Methods and compositions for activating tumor cytotoxicity by human gamma-delta T cells
阅读说明：本技术 由人γ-δ T细胞激活肿瘤细胞毒性的方法和组合物 (Methods and compositions for activating tumor cytotoxicity by human gamma-delta T cells ) 是由 C·D·鲍扎 T·劳森 李海山 刘美龄 肖玲芝 于 2018-06-15 设计创作，主要内容包括：当前公开总体上涉及用于活化γ-δ(GD)T细胞的方法和组合物。所述方法和组合物可用于治疗癌症。(The present disclosure generally relates to methods and compositions for activating gamma-delta (GD) T cells. The methods and compositions are useful for treating cancer.)
1. a viral vector comprising first and second encoding genetic elements, said first encoding genetic element comprising at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and said second encoding genetic element comprising one of a member of the cremophil family, a cytokine or a chemokine.
2. The viral vector of claim 1, further comprising a third encoded genetic element comprising one of a member of the cremophil family, a cytokine, or a chemokine.
3. The viral vector of claim 2, further comprising a fourth encoding genetic element comprising one of a member of the cremophil family, a cytokine, or a chemokine.
4. The viral vector of claim 1, wherein the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentenyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase).
5. The viral vector of claim 1, wherein the first coding genetic element comprises a microRNA or shRNA.
6. The viral vector of claim 5, wherein said microRNA comprises a sequence that is at least 80% or at least 85% or at least 90% or at least 95% identical to:
a)
AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 68); or
b)
AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT(SEQ ID NO:69)。
7. The viral vector of claim 6, wherein the microRNA comprises:
a)
AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 68); or
b)
AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT(SEQ ID NO:69)。
8. The viral vector according to claim 5, wherein said shRNA comprises a sequence that is at least 80% or at least 85% or at least 90% or at least 95% identical to:
a)
GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT(SEQ ID NO:1)；
b)
GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT(SEQ ID NO:2)；
c)
GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT(SEQ ID NO:3)；
d)
GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT(SEQ ID NO:4)；
e)
ACTTTCTCAGCCTCCTTCTGCCTCGAGGCAGAAGGAGGCTGAGAAAGTTTTTT(SEQ ID NO:64)；
f)GCAGAAGGAGGCTGAGAAAGTGAGCTCACTTTCTCAGCCTCCTTCTG(SEQ ID NO:65)；
g) GCAGAAGGAGGCTGAGAAAGTTTACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 66); or
h)GCAGAAGGAGGCTGAGAAAGTACTTTCTCAGCCTCCTTCTGCTTTTT(SEQ ID NO:67)。
9. The viral vector of claim 8, wherein the shRNA comprises:
a)
GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT(SEQ ID NO:1)；
b)
GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT(SEQ ID NO:2)；
c)
GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT(SEQ ID NO:3)；
d)
GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT(SEQ ID NO:4)；
e)
ACTTTCTCAGCCTCCTTCTGCCTCGAGGCAGAAGGAGGCTGAGAAAGTTTTTT(SEQ ID NO:64)；
f)GCAGAAGGAGGCTGAGAAAGTGAGCTCACTTTCTCAGCCTCCTTCTG(SEQ ID NO:65)；
g) GCAGAAGGAGGCTGAGAAAGTTTACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 66); or
h)GCAGAAGGAGGCTGAGAAAGTACTTTCTCAGCCTCCTTCTGCTTTTT(SEQ ID NO:67)。
10. The viral vector of claim 1, wherein the member of the cremophilic protein family comprises BTN3A3, BTN3A2 or BTN3A 1.
11. The viral vector of claim 1, wherein said member of the cremophilic protein family comprises BTN3A3 (R381H).
12. The viral vector of claim 1, wherein the cytokine comprises IL-1, IL-1 β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, TNF- α, or interferon- γ.
13. The viral vector of claim 1, wherein said chemokine comprises a CC chemokine, a CXC chemokine, a CX3C chemokine, a C chemokine, or an XC chemokine.
14. The viral vector of claim 13, wherein the CC chemokine comprises RANTES.
15. The viral vector of claim 1, which is a lentiviral vector.
16. A lentiviral vector system for expressing a lentiviral particle, the system comprising:
the lentiviral vector of claim 15;
at least one envelope plasmid for expressing an envelope protein that optimizes infection of a target cell; and
at least one helper plasmid for expressing gag, pol and rev genes,
wherein, when the lentiviral vector, the at least one envelope plasmid, and the at least one
Transfection of the helper plasmid into a packaging cell that produces the lentiviral particle,
wherein said lentiviral particle is capable of infecting said target cell and inhibiting said at least one enzyme involved in the mevalonate pathway in said target cell.
17. A lentiviral particle capable of infecting a target cell, the lentiviral particle comprising an envelope protein that optimizes infection of the target cell and the lentiviral vector of claim 15.
18. The lentiviral particle of claim 17, wherein the target cell is a cancer cell.
19. A method of activating γ δ (GD) T cells, the method comprising:
infecting the target cell with a lentiviral particle in the presence of the GD T cell or having infected the target cell with a lentiviral particle in the presence of the GD T cell,
wherein the lentiviral particle comprises a viral vector comprising first and second encoding genetic elements,
wherein the first encoding genetic element comprises at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway and the second encoding genetic element comprises one of a member of the lactotrophin family, a cytokine or a chemokine; and is
When the at least one enzyme is inhibited in the target cell, the target cell activates a GD T cell.
20. The method of claim 19, wherein the target cell is a cancer cell.
21. The method of claim 19, further comprising contacting the target cell and the GD T cell with or having contacted the target cell and the GD T cell with an amount of an aminobisphosphonate.
22. A method according to claim 21 wherein the aminobisphosphonate is zoledronic acid.
23. The method of claim 19 or claim 21, wherein the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentenyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase).
24. A method of treating cancer in a subject, said method comprising administering to said subject or having administered to said subject a therapeutically effective amount of a lentiviral particle comprising a viral vector, said vector comprising first and second encoded genetic elements, said first encoded genetic element comprising at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and said second encoded genetic element comprising one of a member of the lactophagin family, a cytokine or a chemokine; when the at least one enzyme is inhibited in the presence of GD T cells in cancer cells, the target cells activate the GD T cells, thereby treating the cancer.
25. A method according to claim 24 further comprising administering to said subject or having administered to said subject a therapeutically effective amount of an aminobisphosphonate.
26. A method according to claim 25 wherein the aminobisphosphonate is zoledronic acid.
27. The method of claim 24 or claim 25, wherein the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentenyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase).
28. The method of claim 24, wherein the member of the cremophilic protein family comprises BTN3A3 or BTN3A3 (R381H).
29. A viral vector comprising:
a first small RNA that targets a first target of the mevalonate pathway and is capable of increasing a first product of the mevalonate pathway; and
a second small RNA that targets a second target of the mevalonate pathway and is capable of reducing a second product of the mevalonate pathway.
30. The viral vector of claim 29, wherein the first target is a mevalonate pathway first enzyme and the second target is a mevalonate pathway second enzyme.
31. The viral vector of claim 30, wherein at least one of the first enzyme and the second enzyme comprises farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentenyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase).
32. The viral vector of claim 29, wherein the first mevalonate pathway product comprises isopentenyl pyrophosphate (IPP).
33. The viral vector of claim 29, wherein the second mevalonate pathway product comprises geranylgeranyl pyrophosphate (GGPP).
34. A method of treating cancer in a subject, the method comprising administering or having administered to the subject a therapeutically effective amount of a lentiviral particle comprising the viral vector of claim 29.
35. A method according to claim 34 further comprising administering to said subject or having administered to said subject a therapeutically effective amount of an aminobisphosphonate.
Technical Field
The present disclosure relates generally to the field of gene therapy and immunotherapy, and in particular to improving γ δ ("GD") T cell activation and its effector cell function.
Background
The major population, including CD4+ and CD8+ subpopulations, express receptors composed of α and β chains.the smaller subpopulation expresses T cell receptors formed by γ and δ chains.γ δ ("GD") T cells constitute 3-10% of circulating lymphocytes, the
Another subgroup of GD T cells,
In general, GD T cells have multiple functions, including killing tumor cells and cells infected with pathogens. Stimulation of cellular cytotoxicity, cytokine secretion and other effector functions by conduction through their unique T cell receptors ("TCRs") which are composed of two glycoprotein chains, γ and δ, which interact with the CD3 complex protein to form a functional TCR. The TCRs of GD T cells have unique specificity and these cells themselves appear with high clonal frequency, thus enabling the formation of rapid innate-like responses to tumors and pathogens.
Bisphosphonates and other inhibitors of farnesyl diphosphate synthase ("FDPS"), which are downstream of isopentenyl pyrophosphate ("IPP") in the mevalonate pathway (see, e.g., figure 1), have been used to treat a variety of diseases, including cancer, particularly those associated with bone metastases. Bisphosphonates include, for example
Some bisphosphonates have also been studied for stimulation of GD T cells, probably because FDPS inhibition in bone marrow cells or tumor cells prevents the conversion of IPP to farnesyl diphosphate, leading to IPP accumulation while reducing the level of geranylgeranyl pyrophosphate (GGPP), a downstream product of FDPS, generally inhibiting the activation of the NLRP3 inflammatory body pathway reduction of GGPP eliminates inhibitors of caspase-dependent inflammatory body pathways, allows for the secretion of cytokines, including interleukin-1 β and interleukin-18, the latter being particularly important for γ δ T cell activation.
Thus, when FDPS is blocked, IPP increase and GGPP decrease alter bone marrow cells or tumor cells, altered cells have an increased ability to activate GD T cells, especially the
An important problem with traditional cancer treatments is that patients become insensitive to chemotherapy. In particular, chemotherapy-resistant tumor cells become difficult to cope with. As an alternative therapy to the treatment of chemotherapy-resistant patients, or as a primary therapy to replace chemotherapy and/or radiotherapy, the present application proposes the use of recombinant lentiviruses to express genes at the tumor site, where manipulation of proteins that affect GD T cell activity can slow tumor growth and activate the patient's own innate immune response to recognize and eliminate cancer.
Summary of The Invention
Disclosed herein in one aspect is a viral vector comprising first and second encoding genetic elements. The first encoding genetic element comprises at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second encoding genetic element comprises one of a member of the cremophil family, a cytokine or a chemokine. In some embodiments, the viral vector further comprises a third encoding genetic element comprising one of a member of the cremophil family, a cytokine, or a chemokine. In some embodiments, the viral vector further comprises a fourth encoding genetic element comprising one of a member of the cremophil family, a cytokine, or a chemokine. In some embodiments, the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase). In some embodiments, the first coding genetic element comprises a microrna or shRNA.
In some embodiments, the microrna comprises a sequence that is at least 80% or at least 85% or at least 90% or at least 95% identical to: AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO:68), or AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 69).
In some embodiments, the microRNA comprises AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGAGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO:68), or AAGGTATATTGCTGTTGACAGTGAGCGACACTTTCTCAGCCTCCTTCTGCGTGAAGCCACAGATGGCAGAAGGGCTGAGAAAGTGCTGCCTACTGCCTCGGACTTCAAGGGGCT (SEQ ID NO: 69).
In some embodiments, the shRNA comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, or more than 95% identical to:
GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT(SEQ ID NO:1)；
GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT(SEQ ID NO:2)；
GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT(SEQ ID NO:3)；
GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 4). In some embodiments, the shRNA comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, or more than 95% identical to: 64, 65, 66, 67, 70, 71, 72 or 76.
In some embodiments, the shRNA comprises:
GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT(SEQ ID NO:1)；
GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT(SEQ ID NO:2)；
GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or
GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT (SEQ ID NO: 4). In some embodiments, the shRNA comprises: 64, 65, 66, 67, 70, 71, 72 or 76.
In some embodiments, the member of the lactoferrin family comprises BTN3A3, BTN3a2, or BTN3a1, or a variant thereof, in some embodiments, the member of the lactoferrin family comprises BTN3A3(R381H), in some embodiments, the cytokine comprises IL-1, IL-1 β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, TNF- α, or interferon- γ.
In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system includes a lentiviral vector described in detail herein; at least one envelope plasmid for expressing an envelope protein that optimizes infection of a target cell; and at least one helper plasmid for expressing gag, pol and rev genes; wherein, when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, the packaging cell produces lentiviral particles, wherein the lentiviral particles are capable of infecting a target cell and inhibiting at least one enzyme involved in the mevalonate pathway in the target cell.
Another aspect discloses a lentiviral particle capable of infecting a target cell. The lentiviral particles comprise an envelope protein that optimizes infection of a target cell and a lentiviral vector as described herein. In some embodiments, the target cell is a cancer cell.
Another aspect discloses a method of activating γ δ (GD) T cells. The method comprises infecting or has been infected with a lentiviral particle in the presence of a GD T cell, the lentiviral particle comprising a viral vector, the vector comprising first and second encoding genetic elements, the first encoding genetic element comprising at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second encoding genetic element comprising one of a member of the cremophil family, a cytokine or a chemokine; when the at least one enzyme is inhibited in the target cell, the target cell activates a GD T cell. In some embodiments, the target cell is a cancer cell. In some embodiments, the method further comprises contacting the target cell and the GD T cell with or has contacted the target cell and the GD T cell with an amount of an aminobisphosphonate. In some embodiments, the aminobisphosphonate is zoledronic acid. In some embodiments, the at least one enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentenyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase).
In another aspect, a method of treating cancer in a subject is disclosed. The method comprises administering to the subject or having administered to the subject a therapeutically effective amount of a lentiviral particle comprising a viral vector, the vector comprising first and second encoding genetic elements, the first encoding genetic element comprising at least one small RNA capable of inhibiting the production of at least one enzyme involved in the mevalonate pathway, and the second encoding genetic element comprising one of a member of the cremophilic family of proteins, a cytokine or a chemokine; when the at least one enzyme is inhibited in the presence of GD T cells in the cancer cells, the target cells activate the GD T cells, thereby treating the cancer. In some embodiments, the method further comprises contacting the target cell and the GDT cell with or has contacted the target cell and the GD T cell with an amount of an aminobisphosphonate. In some embodiments, the aminobisphosphonate is zoledronic acid. In some embodiments, the member of the cremophilic protein family comprises BTN3A3(SEQ ID NO:17) or BTN3A3(R381H) (SEQ ID NO: 54). In other embodiments, the cytokine comprises IL-1, IL-2, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36.
In another aspect, viral vectors are disclosed. The viral vector comprises a first small RNA that targets a first target of the mevalonate pathway and is capable of increasing a first product of the mevalonate pathway, and a second small RNA that targets a second target of the mevalonate pathway and is capable of decreasing a second product of the mevalonate pathway. In some embodiments, the first target is a mevalonate pathway first enzyme and the second target is a mevalonate pathway second enzyme. In some embodiments, at least one of the first enzyme and the second enzyme is farnesyl diphosphate synthase (FDPS), geranylgeranyl diphosphate synthase 1(GGPS1), isopentenyl diphosphate delta-isomerase 1(IDI1), or farnesyl transferase (F-Tase). In some embodiments, the first product of the mevalonate pathway comprises isopentenyl pyrophosphate (IPP). In some embodiments, the second product of the mevalonate pathway comprises isogeranylgeranyl pyrophosphate (GGPP).
In another aspect, a method of treating cancer in a subject is disclosed. The method comprises administering to the subject or having administered to the subject a therapeutically effective amount of a lentiviral particle comprising a viral vector as described herein. In some embodiments, the method further comprises administering to the subject or having administered to the subject a therapeutically effective amount of an aminobisphosphonate.
Brief Description of Drawings
FIG. 1 shows an outline of the major steps in the mevalonate pathway for the biosynthesis of steroids and isoprenoids.
FIG. 2 shows an example of a 3-vector lentiviral vector system in circularized form.
FIG. 3 shows an example of a 4-vector lentiviral vector system in circularized form.
FIG. 4 shows linear profiles of various lentiviral vectors, each expressing a combination of FDPS shRNA targeting sequence with BTN3A3 and/or IL-2, IL-15 and IL-18.
FACS data in figure 5 show activation of V δ 2+ T cells by PC3 prostate cancer cells containing lentiviruses expressing BTN3A3(R381H) or BTN3A3(WT) as described herein.
FACS data in fig. 6 show activation of V δ 2+ T cells by HepG2 cells containing lentiviruses expressing BTN3A3(R381H) or BTN3A3(R381H) and
The FACS data in fig. 7 shows activation of V δ 2+ T cells by PC3 prostate cancer cells containing lentiviruses expressing BTN3A3(R381H) or BTN3A3(R381H) and
The FACS data in FIG. 8 show the activation of V.delta.2 + T cells by lentivirus-containing HepG2 cells, in which the lentivirus expresses shFDPS-IL-2, as described herein.
The FACS data in fig. 9 shows activation of V δ 2+ T cells by PC3 cells containing lentivirus expressing shFDPS-IL-2, as described herein.
The FACS data in fig. 10 shows activation of V δ 2+ T cells by PC3 cells containing lentivirus expressing shFDPS-IL-15 as described herein.
The data in fig. 11 show extracellular expression of BTN3A3 by lentiviral-containing PC3 cells and HepG2 cells, wherein the lentiviruses expressed BTN3A3(R381H) or BTN3A3(R381H) and shFDPS.
The FACS data in fig. 12 show the activation of V δ 2+ T cells by lentivirus transduced HepG2 cells, in which the lentivirus expressed Lv-shFDPS, as described herein.
The data in figure 13 show reduced tumor growth in mice injected with lentivirus transduced PC3 cells, in which the lentivirus expressed Lv-shFDPS, as described herein.
The data in figure 14 show the survival of mice injected with Lv-shFDPS expressing lentivirus and then treated with PBMC and/or zoledronic acid.
The data in fig. 15 show the tumor volumes of mice injected with Lv-shFDPS expressing lentivirus and then treated with PBMC and/or zoledronic acid.
Figure 16 shows the general appearance of PBMC-treated and PBMC-untreated Lv-shFDPS PC3 xenografts.
FIG. 17 shows lentiviral vectors containing the H1 promoter and synthetic shRNA sequences targeting FDPS, GGPS1 or IDI1, and lentiviral vectors containing the
The data in fig. 18 show reduced intracellular FDPS protein expression in HepG2 cells transduced with lentiviruses expressing shFDPS #1(SEQ ID NO:1) or shFDPS #4(SEQ ID NO:4) and treated with or without zoledronic acid, as described herein.
The datA in FIGS. 19A and 19B show A reduction in FDPS RNA (FIG. 19A) and protein expression (FIG. 19B) in PC3 cells transduced with lentiviruses expressing shFDPS-A (SEQ ID NO:64), shFDPS-R (SEQ ID NO:65), shFDPS-TT (SEQ ID NO:66) and shFDPS-L (SEQ ID NO:67) as described herein.
FIG. 20 shows reduced expression of FDPS protein in lentivirus-transduced HepG2 cells, which expressed shFDPS-4(SEQ ID NO:4), miR30-FDPS-1(SEQ ID NO:68), and miR30-FDPS-3(SEQ ID NO:69), as described herein.
The FACS data in FIG. 21 show the activation of V.delta.2 + T cells by THP-1 cells transduced with or without zoledronic acid by lentiviruses expressing miR30-FDPS #1(SEQ ID NO:68) as described herein.
FIG. 22 shows reduced GGPS1 protein expression in lentivirus-transduced HeLa cells expressing shGGPS1#1(SEQ ID NO:70), shGGPS1#2(SEQ ID NO:71) and shGGPS1#3(SEQ ID NO:73) as described herein.
The FACS data in fig. 23 show the activation of V δ 2+ T cells by PC3 cells transduced with lentiviruses expressing shFDPS sequence #4(SEQ ID NO:4) or shGGPS1 sequence #1(SEQ ID NO:70) and treated with or without zoledronic acid, as described herein.
The FACS data in fig. 24 show the activation of V δ 2+ T cells by HepG2 cells transduced with lentiviruses expressing shFDPS sequence #4(SEQ ID NO:4) or shGGPS1 sequence #1(SEQ ID NO:70) and treated with or without zoledronic acid, as described herein.
The FACS data in fig. 25 show the activation of V δ 2+ T cells by THP-1 cells transduced with lentiviruses expressing shFDPS sequence #4(SEQ ID NO:4) and/or shGGPS1 sequence #1(SEQ ID NO:70) and treated with or without zoledronic acid, as described herein.
FIG. 26 shows reduced expression of IDI1 protein in lentivirus-transduced PC3 cells, in which the lentivirus expresses shIDI1(SEQ ID NO:76), as described herein.
The FACS data in FIG. 27 show the activation of V.delta.2 + T cells by lentivirus-transduced PC3 cells expressing shFDPS sequence #4(SEQ ID NO:4) or shIDI1 sequence #1(SEQ ID NO:76) as described herein.
The data in fig. 28 shows the activation of V δ 2+ T cells by THP-1 cells treated with zoledronic acid, FTI277, or salagoxic acid (zaragozic acid), as described herein.
The FACS data in FIG. 29 show the activation of V.delta.2 + T cells by PC3 cells transduced with lentiviruses expressing shFDPS sequence #4(SEQ ID NO:4) and treated with zoledronic acid, FTI277 or salagosic acid, as described herein.
The FACS data in FIG. 30 show the activation of V.delta.2 + T cells by HepG2 cells transduced with lentivirus expressing shFDPS sequence #4(SEQ ID NO:4) and treated with zoledronic acid, FTI277 or salagosamic acid, as described herein.
Detailed Description
SUMMARY
This document relates to gene therapy constructs and their delivery to cells that result in the inhibition of farnesyl diphosphate synthase ("FDPS") or other enzymes in the mevalonate pathway that are necessary for the conversion of isopentenyl phosphate (IPP) to Farnesyl Diphosphate (FDP) and other downstream products of the mevalonate pathway, as shown, for example, in fig. 1, in some embodiments, one or more viral vectors are provided with micrornas or short hairpin RNAs (shrnas) that target one or more of FDPS, GGPS1, IDI1, F-Tase, or squalene synthase, thereby reducing the expression levels of these enzymes.
Definition and interpretation
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Furthermore, unless otherwise indicated, singular terms include the plural and plural terms include the singular. Generally, the nomenclature and techniques used herein for cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization are those well known and commonly employed in the art. Unless otherwise indicated, the methods and techniques of the present invention generally follow conventional methods as are well known in the art and as described in various general and special references, which are variously cited and referred to herein throughout. See, for example: sambrook j. and Russell d. "molecular cloning: a Laboratory Manual, third edition, Cold spring harbor Laboratory Press, Cold spring harbor, N.Y. (2000); and Ausubel et al, eds. guide for cell biology experiments: current Protocols in Molecular Biology Protocols Short for protocol (A Complex of Methods from Current Protocols in Molecular Biology), Wiley, John & Sons, Inc. (2002); harlow and Lane, use of antibodies: a Laboratory Manual (use Antibodies: A Laboratory Manual); cold spring harbor laboratory Press, Cold spring harbor, N.Y. (1998); and Coligan et al, eds. (Shortprotocols in Protein Science), Wiley, John & Sons, Inc. (2003). Various enzymatic reactions or purification techniques are performed as routinely practiced in the art or as described herein, according to the manufacturer's instructions. The nomenclature used in analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry, and laboratory procedures and techniques described herein are those well known and commonly employed in the art.
As used in the specification and the appended claims, the singular forms "a," "an," and "the" are used interchangeably and include the plural forms and are intended to have each meaning unless the context clearly dictates otherwise. Herein, "and/or" means and encompasses any and all possible and combined deletions of one or more of the listed items as interpreted or otherwise ("or").
All numerical values specified, such as pH, temperature, time, concentration and molecular weight, including ranges, encompass approximations that vary by (+) or (-) 0.1. It should be understood that all numerical values given are preceded by the term "about," although not all are explicitly stated. "about" includes the exact value of "X" in addition to minor changes in "X" such as "X + 0.1" or "X-0.1". It is also to be understood that the reagents described herein, although not all explicitly shown, are exemplary only and that equivalents are known in the art.
As used herein, "about" is understood by one of ordinary skill in the art and will vary to some extent depending on the context in which it is used. If the meaning of the word in connection with the context in which it is used is still unclear to a person of ordinary skill in the art, "about" means up to plus or minus 10% of a particular item.
As used herein, "administration" or "administering" refers to administering an active agent to a subject in need of treatment in a form that can be introduced into the body of the subject in a therapeutically useful form and in a therapeutically effective amount.
Herein, "cremophilic protein 3A" is also referred to as "BTN 3A". In addition, "
As used herein, "CA 19-9" refers to carbohydrate antigen 19-9. As used herein, "CC chemokines" refer to a class of chemokine proteins characterized by two adjacent cysteines near their amino termini. "CXC chemokines" refer to a class of chemokine proteins characterized by two cysteines separated by one amino acid near their amino termini. The "CX 3C chemokine" refers to a class of chemokine proteins characterized by two cysteines separated by three amino acids near their amino termini. "XC chemokines" refer to a class of chemokine proteins characterized by a cysteine adjacent to an amino acid near its amino terminus.
Herein, "CD" refers to clusterin. Examples of such proteins include, but are not limited to, CD4 and
As used herein, "CEA" refers to carcinoembryonic antigen.
As used herein, "bisphosphonate" and "bisphosphonate drug" refer to therapeutic agents of various embodiments, including optionally one of an amino bisphosphonate, a bisphosphonate, and a diphosphonic acid, and pharmaceutically acceptable salts and derivatives thereof. The use of any particular bisphosphonate or ester name is not intended to limit the scope of the invention unless otherwise indicated.
As used herein, "co-administration" or "combination therapy" or the like means administration of a therapeutic vector or lentiviral particle and a bisphosphonate or any combination of these to a single subject (i.e., patient) in need thereof, and is intended to encompass treatment regimens in which the drugs need not be administered by the same route of administration and/or at the same time.
As used herein, "fixed combination" refers to two or more active ingredients or components (including various respective compositions, formulations or pharmaceutical forms thereof, such as a therapeutic carrier or lentiviral agent or any combination thereof) administered to a patient in combination (e.g., substantially simultaneously, in a single entity or dose or in a combined entity or dosage form (e.g., in the form of a tablet or capsule or a combination of multiple tablets or capsules or a combination of multiple liquids)).
As used herein, an "unfixed combination" refers to two or more active ingredients or components (including various respective compositions, formulations or pharmaceutical forms thereof, such as a therapeutic carrier or lentiviral particle and a bisphosphonate or any combination thereof) that are administered to a patient as separate entities, simultaneously (simultaneously), concurrently (concurrently) or in combination, sequentially but without specific time constraints, such that administration provides a therapeutically effective level of the active ingredients in the patient. The non-fixed combinations may be administered separately from each other or using different fixed combinations, e.g. simultaneously or at different time points. The active ingredients can be administered as separate pharmaceutical dosage forms or pharmaceutical preparations which can, for example, be sold separately from one another, with or without labeling on the possibility of combined use. Such instructions may be provided in a packaging device such as an insert or in other information, such as to a physician or medical professional. The non-fixed combinations, their respective active ingredients or components, including any composition, formulation or pharmaceutical form of their respective, or parts thereof, may be administered simultaneously or staggered in time, e.g. at different time points and with equal or different time intervals for any part of the administration. The time intervals may be chosen such that the combination therapy is more effective than either active ingredient alone in respect of the effect on the treated disease.
Herein, "combination", "in combination" and "combination therapy" refer generally to the definitions and embodiments of "fixed combination" or "non-fixed combination" or both as described hereinbefore.
As used herein, the transitional word "comprising" when used in defining compositions and methods means that the compositions and methods include the recited elements, but also does not exclude other elements. Herein, "consisting essentially of … …," when used to define compositions and methods, means that the compositions and methods include other elements, but only if those other elements do not materially affect the basic and novel characteristics of the compositions or methods. Herein, "consisting of … …" when used to define compositions and methods means that the compositions and methods do not include any more than trace amounts of other constituent elements and elements other than the main method steps with respect to the composition. Embodiments defined by these transitional words are intended to be within the scope of this disclosure. For example, it should be understood that: the methods and compositions may include other steps and components (including) or alternatively include insignificant steps and compositions (consisting essentially of.) or include only the listed method steps or compositions (consisting of.. once.).
Herein, "expression", "expressing" or "encoding" refers to the process of transcription of a polynucleotide into mRNA and/or the process of subsequent translation of the transcribed mRNA into a peptide, polypeptide or protein. Expression may include mRNA splicing or other forms of post-transcriptional or post-translational modification in eukaryotic cells.
As used herein, "farnesyl diphosphate synthase" is also known as FDPS, and is also known as farnesyl pyrophosphate synthase or FPPS.
Herein, "gamma delta T cells" are also referred to as "γ δ T cells," V γ 9V δ 2T cells, V gamma 9V delta 2T cells, V γ 2V δ 2T cells, V gamma 2V delta 2T cells, or as GD T cells. "γ δ T cell activation" refers to any measurable biological phenomenon associated with γ δ T cells that represents such T cells being activated. Non-limiting examples of such biological phenomena include increased cytokine production, changes in cell surface protein composition or quantity, increased T cell proliferation, and/or increased T cell effector function (e.g., killing of target cells or assisting other effector cells in killing of target cells).
As used herein, "F-Tase" refers to farnesyl transferase.
As used herein, "GGPP" refers to geranylgeranyl pyrophosphate, also known as geranylgeranyl diphosphate.
Herein, "GGDPS", "GGPPS", "
As used herein, "HER-2" refers to human epidermal
Cytokines such as "
Herein, "
As used herein, "IFN" refers to interferon, and the terms IFN-gamma and IFN-gamma refer to interferon-gamma.
As used herein, "individual," "subject," and "patient" are used interchangeably to refer to a variety of individual mammalian subjects, such as bovine, canine, feline, equine, and/or human.
Herein, "IPP" refers to isopentenyl pyrophosphate.
As used herein, "M2-PK" refers to the pyruvate kinase isozyme of M2 type.
Herein, "MHC" refers to the major histocompatibility complex.
Herein, "miRNA" refers to microrna, also known as "miR".
Herein, "NK cell" or "NK receptor family" refers to "natural killer cell" or "natural killer cell receptor family", respectively.
Herein, "packaging cell line" refers to any cell line that can be used to express lentiviral particles.
Herein, "PBMC" refers to peripheral blood mononuclear cells.
As used herein, "homology" refers to the percentage of amino acids, nucleic acids, or analogs thereof that are identical or constitute conservative substitutions. Homology can be determined using sequence comparison programs such as GAP (Devereux et al, 1984,
As used herein, "sequence identity," which may also be present in a non-limiting list of exemplary "50% identical sequences" and "at least 80% or at least 85% or at least 90% or at least 95% identical" analogs, refers to the degree of nucleotide-by-nucleotide or amino acid-by-amino acid identity of the sequences over the comparison window. Thus, "percent sequence identity" can be calculated as follows: the two optimally aligned sequences are compared over a comparison window, and the number of positions at which the same nucleic acid base (e.g., A, T, C, G, I) or the same amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys, and Met) occurs in both sequences is determined to give the number of matching positions, which is divided by the total number of positions in the comparison window (i.e., the window size), and the result is multiplied by 100 to give the percent sequence identity. Optimal alignment of sequences for alignment with the alignment window can be performed by computer-run algorithms (GAP, BESTFIT, FASTA and TFASTA in version 7.0 of the Wisconsin genetic software package, genetics computer group, Science Drive 575, Madison, Wis., USA) or by inspection and various selected methods to produce the best alignment (i.e., the highest percentage of homology obtained in the comparison window). Reference may also be made to the BLAST program family, for example as described in Altschul et al, Nucl. acids Res.25:3389,1997.
As used herein, "percent identity," with respect to two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as determined by one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those skilled in the art), or by visual inspection. "percent identity" can exist over a region of the sequences being compared, such as a functional domain, or over the entire length of the two sequences being compared, depending on the application. For sequence comparison, one sequence is typically used as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence relative to the reference sequence based on the specified program parameters.
Optimal alignment of sequences for comparison can be performed, for example, using the local homology algorithm of Smith & Waterman, adv.Appl.Math.2:482(1981), the homology alignment algorithm of Needleman & Wunsch, J.mol.biol.48:443(1970), the similarity search method of Pearson & Lipman, Proc.Nat' l.Acad.Sci.USA 85:2444(1988), the computer run using these algorithms (GAP, BESTFIT, FASTA and TFASTA in Wisconsin genetic software package version 7.0 (genetic computer group, Madison Science Drive 575, Wis.A.)) or by visual inspection (see Aubesul et al, supra, generally).
Suitable algorithms for determining percent sequence identity include the BLAST algorithm, described in Altschul et al, J.mol.biol.215: 403-. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information.
The percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available from http:// www.gcg.com) using the NWSgapdna. CMP matrix and GAP weights of 40, 50, 60, 70 or 80 and length weights of 1,2, 3,4, 5 or 6. The percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E.Meyers and W.Miller (CABIOS,4:11-17(1989)), which has been integrated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. Furthermore, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J.mol.biol. (48):444-453(1970)) algorithm, which has been integrated into the GAP program of the GCG software package (available from http:// www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, with GAP weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1,2, 3,4, 5, or 6.
Nucleic acid and protein sequences herein may also be used as "query sequences" to search public databases, for example, to thereby identify related sequences. Such a search can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al (1990) J.mol.biol.215: 403-10. A BLAST nucleotide search (score 100, word length 12) can be performed using the NBLAST program to obtain nucleotide sequences homologous to the nucleic acid molecules herein. BLAST protein searches (score 50, word length 3) can be performed using the XBLAST program to obtain amino acid sequences homologous to the protein molecules herein. To obtain gap alignments for comparison purposes, a gap BLAST as described in Altschul et al Nucleic Acids Res.25(17):3389-3402(1997) can be used. When BLAST and gapped BLAST programs are used, the default parameters for each program (e.g., XBLAST and NBLAST) can be used. See http:// www.ncbi.nlm.nih.gov.
As used herein, "pharmaceutically acceptable" refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of humans and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
As used herein, "pharmaceutically acceptable carrier" means and includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, which are physiologically compatible. Compositions may include pharmaceutically acceptable salts, such as acid addition salts or base addition salts (see, e.g., Berge et al J Pharm Sci 66:1-19) (1977).
Herein, "pharmaceutically acceptable salt" refers to a derivative of a compound or other active ingredient, wherein the parent compound or active ingredient is modified by converting its existing acid or base moiety into its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to: inorganic or organic acid salts of basic residues (e.g., amines); alkali metal or organic salts of acidic residues (e.g., carboxylic acids); alkali metal, alkaline earth metal, ammonium and mono-, di-, tri-or tetra-C1-C30 alkyl substituted ammonium; and so on. Pharmaceutically acceptable salts of the various embodiments include conventional non-toxic salts of the compounds or active ingredients, such as those formed from non-toxic inorganic or organic acids. Suitable organic acids are, for example, carboxylic acids or sulfonic acids, such as acetic acid, succinic acid, fumaric acid or methanesulfonic acid. The pharmaceutically acceptable salts herein can be synthesized from the parent compound or active ingredient containing a basic or acidic moiety by conventional chemical methods. In general, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent, or a mixture of the two; generally, nonaqueous media such as diethyl ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred. The list of suitable salts is found in Remington's Pharmaceutical sciences, 17 th edition, Mark Press, Inc. (Mack Publishing Company, Easton, Pa.),1985, p. 1418 and Journal of Pharmaceutical Science,66,2(1977), of Iston, Pa., all incorporated herein by reference in their entirety.
Herein, "PSA" refers to prostate specific antigen.
Herein, "RANTES" is synonymous with chemokine (C-C motif)
Herein, "SEQ ID NO" is synonymous with "sequence ID No.".
As used herein, "small RNA" refers to non-coding RNA, typically about 200 nucleotides or less in length, and having silencing or interfering functions. In some embodiments, the small RNA is about 175 nucleotides or less in length, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less. Such RNAs include microRNAs (miRNAs), small interfering RNAs (siRNAs), double-stranded RNAs (dsRNA), and short hairpin RNAs (shRNAs). In some embodiments, a "small RNA" is capable of inhibiting or knocking down gene expression of a target gene, typically through a pathway that results in the inhibition or destruction of the target gene mRNA.
Herein, "TCR" refers to the T cell receptor, and "TCRs" are in their plural form.
As used herein, a "therapeutically effective amount" refers to an amount of an active agent herein that is sufficient, in a suitable composition, in a suitable dosage form, to treat or avoid the occurrence of symptoms, progression, or complications seen in a patient of a given abnormality, injury, disease, or disorder. The therapeutically effective amount will depend on the condition of the patient or its severity, as well as the age, weight, etc. of the subject being treated. The therapeutically effective amount may vary depending on various factors including, for example, the route of administration, the condition of the subject, and other factors understood by those skilled in the art.
Herein, "therapeutic vector" includes, but is not limited to, reference to lentiviral vectors and lentiviral plasmids such as those mentioned in figures 2 and 3 herein.
As used herein, "TNF" refers to tumor necrosis factor, and TNF-alpha or TNF- α refers to tumor necrosis factor-alpha.
Herein, "therapy" and "treatment" refer to targeting and attacking a disease state as intended, i.e., ameliorating or avoiding the disease state. Thus, the specific therapy will depend on the disease state to be targeted and the state of current or future drug treatments and treatment methods. Treatment may have associated toxicity.
As used herein, "therapy" or "treatment" generally refers to intervention in an attempt to alter the natural course of the subject being treated, and may be used prophylactically or during clinical pathology. Desirable effects include, but are not limited to, avoiding the occurrence or recurrence of a disease, alleviating symptoms, suppressing, reducing or inhibiting various direct or indirect pathological consequences of a disease, ameliorating or calming a disease state, and causing remission or improving prognosis.
As used herein, "VSVG" or "VSV-G" refers to the vesicular stomatitis virus G envelope glycoprotein.
Description of various aspects herein
Disclosed herein in one aspect is a viral vector comprising first and second encoding genetic elements. The first encoding genetic element comprises a small RNA capable of inhibiting the production of an enzyme involved in the mevalonate pathway, and the second encoding genetic element comprises one of a member of the cremophil family, a cytokine or a chemokine. In some embodiments, the viral vector further comprises a third encoding genetic element comprising one of a member of the cremophil family, a cytokine, or a chemokine. In some embodiments, the viral vector further comprises a fourth encoding genetic element comprising one of a member of the cremophil family, a cytokine, or a chemokine. In some embodiments, the enzyme is farnesyl diphosphate synthase (FDPS) or a functional variant thereof. In some embodiments, the first coding genetic element comprises a microrna or shRNA. In some embodiments, the shRNA comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, or more percent identity to:
GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT(SEQ ID NO:1)；
GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT(SEQ ID NO:2)；
GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or
GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT(SEQ ID NO:4)。
In some embodiments, the shRNA comprises:
GTCCTGGAGTACAATGCCATTCTCGAGAATGGCATTGTACTCCAGGACTTTTT(SEQ ID NO:1)；
GCAGGATTTCGTTCAGCACTTCTCGAGAAGTGCTGAACGAAATCCTGCTTTTT(SEQ ID NO:2)；
GCCATGTACATGGCAGGAATTCTCGAGAATTCCTGCCATGTACATGGCTTTTT (SEQ ID NO: 3); or
GCAGAAGGAGGCTGAGAAAGTCTCGAGACTTTCTCAGCCTCCTTCTGCTTTTT(SEQ ID NO:4)。
In some embodiments, the shRNA comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to: 64, 65, 66 or 67 SEQ ID NO.
In some embodiments, the miRNA comprises a sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to:
In some embodiments, the enzyme is GGPS1 or a functional variant thereof. In some embodiments, the shRNA comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to: 70, 71 or 72 SEQ ID NO.
In some embodiments, the enzyme is IDI1 or a functional variant thereof. In some embodiments, the shRNA comprises a sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID No. 76.
In some embodiments, the enzyme is F-Tase or squalene synthase, or a functional variant thereof.
In some embodiments, the member of the cremophilic protein family comprises BTN3A3, BTN3A3, or
In some embodiments, the chemokine comprises a CC chemokine, a CXC chemokine, a CX3C chemokine, a C chemokine, or an XC chemokine. In other embodiments, the CC chemokine comprises RANTES. In some embodiments, the viral vector is a lentiviral vector. In other embodiments, the C chemokine comprises XCL1 (lymphotactin).
In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system includes a lentiviral vector described in detail herein; at least one envelope plasmid for expressing an envelope protein that optimizes infection of a target cell; and at least one helper plasmid for expressing the gag, pol and rev genes or functional variants thereof; wherein, when the lentiviral vector, the at least one envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell, the packaging cell produces lentiviral particles, wherein the lentiviral particles are capable of infecting a target cell and inhibiting an enzyme in the mevalonate pathway in the target cell.
In some embodiments, the lentiviral particle is capable of causing an increase in the level of a first product of the mevalonate pathway. In some embodiments, the first product comprises IPP. In some embodiments, the lentiviral particle is capable of causing a decrease in the level of a second product of the mevalonate pathway. In some embodiments, the second product comprises GGPP. In some embodiments, the lentiviral product increases the first product and decreases the second product.
In some embodiments, the lentiviral particle encodes a small RNA capable of targeting a first target of the mevalonate pathway. In some embodiments, the lentiviral particle further encodes a small RNA capable of targeting a second target of the mevalonate pathway. In some embodiments, at least one of the first target and the second target is an enzyme. In some embodiments, at least one of the first target and the second target is FDPS, GGPS1, IDI1, F-Tase, or squalene synthase.
In some embodiments, targeting of the small RNA to the first target results in an increase in the presence, level, or concentration of the first product of the mevalonate pathway. In some embodiments, the presence, level, or concentration of a first product of the mevalonate pathway is increased by up to 10% compared to a first product control, wherein the first product control can mean the presence, level, or concentration of the first product when the first target is not targeted by a small RNA. In some embodiments, the presence, level or concentration of a first product of the mevalonate pathway is increased by up to 10% and up to 20% as compared to a first product control, as described herein. In some embodiments, the presence, level or concentration of a first product of the mevalonate pathway is increased by up to 20% and up to 30% as compared to a first product control, as described herein. In some embodiments, the presence, level or concentration of a first product of the mevalonate pathway is increased by up to 30% to up to 40% as compared to a first product control, as described herein. In some embodiments, the presence, level or concentration of a first product of the mevalonate pathway is increased by up to 40% and up to 50% as compared to a first product control, as described herein. In some embodiments, the presence, level or concentration of a first product of the mevalonate pathway is increased by more than 50% compared to a first product control, as described herein. In some embodiments, the first product of the mevalonate pathway comprises IPP.
In some embodiments, targeting the small RNA to the second target results in a decrease in the presence, level, or concentration of a second product of the mevalonate pathway. In some embodiments, the presence, level, or concentration of a second product of the mevalonate pathway is reduced by up to 10% compared to a second product control, wherein the second product control can mean the presence, level, or concentration of the second product when the second target is not targeted by a small RNA. In some embodiments, the presence, level or concentration of a second product of the mevalonate pathway is reduced by up to 10% and up to 20% as compared to a second product control, as described herein. In some embodiments, the presence, level or concentration of a second product of the mevalonate pathway is reduced by up to 20% to up to 30% as compared to a second product control, as described herein. In some embodiments, the presence, level or concentration of a second product of the mevalonate pathway is reduced by up to 30% to up to 40% as compared to a second product control, as described herein. In some embodiments, the presence, level or concentration of a second product of the mevalonate pathway is reduced by up to 40% to up to 50% as compared to a second product control, as described herein. In some embodiments, the presence, level or concentration of a second product of the mevalonate pathway is reduced by more than 50% as compared to a second product control, as described herein. In some embodiments, the second product of the mevalonate pathway comprises GGPP.
In some embodiments, an increase in the presence, level, or concentration of a first product of the mevalonate pathway causes increased γ δ (GD) T cell activation. In some embodiments, GD T cell activation is increased by up to 10% compared to a first activation control, wherein the first activation control can mean a level of GD T cell activation when the first target is not targeted by a small RNA. In some embodiments, the modulation of the first product increases GD T cell activation by up to 10% and up to 20% compared to the first activation control, as described herein. In some embodiments, the modulation of the first product increases GD T cell activation by up to 20% and up to 30% compared to the first activation control, as described herein. In some embodiments, the modulation of the first product increases GD T cell activation by up to 30% to up to 40% compared to the first activation control, as described herein. In some embodiments, the GD T cell activation caused by modulation of the first product is increased by up to 40% up to 50% as compared to the first activation control, as described herein. In some embodiments, the modulation of the first product increases GD T cell activation by more than 50% compared to the first activation control, as described herein.
In some embodiments, a decrease in the presence, level, or concentration of a second product of the mevalonate pathway causes increased γ δ (GD) T cell activation. In some embodiments, the modulation of the second product increases GD T cell activation by up to 10% compared to a second activation control, wherein the second activation control can mean a level of GD T cell activation for which the second target is not timed by a small RNA target. In some embodiments, the modulation of the second product increases GD T cell activation by up to 10% up to 20% compared to a second activation control, as described herein. In some embodiments, the modulation of the second product increases GD T cell activation by up to 20% and up to 30% compared to a second activation control, as described herein. In some embodiments, the modulation of the second product increases GD T cell activation by up to 30% to up to 40% compared to a second activation control, as described herein. In some embodiments, the GD T cell activation caused by modulation of the second product is increased by up to 40% up to 50% compared to a second activation control, as described herein. In some embodiments, the modulation of the second product increases GD T cell activation by more than 50% compared to a second activation control, as described herein.
Another aspect discloses a lentiviral particle capable of infecting a target cell. The lentiviral particles comprise an envelope protein that optimizes infection of a target cell and a lentiviral vector as described herein. In some embodiments, the target cell is a cancer cell.
Another aspect discloses a method of activating γ δ (GD) T cells. The method comprises infecting a target cell with a lentiviral particle in the presence of a GD T cell, the lentiviral particle comprising a viral vector, the vector comprising first and second encoded genetic elements, the first encoded genetic element comprising a small RNA capable of inhibiting the production of an enzyme involved in the mevalonate pathway, and the second encoded genetic element comprising one of a member of the cremophil family, a cytokine or a chemokine, the target cell activating the GD T cell when the enzyme is inhibited in the target cell. In some embodiments, the enzyme involved comprises at least one of FDPS, GGPS1, IDI1, F-Tase, and/or squalene synthase, or a functional variant thereof.
In some embodiments, the target cell is a cancer cell. In some embodiments, the method further comprises contacting the target cell and the GD T cell with an amount of an aminobisphosphonate. In some embodiments, the aminobisphosphonate is zoledronic acid.
In another aspect, a method of treating cancer in a subject is disclosed. The method comprises administering to the subject a therapeutically effective amount of a lentiviral particle comprising a viral vector, the vector comprising first and second encoding genetic elements, the first encoding genetic element comprising a small RNA capable of inhibiting the production of an enzyme involved in the mevalonate pathway, and the second encoding genetic element comprising one of a member of the cremophil family, a cytokine or a chemokine; when the enzyme is inhibited in the presence of GD T cells in cancer cells, the target cells activate the GD T cells, thereby treating the cancer. In some embodiments, the enzyme involved comprises at least one of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and/or a functional variant thereof.
In some embodiments, the method further comprises contacting the target cell and the GD T cell with an amount of an aminobisphosphonate. In some embodiments, the method comprises administering to a subject a therapeutically effective amount of a lentiviral particle comprising a viral vector, the viral vector comprising a first, a second, and a third encoded genetic element, the first encoded genetic element comprising one or more small RNAs capable of inhibiting one or more enzymes involved in the mevalonate pathway, the second encoded genetic element comprising a member of the lactosamin family, and the third encoded genetic element encoding a cytokine or chemokine, wherein, when the enzyme is inhibited in cancer cells in the presence of GD T cells, the target cells activate the GD T cells, the lactosamin increases the efficiency of GD T cell activation, the cytokine increases activation and proliferation of the GD T cells, and the chemokine increases the presence of GDT cells at the tumor site, thereby treating the cancer. In some embodiments, the method further comprises exposing the target cells and GD T cells to an amount of an aminobisphosphonate. In some embodiments, the aminobisphosphonate is zoledronic acid.
In some embodiments, the member of the cremophilic protein family comprises BTN3A3(SEQ ID NO:17) or BTN3A3(R381H) (SEQ ID NO: 54). In some embodiments, cytokines include IL-2, IL-12, IL-15, IL-18, IL-23 or IL-36, but may also include known activation of immune cells such as T cells of other cytokines. In some embodiments, the chemokine may comprise chemokine (C-C motif)
Cancer treatment
The compositions and methods provided herein are useful for treating cancer. The cell, tissue or target may be a cancerous cell, tissue carrying cancer or a diagnosed or at-risk subject or patient for a disease or condition. In certain aspects, the cell may be an epithelial cell, an endothelial cell, a mesothelial cell, a glial cell, a stromal cell, or a mucosal cell. The cancer cell population can include, but is not limited to, brain, neuronal, blood, endometrial, meninges, esophageal, lung, cardiovascular, liver, lymph, breast, bone, connective tissue, fat, retina, thyroid, gland, adrenal, pancreas, stomach, intestine, kidney, bladder, colon, prostate, uterus, ovary, cervix, testis, spleen, skin, smooth muscle, cardiac muscle, or striated muscle cells, and can also include a cancer cell population from any of the above, and can be associated with one or more of: carcinomas, sarcomas, myelomas, leukemias, lymphomas, mixed forms or mixtures thereof as described above. In another aspect, the cancer includes, but is not limited to, astrocytoma, acute myelogenous leukemia, anaplastic large cell lymphoma, acute lymphocytic leukemia, angiosarcoma, B-cell lymphoma, burkitt's lymphoma, breast cancer, bladder cancer, head and neck cancer, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, colorectal cancer, endometrial cancer, esophageal squamous cell carcinoma, ewing's sarcoma, fibrosarcoma, glioma, glioblastoma, gastrinoma, gastric cancer, hepatoblastoma, hepatocellular carcinoma, kaposi's sarcoma, hodgkin's lymphoma, laryngeal squamous cell carcinoma, laryngeal carcinoma, leukemia, leiomyosarcoma, lipoma, liposarcoma, melanoma, mantle cell lymphoma, medulloblastoma, mesothelioma, myxofibrosarcoma, myeloid leukemia, mucosa-associated lymphoid tissue B cell lymphoma, multiple myeloma, High risk myelodysplastic syndrome, nasopharyngeal carcinoma, neuroblastoma, neurofibroma, high grade non-hodgkin's lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, pheochromocytoma, prostate carcinoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland tumor, schwann's cell tumor, small cell lung carcinoma, head and neck squamous cell carcinoma, testicular tumor, thyroid carcinoma, urothelial carcinoma, and wilm's tumor.
The compositions and methods provided herein are also useful for treating NSCLC (non-small cell lung cancer), pediatric malignancies, cervical and other tumors caused or contributed to by Human Papillomavirus (HPV), melanoma, barrett's esophagus (premalignant syndrome), adrenal and skin cancers, as well as autoimmune diseases, neoplastic skin disorders.
Infectious diseases
The compositions and methods disclosed herein are useful for treating infectious diseases. The term "infectious disease" includes various diseases caused by infectious agents. "infectious agents" include a variety of exogenous pathogens, including but not limited to bacteria, fungi, viruses, mycoplasma, and parasites. Infectious agents that can be treated with the compositions provided herein include all infectious organisms known in the art to be pathogenic in animals, including organisms such as: bacteria belonging to gram-negative or gram-positive cocci or bacilli, DNA and RNA viruses, including but not limited to DNA viruses such as papillomaviruses, parvoviruses, adenoviruses, herpesviruses, and vaccinia viruses, and RNA viruses such as arenaviruses, coronaviruses, rhinoviruses, respiratory syncytial viruses, influenza viruses, picornaviruses, paramyxoviruses, reoviruses, retroviruses, and rhabdoviruses. Examples of fungi that may be treated with the compositions and methods herein include: fungi that grow mold or yeast-like, for example, fungi that cause diseases such as tinea, histoplasmosis, blastomycosis, aspergillosis, cryptococcosis, sporotrichosis, coccidioidomycosis, paracoccidioidomycosis, and candidiasis. The compositions and methods provided herein are useful for treating parasitic infections, including but not limited to infections caused by somatic cestodes, schistosomes, tissue roundworms, amoeba and plasmodium, trypanosomes, leishmania, and toxoplasma species.
Method for activation of GD T cells
Provided herein are compositions and methods for activating GD T cells in a subject and methods of treating tumors and infectious diseases. For example, in some embodiments, the compositions and methods provided herein can be used in methods of treating all known cancers because activated GD T cells contain a natural immune surveillance mechanism for the tumor (see, e.g., Pauza et al, Frontiersin immunol.5:687 (2014)). Likewise, in some embodiments, the compositions and methods provided herein can be used to treat infectious diseases, including but not limited to flavivirus, influenza virus, human retrovirus, mycobacterium, plasmodium, and various other viral, fungal, and bacterial infections. See, e.g., Pauza and Cairo,2015Cell Immunol.296 (1).
In general, vector systems are administered to a subject with the constructs described herein to transfect or transduce a target cell population thereby reducing FDPS expression and in other embodiments increasing chemokine or cytokine expression. Administration and transfection/transduction may occur in vivo (in vivo) or ex vivo (ex vivo), in which case the transfected cells are subsequently returned to the subject.
Administration of the vector and transfection or transduction of the construct into the cells of a subject results in reduced expression of FDPS, increased expression of cytokines or chemokines, accumulation of IPP and in many cases a reduced growth rate of genetically modified tumor cells. All these features work together to activate GD T cells and co-localize to tumors or sites of infection.
The method described herein can also enhance the ability of NK cells to recognize and destroy tumor cells and/or infected cells the signal interaction (crosstalk) between GDT cells and NK cells is an important aspect of regulating immune and inflammatory responses furthermore, GDT cells are able to trigger dendritic cell maturation, recruit B cells and macrophages, and participate in various cytolytic activities such as secretion of interferon-gamma and TNF- α.
In some embodiments, the compositions and methods provided herein include a form of gene therapy for activating GD T cells at a tumor site. In one aspect, the compositions and methods provided herein activate GD T cells and support their proliferative, differentiation, and functional capabilities by promoting the production of specific cytokines required for cytolytic activity that is capable of killing cancer cells or treating infectious diseases.
In some embodiments, the gene therapy sequences (e.g., FDPS shRNA, FDPS miRNA, GGPS 1shRNA, IDI 1shRNA, F-Tase small RNA, or squalene synthase small RNA) are carried by a therapeutic vector, including but not limited to a viral vector, such as a lentivirus or adeno-associated virus, although other viral vectors may also be suitable. The gene therapy construct may also be delivered in the form of DNA or RNA, including but not limited to plasmid form. In some embodiments, the gene therapy constructs described herein can also be delivered in the form of protein-nucleic acid complexes or lipid-nucleic acid complexes and mixtures of these agents. For example, the protein-nucleic acid complex may comprise a nucleic acid of interest complexed with a cationic peptide (e.g., lysine and arginine). The lipid-nucleic acid complex may comprise lipid emulsions, micelles, liposomes, and/or mixtures of neutral and cationic lipids, such as DOTMA, DOSPA, DOTAP, and DMRIE.
In some embodiments, the therapeutic vector may comprise a single construct or at least two, at least three, at least four, or at least five different constructs. When more than one construct is present in the vector, the constructs may be the same or different. For example, constructs may differ in their promoter, the presence or absence of an integrational element, and/or their sequence.
In some embodiments, the therapeutic vector will comprise at least one construct that encodes a small RNA that is capable of knocking down the expression of at least one of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and/or a functional variant thereof in some embodiments, the therapeutic vector will also encode a specific cytokine and/or chemokine, including but not limited to TNF- α, interferon- γ, IL-1 β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, L-36, or RANTES in some embodiments, a single construct may encode both a small RNA that is capable of knocking down FDS expression and a specific cytokine or chemokine, including but not limited to TNF- α, interferon- γ, IL-1 β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, or RANTES.
In some embodiments, the viral vector may introduce a nucleic acid construct that is integrated into the host chromosome. Alternatively, transient delivery vectors can be used to avoid chromosomal integration and limit the longevity of gene therapy constructs.
In some embodiments, the constructs and vectors described herein comprise sirnas or short hairpin RNAs ("shrnas"), micrornas ("mirnas") capable of reducing or knocking down expression of FDPS, geranyl pyrophosphate synthase ("GPPS"), farnesyl transferase ("F-Tase"), IDI1, and/or squalene synthase genes. By down-regulating these genes that control steroid and isoprenoid synthesis, levels of isopentenyl pyrophosphate ("IPP") are increased and/or levels of GGPP are decreased. IPP elevation and accumulation is a mechanism to increase GD T cell activation. Moreover, down-regulation of these pyrophosphate synthase genes eliminates important negative regulators of inflammatory body function, which in turn leads to increased expression of cytokines important for GD T cell activation and effector cell function. BTN3a3 and high cytoplasmic levels of IPP on the surface of cancer cells strongly activate V gamma 9V delta 2T cells (also known as V γ 9V δ 2T cells).
In some embodiments, the constructs described herein are regulated by specific promoters that are capable of producing interleukin-2 and/or interleukin-15 to maintain GD T cell proliferation, however, as described herein, other cytokines may also be selected, including IL-18, IL-23, and IL-36. in addition, the constructs described herein may be regulated by specific promoters that are capable of producing interleukin-1 β and/or interleukin-18 and/or interferon- γ that are required for GD T cell differentiation and for all effector cell functions.
In some embodiments, the methods described herein activate GD T cells with an indirect effect of increased ability of NK cells to attack and destroy cancer, tumor, or infected cells. NK cell activation requires stimulated proliferation and differentiation of GD T cells and expression of the 4-1BBL co-stimulatory ligand required for binding to the 4-1BB co-stimulatory receptor on NK cells. This form of signaling interaction is believed to be an important mechanism for activating NK cells, and is achieved herein through the action of the methods and compositions described herein.
In another aspect, signal interaction between GD T cells and NK cells is an important mechanism to eliminate inflammatory dendritic cells accumulated in diseased tissues. Neither GD T cells nor NK cells alone can destroy dendritic cells, but once the above-described signal interaction occurs, NK cells become cytotoxic to inflammatory dendritic cells. This immunoregulatory mechanism relies on the potent activation and proliferation of GD T cells.
In some embodiments, the methods of activating GD T cells described herein further comprise the step of inhibiting pathological inflammatory responses, which may include cell proliferation leading to atherosclerosis, chronic immune activation that triggers tumor growth, autoimmune diseases (including psoriasis and other epidermal manifestations), inflammatory diseases of the central nervous system, arthritis, and other immune response disorders.
In some embodiments, the therapeutic carrier is administered concurrently with the bisphosphonate to achieve synergistic activation of γ δ T cells. This synergistic effect can allow for alternative, altered or reduced bisphosphonate dosages and can reduce adverse reactions to the bisphosphonate, including acute inflammatory reactions and chronic diseases.
In some embodiments, the therapeutic carrier is administered in combination with a bisphosphonate. In various embodiments, such combination results in synergistic, positive or increased γ δ T cell activation. Positive activation may allow for alternative, altered, or reduced bisphosphonate dosages, and may reduce adverse reactions to the bisphosphonate, including acute inflammatory reactions and chronic diseases. The combination of the therapeutic carrier and bisphosphonate may be together or separately with or without instructions for combined use or combination of products. The therapeutic carrier and/or bisphosphonate may be administered completely separately and may be formulated in completely different pharmaceutical dosage forms. The therapeutic carrier and/or bisphosphonate may be sold separately from each other with or without labeling instructions regarding the possibility of combined use. Such instructions may also be provided in a packaging device such as an insert or in other information, such as provided to a physician or medical personnel, e.g., oral communication, written communication, etc. The label or other instructions may refer to a fixed combination in the form of a single dosage unit or may refer to a non-fixed combination in the form of a kit of parts for co-administration, in which case the therapeutic carrier may be administered simultaneously or separately during a time interval, independently of the bisphosphonate. In various embodiments, the combination exhibits a synergistic or combined effect, or reduction in toxicity or complications of treatment. In one embodiment, the effect of the combination is synergistic. A synergistic effect is obtained when the effect of the active ingredients used together exceeds the sum of the effects obtained by the individual compounds used separately. The synergistic effect may be obtained when the active ingredients: (1) when formulated together and administered or delivered simultaneously in a combined unit dosage formulation; (2) when delivered alternately or concurrently as separate formulations; or (3) when other schemes are adopted. When delivered in alternation therapy, a synergistic effect may be obtained when the compounds are administered or delivered sequentially, e.g., by different injections with separate syringes. In general, during alternation therapy, an effective dose of each active ingredient is administered sequentially, i.e., continuously, while in combination therapy, effective doses of two or more active ingredients are administered together, but possibly at different times as described herein.
The combinations described herein may be made and/or formulated by the same or different manufacturers. The active ingredients may be brought together to become a combination therapy as follows: (i) prior to dispensing of the combination product to a physician (e.g., in the case of a kit containing a compound as described herein and other therapeutic agents); (ii) prior to proximal administration by the physician administering the treatment (or under the direction of the physician); (iii) in actual patients, the compound and other therapeutic agents described herein are administered sequentially, for example.
In some embodiments, a therapeutically effective amount of each combination may be administered simultaneously or sequentially and in any order, and the components may be administered together or separately. For example, the methods described herein for treating proliferative diseases can comprise: (i) a first drug (e.g. a therapeutic carrier forming part of a lentiviral particle) and/or (ii) a second drug (e.g. a bisphosphonate in free form or in pharmaceutically acceptable salt form). The administration of drugs (i) and/or (ii) may be simultaneous or sequential in any order in a therapeutically effective amount, preferably in a cooperative, jointly effective amount and/or synergistically effective amount, e.g. daily or intermittent doses corresponding to the amounts described herein. These combinations may be administered separately at different times during the course of treatment, or concurrently in separate pharmaceutical forms or as a single pharmaceutical form. Also, "administering" includes administering a prodrug of a component of the combination that converts to the component of the combination in vivo. Accordingly, it is to be understood herein that all such regimes of simultaneous or alternating treatment are included and that "administration" should be interpreted accordingly.
In some embodiments, drugs (i) and (ii) may be administered by any pharmaceutically acceptable method, for example, intranasally, buccally, sublingually, orally, rectally, ocularly, parenterally (intravenously, intradermally, intramuscularly, subcutaneously, intraperitoneally), pulmonarily, intravaginally, topically (locally), topically (topically), topically after laceration, transmucosally, by aerosol, in a semi-solid medium such as agarose or gelatin, or by buccal or nasal spray. For example, the therapeutic carrier and/or bisphosphonate may be administered intravenously. In addition, the drugs (i) and (ii) may be formulated into any pharmaceutically acceptable dosage form, such as solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersions, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, solutions, emulsions and suspensions. For example, bisphosphonates may be formulated for oral administration as tablets.
The combination therapy described herein may be administered in addition to chemotherapy, radiation therapy, immunotherapy, surgical intervention, or a combination thereof, and is specific to cancer treatment. As with the other treatment strategies above, long-term treatment is also possible as is adjuvant treatment. Other possible treatments are those used to maintain the patient's state after tumor regression, or even prophylactic chemotherapy (e.g. in at-risk patients).
Constructs for GD T cell activation
Inhibition of FDPS, GGPS1, IDI1, and/or functional variants thereof results in accumulation of IPP and/or depletion of GGPP levels, thereby activating
For example, in some embodiments, the construct encodes interferon- γ, IL-1 β, IL-2, IL-4, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, IL-33, IL-36, or TNF- α.
The expression of cytokines and chemokines, such as those described above, will result in the local cytotoxic destruction of tumor cells or cells infected with pathogenic organisms. Thus, expression of the construct by tumor cells will result in the tumor cells assisting in their destruction and activating immune mechanisms that can destroy other tumor cells that have not been genetically engineered with lentiviral vectors. The ability of genetically engineered cells to activate GDT cells involves activation of GD T cell receptors, cremophilic protein recognition and GT T cell receptors for conventional gamma chain cytokines. Tumor cell killing relies on the GD T cell surface receptor family, which collectively belong to the NK receptor family members, which differentiate tumor cells from normal cells and provide selectivity in the cell killing process. As a result, a small number of genetically engineered tumor cells can activate a sufficient number of GD T cells to achieve extensive tumor destruction, including killing both genetically engineered and non-engineered cells in the same or distant tumors. Thus, expression of these constructs by tumor cells or infected cells will result in the disadvantaged cells assisting in self-destruction.
Similarly, if the constructs described herein are expressed in tumor cells or infected cells, decreased expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase, and/or their functional variants will result in activation and recruitment of GD T cells to the site of the tumor or site of cell infection. Increasing the expression of RANTES will further direct GD T cells to the expected tissue location. Because GD T cells can kill a wide range of tumors of epithelial origin as well as a variety of leukemias and lymphomas, and also can produce high levels of the anti-tumor cytokine IFN γ, recruitment of GD T cells to the tumor site can be a particularly effective means of inducing anti-tumor immunity.
The reduced expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase and/or functional variants thereof can be achieved by shRNA, microRNA, siRNA or other means known in the art. For example, the shRNAs or variants thereof shown in SEQ ID NOs: 1,2, 3, or 4 can be used in the constructs and methods described herein, and this example is not limiting. The shRNAs or variants thereof shown in SEQ ID NOs 64-67, 70-72, 76 can be used in the constructs and methods described herein, and this example is not limiting. 68 or 69 or variants thereof can be used in the constructs and methods described herein, this example is not limiting. The coding regions of the RNA for reducing the expression of FDPS, GGPS1, IDI1, F-Tase, squalene synthase and/or functional variants thereof, and the coding regions of cytokines and chemokines may be in the same construct or on different constructs.
The classical approach to produce recombinant polypeptides or gene regulatory molecules, including small RNAs, is to employ stable expression constructs. These constructs are based on chromosomal integration of the transduced expression plasmid (or at least part thereof) into the genome of the host cell, short term plasmid transfection or non-integrating viral vectors with limited half-life. The sites of gene integration are generally random, and the number and proportion of integrated genes at any particular site is generally unpredictable; likewise, non-integrating plasmids or viral vectors also produce nuclear DNA but they often lack sequences required for DNA replication and sustained maintenance. Thus, constructs that rely on chromosomal integration result in permanent maintenance of the recombinant gene that may exceed the treatment interval.
An alternative to stable expression constructs for gene expression is transient expression constructs. Expression of this latter gene expression construct is based on a non-integrated plasmid, and thus expression is often lost when cells divide or the plasmid vector is disrupted by endogenous nucleases.
The constructs described herein are preferably transiently expressed episomal (episomal) constructs. The episomal constructs degrade or dilute over time such that they do not permanently alter the genome of the subject nor do they integrate into the chromosome of the target cell. Episomal replication processes typically involve both host cell replication mechanisms and viral trans-acting factors.
Avoiding chromosomal integration reduces some of the barriers to gene delivery in vivo. However, even integration-defective constructs will integrate at background frequency and any DNA molecule will find rare homologies for recombination with host sequences; however, these integration rates are very rare and often of no clinical significance.
Thus, in some embodiments, the vectors described herein can support active gene and/or small RNA delivery for a period of time of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks. In some embodiments, the vector supports active gene and/or small RNA delivery for a period of about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. Any combination of these durations may also be used in the methods of the invention, for example 1 month and 1 week, or 3 months and 2 weeks.
However, in some embodiments, the construct comprises an integration element dependent on the retroviral integrase gene such that the construct is integrated into the chromosome of the subject. Retrotransposition and transposition are additional examples of mechanisms for integration or insertion of mobile genetic elements into chromosomes. Plasmids can integrate into chromosomes by recombination, and gene editing techniques (including CRISPR and TALENs) utilize guide RNA sequences and alter chromosomal loci through gene deletion or gene conversion mechanisms.
The construct may comprise a specific promoter for the expression of a cytokine involved in maintaining GD T cells (i.e., IL-2, IL-7, IL-12, IL-15, IL-17, IL-18, IL-23, or IL-36). For example, promoters that may be incorporated into the construct include, but are not limited to, TATA-box promoters, CpG-box promoters, CCAAT-box promoters, TTGACA-box promoters, BRE-box promoters, INR-box promoters, AT-based promoters, CG-based promoters, ATCG-compact promoters, ATCG-balanced promoters, medium ATCG-promoters, low AT promoters, low CG-promoters, AT-spike promoters and CG-spike promoters. Eukaryotic genomes can exhibit up to 10 major gene promoters (Eukaryotic genes main exclusion up to 10 genetic classifications of gene promoters), BMC GENOMICS 13:512(2012), see, e.g., Gagniuc and Ionescu-tirgovistate.
Therapeutic vectors
The constructs may be delivered by well-known transfection and/or transduction vectors, including but not limited to lentiviral vectors, adeno-associated viruses, poxviruses, herpesvirus vectors, protein and/or lipid complexes, liposomes, micelles, bacterially-produced vesicles, eukaryotic cell-produced vesicles, exosomes, and the like.
The viral vector can be preferentially targeted to the cell type (i.e., tumor cells or bone marrow cells or lymphocytes) that can be used in the methods described herein. Because of the specific viral envelope-host cell receptor interactions and the viral gene expression mechanisms, viral vectors can be used to transduce genes into target cells. Thus, viral vectors have been used as vehicles for gene transfer into a variety of different cell types, including whole embryos, fertilized eggs, isolated tissue samples, in situ tissue targets, and cultured cell lines. The ability to introduce and express foreign genes into cells can be used for studies of gene expression, elucidation of cell lineages, and the potential to provide therapeutic intervention, such as gene therapy, induction of somatic reprogramming of pluripotent stem cells, and various types of immunotherapy. Viral components from viruses such as papovaviridae (e.g., bovine papilloma virus or BPV) or herpesviridae (e.g., Epstein Barr virus or EBV) or hepadnaviridae (e.g., hepatitis b virus or HBV) or poxvirus vectors including vaccinia virus (vaccinia) may be used in the vectors described herein.
Lentiviral vectors are a preferred type of vector for the compositions and methods described herein, but the disclosure is not particularly limited to lentiviral vectors. Lentiviruses are a class of viruses that are capable of delivering large amounts of viral nucleic acid into a host cell. Lentiviruses are characterized by their unique ability to infect/transduce non-dividing cells, and, upon transduction, they integrate their nucleic acids into the host cell chromosome.
Infectious lentiviruses have three major genes, gag, pol and env, which encode virulence proteins, and two regulatory genes, including tat and rev. Depending on the particular serotype and virus, there may be additional auxiliary genes encoding proteins involved in the regulation, synthesis and/or processing of viral nucleic acids and other replication functions.
In addition, lentiviruses have Long Terminal Repeat (LTR) regions, which can be about 600nt long. The LTR may be segmented into a U3 region, an R region, and a U5 region. The LTR mediates the integration of retroviral DNA into the host chromosome by the action of integrase. Alternatively, the LTR may be used to circularize viral nucleic acid in the absence of a functional integrase.
Viral proteins involved in the early stages of lentivirus replication include reverse transcriptase and integrase. Reverse transcriptase is a virally encoded RNA-dependent DNA polymerase. The enzyme synthesizes complementary DNA copies using the viral RNA genome as a template. Reverse transcriptase also has rnase H activity to destroy the RNA template. Integrase binds host DNA and viral cDNA produced by reverse transcriptase. Integrase processes the LTR prior to insertion of the viral genome into host DNA. Tat enhances initiation and elongation as a transactivation element during transcription. The rev response element functions post-transcriptionally, regulating mRNA splicing and transport into the cytoplasm.
Typically, viral vectors comprise glycoproteins, and various glycoproteins can provide specific affinities. For example, vesicular stomatitis virus g (vsvg) peptides can increase transfection into bone marrow cells. Alternatively, the viral vector may also have a targeting moiety, such as an antibody, attached to its capsid peptide. The targeting antibody may be specific for an antigen over-expressed on the tumor-such as HER-2, PSA, CEA, M2-PK, and CA 19-9.
Other viral vector specificities are also known in the art and can be used to target specific cell populations. For example, poxviruses and herpesvirus vectors can target macrophages, dendritic cells and epithelial cells, measles virus vectors can target B cells, and rabies virus vectors can target nerve cells.
Lentiviral vector system
Lentivirus virions (particles) are expressed from a vector system that encodes for the production of essential viral proteins by the virion (viral particle). At least one of the vectors contains a nucleic acid sequence encoding a lentiviral pol protein operably linked to a promoter, the viral pol protein being necessary for reverse transcription and integration. In other embodiments, the pol protein is expressed from a multi-vector. The carrier additionally comprises a nucleic acid sequence encoding a lentiviral gag protein operably linked to a promoter, the lentiviral gag protein being necessary to form the viral capsid. In one embodiment, the gag nucleic acid sequence is located on another vector separate from at least a portion of the pol nucleic acid sequence. In other embodiments, the gag nucleic acid is located on a separate vector from all pol nucleic acid sequences encoding the pol protein.
Various modifications can be made to the vector for generating particles that further minimize the possibility of obtaining wild-type revertants. These modifications include, but are not limited to, deletion of the U3 region of the LTR, tat deletion and Matrix (MA) deletion.
One or more of the gag, pol and env vectors are free of lentiviral genomic nucleotides that package lentiviral RNA, referred to as lentiviral packaging sequences.
The particle-forming vector preferably does not contain a lentiviral genomic nucleic acid sequence expressing an envelope protein. Preferably, an additional vector is employed that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter. The env vector also does not contain a lentiviral packaging sequence. In some embodiments, the env nucleic acid sequence encodes a lentiviral envelope protein.
In other embodiments, env proteins are not lentiviral env proteins, but rather are of other viruses, the resulting particles are referred to as pseudotyped particles, by appropriate selection of the envelope, almost any cell can be "infected" with, for example, env genes encoding envelope proteins targeted to the endocytic compartment, such as the genes for influenza virus, VSV-G, α virus (Simmental forest virus, Sindbis virus), arenavirus (lymphocytic choriomeningitis virus), flaviviruses (tick-borne encephalitis virus, dengue virus, hepatitis C virus, GB virus), rhabdovirus (vesicular stomatitis virus, rabies virus), paramyxovirus (mumps or measles) and orthomyxovirus (influenza virus), other envelopes that can preferably be employed include envelopes for Moloney leukemia viruses such as MLV-E, MLV-A and GALV2A glycoprotein. In other embodiments, different lentiviral capsids with pseudotyped envelopes may be employed (e.g., FIV or SHIV [ U.S. Pat. No. 5,654,195 ]]). SHIV pseudotype vectors work well in animal models such as monkeys.
As described herein, a lentiviral vector system typically comprises at least one helper plasmid comprising at least one of the gag, pol, or rev genes, or functional variants thereof. The gag, pol or rev genes or functional variants thereof may each be located on separate plasmids, or one or more genes may be co-located on the same plasmid. In one embodiment, the gag, pol, and rev genes are located on the same plasmid (e.g., FIG. 2). In other embodiments, the gag and pol genes are on a first plasmid and the rev gene is on a second plasmid (e.g., fig. 3). Thus, both 3-vector and 4-vector systems can be used to produce lentiviruses, as described in the examples section and elsewhere herein. The therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line. A non-limiting example of a packaging cell line is the 293T/17HEK cell line. When the therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line, lentiviral particles are ultimately produced.
In another aspect, a lentiviral vector system for expressing a lentiviral particle is disclosed. The system comprises a lentiviral vector as described herein; an envelope plasmid expressing an envelope protein that optimizes cell infection; and at least one helper plasmid expressing the gag, pol and rev genes or functional variants thereof, wherein when the lentiviral vector, the envelope plasmid and the at least one helper plasmid are transfected into a packaging cell line, the packaging cell line produces lentiviral particles capable of inhibiting the production of chemokine receptor CCR5 or capable of targeting HIV RNA sequences.
On the other hand, as shown in FIG. 2, a lentiviral vector, also referred to herein as a therapeutic vector, may comprise the following elements: hybrid 5 ' Long terminal repeat (RSV/5 ' LTR) (SEQ ID NOS: 5-6), Psi sequence (RNA packaging site) (SEQ ID NO:7), RRE (Rev-response element) (SEQ ID NO:8), cPPT (polypurine tract sequence) (SEQ ID NO:9), H1 promoter (SEQ ID NO:10), shFDPS (SEQ ID NOS: 1,2, 3, 4), CMV (SEQ ID NO:19), BTN3A3(R381H) -T2A-IL-2 (together, SEQ ID NO:55), Woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NO:11) and 3 ' delta LTR (SEQ ID NO: 12). In another aspect, the sequence references herein can be modified with sequence variations by substitutions, deletions, additions or mutations.
In another aspect, helper plasmids have been designated as comprising the elements CMV (CAG) enhancer (SEQ ID NO:21), chicken β actin (CAG) promoter (SEQ ID NO:13), chicken β actin intron (SEQ ID NO:22), HIV gag (SEQ ID NO:14), HIV Pol (SEQ ID NO:15), HIV Int (SEQ ID NO:16), HIV RRE (SEQ ID NO:8), HIV Rev (SEQ ID NO:18), and rabbit β globin poly A (SEQ ID NO:23) as described herein.
On the other hand, as described herein, the envelope plasmid has been designated to contain the following elements from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO:19) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 20). In another aspect, sequence variations by substitution, deletion, addition, or mutation can be used to modify the sequence references herein.
In another aspect, plasmids used for lentiviral packaging can be modified with similar elements and it is possible to remove intron sequences without loss of vector function, for example, the following elements can replace similar elements in plasmids in which the packaging system is located, elongation factor-1 (EF-1), phosphoglycerate kinase (PGK) and ubiquitin C (UbC) promoters can replace CMV or CAG promoters, SV40 poly A and bGH poly A can replace rabbit β globin poly A. the HIV sequences in the helper plasmid can be constructed from different HIV strains or clades.
Notably, lentiviral packaging systems are commercially available (e.g., the Lenti-vpak packaging kit from OriGene technologies, Rokville, Md.) and may be designed as described herein. Furthermore, it is within the skill of the art to substitute or modify various items of a lentiviral packaging system to improve any number of relevant factors, including the efficiency of production of lentiviral particles.
Dosage and dosage form
The vectors described herein allow for short, medium or long term expression of a gene or sequence of interest and episomal maintenance of the vectors described herein. Thus, the dosage regimen may vary depending on the condition being treated and the method of administration.