyl Cellulose (MC), or carboxymethyl cellulose (CMC).

In some embodiments, the sieving agent and/or diffusion reducing agent is included in the pre-implant reaction mixture at a concentration of: at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 75%, 90% or 95% w/v (weight of agent per unit volume of reaction mixture).

In some embodiments, the diffusion limiting agent is a crowding agent. For example, crowding agents can increase the concentration of one or more components in a nucleic acid amplification reaction by creating a crowded reaction environment. In some embodiments, the pre-implant reaction mixture comprises both a sieving agent and/or a diffusing agent and a crowding agent.

In some embodiments, different template nucleic acid molecules are pre-implanted onto one or more different discrete carriers (e.g., beads or particles) without the need for compartmentalization prior to amplification. In other embodiments, the template nucleic acid molecule is partitioned (partitioned) into an emulsion prior to amplification. In contrast to amplification within a single continuous liquid phase, the pre-implant reaction can be performed in parallel in multiple separate reaction volumes. Each reaction volume may contain a pre-implant reaction mixture. For example, the template nucleic acid molecule can be partitioned or placed in an array of reaction chambers or reaction volumes such that at least two such compartments or volumes in the array receive a single template nucleic acid molecule. In some embodiments, a plurality of individual reaction volumes are formed. The reaction chamber (or reaction volume) may optionally be sealed prior to amplification. A pre-implant reaction may be performed in each reaction chamber to generate a substantially monoclonal population of template nucleic acid molecules. In another embodiment, the reaction mixture is partitioned or partitioned into a plurality of microreactors dispersed within the continuous phase of the emulsion. Each compartment or microreactor acts as an independent amplification reactor, so that the entire emulsion is capable of supporting a number of individual amplification reactions in a single reaction vessel (e.g., Eppendorf tube or well) in separate (non-continuous) liquid phases. As used herein, the term "emulsion" includes any composition comprising a mixture of a first liquid and a second liquid, wherein the first and second liquids are substantially immiscible with each other. The partitions or individual reaction volumes are optionally not mixed or in communication with each other, or are not capable of being mixed or in communication with each other. The pre-implant reaction mixture in the microreactor may be any of the pre-implant reaction mixtures discussed herein.

In some embodiments, the nucleic acid synthesis method further comprises recovering at least some of the vectors associated with the population of substantially monoclonal template nucleic acid molecules from the emulsion. In some embodiments, the nucleic acid synthesis method further comprises placing at least some of the vectors linked to the population of substantially monoclonal template nucleic acid molecules onto a surface. In some embodiments, the nucleic acid synthesis method further comprises forming an array by placing at least some of the vectors linked to the population of substantially monoclonal template nucleic acid molecules onto a surface.

In some embodiments, the present disclosure relates generally to compositions, and systems, methods, kits, and devices comprising a pre-implant reaction mixture and a template reaction mixture accordingly, in certain embodiments, provided herein are reaction mixtures comprising a polymerase and one or more pre-implant vectors⁷And 10⁹Between template nucleic acid molecules, the solution comprising 5 × 10⁶And 10¹⁰Beads in between, such as ionic spherical particles. In illustrative examples, each bead in the pre-implant reaction mixture comprises 1 or less than 1 template nucleic acid molecule. For example, between about 0.1 and 0.9 template nucleic acid molecules may be included per solid support, e.g., between about 0.1 and 0.7 template nucleic acid molecules, between about 0.1 and 0.5 template nucleic acid molecules, or between about 0.1 and 0.3 template nucleic acid molecules may be included per solid support. In certain examples, the template reaction mixture comprises less than 1,000,000, 500,000, 1,000, 500, 100, 10, or 0 template nucleic acid molecules in solution, and a pre-implanted solid support of the present teachings. In the pre-implant and template reaction mixture, the polymerase and optionally the recombinase are typically present in amplification effective concentrations, as is known for RPA reactions, or in higher concentrations, so that they can be combined with other reaction components in the final pre-implant reaction mixture. In any of the embodiments of the present teachings, the volume of the pre-implant reaction mixture and/or template reaction mixture is between about 50 and 2,000 μ Ι, such as between about 50 and 1,500 μ Ι, between about 50 and 1,000 μ Ι, between about 50 and 500 μ Ι, between about 50 and 250 μ Ι, or between about 50 and 150 μ Ι. In any of the disclosed embodiments, the volume of reaction mixture and the mold are pre-implantedThe plates varied in volume of the reaction mixture.

The pre-implant reaction mixture and the template reaction mixture may further comprise other components. For example, a composition can comprise a nucleotide, a first primer population, optionally a second primer, a cofactor, and a buffer. The first primer population and optionally the second primer population can be linked to one or more vectors. As non-limiting examples, the composition comprises: one or more carriers; recombinases, such as uvsX; polymerases, such as Sau DNA polymerase; recombinase-loaded proteins, such as uvsY; single chain binding proteins, such as gp32 protein; a nucleotide; ATP; creatine phosphate; and creatine kinase. The composition may be in liquid form, or it may be in solid form, such as in the form of a reconstitutable dry cake (dried-down pellet form). Further, the components of the composition can be separated such that any combination of the components can be in the form of a mass or a liquid and one or more combinations of the remaining components can be in the form of one or more separate masses or liquids. Such combinations may form a kit comprising at least two of such combinations. For example, a kit may comprise a pellet containing all reaction mixture components of the present teachings except for a polymerase, which may be provided in the kit as a separate pellet or liquid.

In an illustrative embodiment, a composition comprises a population of template nucleic acid molecules, a polymerase, a recombinase, a forward primer, a reverse primer, nucleotides, and a buffer. In some embodiments, the composition comprises a template nucleic acid molecule, a forward primer, a reverse primer, uvsX recombinase, uvsY recombinase load protein, gp32 protein, Sau DNA polymerase, dntps, ATP, phosphocreatine, and creatine kinase.

In some embodiments, the composition comprises at least two different template nucleic acid molecules having a first primer binding sequence and a second primer binding sequence, a recombinase helper protein, a polymerase, a first universal primer, a second universal primer, dntps, and a buffer. In some embodiments, the composition further comprises one or more carriers. In illustrative embodiments, a composition comprises at least two different template nucleic acid molecules having a first primer binding sequence and a second primer binding sequence, uvsX recombinase, uvsY recombinase load protein, gp32 protein, Sau DNA polymerase, ATP, phosphocreatine, creatine kinase, a first universal primer linked to a bead carrier, a second universal primer, and a buffer.

In some embodiments, the pre-implant reaction mixture or template reaction mixture is formed by adding each component separately to an aqueous or emulsion solution. In other embodiments, the reaction mixture is in the form of a dehydrated mass that needs to be rehydrated before use. The dehydrated mass can comprise, for example, recombinase, optionally recombinase helper proteins, optionally gp32, DNA polymerase, dntps, ATP, optionally creatine phosphate, optionally crowding agent, and optionally creatine kinase. The reconstitution buffer may comprise, for example, Tris buffer, potassium acetate salt, and optionally a crowding agent such as PEG. The DNA polymerase may be, for example, T4 or T7 DNA polymerase, and may further comprise thioredoxin when the polymerase is T7 DNA polymerase. In some embodiments, when using a dehydrated pellet comprising reaction mixture components, the pellet is rehydrated with a rehydration buffer, and template nucleic acid molecules, primers, and additional nuclease-free water are added to the final volume.

In some embodiments, the preimplantation reaction mixture or template reaction mixture is preincubated under conditions that inhibit premature reaction initiation. For example, one or more components of the pre-implant reaction mixture may be withheld from the reaction vessel to prevent premature reaction initiation. To initiate the reaction, a divalent cation (e.g., magnesium or manganese) is added. In another example, the preimplantation reaction mixture is preincubated at a temperature that inhibits enzyme activity. The reactants may be pre-incubated at about 0-15 deg.C or about 15-25 deg.C to inhibit premature reaction initiation. Subsequently, the reactants are incubated at higher temperatures to increase enzymatic activity. In an illustrative embodiment, the pre-implant reaction mixture is not exposed to a temperature greater than 42 ℃ during the reaction.

In any of the disclosed embodiments, the pre-implant reaction optionally comprises repeated nucleic acid amplification cycles. The amplification cycle optionally comprises: (a) hybridizing a first primer to the template strand, (b) extending the primer to form a first extended strand, (c) partially or incompletely denaturing the extended strand from the template strand. Optionally, the denatured portion of the template strand from step (c) is optionally hybridized to a different first primer in the next amplification cycle. In some embodiments, primer extension in a subsequent amplification cycle involves displacement of a first extended strand from the template strand. A second primer that hybridizes to the 3' end of the first extended strand may be included. In some embodiments, the disclosed methods (and related compositions, systems, and kits) further comprise one or more primer extension steps. For example, the method comprises extending the primer by nucleotide incorporation using a polymerase. In embodiments, extending the primer comprises contacting the hybridized primer with a polymerase and one or more types of nucleotides under nucleotide incorporation conditions. Typically, extension of the primer occurs in a template-dependent manner. Optionally, the disclosed methods (and related compositions, systems, and kits) comprise extending a first primer of a first primer-template duplex by incorporating one or more nucleotides onto a 3' OH of the first primer using a polymerase, thereby forming an extended first primer. Optionally, the disclosed methods (and related compositions, systems, and kits) comprise binding a second primer to a second primer binding sequence of a first extended primer by any suitable method (e.g., conjugation or hybridization). Optionally, the disclosed methods (and related compositions, systems, and kits) comprise extending a second primer by incorporating one or more nucleotides into the second primer of a second primer-template duplex using a polymerase, thereby forming an extended second primer.

In some embodiments, the first primer is extended such that a first extended primer is formed. The first extended primer may comprise some or all of the reverse strand sequence of the template. Optionally, the first extended primer comprises a second primer binding sequence. In some embodiments, the second primer is extended such that a second extended primer is formed. The second extended primer may comprise some or all of the sequence of the template forward strand. Optionally, the second extended primer comprises a first primer binding sequence. In some embodiments, the methods (and related compositions, systems, and kits) may further comprise ligating one or more extended primer strands to the vector. Ligation may optionally be performed during amplification or alternatively after amplification is complete. In some embodiments, the vector is linked to a first population of primers. For example, the support may comprise a first population of primers, and the method may comprise hybridizing at least one of the extended second primers to the first primer of the support, thereby ligating the extended second primer to the support. For example, a first primer can hybridize to a first primer binding sequence in an extended second primer. In some embodiments, the vector comprises multiple instances of the second primer, and the method comprises hybridizing at least one of the extended first primer strands to the second primer of the vector, such as in bridge PCR.

In any embodiment of the present teachings, the pre-implant reaction is performed using an RPA reaction, wherein partial denaturation and/or amplification is achieved using a polymerase, a recombinase, and a recombinase helper protein in general, comprising any one or more of the steps or methods described herein. Without being bound by theory, it is believed that the recombinase coats single-stranded DNA (ssDNA) to form a nucleoprotein filament that invades a homologous double-stranded region on the template nucleic acid molecule. This creates a short hybrid and a displacement strand bubble called the D-loop. The free 3' end of the hybrid primer is extended using a DNA polymerase to synthesize a new complementary strand. The complementary strand displaces the initially paired partner strand of the template nucleic acid molecule as it elongates. In one embodiment, one or more of the pair of primers is contacted with one or more recombinase enzymes prior to contact with the template nucleic acid molecule (which is optionally double-stranded). The RPA reaction is typically isothermal and is carried out in emulsion.

In any of the embodiments of the present teachings, the pre-implant reaction is performed by template walking, wherein portions of the double-stranded nucleic acid molecule become dissociated, such that the primer binds to one strand to initiate a new round of replication (see, e.g., U.S. patent publication No. 2012/0156728, published 6/21 2012, which is incorporated herein by reference in its entirety). Embodiments of template walking include primer extension methods comprising: (a) a primer hybridization step, (b) an extension step, and (c) a walking step. Optionally, the primer hybridization step comprises hybridizing a first primer to a first primer binding sequence on the template nucleic acid molecule ("reverse strand"). Optionally, the extending step comprises generating an extended first forward strand that is the full-length complement of the reverse strand and that hybridizes thereto. The extended first forward strand is generated, for example, by extending the first forward primer in a template-dependent manner using the reverse strand as a template. Optionally, the walking step comprises hybridizing a further first primer to the first primer binding sequence, wherein the reverse strand is also hybridized to the first forward strand. For example, the walking step comprises denaturing at least a portion of the first primer binding sequence from the forward strand, wherein another portion of the reverse strand remains hybridized to the forward strand. In any of the disclosed embodiments, the reaction mixture comprises one or more vectors having a first primer bound thereto, wherein the first primer binding sequence on at least one of the template nucleic acid molecules is complementary or identical to at least a portion of the first primer. In some embodiments, at least one of the template nucleic acid molecules has a second primer binding sequence that is complementary or identical to at least a portion of the second primer. In some embodiments, the second primer is also bound to the support so that amplification can occur back and forth on the surface. In various embodiments, the second primer is in solution. In other embodiments, the second primer is immobilized on a support. The template walking reaction is usually carried out isothermally and in an emulsion.

Template walking can result in the introduction of many identical nucleotides at the proximal end of the template nucleic acid molecule attached to the vector. In some embodiments, template walking is performed on one or more vectors in a manner such that the linked template nucleic acid molecule introduces less than 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, or 300 identical nucleotides at the proximal end of the vector-linked template nucleic acid molecule. In other embodiments, template walking is performed on one or more vectors in a manner such that the linked template nucleic acid molecule introduces between about 10 and 300 identical nucleotides at the proximal end of the vector-linked template nucleic acid molecule, e.g., between about 10 and 200 identical nucleotides, between about 10 and 150 identical nucleotides, or between about 10 and 100 identical nucleotides at the proximal end of the vector-linked template nucleic acid molecule. In any embodiment, the proximal end is the end of the template nucleic acid molecule that is closest to the vector to which each template nucleic acid molecule is ligated. In some aspects, the template nucleic acid molecule attached to the vector is a series of identical nucleotides attached to the template nucleic acid molecule or the template nucleic acid segment. In some embodiments, less than 5%, 10%, 15%, 20%, or 25% of each of the population of substantially monoclonal template nucleic acid molecules has a variable number of identical nucleotides at the proximal end. For example, less than 5%, 10%, 15%, 20%, or 25% of each of the population of substantially monoclonal template nucleic acid molecules may introduce between about 10 and 300 identical nucleotides at the proximal end of the template nucleic acid molecule attached to the vector, e.g., between about 10 and 200 identical nucleotides, between about 10 and 150, between about 10 and 100, or between about 20 and 50 identical nucleotides at the proximal end of the template nucleic acid molecule attached to the vector.

In any of the disclosed embodiments, the pre-implant reaction is performed using a PCR method. One of skill in the art will recognize various methods of performing PCR that will produce a substantially monoclonal population of template nucleic acid molecules. In some embodiments, the pre-implant reaction is performed in a single round of PCR. In other embodiments, the pre-implant reaction is performed in multiple rounds of PCR. For example, the method can comprise diluting an amount of template nucleic acid molecules reacted with a vector to reduce the percentage of vectors reacted with more than one template nucleic acid molecule. In some embodiments, the template nucleic acid molecules are diluted such that the pre-implant reaction has a vector to template nucleic acid molecule ratio selected to optimize the percentage of vectors having a substantially monoclonal population of template nucleic acid molecules attached thereto. For example, the pre-implant reaction can be performed with the following vector: template nucleic acid molecule ratios: at least about 1:1, 1.25:1, 1.5:1, 1.75:1, 2:1, 2.5:1, 3:1, 3.5:1, 4:1, 4.5:1, 5: 110: 1, 25:1, 50:1, 75:1, and 100: 1. In some embodiments, PCR is performed in an emulsion, wherein PCR is performed in a plurality of microreactors in the emulsion as described elsewhere herein.

The described methods for pre-implantation of vectors comprise immobilizing one or more reaction components (e.g., one or more template nucleic acid molecules and/or primers) during the pre-implantation reaction to prevent cross-contamination and consequent reduction in monoclonality of the amplification reaction products. One such example comprises bridge amplification, in which all primers (e.g., forward and reverse primers) required for amplification are attached to the surface of a substrate support. In addition to such immobilization, additional immobilization components are included in the reaction mixture. For example, the template nucleic acid molecule and/or amplification primers may be suspended in a gel or other matrix during amplification to prevent migration of the amplification reaction products from the synthesis site. Such gels and matrices often need to be removed afterwards, requiring the use of appropriate "melting" or other recovery steps with consequent loss of yield.

In any of the embodiments of the present teachings, the pre-implant reaction is performed under isothermal conditions. In some embodiments, isothermal conditions comprise subjecting the reaction to a temperature change constrained within a limited range during at least some portion of the amplification (or the entire amplification process), including, for example, a temperature change equal to or less than about 10 ℃, or about 5 ℃, or about 1-5 ℃, or about 0.1-1 ℃ or less than about 0.1 ℃, or such as a temperature change equal to or less than or 10 ℃, or 5 ℃, or 1-5 ℃, or 0.1-1 ℃ or less than 0.1 ℃. The temperature of the isothermal reaction may typically be between about 15 ℃ and 65 ℃, such as between about 15 ℃ and 55 ℃, between about 15 ℃ and 45 ℃, between about 15 ℃ and 37 ℃, between about 30 ℃ and 60 ℃, between about 40 ℃ and 60 ℃, between about 55 ℃ and 60 ℃, between about 35 ℃ and 45 ℃, or between about 37 ℃ and 42 ℃. In other embodiments, the pre-implant reaction is not exposed to temperatures above: 40 deg.C, 41 deg.C, 42 deg.C, 43 deg.C, 45 deg.C or 50 deg.C. Thus, in certain embodiments, the reaction mixture is not exposed to thermal initiation conditions. However, it will be appreciated that the enzymes used at these temperatures will require combinatorial optimization and may require alteration of the enzymes, for example using a different DNA polymerase such as Bst rather than Bsu. The rate limiting enzyme may be a polymerase, wherein a high or excess (i.e., non-limiting) amount of polymerase or a lower temperature ensures that the amplification reaction proceeds based on the kinetics of the polymerase.

The pre-implant reaction may be performed for 0.25 minutes to 240 minutes to amplify the nucleic acid template. In certain embodiments, the pre-implant reaction is performed for about 0.25 to 240 minutes, such as about 0.25 to 120 minutes, about 0.25 to 60 minutes, about 0.25 to 30 minutes, about 0.25 to 15 minutes, about 0.25 to 10 minutes, about 0.25 to 7.5 minutes, about 0.25 to 5 minutes, or about 2 to 5 minutes. In other illustrative embodiments, the pre-implant reaction is performed for about 1.5 to 10 minutes, such as about 1.5 to 8 minutes, about 1.5 to 6 minutes, about 1.5 to 5 minutes, or about 1.5 to 4 minutes, the reaction is an isothermal reaction, and the temperature of the reaction is between about 35 ℃ and 65 ℃, such as between about 35 ℃ and 55 ℃, between about 35 ℃ and 45 ℃, between about 30 ℃ and 60 ℃, between about 40 ℃ and 55 ℃, between about 50 ℃ and 60 ℃, or between about 37 ℃ and 42 ℃. For example, the pre-implant reaction may be conducted in an isothermal reaction for about 1 to 10 minutes, where the reaction temperature may be between about 35 ℃ and 45 ℃, or may be conducted in an isothermal reaction for about 2 to 5 minutes, where the reaction temperature may be between about 37 ℃ and 42 ℃.

In some embodiments, the method is performed without subjecting the double-stranded template nucleic acid molecule to extreme denaturing conditions during amplification. For example, the method can be performed without subjecting the template nucleic acid template to a T equal to or greater than the template during amplification_mThe temperature of (2). In some embodiments, the method is performed without contacting the template with a chemical denaturant (NaOH, urea, guanidinium, and the like) during amplification. In some embodiments, the amplifying comprises isothermal amplification.

In some embodiments, the method is performed without subjecting the template nucleic acid molecule to extreme denaturation conditions during between about 2 and 50 consecutive cycles, between about 2 and 40 consecutive cycles, between about 2 and 30 consecutive cycles, between about 2 and 25 consecutive cycles, between about 2 and 20 consecutive cycles, or between about 2 and 15 consecutive cycles. For example, the method may include between about 2 and 50 consecutive cycles, between about 2 and 40 consecutive cycles, between about 2 and 30 consecutive cyclesContinuous cycling, between about 2 and 25 continuous cycling, between about 2 and 20 continuous cycling, or between about 2 and 15 continuous cycles of nucleic acid synthesis without contacting the nucleic acid template with a chemical denaturant or raising the temperature above 50 ℃ or 55 ℃. In some embodiments, the method comprises performing between about 2 and 50 consecutive cycles, between about 2 and 40 consecutive cycles, between about 2 and 30 consecutive cycles, between about 2 and 25 consecutive cycles, between about 2 and 20 consecutive cycles, or between about 2 and 15 consecutive nucleic acid synthesis cycles without subjecting the nucleic acid template to an actual or calculated T above a specific template or population of templates_m(or actual or calculated mean T of template or population of templates_m) The temperature is lower by 25 ℃, 20 ℃, 15 ℃, 10 ℃,5 ℃,2 ℃ or 1 ℃. Successive cycles of nucleic acid synthesis may or may not comprise an intervening partial denaturation and/or primer extension step. Optionally, at least one cycle of template-like replication comprises a partial denaturation step, an annealing step and an extension step. In some embodiments, the ligated consensus primer in the preimplantation reaction is an adenosine or uridine sequence or some combination of adenosine and uridine that is between about 5 and 100 nucleotides in length, e.g., between about 5 and 80 nucleotides in length, between about 5 and 60 nucleotides in length, between about 5 and 40 nucleotides in length, between about 10 and 75 nucleotides in length, between about 15 and 75 nucleotides in length, or between about 20 and 50 nucleotides in length.

The pre-implantation reaction results in the formation of a pre-implanted population of vectors having a population of substantially monoclonal template nucleic acid molecules attached thereto. In various aspects, a population of substantially monoclonal template nucleic acid molecules are template nucleic acid molecules having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% identity at the sequence level. In some embodiments, the percentage of substantially monoclonal template nucleic acid molecules attached to the pre-implanted vector is 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the template nucleic acid molecules attached thereto.

In various embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the vectors in the pre-engrafted population of vectors have a substantially monoclonal population of nucleic acid molecules ligated during the pre-engraftment reaction. In illustrative embodiments, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the vectors in the population of pre-implanted vectors have a population of substantially monoclonal nucleic acid molecules ligated during the pre-implantation reaction.

In some embodiments, the pre-implant reaction produces: a vector to which zero template nucleic acid molecules are attached (an empty solid vector), other pre-implanted vectors to which one type of template nucleic acid molecule is attached, and other pre-implanted vectors to which more than one type of template nucleic acid molecule is attached. In any embodiment of the present teachings, the number of ligated template nucleic acid molecules in the population of substantially monoclonal template nucleic acid molecules ligated to the one or more pre-implanted vectors is the pre-implantation number. In any of the disclosed embodiments, the pre-implant number is between about 1 and 150,000 template nucleic acid molecules, such as between about 1 and 100,000, between about 1 and 75,000, between about 1 and 50,000, between about 1 and 25,000, between about 1 and 10,000, between about 1 and 5,000, or between about 1 and 2,500 template nucleic acid molecules. In illustrative embodiments, the pre-implant number is between about 10 and 100,000 template nucleic acid molecules, such as between about 10 and 75,000, between about 10 and 50,000, between about 10 and 25,000, between about 10 and 10,000, between about 10 and 5,000, or between about 10 and 2,500 template nucleic acid molecules.

In some embodiments, a majority of any primers attached to the carrier do not bind to the template nucleic acid molecule after the preimplantation reaction. These unbound primers can be used in subsequent template reactions for further amplification of the template nucleic acid molecule. For example, at least 90%, 95%, 96%, 97%, 98%, or 99% of the primers attached to the carrier typically do not bind to the template nucleic acid molecule after the preimplantation reaction.

In some embodiments, the present disclosure relates generally to methods, and systems, compositions, kits, and devices, wherein the methods generally comprise a template reaction following a pre-implant reaction, wherein the template nucleic acid molecules on the pre-implanted support are further amplified (referred to herein as the template reaction). The template reaction mixture does not contain additional template nucleic acid molecules in solution, such that prior to initiating the template reaction, the template nucleic acid molecules attached to the one or more pre-implanted carriers are the primary or sole source of template nucleic acid molecules in the template reaction mixture. In illustrative embodiments, one or more washes are performed on one or more pre-implanted supports prior to their introduction into the template reaction mixture. In some embodiments, less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0.1% of the template nucleic acid molecules in the solution are present in the template reaction at the end of the pre-implant reaction mixture. In any embodiment of the present teachings, the percentage of template nucleic acid molecules in the template reaction mixture that are attached (pre-implanted) to one or more supports prior to initiating the template reaction is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% of the template nucleic acid molecules in the reaction mixture.

In any of the embodiments of the present teachings, the template reaction is typically an RPA reaction. Thus, any details regarding the components and conditions of the RPA reaction discussed above with respect to the pre-implant reaction apply to the template reaction, except that the template nucleic acid is typically present in the initial reaction mixture of the pre-implant reaction, but not in the initial reaction mixture of the template reaction. The template reaction mixture typically comprises all or some of the following: one or more pre-implanted solid supports comprising an attached substantially identical first primer population and having substantially monoclonal template nucleic acid molecules attached thereto; a polymerase; a recombinase; optionally a single chain binding protein; optionally a recombinase load protein; optionally the firstA second primer or reverse primer that can be attached to a solid support, but in the illustrative example is in solution; dNTP; ATP; a buffer solution; and optionally one or both of phosphocreatine and creatine kinase. Divalent cations may be added, such as MgCl₂Or Mg (OAc)₂To start the reaction. In various embodiments, the buffer comprises a crowding agent, such as PEG; tris buffer solution; and/or potassium acetate salt. The forward primer binding sequence on the template nucleic acid molecule is complementary or identical to at least a portion of the forward primer, and the optional reverse primer binding sequence on the template nucleic acid molecule is complementary or identical to at least a portion of the reverse primer. The reaction mixture of the template reaction itself forms a separate aspect of the invention. In other illustrative embodiments, the RPA template reaction is a bulk isothermal amplification or is performed in the pores of a porous solid support (e.g., see the pre-implant amplification reaction discussed further herein).

In some embodiments, the template reaction mixture is pre-incubated under conditions that inhibit the initiation of a premature reaction. For example, one or more components of the template reaction mixture may be withheld from the reaction vessel to prevent premature reaction initiation. To initiate the reaction, a divalent cation (e.g., magnesium or manganese) is added. In another example, the template reaction mixture is pre-incubated at a temperature that inhibits enzyme activity. The reactants are pre-incubated at about 0-15 deg.C or about 15-25 deg.C to inhibit premature reaction initiation. Subsequently, the reactants can be incubated at higher temperatures to increase enzymatic activity. In an illustrative embodiment, the template reaction mixture is not exposed to a temperature greater than 42 ℃ during the reaction.

Since the template reaction is usually an RPA reaction, it is carried out under isothermal conditions. In some embodiments, isothermal conditions comprise subjecting the reaction to a temperature change constrained within a limited range during at least some portion of the amplification (or the entire amplification process), including, for example, a temperature change equal to or less than about 10 ℃, or about 5 ℃, or about 1-5 ℃, or about 0.1-1 ℃ or less than about 0.1 ℃, or such as a temperature change equal to or less than or 10 ℃, or 5 ℃, or 1-5 ℃, or 0.1-1 ℃ or less than 0.1 ℃. The temperature of the isothermal reaction may typically be between about 15 ℃ and 65 ℃, such as between about 15 ℃ and 55 ℃, between about 15 ℃ and 45 ℃, between about 15 ℃ and 37 ℃, between about 30 ℃ and 60 ℃, between about 40 ℃ and 60 ℃, between about 55 ℃ and 60 ℃, between about 35 ℃ and 45 ℃, or between about 37 ℃ and 42 ℃ about 15 ℃. In other embodiments, the pre-implant reaction is not exposed to temperatures above: 40 deg.C, 41 deg.C, 42 deg.C, 43 deg.C, 45 deg.C or 50 deg.C. Thus, in certain embodiments, the reaction mixture is not exposed to thermal initiation conditions. However, it will be appreciated that the enzymes used at these temperatures will require combinatorial optimization and may require alteration of the enzymes, for example using a different DNA polymerase such as Bst rather than Bsu. The rate limiting enzyme may be a polymerase, wherein a high or excess (i.e., non-limiting) amount of polymerase or a lower temperature ensures that the amplification reaction proceeds based on the kinetics of the polymerase.

In any of the embodiments of the present teachings, the template reaction is typically an RPA reaction that is carried out for about 0.25 to 240 minutes, e.g., about 0.25 to 120 minutes, about 0.25 to 60 minutes, about 0.25 to 30 minutes, about 0.25 to 15 minutes, about 0.25 to 10 minutes, about 0.25 to 7.5 minutes, about 0.25 to 5 minutes, or about 2 to 5 minutes. In illustrative embodiments, the template reaction is performed for about 10 to 120 minutes, such as about 10 to 60 minutes, about 10 to 45 minutes, about 10 to 30 minutes, or about 10 to 20 minutes. In other illustrative embodiments, the template reaction is performed for about 20 to 60 minutes, such as about 20 to 50 minutes, about 20 to 40 minutes, about 20 to 35 minutes, or about 20 to 30 minutes.

In any of the embodiments of the present teachings, the template reaction comprises amplifying a population of different template nucleic acid molecules on one or more pre-implanted vectors to produce one or more templated vectors. For example, following the template reaction, the attached substantially monoclonal template nucleic acid molecule present on the templated solid support may be at least 2, 3,4, 5,6, 7, 8, 9, 10, 25, 50, 100, 250, 500, 1,000, 2,500, 5,000, 10,000, 25,000, 50,000, 100,000, 250,000, 500,000, or 10 present on the pre-implanted solid support⁶And (4) doubling. In illustrative embodiments, the attached substantially monoclonal template nucleic acid is present on a templated solid supportA molecule that is at least 10, 25, 50, 100, 250, 500, 1,000, 2,500, 5,000, 10,000, 25,000, or 50,000 fold present on a pre-implanted solid support. In some embodiments, at least 50,000, 75,000, or 100,000 substantially monoclonal template nucleic acid molecules, or between about 25,000 and 1,000,000 substantially monoclonal template nucleic acid molecules, are present on the pre-implanted solid support, such as between about 25,000 and 500,000, between about 25,000 and 250,000, between about 25,000 and 125,000, or between about 25,000 and 100,000 substantially monoclonal template nucleic acid molecules are present on the pre-implanted solid support. During the template reaction, one or more supports are typically still in fluid communication.

Since the pre-implant response may be an RPA response and the template response is typically an RPA response in accordance with the teachings of the present invention, the method comprises sequential RPA responses. The first RPA response is a pre-implant response followed by a second RPA template response. The reaction was carried out under the same conditions. However, in illustrative embodiments, the pre-implant RPA reaction is performed such that fewer amplification cycles occur than the template RPA reaction. For example, the pre-implant RPA reaction may be performed for a shorter time than a template RPA reaction that amplifies template nucleic acid molecules attached to a pre-implanted solid support produced by the pre-implant RPA reaction. As a non-limiting illustrative example, a pre-implant RPA reaction is performed for 2 to 5 minutes to produce one or more, e.g., pre-implanted, populations of solid supports, which are then subjected to a template RPA reaction, which is performed for 10 to 60 minutes. In these non-limiting illustrative examples, the reaction components comprising the template nucleic acid are washed from the pre-implanted solid support prior to the template RPA reaction. Both the pre-implant and the template reactions contain all other reaction components of the pre-implant and template reactions, except that the template nucleic acid molecule is in solution.

In some embodiments, after the template reaction, the percentage of sites on one or more vectors in the population of vectors having substantially monoclonal template nucleic acid molecules attached thereto is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total amplification vectors (i.e., the total vectors comprise an empty, polyclonal, or substantially monoclonal population of template nucleic acid molecules). In illustrative embodiments, after the template reaction, the percentage of sites on one or more vectors in the population of vectors having substantially monoclonal template nucleic acid molecules attached thereto is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total amplification vectors recovered from the reaction mixture (i.e., the total vectors comprise an empty, polyclonal, or substantially monoclonal population of template nucleic acid molecules). In some embodiments, after the template reaction, the percentage of sites on one or more vectors in the population of vectors having substantially monoclonal template nucleic acid molecules attached thereto is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total vectors recovered from the reaction mixture (i.e., the total vectors comprise vectors having no template nucleic acid molecules attached thereto, and vectors having a polyclonal or substantially monoclonal population of template nucleic acid molecules). In illustrative embodiments, the percentage of sites on one or more vectors in the population of vectors having substantially monoclonal template nucleic acid molecules attached thereto after the template reaction is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the total vectors recovered from the reaction mixture (i.e., the total vectors comprise vectors having no template nucleic acid molecules attached, and vectors having a polyclonal or substantially monoclonal population of template nucleic acid molecules).

In some embodiments, at least a portion of the primer hybridizes to a portion of at least one strand of a polynucleotide in a template reaction mixture. For example, at least a portion of the primer can hybridize to a nucleic acid adaptor that is ligated to one or both ends of the polynucleotide. In some embodiments, at least a portion of the primer is complementary to a portion of the polynucleotide or to a nucleic acid adaptor portion or is completely complementary. In some embodiments, primer compatibility is applicable to any type of sequencing platform, including chemical degradation platforms, chain termination platforms, sequencing-by-synthesis platforms, pyrophosphate platforms, massively parallel platforms, ion sensitive platforms, and single molecule platforms.

In some embodiments, a primer (e.g., a first, second, or third primer) has a 5 'or 3' overhang tail (tailed primer) that does not hybridize to a portion of at least one strand of a polynucleotide in a reaction mixture. In some embodiments, the tailed primer is of any length, including between about 1 and 100 nucleotides in length, such as between about 1 and 90, between about 1 and 80 nucleotides in length, between about 1 and 70 nucleotides in length, between about 1 and 60 nucleotides in length, between about 1 and 50 nucleotides in length, between about 1 and 40 nucleotides in length, or between about 1 and 30 nucleotides in length.

The disclosed methods result in the generation of a population of amplicons, in certain embodiments, at least some of which comprise a population of amplified nucleic acids. The amplified populations produced by the methods of the present disclosure are suitable for a variety of purposes. In some embodiments, the disclosed methods (and related compositions, systems, and kits) optionally comprise further analysis and/or manipulation of the amplified population (amplicons). For example, in some embodiments, the number of amplicons exhibiting certain desired characteristics is detected and optionally quantified. In some embodiments, after amplification, the amplification products are sequenced. The amplification product undergoing sequencing can be an amplicon that is a substantially monoclonal population of nucleic acids. In some embodiments, the disclosed methods comprise amplifying a single member of an amplicon population at different sites or on different supports. The different sites optionally form part of an array of sites. In some embodiments, the sites in the array of sites comprise wells (reaction chambers) on the surface of an isFET array. Optionally, a nucleic acid molecule to be sequenced is placed at the site. The site may comprise a reaction chamber or well. The sites may be part of an array of similar or identical sites. The array may comprise a two-dimensional array of sites on a surface (e.g., the surface of a flow cell, electronic device, transistor chip, reaction chamber, channel, and the like), or a three-dimensional array of sites within a matrix or other medium (e.g., solid, semi-solid, liquid, fluid, and the like). In any of the embodiments of the present teachings, the site is operatively coupled to a sensor. The method comprises detecting nucleotide incorporation using a sensor. Optionally, the sites and sensors are located in an array of sites coupled to the sensors.

In any of the embodiments of the present teachings, after the template reaction, the templated vectors have at least 50,000, 75,000, 100,000, 125,000, 150,000, 200,000, 250,000, 300,000, 350,000, 400,000, 450,000, or 500,000 substantially monoclonal template nucleic acid molecules attached to each templated vector. In some embodiments, after the template reaction, the templating vectors have between about 50,000 and 500,000 substantially monoclonal template nucleic acid molecules attached to each templating vector, such as between about 50,000 and 400,000 substantially monoclonal template nucleic acid molecules, between about 50,000 and 300,000 substantially monoclonal template nucleic acid molecules, between about 50,000 and 200,000 substantially monoclonal template nucleic acid molecules, or between about 50,000 and 100,000 substantially monoclonal template nucleic acid molecules attached to each templating vector. In illustrative embodiments, after the template reaction, the templated vectors have between about 100,000 and 400,000 substantially monoclonal template nucleic acid molecules attached, between about 100,000 and 300,000 substantially monoclonal template nucleic acid molecules, between about 100,000 and 200,000 substantially monoclonal template nucleic acid molecules, or between about 150,000 and 300,000 substantially monoclonal template nucleic acid molecules attached to each templated vector.

In any of the disclosed embodiments, the amplified template nucleic acid molecule on the vector is sequenced. The sequencing method may comprise any suitable sequencing method known in the art. In some embodiments, template nucleic acid molecules that have been amplified according to the teachings of the present invention are used in any nucleic acid sequencing workflow, including by oligonucleotide probe engagement and detection (e.g., SOLiD^TMFrom Life Technologies, WO 2006/084131), probe-anchor binding sequencing (e.g., Complete Genomics^TMOr Polonator^TM) Sequencing by synthesis (e.g.Gene Analyzer and HiSeq)^TMFrom Illumina), pyrophosphate sequencing (e.g. genome sequencer FLX, from 454Life Sciences), ion sensitive sequencing (e.g. Personalized Genome Machine (PGM)^TM)、Ion Proton^TMSequencer, Ion S5 and Ion S5XL, all from Ion Torrent^TMSystems, Inc.), Single molecule sequencing platforms (e.g., HeliScope)^TMFrom Helicos^TM) Nanopore sequencing by reading individual bases as they pass through the nanopore (e.g., MinION, from oxford anoplore Technologies), chemical degradation sequencing, capillary electrophoresis, gel electrophoresis, and any other next generation, massively parallel sequencing platform.

In some sequencing devices, such as Ion Torrent Systems, sequencing reactions are performed in microwells on a surface (e.g., a semiconductor chip). An exemplary embodiment of the use of a bead carrier in a sequencing device comprising reaction chambers (e.g., wells) is depicted in fig. 8. For example, referring to fig. 8, the exemplary sequencing device 416 includes an array of wells 418. Bead carriers 406 comprising target polynucleotides 402 to be sequenced are attached to magnetic beads 410 to form a bead assembly 412 designed for introducing the bead carriers with attached target polynucleotides into the wells. In some embodiments, the magnetic beads 410 are linked to the bead carrier 406 by double stranded polynucleotide ligation. In some cases, the linker moiety is hybridized to a portion of the target polynucleotide on the bead support 406. In this example, the linker moiety is linked to a complementary linker moiety on the magnetic bead 410. In another example, the template polynucleotide used to form the target nucleic acid attached to bead 406 comprises a linker moiety attached to magnetic bead 410. In another example, a template polynucleotide complementary to a target polynucleotide attached to the bead support 406 is generated from modifying a primer having a linker attached to the magnetic bead 410. In some embodiments, the linker moiety attached to the polynucleotide and the linker moiety attached to the magnetic bead are complementary to each other and are attached to each other. In one example, the linker moiety has an affinity and comprises: an avidin moiety and a biotin moiety; an epitope and an antibody or immunoreactive fragment thereof; antibodies and haptens; digoxin moieties and anti-digoxin antibodies; a fluorescein moiety and an anti-fluorescein antibody; an operon and a suppressor; nucleases and nucleotides; lectins and polysaccharides; steroids and steroid binding proteins; active compounds and active compound receptors; hormones and hormone receptors; an enzyme and a substrate; immunoglobulins and protein a; or an oligonucleotide or polynucleotide and its corresponding complementary sequence. In a particular example, the linker moiety attached to the polynucleotide comprises biotin and the linker moiety attached to the magnetic bead comprises streptavidin.

As illustrated in the embodiment depicted in fig. 8, a plurality of bead carriers 404 and a plurality of polynucleotides 402 (target or template polynucleotides) are placed in solution. A plurality of bead supports 404 are activated or otherwise prepared to bind to the polynucleotides 402. For example, the bead support 404 comprises an oligonucleotide (capture primer) that is complementary to a portion of a polynucleotide of the plurality of polynucleotides 402. In another example, bead vector 404 is modified with target polynucleotide 402 using techniques such as biotin-streptavidin binding. In a particular embodiment, the hydrophilic bead particles and the polynucleotides are subjected to Polymerase Chain Reaction (PCR) amplification or Recombinase Polymerase Amplification (RPA). The template polynucleotide will hybridize to the capture primer. The capture primer is extended to form beads 406 comprising the target polynucleotide attached thereto. Other beads may not yet be attached to the target nucleic acid, and other template polynucleotides may be free floating in solution. A variety of methods can be used to implant the bead carrier and capture by the magnetic beads. For example, turning to 502 of fig. 9, the template polynucleotide (B x-a) is captured by a capture probe (B) attached to a bead support 510. The capture probe (B) complementary to the template polynucleotide is extended, thereby generating B-a. Optionally, the resulting double stranded polynucleotide is denatured, thereby removing the template nucleic acid (B-a) and leaving the single strand (B-a) attached to the bead carrier 510. As illustrated at 504 of fig. 9, a primer (a) modified with a linker moiety (e.g., biotin) is hybridized to a moiety (a) of a nucleic acid (B-a) attached to a bead carrier 510. Optionally, the primer (a) is extended to form a complementary nucleic acid (a-B). As shown at 506, magnetic beads 512 are introduced into the solution. The magnetic beads 512 comprise a linker complementary to the linker moiety to which primer (a) is attached. In this example, the linker attached to primer (a) is biotin and magnetic bead 512 is coated with streptavidin. The magnetic beads 512 may be used to clean the solution and help place the bead carriers 510 and attached nucleic acids (B-a) into the wells of the sequencing device. As illustrated in 508 of fig. 9, in some cases, denaturing the double stranded polynucleotides of 506 allows for de-hybridization of nucleic acids (B-a) from nucleic acids (B-a) attached to the bead vector 510. Thus, the bead vector 510 is placed into the well of a sequencing device, and the bead vector has a single stranded target nucleic acid (B-a). Alternatively, the linker modified probe (a) may not be extended to form a complementary polynucleotide having a length of polynucleotide (B-a). The extension reaction may be performed using Polymerase Chain Reaction (PCR), Recombinase Polymerase Amplification (RPA), or other amplification reactions.

Turning back to fig. 8, in an embodiment using magnetic beads to aid in placement of the bead carriers and attached nucleic acids into the wells of a sequencing device, a bead assembly 412 is coated on a substrate 416 of the sequencing device comprising wells 418. In an example, a magnetic field can be applied to the substrate 416 to pull the magnetic beads 410 of the bead assembly 412 toward the aperture 418. The bead carrier 406 enters the aperture 418. For example, the magnet may be moved parallel to the surface of the substrate 416, causing the bead carrier 406 to be placed in the 418 wells. The bead assembly 412 is denatured to remove the magnetic beads 410, leaving the bead carriers 406 in the wells 418. For example, the hybridized double stranded DNA of the bead assembly 412 may be denatured using thermal cycling or ionic solutions to release the magnetic beads 410 and the template polynucleotide having the linker moiety attached to the magnetic beads 410. Optionally, the target polynucleotide 406 can be amplified, such as in a template reaction, while in the well 418, the bead vector 414 is provided with multiple copies of the target polynucleotide. In particular, the bead 414 has a monoclonal population of the target polynucleotide. Such amplification reactions are performed, for example, using Polymerase Chain Reaction (PCR) amplification, Recombinant Polymerase Amplification (RPA), or a combination thereof. In a particular embodiment, the enzyme (e.g., polymerase) is present, bound to, or in close proximity to the particle or bead. In one example, the polymerase is present in solution or in the well to facilitate the replication of the polynucleotide. A variety of nucleic acid polymerases can be used in the methods described herein. In an exemplary embodiment, the polymerase can comprise an enzyme, fragment, or subunit thereof that can catalyze the replication of a polynucleotide. In another embodiment, the polymerase may be a naturally occurring polymerase, a recombinant polymerase, a mutant polymerase, a variant polymerase, a fusion or otherwise engineered polymerase, a chemically modified polymerase, a synthetic molecule or analog, a derivative or fragment thereof. Although the polynucleotides of the bead support 414 are shown on the surface, the polynucleotides may extend within the bead support 414. Hydrogels and hydrophilic particles having a low concentration of polymer relative to water may contain polynucleotide segments on the interior and throughout the bead support 414, or polynucleotides may be present in pores and other openings. In particular, in some examples, the bead carrier 414 permits the diffusion of enzymes, nucleotides, primers, and reaction products used to monitor the reaction. A large number of polynucleotides per particle yields a better signal.

In some embodiments, sequencing comprises extending a template nucleic acid molecule or amplified template nucleic acid molecule, or extending a sequencing primer hybridized to a template or amplified template, by nucleotide incorporation with a polymerase. In some embodiments, sequencing comprises sequencing the template or amplified template attached to the support by contacting the template or extension primer with a sequencing primer, a polymerase, and at least one type of nucleotide. In some embodiments, sequencing comprises contacting the template or amplification template or extension primer with a sequencing primer, a polymerase, and with only one type of nucleotide that does not comprise a foreign label or chain termination group. In some embodiments, the sequencing reaction is performed using at least one sequencing primer that hybridizes to any portion of the polynucleotide construct (comprising the nucleic acid adaptor or the target polynucleotide sequence).

Returning to fig. 8, in one example, a sequencing primer is added to the well 418, or the bead vector 414 is pre-exposed to the primer prior to placement in the well 418. In particular, the bead carrier 414 comprises bound sequencing primers. The sequencing primer and the polynucleotide form a nucleic acid duplex comprising a polynucleotide (e.g., a template nucleic acid) hybridized to the sequencing primer. Nucleic acid duplexes are at least partially double-stranded polynucleotides. The wells 418 are provided with enzymes and nucleotides to facilitate detectable reactions, such as nucleotide incorporation. In some embodiments, sequencing involves detecting nucleotide additions. The method for detecting nucleotide addition includes a fluorescence emission method or an ion detection method. For example, a set of fluorescently labeled nucleotides is provided to the system 416 and migrated into the well 418. Excitation energy is also provided to the aperture 418. When a nucleotide is captured by the polymerase and added to the end of the extension primer, the nucleotide label fluoresces, indicating which type of nucleotide was added. In an alternative example, solutions containing a single type of nucleotide are fed in sequence. In response to nucleotide addition, the pH within the local environment of the pore 418 may change. This pH change can be detected by an Ion Sensitive Field Effect Transistor (ISFET). Thus, a pH change can be used to generate an indication of the order of nucleotides complementary to the polynucleotide of particle 410.

In typical embodiments of ionic nucleic acid sequencing, nucleotide incorporation is detected by detecting the presence and/or concentration of hydrogen ions generated by a polymerase-catalyzed extension reaction. In one embodiment, a template nucleic acid molecule, optionally pre-bound to a sequencing primer and/or polymerase, can be loaded into a reaction chamber, after which a nucleotide addition cycle is repeated and a wash is performed. In some embodiments, such templates are linked to a vector (such as a particle, bead, or the like) as a substantially monoclonal population, and the substantially monoclonal population is loaded into a reaction chamber.

In each addition step of the cycle, the polymerase extends the primer by incorporating the added nucleotide when the next base in the template is the complementary base of the added nucleotide in solution. One incorporated if there is one complementary base on the template nucleic acid molecule; if there are two consecutive complementary bases on the template nucleic acid molecule, then there are two incorporations; if three, then there are three incorporations; and the like. In each such incorporation case, there is released hydrogen ions, and the template releases a population of hydrogen ions that collectively alter the local pH of the reaction chamber. The generation of hydrogen ions is monotonically related to the number of consecutive complementary bases in the template (and the total number of template molecules with primers and polymerase participating in the extension reaction). Thus, when there are many consecutive identical complementary bases (i.e., homopolymer regions) in the template, the amount of hydrogen ions generated and thus the magnitude of the local pH change is directly proportional to the number of consecutive identical complementary bases. If the next base in the template is not complementary to the added nucleotide, no incorporation occurs and no hydrogen ion is released. In some embodiments, after each step of adding nucleotides, an additional step is performed in which the nucleotides of the previous step are removed using an unbuffered wash solution at a predetermined pH to prevent misincorporation in subsequent cycles. In some embodiments, after each step of adding nucleotides, an additional step is performed in which the reaction chamber is treated with a nucleotide destroying agent, such as apyrase (apyrase), to eliminate any residual nucleotides remaining in the chamber that may produce spurious extensions in subsequent cycles.

In a particular embodiment, the sequencing system includes a hole or holes disposed on a sensor pad of an ionic sensor, such as a Field Effect Transistor (FET)²、10³、10⁴、10⁵、10⁶、10⁷Or more FETs. In an embodiment, the system includes one or more polymer particles loaded into a hole disposed on a sensor pad of an ionic sensor (e.g., a FET), or one or more polymer particles disposed in a plurality of holes disposed on a sensor pad of an ionic sensor (e.g., a FET). In an embodiment, the FET is a chemFET or an ISFET. "chemFET" or chemical field effect transistor includes the type of field effect transistor that acts as a chemical sensor. chemfets have a structural analog of a MOSFET transistor in which the charge on the gate electrode is applied by chemical means. "ISFET" or ion sensitive field effect transistor is used to measure the concentration of ions in a solution; when the ion concentration (e.g., H +) changes, the current through the transistor changes accordingly. In some embodiments, in FET driveOne or more microfluidic structures are fabricated on the sensor array to provide containment or confinement of biological or chemical reactions. For example, in one embodiment, the microfluidic structure is configured as one or more wells (or wells, or reaction chambers, or reaction wells, as the terms are used interchangeably herein) disposed over one or more sensors of the array such that the one or more sensors on which a given well is disposed detect and measure the presence, level, or concentration of an analyte in the given well. In an embodiment, there may be a 1:1 correspondence between the FET sensor and the reaction well.

Returning to fig. 8, in another example, the wells 418 of the well array are operatively connected to a measurement device. For example, for fluorescence emission methods, the aperture 418 may be operably coupled to a light detection device. In the case of ionic detection, the lower surface of the aperture 418 may be disposed on a sensor pad of an ionic sensor, such as a field effect transistor.

In some embodiments, the different classes of nucleotides are added to the reaction chamber sequentially such that each reactant is exposed to the different nucleotides one at a time. For example, nucleotides are added in the following order: dATP, dCTP, dGTP, dTTP, etc.; wherein each exposure is followed by a washing step. The cycle may be repeated 50 times, 100 times, 200 times, 300 times, 400 times, 500 times, 750 times or more depending on the length of sequence information desired.

In some embodiments, the methods (and related compositions, systems, and kits) comprise detecting the presence of one or more nucleotide incorporation byproducts at a site of an array, optionally using a FET. In some embodiments, the method comprises detecting a pH change occurring within at least one reaction chamber, optionally using a FET. In some embodiments, the disclosed methods further comprise detecting a change in ion concentration in the at least one site due to at least one amplification cycle.

An exemplary system involving sequencing by ionic byproducts through detection of nucleotide incorporation is Ion TorrentPGM^TM、Proton^TMOr S5^TMSequencer (Thermo Fisher Scientific) by assay as a testAn ion-species sequencing system for sequencing nucleic acid templates using hydrogen ions generated by the nucleotide incorporation byproducts. Typically, hydrogen ions are released as a by-product of nucleotide incorporation that occurs during template-dependent nucleic acid synthesis using a polymerase. Ion Torrent PGM^TM、Proton^TMOr S5^TMThe sequencer detects nucleotide incorporation by detecting hydrogen ion by-products of nucleotide incorporation. In some embodiments, Ion Torrent PGM^TM、Proton^TMOr S5^TMThe sequencer comprises a plurality of template polynucleotides to be sequenced, each template disposed within an individual sequencing reaction well in an array. The wells of the array are each coupled to at least one ion sensor that detects the release of H + ions or changes in solution pH generated as a byproduct of nucleotide incorporation. The ion sensor includes a Field Effect Transistor (FET) coupled to an ion sensitive detection layer that senses the presence of H + ions or changes in solution pH. The ion sensor provides an output signal indicative of nucleotide incorporation, which may be represented as a voltage change whose magnitude is related to the H + ion concentration in the individual well or reaction chamber. The different nucleotide types are flowed into the reaction chamber in series and can be incorporated into the extension primer (or polymerization site) by the polymerase in the order determined by the template sequence. For example, a sequencing system containing a fluidic circuit is connected to at least two reagent reservoirs, a waste reservoir, through an inlet, and to a biosensor through a fluidic path for fluidic communication. Reagents from the reservoirs are driven to the fluidic circuit by a variety of methods, including pressure, pump (e.g., syringe pump), gravity feed, and the like, and are selected by control of valves. The reagent from the fluidic circuit is driven through a valve that receives a signal from the control system. The control system includes a controller of the valve that generates signals for opening and closing through electrical connections. The control system also includes controls for other components of the system, such as a wash solution valve and a reference electrode electrically connected thereto. Each nucleotide incorporation was accompanied by H + ion release in the reaction well, and a concomitant change in local pH. Registering H by FET of sensor⁺Release of ions, the FET generating a signal indicating the occurrence of nucleotide incorporation. Nucleotides not incorporated during flow of specific nucleotidesNo signal may be generated. The magnitude of the signal from the FET may also be related to the number of particular types of nucleotides incorporated into the extended nucleic acid molecule, permitting resolution of the homopolymer region. Thus, during the operation of the sequencer, the flow of multiple nucleotides into the reaction chamber and the incorporation of monitoring in multiple wells or reaction chambers permits the instrument to simultaneously resolve the sequences of multiple nucleic acid templates.

In some embodiments, the method of downstream analysis comprises parallel sequencing of at least some of the population of amplicons. Optionally, multiple templates/amplification templates/extended first primers at different sites of the array are sequenced in parallel.

In some embodiments, sequencing comprises combining sequencing primers with at least two different template nucleic acid molecules or at least two different substantially monoclonal populations of nucleic acid molecules. In some embodiments, sequencing comprises incorporating a nucleotide onto the 3' OH of the sequencing primer using a polymerase. Optionally, incorporating comprises forming at least one nucleotide incorporation byproduct.

In embodiments of the present disclosure involving dispensing template nucleic acid molecules into the wells of an isFET array and subsequent amplification of templates within the wells of the array, an optional downstream analysis step is performed following amplification that quantifies the number of sites or wells containing amplification products. In some embodiments, the products of the nucleic acid amplification reaction are detected in order to count the number of sites or wells comprising the amplified template. In some embodiments, after amplification, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the wells comprise a substantially monoclonal population of template nucleic acid molecules.

In some embodiments, the templated support is dispensed into individual reaction chambers (e.g., an array of wells) for sequencing. In some embodiments, at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the reaction chambers have templated vectors comprising a substantially monoclonal population of template nucleic acid molecules. In some embodiments, between about 25% and 95% of the reaction chambers have templated vectors containing a substantially single clonal population of template nucleic acid molecules, e.g., between about 25% and 85%, between about 25% and 75%, between about 35% and 95%, between about 35% and 85%, between about 35% and 75%, between about 45% and 95%, between about 45% and 85%, between about 45% and 75%, between about 55% and 95%, between about 55% and 85%, between about 55% and 75%, between about 65% and 95%, between about 65% and 85%, between about 65% and 75%, between about 75% and 95%, between about 75% and 85%, or between about 85% and 95% of the reaction chambers have templated vectors containing a substantially single clonal population of template nucleic acid molecules. In some embodiments, the individual reaction chambers are wells on a sequencing chip. In some embodiments, no more than 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, or 25% of the pores produce low quality results, wherein the low quality pores are determined by a sequencing method.

In various embodiments, the methods, systems, and computer-readable media described herein may be advantageously used to process and/or analyze data and signals obtained from electronic or charge-type nucleic acid sequencing. In electronic or charge-based sequencing (e.g., pH-based sequencing), nucleotide incorporation events can be determined by detecting ions (e.g., hydrogen ions) produced as a natural byproduct of a polymerase-catalyzed nucleotide extension reaction. This can be used to sequence a template nucleic acid molecule, which can be, for example, a fragment of a nucleic acid sequence of interest, and which can be attached directly or indirectly to a vector (e.g., a particle, microparticle, bead, etc.) as a substantially monoclonal population of nucleic acid molecules. The sample or template nucleic acid may be operably linked to a primer and a polymerase, and may be subjected to repeated cycles or "flows" of nucleotide additions (which may be referred to herein as "nucleotide flows" from which nucleotide incorporation may occur) and washes. The primer can be bound to the sample or template such that the 3' end of the primer is extended by the polymerase each time a nucleotide complementary to the next base in the template is added. Subsequently, based on the known sequence of the nucleotide flows and on the output signal measured from the chemical sensor indicative of the ion concentration during each nucleotide flow, the identification of the type, sequence, and amount of nucleotides bound to the sample nucleic acid present in the reaction region coupled to the chemical sensor can be determined.

In a template reaction, a sufficient number of substantially monoclonal or monoclonal populations may be generated to support the growth of TorrentPGM at Ion^TM314. At least 100MB, 200MB, 300MB, 400MB, 500MB, 750MB, 1GB or 2GB of AQ20 sequencing reads were generated on a 316 or 318 sequencer. With respect to related high throughput systems, a sufficient number of substantially monoclonal or monoclonal amplicons can be generated in a single amplification reaction to produce at least 100MB, 200MB, 300MB, 400MB, 500MB, 750MB, 1GB, 2GB, 5GB, 10GB, or 15GB of AQ20 sequencing reads on an Ion Torrent Proton, S5, or S5XL sequencer. As used herein, the term "AQ 20" and variations thereof refers to a measurement of Ion Torrent PGM^TMSpecific methods of sequencing accuracy in a sequencer. Accuracy can be measured with respect to Phred-like Q-scores, which measure accuracy on a logarithmic scale: q10-90%, Q20-99%, Q30-99.9%, Q40-99.99% and Q50-99.999%. For example, in a particular sequencing reaction, an accuracy metric may be calculated by a predictive algorithm or by actual alignment to a known reference genome. The predicted quality score ("Q" score) can be derived from algorithms that look at the inherent characteristics of the input signal and obtain extremely accurate estimates as to whether a given single base included in the sequencing "read" will align. In some embodiments, such predicted quality scores are suitable for filtering and removing lower quality reads prior to downstream alignment. In some embodiments, accuracy is reported with respect to a Phred-like Q score that measures accuracy on a logarithmic scale such that: q10-90%, Q17-98%, Q20-99%, Q30-99.9%, Q40-99.99% and Q50-99.999%. In some embodiments, data obtained from a given polymerase reaction is filtered to measure only polymerase reads that measure "N" nucleotides or longer and have a Q score, e.g., Q10, Q17, Q100 (referred to herein as an "NQ 17" score), that exceeds a certain threshold. For example, a 100Q20 score may indicate the number of reads obtained from a given reaction that are at least 100 nucleotides in length and a Q score of Q20 (99%) or greater. Similarly, a 200Q20 score may indicateA number of reads at least 200 nucleotides in length and having a Q score of Q20 (99%) or greater.

In some embodiments, the accuracy is calculated based on an appropriate alignment using the reference genomic sequence, referred to herein as "raw" accuracy. This is in contrast to the common accuracy of measuring the error rate with a consensus sequence as a result of multiple reads, which is a one-way accuracy that involves measuring the "true" per base error associated with a single read. Raw accuracy measurements can be reported in terms of "AQ" scores (for alignment quality). In some embodiments, data obtained from a given polymerase reaction is filtered to measure only polymerase reads that measure "N" nucleotides or longer, with AQ scores exceeding a certain threshold, e.g., AQ10, AQ17, AQ100 (referred to herein as "NAQ 17" scores). For example, a 100AQ20 score may indicate the number of reads obtained from a given polymerase reaction, which is at least 100 nucleotides in length and the AQ score is AQ20 (99%) or greater. Similarly, a 200AQ20 score may indicate a number of reads at least 200 nucleotides in length and an AQ score of AQ20 (99%) or greater.

In some embodiments, the present disclosure provides kits for performing nucleic acid amplification in a pre-implant reaction followed by a template reaction. The compositions discussed herein are also amenable to a kit format, wherein the primers and amplification components can be in the same vessel, in separate vessels, and in liquid or dehydrated form. The kit can comprise instructions for performing a method of amplifying a template nucleic acid molecule, the method comprising a pre-implant reaction for a downstream sequencing method. In one embodiment, the kit provides instructions for nucleic acid sequencing preparation.

In some embodiments, a kit comprises at least two containers, at least one of which comprises a primer and at least one of which comprises a recombinase enzyme. The recombinase and the primer can be in the same or different tubes. In some embodiments, at least one primer is linked to one or more vectors. The kit may further comprise one or more pre-implanted solid carriers.

In some embodiments, the container comprising the recombinase further comprises one or more amplification reagents comprising a recombinase helper protein, a polymerase, dntps, and a buffer. In certain embodiments, the kit comprises one or more containers having: uvsX recombinase, uvsY recombinase load protein, gp32 protein, Sau DNA polymerase, dNTP, ATP, phosphocreatine, and creatine kinase.

In some embodiments, the kit comprises any combination of: optionally one or more solid supports having a population of attached at least one primer, a polynucleotide, a recombinase-loading protein, a single-stranded binding protein (SSB), a polymerase, a nucleotide, ATP, phosphocreatine, creatine kinase, a hybridization solution, a wash solution, a buffer, and/or a cation (e.g., a divalent cation). The kit may comprise all or some of these components, typically in at least two separate containers. The kit may comprise any of the components of the pre-implant reaction mixture or the template reaction mixture.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the embodiments of the present teachings are used, and are not intended to limit the scope of the disclosure nor are they intended to represent that the following examples are all or only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental error and deviation should be accounted for. Parts are parts by volume and temperatures are in degrees celsius unless otherwise indicated. It should be understood that changes can be made to the methods described without changing the basic aspects that the examples are intended to illustrate.

Examples of the invention

EXAMPLE 1 Pre-implantation of P1 Ion Spherical Particles (ISP) Using Single-cycle PCR prior to bulk isothermal amplification

This example provides a method of pre-implanting ISPs with monoclonal templates before isothermal amplification for downstream next generation sequencing. These pre-implanted ISPs do not require additional templates in solution during the isothermal amplification step and are able to generate templates that produce better sequencing results than ISPs without pre-implanted templates (non-template controls or "NTCs"). Ion Torrent ISP ("P1 ISP") with forward P1 adaptor was pre-implanted with different copy numbers of monoclonal templates and amplified in Bulk isothermal amplification ("Bulk IA"). The preimplantation ISP is compared to a no template control ("NTC") ISP that has the same template polynucleotide added during the template reaction, but not during the preimplantation reaction prior to the template reaction. The sequencing results from different amplification reactions were compared using various metrics.

Generating a template nucleic acid molecule

DNA was amplified from genomic DNA using PCR primers 1, 12 and 13 from Oncomine Focus Assay (OFA) (Thermo Fisher Scientific, Waltherm, Mass.). During 10 cycles of the second tailed PCR, adapters that promote binding to immobilized primer B and primer a in the solution used in the implantation reaction were added to the amplicons. Amplification yielded 3 templates: OFA 1AB, 19.2 ng/. mu.l (148 nM); OFA 12AB, 15.6 ng/. mu.l (100 nM); and OFA 13AB, 17.2 ng/. mu.l (76 nM).

Preimplantation reaction

Dilutions of the OFA 1AB, OFA 12AB and OFA 13AB templates were prepared and used to generate the individual preimplantation P1ISP in the preimplantation reaction. The preimplantation reaction contained 6.67 μ l of P1ISP (400,000,000ISP) with immobilized primer B, 88.33 μ l of 1X platinum HiFi mixture (Thermo Fisher Scientific, waltham, ma) and 5 μ l of appropriate template diluent to produce the desired number of substantially monoclonal template molecules (copy numbers 70,665 and 4,170 for P1 ISP) the ISP preimplantation reaction mixture was placed in a thermocycler to perform a denaturation step at 98 ℃ for 2min followed by 98 ℃ for 25 seconds and 56 ℃ for 10min to produce the preimplantation ISP. To examine the relative size of ISPs, 1. mu.l of each pre-implanted P1ISP was diluted in 999. mu.l of annealing buffer (Ion PGM)^TMHi-Q^TMView Sequencing Solution, (product No. A30275)), and analyzed using a Guava easyCyte flow cytometer (EMD Millipore, Billerica, Mass.). The relative size of NTC P1ISP in the absence of bound template was also analyzed.

Washing residues in a total volume of 1ml of OneTouch Wash Solution washing bufferThe P1ISP left preimplantation was twice. After the first washing, in>The samples were centrifuged at 21,000g for 8min and the supernatant removed, leaving-100. mu.l. After a second wash and centrifugation, the supernatant was removed, leaving-50 μ Ι of sample in the tube. Subsequently, the samples were treated with 300 μ l of freshly prepared melt off solution (125mM NaOH, 0.1% Tween 20) and vortexed thoroughly before being incubated for 5 minutes at room temperature. Subsequently, these samples were treated with nuclease-free (NF) H₂O washes three times with a final volume of 1 ml. After each washing, at>The samples were centrifuged at 21,000g for 8min and the supernatant removed, leaving-100. mu.l. To examine the size of the pre-implanted P1ISP after the last wash, 1 μ l of each pre-implanted P1ISP was diluted in 99 μ l of annealing buffer and analyzed using a Guava easyCyte flow cytometer. The relative size of NTC P1ISP in the absence of bound template was also analyzed.

Determination of copy number on Pre-implanted P1ISP

Dilutions of pre-implanted P1ISP were prepared to give 50,000, 5,000, 500 or 50ISP/μ l based on the sample counts from the Guava easyCyte flow cytometer after washing. These dilutions were used in qPCR as follows: mu.l FastSYBR (Thermo Fisher Scientific, Waltham, Mass.), 0.2. mu.l 10. mu.M truncated PCR A primer (5'-CCA TCT CAT CCC TGC GTG TC-3'; SEQ ID NO:2), 0.2. mu.l 10. mu.M truncated PCR B primer (5'-CCT ATC CCC TGT GTG CCT TG-3'; SEQ ID NO:3), 2. mu.l pre-implanted P1ISP and 7.6. mu.l NF H ₂And O. The reaction mixture was placed in a real-time PCR instrument to perform a 95 ℃ denaturation step for 20 seconds followed by 40 cycles (95 ℃ for 3 seconds and 60 ℃ for 30 seconds). C of each qPCR reaction_tC reacted with qPCR with known molecular number_tThe values were compared to calculate the copy number of the monoclonal template on each ISP. Samples with the same pre-implanted template amount were pooled to obtain the average copy number per ISP for each group.

Template reaction

The preimplantation P1 ISP with the same copy number of each monoclonal template was merged, i.e. 70 copies of OFA1 AB, OFA12 AB or OFA 13 AB had been preimplantationThe P1 ISPs were all merged, and similarly the P1 ISP pre-planted with 665 template copies was merged, and the P1 ISP pre-planted with 4,170 template copies was merged. A pool of pre-implanted P1 ISP (100. mu.l, containing 375,000,000 pre-implanted P1 ISPs) was incubated with 4. mu.l of primer mix S (Ion PGM)^TMTemplate IA 500 kit, thermo fisher Scientific) in solution without any substrate ligation, wherein the Template nucleic acid molecule comprises a primer binding site for a second primer at or near the opposite end of the proximal segment) and 146ISP dilution buffer, both from Ion PGM^TMTemplate IA 500. NTC P1 ISP (100. mu.l, containing 375,000,000 ISPs) was combined with 4. mu.l of primer mix S, 131. mu.l of ISP dilution buffer and three 5. mu.l library aliquots. Two Ion PGM^TMTemplate IA (isothermal amplification) pellets were each reconstituted with 720. mu.l of reconstitution buffer, vortexed and briefly spun, dehydrated Template IA pellets containing T7 polymerase, uvsX recombinase, uvsY recombinase load protein, gp32 protein, Bsu DNA polymerase, dNTPs, ATP, thioredoxin, phosphocreatine, and creatine kinase 120. mu.l of reconstitution buffer (25mM Tris, pH 8.3; 5mM DTT; 3mM dNTPs; 3.5625% trehalose; 0.1mg/ml creatine kinase; 1.1375mg/ml Twist gp 32; 0.4mg/ml UvsX; 0.1mg/ml UvsY; 0.25mU/μ L PPi enzyme; 0.02mg/ml Sau Pol; 0.03063mg/ml T7 Dbl Exo-o-0.0225 mg/ml thioredoxin (5 × ml), 1.425% PEG from PEG in a kit (tube 2)^TMFour pellets of the base kit were rehydrated. Vortex and spin the recombinase solution, then freeze. To each pool of pre-implanted P1 ISP and NTC ISP, 360 μ l of reconstituted pellet solution was added. The solution was vortexed thoroughly and briefly spun. The template reaction was carried out at 40 ℃ for 30 minutes. To stop the template reaction, 650 μ l of 100mM EDTA was added, the solution was vortexed, and the tube was briefly rotated.

Enrichment templated ISP

MyOne beads (ThermoFisher Scientific, Waltham, Mass.) were used to enrich templated ISPs. Briefly, each terminated template reaction was divided into 2 tubes and 100 μ Ι MyOne beads were added to each tube. The tubes were spun at room temperature for 15 minutes, spun, and placed on magnetic tube racks. The beads are sufficiently concentratedAfter this time, the supernatant was removed and discarded. Subsequently, similar samples were pooled using 500. mu.l of 3mM SDS solution per tube, so that each similar sample group had a total of 1ml of 3mM SDS. The tube was vortexed thoroughly, briefly spun, and placed on a magnetic tube rack for 2 minutes. The supernatant was removed and the tube was removed from the magnetic tube rack. The beads were resuspended with 200. mu.l of the draw-off solution (125mM NaOH and 0.1% Tween 20), vortexed thoroughly and spun briefly. After 2 minutes of room temperature incubation, the bead solution was placed on a magnetic tube rack for 2 minutes and the supernatant was transferred to a new 0.2ml tube. The tube was rotated at maximum speed for 8 minutes and the supernatant was removed, leaving-10-15 μ l of solution. To the templated ISP 90 μ Ι of water was added and 2 μ Ι was removed for analysis on the Guava easyCyte flow cytometer. The tube was rotated at 15,000rcf for 5 minutes and the supernatant removed, leaving 10 μ l of the templated ISP-containing solution. To ISP added 20 u l 100% PBST and 20 u l sequencing primer, and vortex tube and rotate briefly. Ion Torrent PI was used according to the manufacturer's instructions^TMSequeningHiQ 200 kit (Life Technologies, Calsward, Calif.) anneals the sequencing primers.

Sequencing

Ion Torrent PI was used according to the manufacturer's instructions^TMThe Sequencing HiQ 200 kit (Life technologies, Calsbad, Calif.) performs a standard Sequencing reaction on Ion Torrent PGM. Sequencing signals were analyzed by the Torrent software set to determine the sequences present within the amplicons of these ISPs.

Results

Pre-implantation of the P1 ISP monoclonal template before Bulk IA yielded better sequencing metric values than a similar response without pre-implantation (i.e., NTC P1 ISP). Furthermore, the P1 ISP pre-implanted with more copies of the monoclonal template, up to 4170 (the maximum number tested in this example), had better sequencing metric values than the ISP pre-implanted with fewer copies. For example, the read length frequency distribution graph illustrates that the pre-implanted samples have fewer short length reads (fig. 1A-1D). Furthermore, the percentage of usable reads by and from the loaded ISPs increases as the number of copies pre-implanted onto the ISP increases (fig. 2A-2B). The mean and median of the total and read lengths also increased with the number of pre-planted copies (FIGS. 2C-2D). The negative metric of sequencing decreased with pre-implantation in a copy number dependent manner. For example, the percentage of empty and low quality pores decreased with the pre-implanted P1 ISP (fig. 2E-2F). Overall, this experiment shows that P1 ISP can be pre-implanted with a monoclonal template before Bulk IA to obtain significant improvements in next generation sequencing.

EXAMPLE 2 Pre-implantation of ISP with Single PCR cycle followed by isothermal amplification

As in the previous example, this example provides a method for pre-implanting ISP monoclonal templates before isothermal amplification (template reaction) for downstream next generation sequencing. However, in the method disclosed in this example, a template reaction was performed after allocating a pre-implanted ISP into the wells of the Ion Torrent chip. The preimplantation ISP was compared to a no template control ("NTC") ISP that had the same template polynucleotide during the template reaction, but not prior to the template reaction and during the preimplantation reaction. The sequencing results from different amplification reactions were compared using various metrics.

Preimplantation reaction

Thus, ISPs with the P1 adaptor were pre-implanted with OFA1 AB, OFA12 AB or OFA 13 AB template nucleic acid molecules, as provided in example 1. After pre-implantation, the pre-implanted ISPs were washed and counted, as provided in example 1. The pre-planted ISPs with the same copy number of each monoclonal template were merged, i.e., ISPs that had been pre-planted with 82 OFA1 AB, OFA12 AB, or OFA 13 AB copies were all merged, and ISPs that had been pre-planted with 775 template copies were similarly merged, as well as ISPs that had been pre-planted with 5,400 template copies.

Cartridge load

Ion Torrent 541 chip with 100 u l100 mM NaOH washing for 60 seconds, with 200 u l nuclease free water washing, with 200 u l isopropanol washing and suction drying. To load the chips, vortex ISP (500,000,000 NTC ISP or pooled, pre-implanted ISP) with annealing buffer (Ion PI)^TMHi-Q^TMSequencing 200 kit, Ion Torque) to 45. mu.l, and injected into the processed chip through the load port. The chip was centrifuged at 1424rcf for 2 minutes. 1ml of foam (980. mu.l of 50% annealing buffer, combined with 20. mu.l of 10% Triton X-100, 1ml of air drawn in, and the foam mixed further by pipette for 5 seconds) was injected into the chip and the excess foam was aspirated. Mu.l of 60% annealing buffer/40% isopropanol rinse solution was injected into the chip and the chip was aspirated to dryness. The chip was rinsed with 200. mu.l annealing buffer and the chip was vacuum dried. For chips with pre-implanted ISPs, 40 μ l PBST was added to the chip and each port was filled with 35 μ l PBST. For chips with NTC ISP, 5. mu.l of 100pM library (equal parts of OFA1 AB, OFA12 AB and OFA 13 AB) was added to 110. mu.l of annealing buffer to prepare a library mixture. Add 40. mu.l of library mix to the chip and fill each port with 35. mu.l of library mix. The chip was placed on a thermal cycler and cycled once (1 minute at 95 ℃, then 2 minutes at 37 ℃, then 4 ℃). The chip was washed once with 200 μ l annealing buffer and left wet.

Template reaction

Ion PGM^TMTemplate IA block 871 μ l Ion PGM^TMThe rehydration buffer is rehydrated, vortexed thoroughly, and spun briefly. Each chip was injected with 40. mu.l of pellet IA solution and the displaced annealing buffer was aspirated from the outlet. Add 20. mu.l of pellet IA solution to the loading port and rotate the chip at 1424rcf for 2 minutes. To activate the pellet IA solution, 218.2. mu.l ion PGM was added^TMThe starting solution was combined with 8. mu.l of primer A and added to the pellet IA solution. The activated pellet IA solution was vortexed and briefly spun. Into each chip, 60 μ l of the activated pellet IA solution was injected and the displaced fluid was aspirated. An additional 35. mu.l of pellet IA solution was added to each port for each chip. The chip was placed on a thermal cycler set to 40 ℃, capped, and incubated for 15 minutes. The chip was vacuum rinsed with 200. mu.l 0.5M EDTA and dried by aspiration. The chip was vacuum rinsed with 200. mu.l annealing buffer and dried by aspiration. The chip was rinsed twice in vacuo with 200. mu.l 1% SDS and dried with suction. The chip was vacuum rinsed with 200. mu.l of rinsing solution (50% isopropanol/50% annealing buffer) and suction dried. Subsequently, the chips were buffered with 200. mu.l annealingLiquid rinse, and suction dry. To each chip, 40. mu.l of primer mix (250. mu.l of sequencing primer and 250. mu.l of annealing buffer) was injected into the flow cell and 35. mu.l of primer mix was added to each port. The chip was placed on a thermal cycler and cycled once (2 minutes at 95 ℃, then 2 minutes at 37 ℃, then 4 ℃). The chip was rinsed once with 200. mu.l of annealing buffer and aspirated. To each chip was added 60. mu.l of the enzyme mix (60. mu.l annealing buffer and 6. mu.l PSP4 enzyme) and incubated for 5 minutes. The chip was vacuum dried and immediately 100. mu.l annealing buffer was added. The chip was loaded onto an Ion Proton System for sequencing.

Sequencing

The Ion Proton System was started with Hi-Q200 material and sequenced using 400 flows (flows).

Results

Pre-implanting the ISP with monoclonal templates and then loading the pre-implanted ISP onto an Ion Torrent sequencing chip yields better sequencing metric values than NTC ISP, which has attached monoclonal templates and is amplified in one reaction. The percentage of ISP loaded increased with 82 template copies pre-implanted onto the ISP, but higher levels of pre-implantation reduced the percentage of ISP loaded below the NTC ISP (fig. 3A). The percentage of usable reads increases with the pre-implanted ISP (fig. 3B). The pre-implanted ISP also had up to a 9-fold increase over NTC ISP in total reads, and greater than a 2-fold increase in mean, median and mode of read lengths (fig. 3C-3D). All pre-implanted ISPs showed lower percentages of low-quality holes and of holes without template (fig. 3E-3F). This example demonstrates that single clone template nucleic acid molecules can be preimplanted into an ISP to achieve sequencing data improvements in a method in which template reactions are performed on the ISP distributed within the wells of an iontorent chip.

Example 3 Pre-implantation of Complex libraries against ISP in RPA response

As in the previous example, this example provides a method of pre-implanting an ISP. However, in the method disclosed in this example, the template reaction is completed using a short RPA reaction rather than a single PCR cycle. In addition, reactions were performed on ISPs in the wells of the Ion Torrent 541 chip. After the RPA pre-implant reaction, the pre-implanted ISP is washed before performing a second isothermal RPA reaction (template reaction). ISPs generated in a two-step process with a pre-implant ISP followed by a template reaction in which the template nucleic acid molecules are washed away prior to the template reaction are compared to ISPs that undergo a single RPA amplification without washing, which have the same template polynucleotide throughout the entire incubation reaction mixture. Four replicates of each of the one-step and two-step reactions were performed and compared.

Preimplantation reaction

Thus, 500,000,000 ISPs were added to the wells of the Ion Torrent chip and were pre-implanted with 160,000,000 copies of 130 base pair fragments of the E.coli genome with adaptors at the ends of the fragments (A-B, A-AV5 or A-AV6) and other components in the reaction mixture (same as in example 2). The adaptors comprise primer binding sites that facilitate binding to the immobilized universal primer (primer B, AV5 or AV6) linked to the ISP, the universal primer (primer a) in solution during the preimplantation and template reactions, and the sequencing primer. Briefly, 40. mu.l of the preimplantation reaction mixture was added to the chip and each port was filled with 35. mu.l of the preimplantation reaction mixture. The preimplantation reactions were incubated at 40 ℃ for 2.5 minutes and then stopped by vacuum rinsing with 200 μ l 0.5M EDTA and then dried by aspiration. Pre-implanted ISP was washed with annealing buffer.

Template reactions of NTC ISP were assembled as above and incubated at 40 ℃ for 30 min. Following template reaction, NTC ISP was treated in the same way as pre-implanted ISP.

Template reaction

The template reaction was performed as in example 2. The template reaction for the preimplantation ISP was incubated at 40 ℃ for 30 minutes.

Sequencing

As in example 1, Ion Torrent PI was used^TMSequencing HiQ 200 kit for Sequencing.

Results

Pre-implanting the ISP with a template nucleic acid molecule and then subjecting the ligated template nucleic acid molecule to a template reaction in a second reaction (i.e., a template reaction) produces an average of 7,750,000 more reads than the templated ISP produced without the pre-implant reaction alone. In addition, other sequencing metrics were better in the case of the preimplantation response. The average AQ20 score was 109 and 110.75 for the one-step and two-step (preimplantation reaction alone, followed by template reaction) reactions, and the average AQ20GBases score was 2.375 and 3.075, respectively. This example demonstrates that ISPs pre-implanted with a complex population of template nucleic acid molecules improve the sequencing data generated for the template.

Example 4 Pre-implantation of composite libraries for ISPs in a Large Scale isothermal amplification

As in the previous example, this example provides a method of pre-implanting a complex population of template nucleic acid molecules to an ISP. However, this example provides a preimplantation RPA response with longer incubation. Following the pre-implant reaction, the pre-implanted ISP was enriched using MyOne magnetic beads prior to performing a second isothermal RPA reaction (i.e., template reaction). Following the template reaction, templated ISPs were further enriched using MyOne magnetic beads before processing for downstream sequencing. ISPs generated in a two-step process with a pre-implant ISP followed by a template reaction in which the template nucleic acid molecules are washed away prior to the template reaction are compared to ISPs that undergo a single RPA amplification without washing, which have the same template polynucleotide throughout the entire incubation reaction mixture.

Preimplantation reaction

A pre-implant reaction with a mixture of a' primer and capped P1 primer was performed (see fig. 4). Will include 50. mu.l annealing buffer (Ion PGM)^TMHi-Q^TMView Sequencing Solutions, (product No. A30275)), primer mix S (3A ' primer mix: 5'-ACG ATC CAT CTC ATC CCT GCG TGT C-3' (SEQ ID NO: 4); 5'-TCC ATA AGG TCA GTA ACG ATC CAT CTC ATC CCT GCG TGT-3' (SEQ ID NO: 5); and 5' -/5-Bio/TCC ATA AGGTCA GTA ACG ATC CAT CTC ATC CCT GCG TGT-3' (SEQ ID NO:5)), terminated fusion primer (5' -CCT ATC CCC TGT GTG CCT TGG CAG TCT CAG CCA CTA CGC CTC CGC TTTCCT CTC TAT GGA A/3-Phos/-3 '; SEQ ID NO:6)), 7.5 × 10⁶ISP and 35pM 130bp template nucleic acid molecule from human genome libraryThe tube of daughter, vortexed, briefly swirled and incubated at 98 ℃ for 2 minutes, and then at 37 ℃ for 2 minutes. Another aliquot of annealing buffer (75 μ Ι) was added and the solution was transferred to a new tube and vortexed. IonPGM^TMTemplate IA masses (ThermoFisher Scientific, Waltherm, Mass.) were treated with 720. mu.l Ion PGM^TMTemplate IA rehydration buffer was rehydrated, mixed well, and stored on ice. 375. mu.l of reconstituted Ion PGM^TMThe template IA pellet was combined with 125 μ l of the previously prepared solution containing the library, vortexed, and then placed back on ice. The mixture was premixed with 150. mu.l of Ion PGM^TMThe template IA starting solutions were combined, mixed well to form a preimplantation reaction mixture, centrifuged briefly, and placed on ice. To initiate the preimplantation reaction, the tubes were placed in a 40 ℃ heat block and subsequently incubated at 40 ℃ for 4 minutes to produce preimplantation ISPs. The pre-implant reaction was stopped by adding 650 μ l of 100mM EDTA followed by vortexing.

Control reactions were assembled as above with the following differences using 5.625 × 10⁶Individual ISP and 11pM templates and incubation at 40 ℃ for 30min was maintained. These control reactions were processed in the same manner as the preimplantation samples, followed by enrichment for templated ISPs.

Enrichment of preimplantation ISP

MyOne beads (ThermoFisher Scientific, Waltham, Mass.) were used to enrich for pre-implanted ISPs. Briefly, 100 μ Ι MyOne beads were added to tubes with pre-implanted ISP and vortexed. The tube was rotated for 10 minutes, spun, and placed on a magnetic tube rack. After the beads had sufficiently pelleted, the supernatant was removed and discarded. Using a magnetic tube frame, with 1ml ion PGM^TMThe bead was washed once with the washing solution. Subsequently, the beads were washed once with 1ml of 3mM SDS solution using a magnetic tube rack, and the supernatant was transferred to a new tube for further processing. The supernatant from the SDS wash was rotated at 21,000rcf for 8 minutes and the supernatant was removed, leaving approximately 50 μ Ι. The preimplantated ISP was resuspended in 150. mu.l of the melt-out solution (125mM NaOH and 0.1% Tween 20) and transferred to a new tube. The tube was rotated at 15,000rcf for 5 minutes and the supernatant removed, leaving 10 μ l of solution. Adding 190 to a pre-implanted ISPμ l of water, and 2 μ l was removed for analysis on a Guava easyCyte flow cytometer. The tube was rotated at 15,000rcf for 5 minutes and the supernatant removed, leaving 10 μ l of solution containing residual pre-implanted ISP.

Template reaction

To the tubes containing the preimplantation ISP 111. mu.l annealing buffer and 4. mu.l primer mix S were added. Pre-implanted ISPs were aspirated back and forth to pool and all solutions were transferred to new tubes. Add 375. mu.l of rehydrated Ion PGM to the tube^TMTemplate IA clumps, and vortexed tubes, briefly spun and placed on ice. Reaction mixture was premixed with 150. mu.l of Ion PGM^TMThe template IA starting solutions were combined, mixed well, centrifuged briefly, and placed on ice. To initiate the template reaction, the tube was placed in a 40 ℃ heating block and subsequently incubated at 40 ℃ for 30 minutes. The reaction was stopped by adding 650. mu.l of 100mM EDTA followed by vortexing.

Enrichment templated ISP

MyOne beads (ThermoFisher Scientific, Waltham, Mass.) were used to enrich templated ISPs. Briefly, 100 μ Ι MyOne beads were added to tubes with templated ISP and vortexed. The tube was rotated for 10 minutes, spun, and placed on a magnetic tube rack. After the beads had sufficiently pelleted, the supernatant was removed and discarded. Using a magnetic tube rack, 1ml of IonPGM^TMThe bead was washed once with the washing solution. Add 200 μ l of the melt-out solution (125mM NaOH and 0.1% Tween 20) to the tube, mix, and transfer the solution to a new tube. The tube was rotated at 15,000rcf for 5 minutes and the supernatant removed. ISP was washed with 200 μ Ι water and 2 μ Ι was removed for analysis on the Guava easyCyte flow cytometer. The ISP is then processed for sequencing according to the Proton Hi-Q user guide.

Results

Pre-implanting the ISP with a template nucleic acid molecule and then subjecting the ligated template nucleic acid molecule to a template reaction in a second reaction (i.e., a template reaction) produces an average of 9,167,000 more reads than the templated ISP produced without the pre-implant reaction alone. In addition, other sequencing metrics were better in the case of the preimplantation response. The mean AQ20 score was 105 and 110.25 for the one-step and two-step (preimplantation reaction alone followed by template reaction) reactions, and the mean AQ20GBases score was 2.889 and 4.267, respectively. This example demonstrates that ISPs pre-implanted with a complex population of template nucleic acid molecules produce improved sequencing data for the template.

Example 5

Implant

The library (2.4B copies) was mixed with biotin TPCRA (1. mu.L, 100. mu.M) in a PCR tube. The tube was filled to 20 μ L with 1 × platinum HiFi mixture. The tubes were thermocycled once on a thermocycler (2 min at 98 ℃, 5min at 37 ℃, 5min at 54 ℃). Add 60 billion beads to the tube. 1 × HiFi was added to increase volume by 50% (i.e., 20 μ L beads +10 μ L platinum Hifi mix). The solution was thermocycled once on a thermocycler (2 min at 98 ℃, 5min at 37 ℃ and 5min at 54 ℃).

1mL of myOne beads were pipetted into 1.5mL tubes (1mL of myOne beads for 2 samples) and the tubes were placed on a magnet and the supernatant discarded. To the MyOne mixture was added 1mL of 3% BSA in 1 XPBS, vortexed, and pulsed. The mixture was placed on a magnet and the supernatant was discarded. To the MyOne mixture was added 1mL AB, vortexed, and pulsed. The mixture was placed on a magnet and the supernatant was discarded. To the MyOne mixture was added 250. mu.L of AB (125. mu.L of 4 Xconcentrated MyOne was used for one sample). The purified MyOne mixture was transferred to a new 1.5mL tube.

The sample was transferred from the PCR tube to a new 1.5mL tube. To this was added 125. mu.L of 4 Xconcentrated MyOne. The mixture was pipetted back and forth 3 times (200. mu.L/s) and allowed to stand for 10 min. The mixture was placed on a magnet, ISP captured by MyOne was pulled out (chef speed 80. mu.L/s), and the supernatant was discarded. Add 20. mu.L NF water, pulse vortex, pulse spin, and place on magnet to nucleate MyOne.

Chip preparation

Wash chip 2X with 200. mu.L NF Water.

Magnetic ISP load

mu.L of ISP mixture was mixed with 4.5. mu.L of 10 × annealing buffer and 20.5. mu.L of water (45. mu.L total). ISP was vortexed and combined with 10 × annealing buffer and water. The ISP solution was vortexed and spun rapidly. The ISP solution was slowly injected into the chip through the load port. Magnetic loading was performed for 40 minutes at 30 seconds/scan. 200 μ L of foam (1 × AB with 0.2% Triton) was injected into the chip and excess foam was extracted. While the outlet was being vacuumed, 200 μ L of 1 × AB was added, and then aspirated to dry the chip. While the vacuum suction outlet was being used, 200. mu.L of the rinse solution (60% AB/40% IPA) was sucked, and then sucked to dry the chip. 200 μ L of 1 × AB was added while the vacuum was drawn through the outlet. The chip was kept in 1 × AB until the ISP on the chip was ready to be amplified.

Amplification, all reagents were kept on ice

1 st step of amplification

Tubes with biotin-labeled primer a and a capping molecule (neutravidin) were prepared and incubated on ice for >15 minutes. The solution contained 1.1. mu.L of 100. mu.M primers per chip and 1. mu.L of 10mg/mL NAv (reconstituted in 0-PEG buffer) per chip. To a1 × IA pellet (batch No. LTBP0047, PN100032944), 871 μ L of reconstitution buffer was added. The solution was vortexed 10 ×, vortexed rapidly, to collect the tube contents. The contents were divided into two tubes of equal volume (900. mu.L in a separate tube). One 900 μ L tube was used for step 1 amplification and another 900 μ L tube was stored for step 2 amplification.

For each chip to be run, 60 μ L of pellet solution was slowly injected into the chip. The displaced annealing buffer was aspirated from the outlet. The chip was incubated with the pellet solution for 4 minutes at RT. Add 177.4 μ Ι _ of starting solution to the pellet solution tube, pulse vortex 10 ×, and spin rapidly. Transfer 110 μ L/chip of starting solution into tube with primer and blocking agent, pulse vortex 10 × and spin rapidly. For each chip, -60 μ L of the activated pellet solution was slowly injected into the chip. All displaced fluid is pumped from both ports. To each port was added 25. mu.L of pellet solution. The chip was placed on a hot plate (thermal cycler) set at 40 ℃. The chip is covered with a pipette tip cap or the like (not a heated thermocycler cap) and incubated for 2.5 minutes.

Short reaction termination and cleaning between amplification steps

The amplified chip was placed near a hood equipped with vacuum. While the outlet was being aspirated under vacuum, 200. mu.L of 0.5MEDTA pH 8(VWR E522-100ML) was added, followed by aspiration to dry the chip. While the outlet was being vacuumed, 200. mu.L of 1 × AB was aspirated, and then aspirated to dry the chip. The AB addition was repeated and the chip was wetted for step 2 amplification. (evacuation of AB twice, and leave the 3 rd AB in the chip)

Step 2 amplification (without capping agent)

Tubes with biotin-labeled primer a were prepared and incubated on ice for >15 minutes. The solution contained 1.1. mu.L of 100. mu.M primers per chip. To a1 × IA pellet (batch No. LTBP0047, PN100032944), 871 μ L of reconstitution buffer was added. The solution was vortexed 10 ×, vortexed rapidly, to collect the tube contents. After discarding the appropriate volume of pellet solution, 6.6 μ L of 100 μ M biotin-labeled primer was added to the pellet mixture and pulsed vortexed 10 ×.

Add 177.4 μ Ι _ of starting solution to the pellet solution tube, pulse vortex 10 ×, and spin rapidly. For each chip, -60 μ L of activated pellet solution was injected into the pre-spun chip. The displaced fluid is aspirated from both ports. An additional 25. mu.L of pellet solution was added to each port. The chip was placed on a hot plate (thermal cycler) set at 40 ℃. The chip is covered with a pipette tip cap or the like (not a heated thermocycler cap) and incubated for 20 minutes.

Reaction termination and cleaning

The amplified chip was placed near a hood equipped with vacuum. While the outlet was being vacuumed, 200 μ L of 0.5MEDTA pH 8 was added and the chip was aspirated to dry the chip. 200 μ L of 1 × AB) was added while the outlet was vacuum aspirated), and then aspirated to dry the chip. While the outlet was being vacuumed, 200. mu.L of water (Ambion PN AM9822) containing a 1% SDS solution was added, and then aspirated to dry the chip. The SDS wash was repeated. While the outlet was being vacuumed, 200. mu.L of formamide was added. The chip was incubated at 50 ℃ for 3 minutes, followed by aspiration to dry the chip. While the outlet was being vacuumed, 200. mu.L of a rinse (50% IPA/50% AB) solution was added. The chips were aspirated to dryness. While the outlet was being vacuumed, 200. mu.L of annealing buffer was added. The chip was left in 1 × AB until ready to prime.

On-chip sequencing primer hybridization and enzymes

And (4) thawing the sequencing primer tube. Primer mix for the final 50%/50% AB/primer mix was prepared and the wells vortexed. If the sequencing primer tube has a volume of 250. mu.L, then 250. mu.L of 1 × AB is added. The chip was aspirated to dryness, and then 80. mu.L of primer mix (50. mu.L in flow cell, 30. mu.L in port) was added to the chip. The chip was placed on a thermocycler and incubated at 50 ℃ for 2min and 20 ℃ for 5 min. 200 μ L of 1 × AB was injected while the outlet was vacuum-aspirated. Enzyme cocktail was prepared with 60. mu.L of annealing buffer and 6. mu.L of PSP4 enzyme. The ports were cleaned and a vacuum was pulled from the inlet to dry the chips. To the chip add 60 u L enzyme mixture, and at RT temperature 5 minutes incubation. The chips were aspirated from the inlet to dry the chips. Immediately 100. mu.L of 1 × AB was added to the chip. The through ports were cleaned and the back of the chip was dried and the chip was loaded onto the Proton for sequencing.

Example 6

Implant

In a PCR tube, the Ampliseq exome library (2.4B copies) with A and B adaptors was mixed with 5' -biotin-labeled primer TPCRA (1. mu.L, 100. mu.M) complementary to the A adaptor. Tubes were filled to 20 μ L with a1 XPlatinum HiFi mix containing high fidelity Taq DNA polymerase, salts, magnesium and dNTPs. The tubes were thermocycled once on a thermocycler (2 min at 98 ℃, 5min at 37 ℃, 5min at 54 ℃). To the tubes were added Ionic Spherical Particle (ISP) beads (60 million) each having thousands of B primers immobilized thereon. 1 × HiFi was added to increase volume by 50% (i.e., 20 μ L beads +10 μ L platinum Hifi mix). The solution was thermocycled once on a thermocycler (2 min at 98 ℃, 5min at 37 ℃ and 5min at 54 ℃).

In an alternative method, 12 hundred million copies of the Ion Ampliseq exome library (20. mu.L 100pM with standard Ion Torrent A and P1 library adaptors) were mixed 5 Xwith 3. mu.L of 3. mu.M biotin-TPCRA (sequence 5 'biotin-CCA TCT CAT CCC TGC GTG TC-3'; SEQ ID NO:2) and 3. mu.L of 1.5. mu. M B-trP1(trP1 is a 23-mer segment of the Ion P1 adaptor with sequence CCT CTC TAT GGG CAG TCG GTG AT; SEQ ID NO: 1; B is an ISP primer sequence) primers and 9. mu.L of Ion Ampliseq Himaster mix in a PCR tube. The volume was made up to 45. mu.L with 10. mu.L nuclease free water. The tubes were thermally cycled on a thermal cycler with the following temperature profiles: 2min at 98 ℃, 2 [ 15 sec at 98 ℃ to 2min at 58 ℃) cycles, finally held at 10 ℃. After thermal cycling, 60 hundred million ISP (75. mu.L, 8000 ten thousand/microliter) and 6. mu.L of Ion Ampliseq HiFi master mix 5X were added to the tube. 5 μ L nuclease free water was also added to bring the total volume to 131 μ L. The solution was mixed well and the tube was returned to the thermocycler. The third amplification cycle was performed with the following temperature profile: at 98 ℃ for 2min, at 56 ℃ for 5min, and finally at 10 ℃. After thermal cycling, 5 μ L EDTA 0.5M was added and mixed to stop the reaction.

Enrichment of ISP

MyOne superparamagnetic beads (1mL) with streptavidin covalently coupled to the bead surface were pipetted into 1.5mL tubes (1mL MyOne beads for 2 samples) and the tubes placed on a magnet and the supernatant discarded. To the MyOne mixture was added 1mL of 3% BSA in 1 x PBS, followed by vortexing and pulse rotation. The mixture was placed on a magnet and the supernatant was discarded. Annealing buffer (AB; 1mL) was added to the MyOne mixture, vortexed and pulsed. The mixture was placed on a magnet and the supernatant was discarded. AB (250. mu.L) was added to the MyOne mixture (125. mu.L 4 Xconcentrated MyOne was used for one sample). The purified MyOne mixture was transferred to a new 1.5mL tube.

The sample was transferred from the PCR tube containing the ISP mixture to a new 1.5mL tube. To the ISP mixture was added concentrated (4X) MyOne beads (125. mu.L). The mixture was pipetted back and forth 3 times (200. mu.L/s) and then allowed to stand for 10 min. The mixture was placed on a magnet, ISP captured by MyOne was pulled out (chef speed 80. mu.L/s), and the supernatant was discarded. Nuclease Free (NF) water (20 μ L) was added to the tube, followed by pulse vortexing, pulse rotation, and placement on a magnet to aggregate MyOne beads.

In an alternative method of enriching ISPs, 120 μ Ι _ of MyOne streptavidin C1 beads were transferred to individual tubes and the tubes were placed on a magnet to aggregate the magnetic beads. The supernatant was discarded and the tube removed from the magnet. The beads were washed by resuspension in 150. mu.L of Ion Torrent annealing buffer, followed by pooling on the magnet. The supernatant was discarded and the wash with 150 μ Ι _ of annealing buffer was repeated one additional time. After discarding the supernatant from the second wash, the washed MyOne C1 beads were resuspended with 50 μ Ι _ of annealing buffer. The entire contents of the washed MyOne C1 in annealing buffer were transferred to a thermocycled PCR tube containing the library and ISP. The pipette volume was set to 160 μ Ι _ and the contents were slowly mixed by pipetting three times back and forth or dispensing movements at 1 sec/aspirate. The mixture was allowed to stand at room temperature without agitation for 30min to allow the magnetic beads to capture the ISP into which the library was implanted. Subsequently, the tube was placed on a magnet to pellet the magnetic beads and the supernatant was discarded. Water containing Tween-20 (25. mu.L, 0.1%) was added to the pellet. The mixture was vortexed vigorously to elute the implanted ISP from MyOne C1 beads. The pulse rotates the tube and then returns to the magnet. The supernatant (eluate) containing the implanted ISP was collected into fresh tubes for downstream chip loading and amplification steps.

Chip preparation

Wash chip 2X with 200. mu.L NF Water.

Magnetic loading of ISP onto chip

Several methods were used to prepare the ISP/library mixture and load it onto Ion Torrent semiconductor chips containing reaction chamber microwells. In one method, the ISP/library mixture (20. mu.l) is mixed with 4.5. mu.l of 10 × annealing buffer and 20.5. mu.l of water (45. mu.l total). The mixture was vortexed and spun. The ISP solution was slowly injected into the chip through the load port. Magnetic loading was performed for 40 minutes at 30 seconds/scan. Foam (200 μ L) containing 1 × AB with 0.2% Triton was injected into the chip and excess foam was extracted. 200 μ L of 1 × AB was injected into the chip while the outlet of the chip was vacuum-aspirated, and then aspirated to dry the chip. Simultaneously with the vacuum aspiration outlet, 200 μ L of rinse (60% AB/40% IPA) was then injected into the chip, and then aspirated to dry the chip. 200 μ L of 1 × AB was then added to the chip by injection while the outlet was aspirated under vacuum. The chip was held in 1 × AB until the nucleic acid on the ISP on the chip was ready to be amplified.

In another method, 150 μ L of Dynabead M-270 streptavidin (Thermo Fisher scientific), which is a magnetic bead with streptavidin bound to its surface, is transferred to a tube, which is then placed in a magnet to aggregate the magnetic beads. The supernatant was discarded and the tube removed from the magnet. Subsequently, to the tube containing the M-270 aggregate beads were added the following: 20 μ L of ISP mixture from the implantation process, 9 μ L of 5 × annealing buffer and 16 μ L of nuclease-free water, for a total of 45 μ L. Alternatively, 20. mu.l of ISP/library mixture was mixed with 3.2. mu.L of 10 × annealing buffer, 3. mu.L of concentrated M270 magnetic beads and 5.8. mu.L of water, for a total of 32. mu.l. The mixture was mixed to resuspend the M-270 pellet and slowly injected through the loading port into the chip. The magnet placed under the chip repeatedly scans the chip back and forth to load the ISP into the chip wells. The magnetic load scan was performed for 40 minutes at 30 seconds/scan. After loading, a 15mL falcon tube containing 5mL 1% SDS was vigorously shaken to generate a dense foam, followed by injection of 800 μ Ι _ into the chip to remove the magnetic beads from the chip flow cell. The flow at the exit of the chip was discarded. Subsequently, annealing buffer (200 μ L) was injected into the chip and the flow through was discarded. The chips were vacuum dried from the chip outlet. Rinse solution (200 μ L, 60% annealing buffer, 40% IPA) was injected into the chip, followed by vacuum drying of the chip. Annealing buffer (200 μ L) was injected to fill the chip flow cell and the flow-through at the chip outlet was discarded. The chip is filled with annealing buffer until ready for amplification in a downstream amplification step.

Amplification of

First step amplification

For each chip being amplified, 1.1. mu.L of biotin-labeled primer A (100. mu.M) and 1. mu.L of blocking molecule (10 mg/mL neutravidin in buffer reconstituted) were combined in a tube and incubated on ice for >15 minutes.

To PGM from ION^TMTEMPLATE IA 500 kit contains components of the reaction for performing recombinase-polymerase amplification (e.g., recombinase, polymerase, single-stranded binding protein, nucleotides, buffers, and other components) in 1 × IA pellet (PN 100032944)Rehydration buffer (871 μ L) was added, solution 10 × was vortexed pulsed and spun rapidly to collect the tube contents during the process, rehydrated contents (called "bolus solution", approximately 900 μ L) were kept on ice.

For each Ion Torrent chip, 60 μ L of reconstituted IA pellet solution was slowly injected into the chip. The displaced annealing buffer was aspirated from the outlet. The chips were incubated with the reconstituted IA pellet solution for 4 minutes at RT.

For each chip being amplified, 90. mu.L of reconstituted IA pellet solution was transferred to a new tube. Previously prepared biotin-labeled primer A and neutravidin-terminated molecule (2.1. mu.L) were added and pulsed mixed. To the tube of the reconstituted IA pellet solution was added a solution containing 28mM Mg (OAc)₂Starting solutions (30 μ L) of aqueous solution, 10mM Tris acetate and 3.75% (V/V) methylcellulose, pulsed vortex 10 ×, and spun rapidly to form a total volume of 120 μ L of activated amplification solution for each chip 60 μ L of activated amplification solution was slowly injected into the chip.

Short reaction termination and cleaning between amplification steps

The amplified chip is removed from the hot plate or thermal cycler. 200 μ L of 0.5MEDTApH 8(VWR E522-100ML) was injected into the chip while the outlet was vacuum aspirated, and then the chip was vacuum aspirated to dryness. 200 μ L of 1 × AB was injected into the chip while the outlet was vacuum-aspirated, followed by aspiration of the chip to dryness. The AB addition was repeated two additional times and the chip was filled for step 2 amplification. (evacuate AB twice and leave the third AB addition on the chip.)

Second step amplification (without capping agent)

For each chip, 60 μ L of reconstituted bolus solution was injected into the chip slowly. The displaced annealing buffer was aspirated from the outlet. The chip was incubated with the pellet solution for 4 minutes at RT.

For each chip being prepared, 90 μ L of the reconstituted pellet solution was transferred to a fresh tube. Biotin-labeled primer A (1.1. mu.L, 100. mu.M) was added, and the tube was vortexed and spun.

The starting solution (30 μ L) was added to the tube containing the reconstituted bolus solution and primer a, and pulsed vortexed 10 x and spun rapidly to generate an activated amplification solution. Approximately 60 μ L of activated amplification solution was injected into the chip. The displaced fluid is aspirated from both ports. An additional 25. mu.L of residual amplification solution was added to each port. The chip was placed on a hot plate (thermal cycler) set at 40 ℃. The chip is covered with a pipette tip cap or similar and incubated for 20 minutes.

Reaction termination and cleaning

The chip that has been subjected to the amplification reaction is placed near a hood equipped with a vacuum. While the outlet was being vacuumed, 200 μ L of 0.5M EDTA pH 8 was added and the chip was aspirated to dry the chip. While the outlet was being vacuumed, 200 μ L of 1 × AB was added, and then aspirated to dry the chip. While the outlet was being vacuumed, 200. mu.L of water (AmbionP AM9822) containing a 1% SDS solution was added, and then aspirated to dry the chip. The SDS wash was repeated. While the outlet was being vacuumed, 200. mu.L of formamide was added. The chip was incubated at 50 ℃ for 3 minutes, followed by aspiration to dry the chip. While the outlet was being vacuumed, 200. mu.L of a rinse (50% IPA/50% AB) solution was added. The chips were aspirated to dryness. While the outlet was being vacuumed, 200. mu.L of annealing buffer was added. The chip was left in 1 × AB until ready to prime.

On-chip sequencing primer hybridization and enzymatic reactions

Tubes containing Ion sequencing primers (100. mu.M) were thawed. For each chip being sequenced, a primer mix of 40. mu.L annealing buffer and 40. mu.L sequencing primer was prepared and the wells vortexed. The chip was aspirated to dryness, and then 80. mu.L of primer mix (50. mu.L in flow cell, 15. mu.L in each port) was added to the chip. The chip was placed on a thermocycler and incubated at 50 ℃ for 2min and 20 ℃ for 5 min. 200 μ L of 1 × AB was injected while the outlet was vacuum-aspirated. Enzyme cocktail was prepared with 60 μ L annealing buffer and 6 μ L of sequencing enzyme (Ion PSP4 sequencing polymerase). The ports were cleaned and a vacuum was pulled from the inlet to dry the chips. The enzyme cocktail (60 μ L) was added to the chip and incubated for 5 minutes at RT. The chips were aspirated to dryness. AB (100. mu.L, 1X) was injected immediately to fill the chip. The ports were cleaned, the chip backside dried, and the chip was loaded onto an Ion Torrent Proton (thermo fisher Scientific) apparatus for sequencing library nucleic acids.

Example 7 comparison of sequencing results Using different nucleic acid manipulation methods

FIG. 10 shows the total available reads for a run set of nucleic acid sequencing runs of nucleic acid templates generated using four different amplification conditions (A-D in the figure). In method a, non-templated Ion Sphere Particles (ISP) were loaded into the microwells of an Ion Torrent 541 chip according to the method described in example 2 herein. Subsequently, after injecting the library amplicons into the chip, library molecules with adaptors complementary to the ISP primers (110bphg19 fragment library) were hybridized to the preloaded ISP by a single 95 ℃ 1min/37 ℃ 1min thermocycling step. Following library hybridization, amplification was performed using a single step RPA template amplification method essentially as described in example 2. The primers were not labeled with biotin. Method B employed two important variations over amplification protocol a: 1) an additional amplification step prior to template amplification ("first" amplification step); and 2) incorporating neutravidin and biotin-labeled solution primers in the added first amplification step. In this example, the first amplification step, which is isothermal RPA amplification, is 2.5 minutes and contains equivalent concentrations of biotin-labeled solution primers and neutravidin. The second amplification step was 15 minutes and contained no neutravidin. In this method, a first amplification step is used to locally amplify the template copy while adding a drag (drags) (via neutravidin) to limit the pore-2-pore diffusion of nascent strands. After 2.5 minutes, enough local copies were generated that no further component dragging was required. Subsequently, a second amplification step was performed as described in example 2. In methods C and D, a 220bp hg19 Ampliseq exome library was used. Method C was improved over method B by replacing the library hybridization method in methods a and B with a solution-based preamplification ISP enrichment method as described in example 6 herein. Thus, instead of performing all steps in the wells, the first step of library hybridization to ISP is done in solution, followed by the addition of magnetic beads to the tubes, enrichment of the ISP with template, and then separation from the magnetic beads and loading into the wells for 2-step amplification as done in method B. The pre-amplification enrichment method enables the loading of ISPs with a single copy of the library template. Finally, amplification method D, which was performed according to method C, employed modified ISP primer sequences compared to method C. The modified primer AV4 has the following sequence: ATTCGAGCTGTTCATCTGTATCTTGCGCTACCAA (SEQ ID NO: 7). As shown in FIG. 10, the improved combination resulting from methods A-D enables total reads equivalent to sequencing of template nucleic acids amplified by emulsion PCR.

The disclosed embodiments, examples, and experiments are not intended to limit the scope of the present disclosure or to indicate that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental error and deviation should be accounted for. It is understood that changes may be made to the methods described without changing the basic aspects that the experiments are intended to illustrate.

It should be noted that not all of the activities described above in the general description or the examples are required, that a portion of a specific activity may not be required, and that one or more other activities may be performed in addition to those described. Still further, the order in which activities are listed is not necessarily the order in which the activities are performed. Many modifications and other embodiments may be devised by those skilled in the art which fall within the scope and spirit of the present disclosure. Indeed, the skilled artisan can vary the materials, methods, figures, experiments, examples, and embodiments described without altering the basic aspects of the disclosure. Any of the disclosed embodiments can be used in combination with any other disclosed embodiment. When multiple low values and multiple high values are given for a range, those skilled in the art will recognize that the selected range will include lower values less than the high values. All headings in this specification are for convenience of reading and are not limiting. In the foregoing specification, the concepts have been described with reference to specific embodiments. However, one of ordinary skill in the art appreciates that various modifications and changes can be made without departing from the scope of the present invention as set forth in the claims below. Accordingly, the specification and figures are to be regarded in an illustrative rather than a restrictive sense, and all such modifications are intended to be included within the scope of present invention. Benefits, other advantages, and solutions to problems have been described above with regard to specific embodiments. However, the benefits, advantages, solutions to problems, and any feature(s) that may cause any benefit, advantage, or solution to occur or become more pronounced are not to be construed as a critical, required, or essential feature or feature of any or all the claims. After reading this specification, skilled artisans will appreciate that certain features are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination. Further, references to values stated in ranges include each and every value within that range.