Application of miRNA-6766-3p in preparation of medicine for preventing and/or treating hepatic fibrosis
阅读说明：本技术 miRNA-6766-3p在制备预防和/或治疗肝纤维化药物中的应用 (Application of miRNA-6766-3p in preparation of medicine for preventing and/or treating hepatic fibrosis ) 是由 段玉友 王宁 李夏静 钟志勇 陈洪林 于 2021-08-17 设计创作，主要内容包括：本发明属于基因工程与生命科学领域,公开了miRNA-6766-3p在制备预防和/或治疗肝纤维化药物中的应用。本发明首次发现了miRNA-6766-3p及相关生物材料可用于预防和/或治疗肝纤维化,通过抑制肝脏星状细胞的增殖、迁移以及纤维化指标,从而达到预防和/或治疗肝纤维化的效果,可作为预防和/或治疗肝纤维化的药物。本发明提供了一种包含miRNA-6766-3p或相关生物材料的药物,该药物与传统的治疗药物相比,具有易于合成,易于检测,定量精确,经化学修饰后能増加其稳定性并提高亲和力,可通过特殊药物递送系统有效定位到靶器官等优点,将大大提高肝纤维化疾病治疗的特异性和靶向性。(The invention belongs to the field of genetic engineering and life science, and discloses application of miRNA-6766-3p in preparation of a medicament for preventing and/or treating hepatic fibrosis. The invention discovers for the first time that miRNA-6766-3p and related biological materials can be used for preventing and/or treating hepatic fibrosis, achieves the effect of preventing and/or treating hepatic fibrosis by inhibiting proliferation, migration and fibrosis indexes of hepatic stellate cells, and can be used as a medicament for preventing and/or treating hepatic fibrosis. Compared with the traditional therapeutic medicine, the medicine containing miRNA-6766-3p or related biomaterials has the advantages of easy synthesis, easy detection, accurate quantification, capability of increasing the stability and improving the affinity of the medicine after chemical modification, capability of effectively positioning to a target organ through a special medicine delivery system and the like, and can greatly improve the specificity and the targeting property of the treatment of hepatic fibrosis diseases.)
1. The application of any one of the substances shown in the following (1) to (5) in the preparation of medicines for preventing and/or treating hepatic fibrosis;
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(3) a miRNA-6766-3p mimetic;
(4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2);
(5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
2. Use of any one of the following substances (1) to (5) in at least one of the following substances (a) to (d);
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(3) a miRNA-6766-3p mimetic;
(4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2);
(5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4);
(a) preparing a product for inhibiting expression of a TGF beta type II receptor;
(b) preparing a product for inhibiting the expression of COLLAGEN I, α -SMA and Ki 67;
(c) preparing a product for inhibiting the expression of TIMP3 and TIMP 1;
(d) preparing products for promoting expression of MMP2 and MMP 9.
3. Use of any one of the following substances (1) to (5) in at least one of the following substances (e) to (f);
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(3) a miRNA-6766-3p mimetic;
(4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2);
(5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4);
(e) preparing a product for inhibiting stellate cell proliferation;
(f) preparing a product for inhibiting stellate cell migration.
4. Use of any one of the following substances (1) to (5) in at least one of the following substances (h) to (j);
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(3) a miRNA-6766-3p mimetic;
(4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2);
(5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4);
(h) preparing products for inhibiting the expression of P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2 mRNA;
(i) preparing a product for inhibiting expression of SMAD3, SMAD4, P38MAPK and ERK proteins;
(j) preparing products for inhibiting phosphorylation of SMAD2 and SMAD 3.
5. Use according to any one of claims 1 to 4, characterized in that:
(1) the nucleic acid sequences of the miRNA-6766-3p in the (2) and (3) are shown in SEQ ID NO. 1.
6. Use of a substance capable of inhibiting the expression of (1) or (2) in at least one of the following (a ') to (d');
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(a') preparing a product for promoting expression of a TGF beta type II receptor;
(b') preparing a product for promoting expression of COLLAGEN I, α -SMA and Ki 67;
(c') preparing a product for promoting the expression of TIMP3 and TIMP 1;
(d') preparing a product for inhibiting the expression of MMP2 and MMP 9.
7. Use of a substance capable of inhibiting the expression of (1) or (2) in at least one of the following (e ') to (f');
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(e') preparing a product for promoting proliferation of stellate cells;
(f') preparing a product for promoting migration of stellate cells.
8. Use of a substance capable of inhibiting the expression of (1) or (2) in at least one of the following (h ') to (i');
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(h') preparing a product for promoting expression of P38MAPK, SMAD4, SMAD3, ERK1, SMAD2 mRNA;
(i') preparing a product for promoting expression of SMAD3, SMAD4, P38MAPK and ERK proteins;
(j') preparing a product for promoting phosphorylation of SMAD2 and SMAD 3.
9. Use according to any one of claims 6 to 8, wherein:
(1) the nucleic acid sequence of the miRNA-6766-3p in the (2) is shown in SEQ ID NO. 1;
preferably, the substance capable of inhibiting the expression of (1) is an miRNA-6766-3p inhibitor.
10. A medicament comprising a pharmaceutically acceptable carrier and any one of the following substances (1) to (5);
(1)miRNA-6766-3p；
(2) a precursor of miRNA-6766-3 p;
(3) a miRNA-6766-3p mimetic;
(4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2);
(5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
Technical Field
The invention belongs to the field of genetic engineering and life science, and particularly relates to application of miRNA-6766-3p in preparation of a medicament for preventing and/or treating hepatic fibrosis.
Background
Hepatic fibrosis refers to a pathological change characterized by the activation and proliferation of quiescent Hepatic Stellate Cells (HSCs) under the action of various pathogenic factors, which is manifested by the excessive production and deposition of extracellular matrix mainly composed of collagen, thereby gradually forming fibrous tissues and further destroying normal liver tissues. The process of early hepatic fibrosis is reversible and is a necessary way for the development of various chronic liver diseases to cirrhosis. The search of genes related to hepatic fibrosis and the understanding of molecular mechanisms of hepatic fibrosis occurrence and development, thereby providing theoretical basis for diagnosis and treatment of hepatic fibrosis, and is a research hotspot at present.
The microRNA (microRNA, miRNA) is an endogenous non-coding regulation RNA with the length of about 21-22 nt, can act on target mRNA to degrade the target mRNA or inhibit the translation of the target mRNA, plays an important negative regulation role in gene expression, and participates in a plurality of important biological processes such as development, cell differentiation, cell proliferation, cell death and the like in vivo. A large amount of biological data show that miRNA can regulate about 30% of genes of human bodies, participate in various biological regulation ways, participate in the occurrence and development processes of various human diseases, and are important candidate diagnosis markers and potential therapeutic targets of the diseases. Recent researches show that miRNA (micro ribonucleic acid) plays an important role in the development of hepatic fibrosis. However, the research results are all from chip-based real-time quantitative PCR technology, the integrity and accuracy of the obtained data are all to be verified, and the high-throughput sequencing technology provides an effective strategy for efficiently and sensitively detecting the expression profile of miRNA. Several mirnas have been found to regulate cytokines involved in liver fibrosis formation or to promote or slow the progression of fibrosis by regulating HSC activation proliferation, apoptosis, etc. Research shows that miRNA-27 can restore HSC to a resting state by inhibiting the proliferation of the HSC, thereby inhibiting the occurrence of hepatic fibrosis. miR-1273g-3p is also considered to be a miRNA molecule closely related to liver fibrosis, and the transfer of miR-1273g-3p into HSC can regulate liver fibrosis by affecting the activation and apoptosis of HSC. In addition, miR-203 is down-regulated in liver fibrosis tissues and transformation growth factor-beta (TGF-beta) -induced HSC-T6 cells, and can be used as a regulator to regulate HSC proliferation. Up-regulation of miR-9a-5p can cause proliferation, migration, and activation of HSCs. The research can indicate that miRNA is closely related to the occurrence and development of hepatic fibrosis, and suggests that miRNA regulation of HSC activation, proliferation, apoptosis and migration is one of the mechanisms of the occurrence and development of hepatic fibrosis. In a CCl 4-induced hepatic fibrosis model, miR-125a-5p and miR-29a are down-regulated to inhibit the activation and proliferation of HSC, and the miR-125a-5p and miR-29a can be a new target point for hepatic fibrosis treatment. At present, no research indicates that miRNA-6766-3p can be used as a target for hepatic fibrosis treatment.
Disclosure of Invention
The invention aims to provide new application of miRNA-6766-3p and related biological materials.
In a second aspect, the present invention is directed to a medicament.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
in a first aspect of the invention, novel uses of miRNA-6766-3p and related biomaterials are provided.
The first aspect of the present invention provides use of any one of the following substances (1) to (5) in the preparation of a medicament for preventing and/or treating liver fibrosis.
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p; (3) a miRNA-6766-3p mimetic; (4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2); (5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1), (2) and (3) is shown in SEQ ID NO. 1.
Secondly, the present invention provides the use of any one of the following substances (1) to (5) in at least one of the following substances (a) to (d).
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p; (3) a miRNA-6766-3p mimetic; (4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2); (5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
(a) Preparing a product for inhibiting expression of a TGF beta type II receptor; (b) preparing a product for inhibiting the expression of COLLAGEN I, α -SMA and Ki 67; (c) preparing a product for inhibiting the expression of TIMP3 and TIMP 1; (d) preparing products for promoting expression of MMP2 and MMP 9.
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1), (2) and (3) is shown in SEQ ID NO. 1.
Preferably, the expression in (a), (b), (c) and (d) is at least one of mRNA expression and protein expression.
Third, the present invention provides the use of any one of the following substances (1) to (5) in at least one of the following substances (e) to (f).
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p; (3) a miRNA-6766-3p mimetic; (4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2); (5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
(e) Preparing a product for inhibiting stellate cell proliferation; (f) preparing a product for inhibiting stellate cell migration.
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1), (2) and (3) is shown in SEQ ID NO. 1.
Preferably, the stellate cells of (e), (f) are derived from the liver.
Fourthly, the present invention provides the use of any one of the following substances (1) to (5) in at least one of the following substances (h) to (j).
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p; (3) a miRNA-6766-3p mimetic; (4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2); (5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
(h) Preparing products for inhibiting the expression of P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2 mRNA; (i) preparing a product for inhibiting expression of SMAD3, SMAD4, P38MAPK and ERK proteins; (j) preparing products for inhibiting phosphorylation of SMAD2 and SMAD 3.
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1), (2) and (3) is shown in SEQ ID NO. 1.
Fifth, the present invention provides use of a substance capable of inhibiting the expression of (1) or (2) in at least one of the following (a ') to (d').
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p.
(a') preparing a product for promoting expression of a TGF beta type II receptor; (b') preparing a product for promoting expression of COLLAGEN I, α -SMA and Ki 67; (c') preparing a product for promoting the expression of TIMP3 and TIMP 1; (d') preparing a product for inhibiting the expression of MMP2 and MMP 9.
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1) and (2) is shown in SEQ ID NO. 1.
Preferably, the substance capable of inhibiting the expression of (1) is an miRNA-6766-3p inhibitor.
Preferably, the miRNA-6766-3p inhibitor is a nucleic acid molecule shown as SEQ ID NO. 3.
Preferably, the expression of (a '), (b'), (c '), (d') is at least one of mRNA expression and protein expression.
Sixthly, the present invention provides a use of a substance capable of inhibiting the expression of (1) or (2) in at least one of the following (e ') to (f').
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p.
(e') preparing a product for promoting proliferation of stellate cells; (f') preparing a product for promoting migration of stellate cells.
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1) and (2) is shown in SEQ ID NO. 1.
Preferably, the substance capable of inhibiting the expression of (1) is an miRNA-6766-3p inhibitor.
Preferably, the miRNA-6766-3p inhibitor is a nucleic acid molecule shown as SEQ ID NO. 3.
Preferably, the stellate cells of (e '), (f') are derived from liver.
Seventh, the present invention provides use of a substance capable of inhibiting the expression of (1) or (2) in at least one of the following (h ') to (j').
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p.
(h') preparing a product for promoting expression of P38MAPK, SMAD4, SMAD3, ERK1, SMAD2 mRNA; (i') preparing a product for promoting expression of SMAD3, SMAD4, P38MAPK and ERK proteins; (j') preparing a product for promoting phosphorylation of SMAD2 and SMAD 3.
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1) and (2) is shown in SEQ ID NO. 1.
Preferably, the substance capable of inhibiting the expression of (1) is an miRNA-6766-3p inhibitor.
Preferably, the miRNA-6766-3p inhibitor is a nucleic acid molecule shown as SEQ ID NO. 3.
In a second aspect of the present invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier and any one of the following substances (1) to (5);
(1) miRNA-6766-3 p; (2) a precursor of miRNA-6766-3 p; (3) a miRNA-6766-3p mimetic; (4) a DNA molecule encoding the miRNA-6766-3p of (1) or the precursor of the miRNA-6766-3p of (2); (5) an expression cassette, a recombinant vector or a transgenic cell comprising the DNA molecule of (4).
Preferably, the nucleic acid sequence of miRNA-6766-3p in (1), (2) and (3) is shown in SEQ ID NO. 1.
Preferably, the pharmaceutically acceptable carrier comprises liposomes, nanoparticles.
Preferably, the administration mode of the medicament comprises oral administration and intravenous injection.
The invention has the beneficial effects that:
the invention discovers for the first time that miRNA-6766-3p and related biological materials can be used for preventing and/or treating hepatic fibrosis, achieves the effect of preventing and/or treating hepatic fibrosis by inhibiting proliferation, migration and fibrosis indexes of hepatic stellate cells, and can be used as a medicament for preventing and/or treating hepatic fibrosis.
Compared with the traditional therapeutic medicine, the medicine containing miRNA-6766-3p or related biomaterials has the advantages of easy synthesis, easy detection, accurate quantification, capability of increasing the stability and improving the affinity of the medicine after chemical modification, capability of effectively positioning to a target organ through a special medicine delivery system and the like, and can greatly improve the specificity and the targeting property of the treatment of hepatic fibrosis diseases.
Drawings
FIG. 1 is a graph showing the results of different miRNA expression in Exosomes of 3-D cultured human embryonic stem cells (3D-hESC-Exosomes) compared to Exosomes of 2-D cultured human embryonic stem cells (2D-hESC-Exosomes): wherein A is microarray heat map (fold change ≧ 2, P < 0.05); b is a scatter plot of 3D-hESC-Exosomes differentially expressed with miRNAs significant in expression from 2D-hESC-Exosomes; c is a volcano plot of 3D-hESC-Exosomes and 2D-hESC-Exosomes differentially expressed miRNAs.
FIG. 2 is a graph showing the results of the expression levels of different miRNAs in 2D-hESC-Exosomes and 3D-hESC-Exosomes: wherein A is a relative expression profile of hsa-miR-5194, hsa-miR-6511b-5p, hsa-miR-500a-5p, hsa-miR-6793-5p, hsa-miR-4259 in 2D-hESC-Exosomes and 3D-hESC-Exosomes; b is a relative expression quantity diagram in hsa-miR-4690-5p, hsa-miR-6734-5p, hsa-miR-6785-5p, hsa-miR-6766-3p, hsa-miR-4728-5p and hsa-miR-3652 in 2D-hESC-Exosomes and 3D-hESC-Exosomes; c is a CT value graph after hsa-miR-5194, hsa-miR-6511b-5p, hsa-miR-500a-5p, hsa-miR-6793-5p and hsa-miR-4259qPCR in 2D-hESC-Exosomes and 3D-hESC-Exosomes; d is a CT value chart after hsa-miR-4690-5p, hsa-miR-6734-5p, hsa-miR-6785-5p, hsa-miR-6766-3p, hsa-miR-4728-5p and hsa-miR-3652qPCR in 2D-hESC-Exosomes and 3D-hESC-Exosomes: denotes p < 0.05; denotes p < 0.01; denotes p < 0.001; ns denotes p > 0.05.
FIG. 3 is a graph showing the results of miR-6766-3p Mimic (miR-6766-3p Mimic)/miR-6766-3 p Mimic NC (miR-6766-3p Mimic negative control) co-transfecting HEK-293T cells with h-TGFBR2-3UTR-WT/h-TGFBR2-3UTR-MUT dual fluorescent vector: wherein A is a schematic diagram of the putative binding sites of miR-6766-3p and h-TGFBR2-3UTR-WT/h-TGFBR2-3UTR-MUT respectively; b is a luciferase report activity diagram of miR-6766-3p Mimic/miR-6766-3p Mimic NC after HEK-293T cells are co-transfected with h-TGFBR2-3UTR-WT/h-TGFBR2-3UTR-MUT double-fluorescence vector respectively: denotes p < 0.001; ns denotes p > 0.05.
FIG. 4 is a graph of the results of the effects of miR-6766-3p Mimic and miR-6766-3p Inhibitor on the expression of TGF beta R II of LX2 cells: wherein A is a miR-6766-3p Mimic/miR-6766-3p Mimic NC and LX2 cell transfection relative expression quantity graph; b is a graph of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the relative expression of TGF beta R II mRNA of LX2 cells; c is a graph of the effect of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on TGF beta RII mRNA expression; d is a cellular immunofluorescence staining result graph of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the expression of TGF beta R II protein of LX2 cells; e is a statistical result chart of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the expression of the TGF beta R II protein; f is a cellular immunofluorescence staining result graph of the influence of miR-6766-3pINhibitor/miR-6766-3p Inhibitor NC on the expression of TGF beta R II protein of LX2 cells; g is a statistical result chart of the influence of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on the expression of TGF beta R II protein: denotes p < 0.05; denotes p < 0.01; denotes p < 0.001; represents p < 0.0001; ns denotes p > 0.05.
FIG. 5 results of the effect of miR-6766-3p Mimic and miR-6766-3p Inhibitor on COLLAGNE I, alpha-SMA and Ki67 protein expression of LX2 cells are shown: wherein A is a cellular immunofluorescence staining result graph of influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on expression of COLLAGNE I, alpha-SMA and Ki67 proteins of LX2 cells; b is a statistical result chart of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the COLLAGLNE I protein expression of LX2 cells; c is a statistical result chart of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the alpha-SMA protein expression of LX2 cells; d is a statistical result chart of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the Ki67 protein expression of LX2 cells; e is a cellular immunofluorescence staining result graph of influence of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on expression of COLLAGNE I, alpha-SMA and Ki67 proteins of LX2 cells; f is a statistical result chart of the influence of miR-6766-3pINhibitor/miR-6766-3p Inhibitor NC on the collagine I protein expression of LX2 cells; g is a statistical result graph of the influence of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on the expression of alpha-SMA protein of LX2 cells; h is a statistical result chart of the influence of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on the expression of KI67 protein of LX2 cells: denotes p < 0.05; denotes p < 0.01; denotes p < 0.001; ns denotes p > 0.05.
FIG. 6 is a graph showing the effect of miR-6766-3p Mimic and miR-6766-3p Inhibitor on COLLAGNE I, alpha-SMA, TIMP3, TIMP1, MMP2, MMP9 mRNA expression of LX2 cells: wherein A is an influence graph of miR-6766-3p Mimic/miR-6766-3p Mimic NC on expression of COLLAGNE I, alpha-SMA, TIMP3, TIMP1, MMP2 and MMP9 mRNA of LX2 cells; b is a graph showing the effect of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on COLLAGNE I, alpha-SMA, TIMP3, TIMP1, MMP2, and MMP9 mRNA expression of LX2 cells: denotes p < 0.05; denotes p < 0.01; ns denotes p > 0.05.
FIG. 7 is the effect of miR-6766-3p Mimic and miR-6766-3p Inhibitor on LX2 cell proliferation and migration: wherein A is a graph of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the growth rate of LX2 cells; b is a graph of the influence of miR-6766-3pINhibitor/miR-6766-3p Inhibitor NC on the growth rate of LX2 cells; c is an migration index chart of miR-6766-3p Mimic/miR-6766-3pMimic NC on wound surface recovery of LX2 cells; d is a migration index chart of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on wound surface recovery of LX2 cells: denotes p < 0.05; ns denotes p > 0.05.
FIG. 8 is a graph showing the effect of miR-6766-3P Mimic on the expression of TGF-. beta.RII fibrosis pathway-associated proteins (TGF-. beta.RII, SMAD2, P-SMAD2, SMAD3, P-SMAD3, SMAD4, P38MAPK and ERK): wherein A is an immunoblot result graph of the effect of miR-6766-3P Mimic/miR-6766-3pMimic NC on the expression of TGF beta RII fibrosis pathway-associated proteins (TGF beta RII, SMAD2, P-SMAD2, SMAD3, P-SMAD3, SMAD4, P38MAPK and ERK); b is a cellular immunofluorescence staining result graph of the influence of miR-6766-3p Mimic/miR-6766-3p Mimic NC on the expression of Smads pathway-associated proteins (p-SMAD2, p-SMAD3 and SMAD 4); c is a statistical result chart of the influence of miR-6766-3pMimic/miR-6766-3p Mimic NC on the expression of Smads pathway-associated proteins (p-SMAD2, p-SMAD3 and SMAD 4); d is a cellular immunofluorescence staining result graph of miR-6766-3P Mimic/miR-6766-3P Mimic NC on the influence of non-Smads pathway-associated protein (P38MAPK and ERK1) expression; e is a statistical result chart of the effect of miR-6766-3P Mimic/miR-6766-3P Mimic NC on the expression of non-Smads pathway-associated proteins (P38MAPK and ERK 1): denotes p < 0.05; denotes p < 0.01; denotes p < 0.001; ns denotes p > 0.05.
FIG. 9 is a graph showing the effect of miR-6766-3P Inhibitor on the expression of TGF-. beta.RII fibrosis pathway-associated proteins (TGF-. beta.RII, SMAD2, P-SMAD2, SMAD3, P-SMAD3, SMAD4, P38MAPK and ERK): wherein A is an immunoblot result graph of the influence of miR-6766-3P Inhibitor/miR-6766-3 pIninhibitor NC on the expression of TGF beta RII fibrosis pathway-associated proteins (TGF beta RII, SMAD2, P-SMAD2, SMAD3, P-SMAD3, SMAD4, P38MAPK and ERK); b is a cellular immunofluorescence staining result graph of the influence of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on the expression of Smads pathway-associated proteins (p-SMAD2, p-SMAD3 and SMAD 4); c is a statistical result chart of the influence of miR-6766-3p Inhibitor/miR-6766-3p Inhibitor NC on the expression of Smads pathway-associated proteins (p-SMAD2, p-SMAD3 and SMAD 4); d is a cellular immunofluorescence staining result graph of the influence of miR-6766-3P Inhibitor/miR-6766-3P Inhibitor NC on the expression of non-Smads pathway-associated proteins (P38MAPK and ERK 1); e is a statistical plot of the effect of miR-6766-3P Inhibitor/miR-6766-3P Inhibitor NC on the expression of non-Smads pathway-associated proteins (P38MAPK and ERK 1): denotes p < 0.05.
FIG. 10 is a graph showing the effect of miR-6766-3P Mimic and miR-6766-3P Inhibitor on P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2mRNA expression: a is a result graph of the influence of miR-6766-3P Mimic/miR-6766-3P Mimic NC on the expression of P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2 mRNA; b is a result chart of the influence of miR-6766-3P Inhibitor/miR-6766-3P Inhibitor NC on P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2mRNA expression: denotes p < 0.05; denotes p < 0.01; denotes p < 0.001; ns denotes p > 0.05.
Detailed Description
The present invention will be described in further detail with reference to specific examples.
It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers. The materials, reagents and the like used in the present examples are commercially available reagents and materials unless otherwise specified.
The reagents used in this example were analytical grade reagents and were commercially available from a regular channel.
The transfection reagent for cell experimental transfection in this example and miR-6766-3p Mimic NC (purchased from Sharp Bomb, Guangzhou, supplied by Sharp Bomb and responsible for interpretation), miR-6766-3p Mimic (5'-UGAUUGUCUUCCCCCACCCUCA-3', SEQ ID NO.2), miR-6766-3p Inhibitor NC (purchased from Sharp Bomb, Guangzhou, supplied by Sharp Bomb and responsible for interpretation), miR-6766-3p Inhibitor NC (3 '-ACUAACAGAAGGGGGUGGGAGU-5', SEQ ID NO. 3).
Example 12 on-chip sequencing of exosome (2D-hESC-Exosomes) and miRNAs content of 3D-cultured human embryonic stem cells (3D-hESC-Exosomes)
2.2D culture of human embryonic stem cells: pre-laying Matrigel to prepare a culture plate special for human embryonic stem cells: diluted Matrigel (DMEM/F12: Matrigel ═ 100:1) was pre-plated in six-well plates at a volume of 2 mL/well, and the plates were returned to CO2Incubating in an incubator for more than 24 hours; digestion and passage: selecting human embryonic stem cells with good state (good state: 4-5 days after hESC passage, the cell coverage rate reaches 70% -80%, cloning human embryonic stem cells (hESC) with regular edges and no differentiated cells, removing the culture medium, adding 1mL of calcium-magnesium-free PBS to clean the cells, removing the medium, adding 1mL of ReLeSRTM(STEMCELL) and aspirate in 1 minute, and place the cells back in CO2After 2 minutes incubation in the incubator, 1mL of mTeSR1 medium was added to each well, the plates were gently tapped to try to dislodge the digested cells from the plate bottom, and the cells were gently pipetted into small clumps (about ten or more hESCs) using a 1mL disposable pipette. Inoculation: the pre-plated Matrigel well plate was removed, the Matrigel dilution was aspirated, 3mL mTeSR1 was added and 10. mu.M Y-27632(Rocki) was added to increase cell seeding viability, the cell pellet suspension was aspirated and coated and 2.5mL serum-free mTeSR was addedTM1 ratio of 1:6 in wells of medium) and the plate was shaken crosswise to suspend the cells evenly in the culture medium, and the medium was changed every day. And (3) harvesting the supernatant:starting on day three, cell supernatants were harvested and stored at-80 ℃ for exosome isolation.
2.3D culture of human embryonic stem cells: pre-laying Pluronic-F68 to make low adhesion pores: diluting Pluronic-F68 with DMEM/F12 medium to obtain diluted Pluronic-F68(DMEM/F12: Pluronic-F68: 1 (volume ratio)); the diluted Pluronic-F68 was plated in a well plate, which was placed in CO2And (5) incubation in an incubator. Digestion and passage: selecting culture holes with coverage rate of 70-80%, regular clone edges and no differentiated cells, removing culture medium by suction, adding 1mL calcium-magnesium-free PBS to clean cells, removing culture medium by suction, adding 1mL GCDR (cell dissociation reagent), and returning CO2Incubate for 5 minutes in the incubator, then aspirate the GCDR in the well, add 1mL mTeSR1 media, blow the cells down and pipette into a single cell suspension. Inoculation: sucking 10 mu L of single cell suspension, staining trypan blue, and counting by using a blood counting chamber; taking out the pore plate with the pre-paved Pluronic-F68, sucking out Pluronic-F68 diluent, adding 2mL mTeSR1 and adding 10 μ M Y-27632(Rocki) to improve the survival rate of cell inoculation, sucking cell suspension containing 50 ten thousand single cells to inoculate the pores, and shaking the pore plate in a cross way to enable the cells to be evenly suspended in the culture solution; liquid changing: after 48h, half a day per well was changed, and during the subsequent culture, Rocki was no longer added to the medium; and (3) harvesting the supernatant: and (3) collecting the waste culture medium of each liquid change from the 3 rd day, filtering by using a sterile membrane of 0.22 mu m, and then loading into a 50mL sterile centrifuge tube for subsequent separation and purification of exosome.
3. The method for extracting the exosome comprises the following steps: collecting filtered 2D cultured human embryonic stem cells and 3D cultured human embryonic stem cell conditioned medium, centrifuging at 4 deg.C for 10min at 1000g, and collecting supernatant; centrifuging the collected supernatant at 4 ℃ for 20min at 2000g, and collecting the supernatant; centrifuging the collected supernatant at 4 ℃ for 30min at 10000g, and collecting the supernatant; centrifuging the collected supernatant at 110000g for 70min, discarding the supernatant, and resuspending the precipitate by using a phosphate buffer solution; and centrifuging 110000g for 70min again, discarding the supernatant, resuspending the precipitate with a small amount of phosphate buffer solution, and filtering and sterilizing with a 0.22-micrometer filter membrane to obtain the exosome derived from the 2D and 3D cultured human embryonic stem cells.
4. 2D-hESC-Exosomes and 3D-hESC-Exosomes are respectively taken to extract miRNA in Exosomes for sequencing on a computer. The method comprises the following specific steps: extracting sample RNA; detecting the quality of RNA; preparing a fluorescence labeling probe, carrying out Cy fluorescence labeling on the 3' end of miRNA, and synthesizing a 60-mer fluorescence probe for hybridization with a chip by adopting a SurePrint in-situ inkjet synthesis technology; hybridizing the chip, namely taking a certain amount of quality test standard sample, and hybridizing the quality test standard sample with the miRNA chip; image acquisition and data analysis. The results are shown in FIG. 1: compared with 2D-hESCs-Exosomes, 39 miRNAs were up-regulated, 29 miRNAs were down-regulated (>1.5 fold) in 3D-hESCs-Exosomes, and the expression of 963 miRNAs was unchanged.
Example 2 qRT-PCR validation of expression of miRNA
Total RNA was extracted from 2D-hESC-Exosomes and 3D-hESC-Exosomes miRNAs using RNAioso Plus (Takara 9109) according to the instructions.
The cDNA was obtained by RNA reverse transcription reaction in a total volume of 10. mu.L, including 2. mu.L of 5 XPrimeScript Buffer (for Real Time), 0.5. mu.L of PrimeScript RT Enzyme Mix I, 0.5. mu.L of Specific Primer (2. mu.M), 1. mu.L of total RNA (500 ng/. mu.L) and 6. mu.L of RNase Free dH2And O. The reaction step comprises reacting at 42 ℃ for 15min, reacting at 85 ℃ for 5sec, and storing at 4 ℃; after the reaction was complete 20. mu.L RNase Free dH was added2O, make up to 30 μ L final volume. The instrument used was Veriti 96. The reverse transcription primer was designed and synthesized by Shanghai Bioengineering Co., Ltd. (the specific sequence is shown in Table 1).
TABLE 1 reverse transcription primer sequences in example 2
qRT-PCR reaction: the total volume of the reaction system is 5 μ L, and the reaction system comprises: 2.5. mu.L Premix Ex Taq II (Tli RNaseH Plus), 0.1. mu.L 50 XROX Reference Dye, 0.1. mu.L PCR Forward Primer (10. mu.M), 0.1. mu.L PCR Reverse Primer (10. mu.M), 1.2. mu.L RNase Free dH2O and 1. mu.L of cDNA obtained by reverse transcription. Using ABI Prism 7900 fluorescent quantitative PCR instrument, the PCR reaction conditions are as follows: one cycle at 95 ℃ for 30 sec; 40 cycles of 95 ℃ for 0.05sec, 60 ℃ for 1 min. Amplification reactionThe forward primer and the reverse primer were designed and synthesized by Shanghai Bioengineering Co., Ltd. (the specific sequences are shown in Table 2). After normalization of U6 abundance, pass 2-ΔΔCTThe method calculates the relative level of gene expression. Relative changes of the mirnas in each group were compared with U6 as an internal control. The results are shown in FIG. 2: according to analysis of Venny tool, selecting the first 11 miRNAs with relatively high expression quantity, and verifying through qRT-PCR; among these miRNAs, the expression of miR-6766-3p (sequence: UGAUUGUCUUCCCCCACCCUCA, SEQ ID NO.1) is obviously up-regulated, and the relative abundance of the miR-6766-3p in 3D-hESCs-Exosomes is the highest, which is consistent with the results of the previous miRNAs chip shown in FIG. 1.
TABLE 2 qRT-PCR primer sequences in example 2
Example 3 Dual luciferase assay validation that miR-6766-3p targets binding to TGF beta type II receptor (TGF beta R II)
To elucidate the role of miR-6766-3p in liver fibrosis, the inventors first performed bioinformatic analysis using TargetScan, and as a result, showed that TGF β II is involved in the formation of fibrosis as a receptor for TGF β. And (3) detecting by adopting a dual-luciferase reporter gene, and further researching whether the miR-6766-3p directly targets the TGF beta RII. The method comprises the steps of constructing h-TGFBR2-3UTR-WT and h-TGFBR2-3UTR-MUT double-fluorescence carriers (purchased from Hanhengshen Biotechnology (Shanghai) Co., Ltd.), respectively fully and uniformly mixing with 5pmol hsa-miR-6766-3p Mimic/miR-6766-3p Mimic NC, then co-transfecting into HEK-293T cells, collecting the cells, adding Luciferase Assay Reagent II (Luciferase detection Reagent II), and determining and recording a Fireflyfluciferase value which is an internal reference value; add 100. mu.L of Stop&Reagent, measuring and recording the value of Renilla luciferase, wherein the value is the luminescent value of the reporter gene. The results are shown in FIG. 3: ectopic overexpression of miR-6766-3p obviously inhibits the luciferase activity of wild-type TGF beta RII 5' UTR, but does not influence the activity of mutant luciferase. The above numbermiR-6766-3p is shown to play an anti-fibrosis role by negatively regulating the expression of TGF beta R II through direct binding with the 5' UTR sequence of TGF beta RII.
Example 4 experiment of Up-regulating miR-6766-3p levels in human hepatic stellate cells
(1) Grouping of cells
At the logarithmic proliferation phase of LX2 cells, trypsinized and passaged. At 1.25X 105Individual cells/well (30% confluency) were plated in 6-well plates and polylysine treated 0.5cm microslips placed in the wells. When the cells are attached (more than 6h), the control group is divided according to the required experiment (normal LX2 cells are not treated at all); treatment group (TGF β treated LX2 cells for 48 hours); miR-6766-3p Mimic NC + treatment group (cells are transfected with 25nM negative control miR-6766-3p Mimic NC and then treated with TGF beta on LX2 cells for 48 hours); the miR-6766-3p Mimic + treatment group (cells are transfected with 25nM miR-6766-3p Mimic and then treated with TGF beta to treat LX2 cells for 48 hours) comprises four groups.
(2) Cell transfection
Carrying out transfection treatment when the cell growth density reaches 40%, dissolving 5nM dry powder miR-6766-3p Mimic/miR-6766-3p Mimic NC with sterilized 250 mu L DEPC water in advance, storing to a final concentration of 20 mu M, and subpackaging and storing; inoculation 2X 105Placing LX2 cells into a 24-pore plate culture well containing a proper amount of complete culture medium, so that the cell density during transfection can reach 30-50%; using 30. mu.L of 1 xriboFECTTMDiluting 1.25 mu L of 20 mu M miRNA Mimic by CP Buffer, and gently mixing; add 3. mu.L of riboFECTTMCP Reagent, gently whipping and mixing, and incubating at room temperature for 15min to obtain riboFECTTMCP mixed liquor; will riboFECTTMAdding the CP mixed solution into a double-antibody-free complete culture medium, and gently mixing uniformly; then adding TGF beta with the final concentration of 10ng/mL into each group of LX2 cells for induction activation treatment; place the plates in 37 ℃ CO2And culturing for 48h in an incubator, and collecting each group of cells for detection.
(3) Extraction of cellular RNA and qPCR experiments
Digesting each group of cells by pancreatin until the cells can be lightly blown down by a pipette or a gun head, blowing down all adherent cells, andgently blowing off the cells; collecting the mixture into a centrifugal tube again; centrifuging about 1000g for 5min to precipitate cells; adding appropriate amount of RNAioso Plus (750 μ L) to each group of cell pellets, standing at room temperature for 5 minutes, and then centrifuging at 12000g at 4 ℃ for 5 minutes; carefully aspirate the supernatant and move into a new centrifuge tube (do not aspirate the pellet); adding chloroform (1/5 volume of RNAioso Plus) into the lysate, covering the centrifuge tube, mixing until the solution is milky, and standing at room temperature for 5 min; centrifuging at 12000g and 4 ℃ for 15 minutes, carefully taking out a centrifuge tube from the centrifuge, and carefully sucking the supernatant on the uppermost layer to transfer to another new centrifuge tube; adding isopropanol with the volume of 0.5 time of that of the RNAioso Plus into the supernatant, turning the centrifuge tube upside down, fully mixing the mixture evenly, and standing the mixture for 10 minutes at room temperature; centrifuging at 12000g for 10min at 4 ℃, taking the RNA sediment at the bottom of the test tube, carefully cleaning to remove the supernatant, adding 75% ethanol with the same amount, slightly reversing the direction to wash the wall of the centrifugal tube, centrifuging at 7500g for 5min at 4 ℃, and carefully discarding the supernatant; the centrifuge tube lid was opened and the pellet was dried at room temperature for several minutes. Then adding a proper amount of RNase-free water to dissolve the precipitate; the RNA concentration is determined by Nanodrop, and the ratio of OD260/OD280 is preferably 1.7-2.1. The RNA is reversely transcribed into cDNA, and the reaction system of the RNA reverse transcription is as follows: PrimeScript RT Enzyme Mix I2. mu.l; 500 nanograms of RNA; RNase Free dH2O to 10 microliters; the reaction procedure was as follows: 15 minutes at 37 ℃; 5 seconds at 85 ℃; and finally 4 ℃. The obtained cDNA can be frozen in an ultra-low temperature refrigerator at minus 80 ℃ or directly enter a real-time quantitative PCR experiment.
The resulting cDNA was diluted 10-fold with enzyme-free water, followed by RT-qPCR detection: the nucleotide sequence design primer is synthesized by Shanghai Biotech service Co., Ltd, and specifically as shown in Table 3, the RT-qPCR reaction system is as follows:Green PCR Master Mix 10μL，Forward primer 0.5μL，Reverse primer 0.5μL，cDNA 5μL，RNase Free ddH2o4 μ L, reaction program as follows: pre-denaturation at 95 deg.C for 5 min; cycling for 40 times at 95 ℃ for 15sec, 60 ℃ for 15sec, and 72 ℃ for 32 sec; dissolution curve: 60-95 ℃. GAPDH is used as an internal reference, and the expression level of a target gene is analyzed and selected relative to the internal reference2-△△CTThe method performs the calculation.
TABLE 3 primers for RT-qPCR reaction system in example 4
Finally, qPCR data analysis was performed: all the tests are repeated by using three biological samples, each biological sample is repeatedly tested for three times, and internal reference genes are utilized to perform the test according to the ratio of 2-△△CtData processing and Graphpad mapping are carried out, and the results of the influence of miR-6766-3p Mimic on the expression of the TGF beta RII gene are shown in a figure 4: as can be seen in A in FIG. 4, the miR-6766-3p Mimic + treatment group successfully transfects miR-6766-3p Mimic; in FIG. 4B, it is shown that: after miR-6766-3p Mimic infection, the expression of TGF beta RII mRNA is obviously reduced. The above data and example 3 data indicate that miR-6766-3p can negatively regulate the expression of TGF beta RII by directly binding to the 5' UTR sequence of TGF beta RII, thereby exerting an anti-fibrotic effect.
The influence results of miR-6676-3p on stellate cell activation related indexes alpha-SMA and type I collagen, anti-fiber degradation related indexes TIMP3 and TIMP1, and fiber degradation related indexes MMP2 and MMP9 mRNA expression are shown in A in FIG. 6: miR-6676-3p has negative regulation and control effects on mRNA expression of alpha-SMA, type I collagen, TIMP3 and TIMP1, and positive regulation and control effects on mRNA expression of MMP2 and MMP9, and shows that up-regulation of miR-6676-3p in LX2 cells has significant promotion effect on anti-fibrosis.
(4) Cellular immunofluorescence staining
Four groups of LX2 cells were collected and washed 3 times with PBS, 3 minutes each time; fixing the slide by 4% paraformaldehyde for 15 minutes, and soaking and washing the slide by PBS for 3 times, each time for 3 minutes; 0.5% Triton X-100 (in PBS) was allowed to permeate for 20 minutes at room temperature; soaking and washing the slide with PBS for 3 times, each time for 3 minutes, dripping normal goat serum on the slide, and sealing for 30 minutes at room temperature; sucking the sealing liquid by absorbent paper, not washing, dripping enough diluted anti-TGF beta RII + anti-alpha-TUBULIN, anti-Ki 67, anti-Collagen I and anti-alpha-SMA primary antibody on each slide, putting the slide into a wet box, and incubating overnight at 4 ℃; PBST immersion-washing the climbing sheet for 3 times, each time for 3 minutes, dripping diluted Alexa Fluor 488 goat anti-rabbit IgG/Alexa Fluor 488 goat anti-mouse IgG (CST) fluorescent secondary antibody after sucking the liquid, incubating for 1 hour at 37 ℃, PBST immersion-washing for 3 times, each time for 3 minutes; counterstaining the nucleus: dripping DAPI, incubating for 5 minutes in a dark place, staining the core of the specimen, washing for 4 times by PBST, and washing off the redundant DAPI; sucking the liquid on the slide, sealing the slide by using a sealing liquid containing an anti-fluorescence quenching agent, and observing and acquiring an image under a laser confocal microscope. The results are shown in fig. 4 at D: immunofluorescence analysis shows that the protein expression level of TGF beta RII is reduced due to miR-6676-3p overexpression. The results are shown in FIG. 5 as A: immunofluorescence analysis shows that the protein levels of the profibrotic markers a-SMA and type I collagen are reduced due to miR-6676-3p overexpression. The above results indicate that the expression of TGF-beta RII and the downstream fibrosis-promoting marker of TGF-beta RII are mediated by miR-6676-3 p.
(5) CCK8 determination of cell proliferation
Cell suspensions were prepared by digesting each set of cells: cells were counted and plated in 96-well plates (approx. 2X 10)4/well), cultured in an incubator at 37 ℃ until the cells adhere to the walls for about 4 hours. 10 mu LCCK8 was added, or a culture medium containing 10% CCK8 (ready-to-use) was prepared directly and added as a stock solution, and the culture was carried out for 1 hour, 2 hours, 4 hours and 6 hours, respectively. The 96-well plate was taken out and put in a microplate reader for detection with a wavelength of 450 nm. The results are shown in FIG. 7, A: miR-6766-3p overexpression significantly reduced the growth rate of TGF β -treated LX2 cells.
(6) Wound healing experiments
To determine the migration and repair capacity of each group of cells, we performed a cell scratch experiment. The specific operation steps are as follows: a marker pen is firstly used at the back of the 6-hole plate, and then the 6-hole plate is touched by a ruler, and transverse lines are uniformly drawn and transversely pass through the holes approximately every 0.5-1 cm. Each hole passes through 5 lines. About 5X 10 additions to the wells5And (4) culturing the cells until the confluence degree reaches more than 90%. The head is placed against the ruler and the mark is made perpendicular to the transverse line on the back. The cells were washed 3 times with PBS, the scratched cells were removed, and serum-free DMEM high-sugar medium was added. Put in 5% CO at 37 DEG C2Culturing in an incubator. Samples were taken at 0h and 48h time points and photographed under a 100-fold microscope. The migration index is calculated by comparing the cells to the scratch area at 24h with 0hNumber of cells per square centimeter of domain migration. The results are shown in fig. 7, C: the wound healing test result shows that miR-6766-3p Mimic remarkably inhibits migration of LX2 cells, and reduces the activation level of LX2 cells to a certain extent.
Example 5 experiment to Down-regulate miR-6766-3p levels in human hepatic stellate cells
(1) Grouping of cells
At the logarithmic proliferation phase of LX2 cells, trypsinized and passaged. At 1.25X 105Individual cells/well (30% confluency) were plated in 6-well plates and polylysine treated 0.5cm microslips placed in the wells. When the cells are attached (more than 6h), the control group is divided according to the required experiment (normal LX2 cells are not treated at all); treatment group (TGF β treated cells 48 h); miR-6766-3p Inhibitor NC + treatment group (cells are transfected with 25nM negative control miR-6766-3p Inhibitor NC and treated with TGF beta on LX2 cells for 48 hours); the miR-6766-3p Inhibitor + treatment group (cells are transfected with 25nM miR-6766-3p Inhibitor and treated with TGF beta to treat LX2 cells for 48 hours) comprises four groups.
(2) Cell transfection
And (3) carrying out transfection treatment when the cell growth density reaches 40%, dissolving 5nM dry powder miR-6766-3p Inhibitor reagent/miR-6766-3 pInhibitor Inhibitor negative control NC with sterilized 250 mu L DEPC water in advance, storing to the final concentration of 20 mu M, and subpackaging and storing. The transfection procedure was the same as in (2) in example 4.
(3) Detection of correlation indicators
The specific experimental procedures of extraction of cellular RNA, qPCR experiment, cellular immunofluorescence staining, CCK8 cell proliferation assay, and wound healing assay were the same as in (3) to (6) of example 4.
The results of the effect of miR-6766-3p Inhibitor on TGF beta RII are shown in FIG. 4 as C, F and G: miR-6676-3p Inhibitor promotes the expression of TGF beta RII protein/gene.
The influence result of miR-6766-3p Inhibitor on stellate cell activation related indexes alpha-SMA and type I collagen expression is shown as E in figure 5: miR-6766-3p Inhibitor promotes the expression of stellate cell activation related indexes alpha-SMA and type I collagen.
The results of the influence of miR-6766-3p Inhibitor on alpha-SMA, type I collagen, the indexes related to anti-fiber degradation TIMP3 and TIMP1 and the indexes related to fiber degradation MMP2 and MMP9 mRNA expression are shown in B in figure 6: the miR-6766-3p Inhibitor promotes alpha-SMA, type I collagen, TIMP3 and TIMP1, and inhibits the mRNA expression of MMP2 and MMP 9.
The above results show that: the miR-6676-3p in the LX2 cell is up-regulated to have a remarkable promoting effect on the anti-fibrosis aspect, and the expression of TGF beta RII and a downstream fibrosis-promoting marker of TGF beta is mediated by the miR-6676-3 p.
The effect of miR-6766-3p Inhibitor on proliferation and migration of TGF β -treated LX2 cells is shown in figure 7: in FIG. 7B is shown: the proliferation speed of the LX2 cell expressed by the knocked-down miR-6766-3p is obviously increased; in fig. 7D indicates: influence of miR-6766-3p Inhibitor on wound recovery of LX2 cells, namely that miR-6766-3p Inhibitor promotes migration of LX2 cells.
The above results show that: miR-6766-3p not only regulates the expression of LX2 cell fibrosis promoting markers, but also regulates secondary reactions such as cell proliferation and migration, and finally regulates the progress of hepatic fibrosis.
Example 6 inhibition of LX2 cell activation by miR-6766-3p through the TGF β RII/SMADS pathway
In order to further clarify the mechanism of miR-6766-3p/TGF beta RII axis regulation of hepatic fibrosis, the miR-6766-3p Mimic mimics, the miR-6766-3p Inhibitor and negative controls thereof are respectively transfected into LX2 cells, and the expression level of TGF beta RII is detected. Smads, an important downstream signaling molecule for TGF β 1, has been shown to disrupt the balance of ECM synthesis and degradation, leading to fibrosis. Therefore, we further evaluated the effect of miR-6766-3p on activation and phosphorylation of Smads.
(1) Grouping of cells
At the logarithmic proliferation phase of LX2 cells, trypsinized and passaged. At 1.25X 105Individual cells/well (30% confluency) were plated in 6-well plates and polylysine treated 0.5cm microslips placed in the wells. When the cells are attached (more than 6h), the control group is divided according to the required experiment (normal LX2 cells are not treated at all); treatment group (TGF β treated cells 48 h); miR-6766-3p Mimic NC + treatmentGroup (cells transfected 50nM negative control miR-6766-3p Mimic NC and treated LX2 cells with TGF beta for 48 hours); a miR-6766-3p Mimic + treatment group (cells are transfected with 50nM miR-6766-3p Mimic and then treated with TGF beta to LX2 cells for 48 hours); miR-6766-3p Inhibitor NC + treatment group (cells are transfected with 100nM negative control miR-6766-3p Inhibitor NC and treated with TGF beta on LX2 cells for 48 hours); miR-6766-3pInhibitor + treatment group (cells are transfected with 100nM miR-6766-3p Inhibitor and treated with TGF beta to LX2 cells for 48 hours) for six groups.
(2) Cell transfection
The cell transfection procedure was the same as in (2) of examples 4 and 5.
(3) Extraction of cellular RNA and qPCR experiments
The procedures of extraction of cellular RNA and qPCR experiment were the same as in (3) to (4) of example 4, and the differences were only in the primer design and nucleotide sequence synthesis by shanghai bio-technology service ltd, as shown in table 4.
The results of the effect of miR-6766-3P Mimic on the expression of P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2mRNA are shown in A in FIG. 10: after miR-6766-3P is over-expressed, the mRNA expression of P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2 is obviously reduced.
The effect of miR-6766-3P Inhibitor on P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2mRNA expression is shown as B in FIG. 10: miR-6766-3P Inhibitor enables P38MAPK, SMAD4, SMAD3, ERK1 and SMAD2mRNA expression to be obviously up-regulated.
The effect of miR-6766-3p Mimic on the expression of Smads pathway-associated proteins (p-SMAD2, p-SMAD3 and SMAD4) is shown in B, C in FIG. 8: smads pathway related protein expression is obviously reduced after miR-6766-3p is over-expressed.
The results of the effect of miR-6766-3P Mimic on the expression of non-Smads pathway-associated proteins (P38MAPK and ERK1) are shown in D, E in FIG. 8: the expression of non-Smads pathway related proteins is obviously reduced after miR-6766-3p is over-expressed.
The effect of miR-6766-3p Inhibitor on the expression of Smads pathway-associated proteins (p-SMAD2, p-SMAD3, SMAD4) is shown in B, C in FIG. 9: miR-6766-3p Inhibitor enables Smads pathway-associated protein expression to be remarkably up-regulated.
The results of the effect of miR-6766-3P Inhibitor on non-Smads pathway-associated proteins (P38MAPK and ERK1) are shown in D, E in FIG. 9: miR-6766-3p Inhibitor significantly upregulates non-Smads pathway-associated protein expression.
TABLE 4 primers for RT-qPCR reaction system in example 6 (internal control GAPDH primer same as SEQ ID NO.44 and SEQ ID NO.45)
(4) Extraction of cell total protein and Western blot experiment
Preparing cell lysate (1mL RIPA lysate, adding 10 mu LPMSF before use to make the final concentration 1mmol), discarding the culture solution from each well of a six-well plate, washing with 1mL PBS for 1 time, adding 80 mu L of the prepared lysate into each well, and performing shake decomposition at 4 ℃ for 30 minutes. Centrifugation was carried out at 12,000rpm for 15min at 4 ℃ to collect the supernatant, total protein concentration was determined by BCA method, and relative expression of cellular TGF-. beta.RII downstream Smads pathway proteins and non-Smads pathway proteins was detected by western blot assay.
The results of the effect of miR-6766-3P Mimic on TGF beta RII fibrosis pathway-associated proteins (TGF beta RII, SMAD2, P-SMAD2, SMAD3, P-SMAD3, SMAD4, P38MAPK and ERK) are shown in A in FIG. 8: after miR-6766-3p is over-expressed, the expression of TGF beta RII fibrosis pathway related protein is obviously reduced.
The results of the effect of miR-6766-3P Inhibitor on TGF-. beta.RII fibrosis pathway-associated proteins (TGF. beta.RII, SMAD2, P-SMAD2, SMAD3, P-SMAD3, SMAD4, P38MAPK and ERK) are shown in A in FIG. 9: miR-6766-3p Inhibitor enables the expression of TGF beta RII fibrosis pathway related proteins to be remarkably up-regulated.
Therefore, the up-regulation of the expression level of miR-6766-3p in human liver stellate cells has obvious inhibition effect on the expression of hepatic fibrosis related indexes. Therefore, the application of the compound in the research and development of hepatic fibrosis drugs has a good application prospect.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> university of southern China's science
Application of <120> miRNA-6766-3p in preparation of medicine for preventing and/or treating hepatic fibrosis
<130>
<160> 55
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> RNA
<213> Homo sapiens
<400> 1
ugauugucuu cccccacccu ca 22
<210> 2
<211> 22
<212> RNA
<213> Artificial sequence
<400> 2
ugauugucuu cccccacccu ca 22
<210> 3
<211> 22
<212> RNA
<213> Artificial sequence
<400> 3
acuaacagaa ggggguggga gu 22
<210> 4
<211> 50
<212> DNA
<213> Artificial sequence
<400> 4
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactgcttg 50
<210> 5
<211> 50
<212> DNA
<213> Artificial sequence
<400> 5
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactctcca 50
<210> 6
<211> 50
<212> DNA
<213> Artificial sequence
<400> 6
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactcctca 50
<210> 7
<211> 50
<212> DNA
<213> Artificial sequence
<400> 7
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactcaccc 50
<210> 8
<211> 50
<212> DNA
<213> Artificial sequence
<400> 8
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactgaggg 50
<210> 9
<211> 50
<212> DNA
<213> Artificial sequence
<400> 9
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgaccaccat 50
<210> 10
<211> 50
<212> DNA
<213> Artificial sequence
<400> 10
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactctcac 50
<210> 11
<211> 50
<212> DNA
<213> Artificial sequence
<400> 11
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactgtcag 50
<210> 12
<211> 50
<212> DNA
<213> Artificial sequence
<400> 12
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacttcagc 50
<210> 13
<211> 50
<212> DNA
<213> Artificial sequence
<400> 13
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacccatcc 50
<210> 14
<211> 50
<212> DNA
<213> Artificial sequence
<400> 14
gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactcctga 50
<210> 15
<211> 26
<212> DNA
<213> Artificial sequence
<400> 15
aaaatatgga acgcttcacg aatttg 26
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence
<400> 16
agtgcagggt ccgaggtatt 20
<210> 17
<211> 17
<212> DNA
<213> Artificial sequence
<400> 17
tgggagggga gaggcag 17
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence
<400> 18
gcgttgaggg gagaatgagg 20
<210> 19
<211> 16
<212> DNA
<213> Artificial sequence
<400> 19
cgcgcggctg gaggtg 16
<210> 20
<211> 19
<212> DNA
<213> Artificial sequence
<400> 20
gcgtgtgggt tctgggttg 19
<210> 21
<211> 19
<212> DNA
<213> Artificial sequence
<400> 21
gcgtgattgt cttccccca 19
<210> 22
<211> 16
<212> DNA
<213> Artificial sequence
<400> 22
tgggagggcg tggatg 16
<210> 23
<211> 21
<212> DNA
<213> Artificial sequence
<400> 23
cgcgtaatcc ttgctacctg g 21
<210> 24
<211> 18
<212> DNA
<213> Artificial sequence
<400> 24
ctgcaggcag aagtgggg 18
<210> 25
<211> 17
<212> DNA
<213> Artificial sequence
<400> 25
ggagcaggcg aggctgg 17
<210> 26
<211> 19
<212> DNA
<213> Artificial sequence
<400> 26
gcgtgagggg tttggaatg 19
<210> 27
<211> 18
<212> DNA
<213> Artificial sequence
<400> 27
cgcagttggg tctagggg 18
<210> 28
<211> 23
<212> DNA
<213> Artificial sequence
<400> 28
ctcgcttcgg cagcacatat act 23
<210> 29
<211> 22
<212> DNA
<213> Artificial sequence
<400> 29
acgcttcacg aatttgcgtg tc 22
<210> 30
<211> 24
<212> DNA
<213> Artificial sequence
<400> 30
atgtctaggg tctagacatg ttca 24
<210> 31
<211> 20
<212> DNA
<213> Artificial sequence
<400> 31
ccttgccgtt gtcgcagacg 20
<210> 32
<211> 24
<212> DNA
<213> Artificial sequence
<400> 32
actgagcgtg gctattcctc cgtt 24
<210> 33
<211> 21
<212> DNA
<213> Artificial sequence
<400> 33
gcagtggcca tctcattttc a 21
<210> 34
<211> 20
<212> DNA
<213> Artificial sequence
<400> 34
ttgtgggacc tgtggaagta 20
<210> 35
<211> 20
<212> DNA
<213> Artificial sequence
<400> 35
ctgttgttgc tgtggctgat 20
<210> 36
<211> 22
<212> DNA
<213> Artificial sequence
<400> 36
gatacccctt tgacggtaag ga 22
<210> 37
<211> 21
<212> DNA
<213> Artificial sequence
<400> 37
ccttctccca aggtccatag c 21
<210> 38
<211> 20
<212> DNA
<213> Artificial sequence
<400> 38
gggacgcaga catcgtcatc 20
<210> 39
<211> 20
<212> DNA
<213> Artificial sequence
<400> 39
tcgtcatcgt cgaaatgggc 20
<210> 40
<211> 20
<212> DNA
<213> Artificial sequence
<400> 40
ctgacaggtc gcgtctatga 20
<210> 41
<211> 20
<212> DNA
<213> Artificial sequence
<400> 41
ggcgtagtgt ttggactggt 20
<210> 42
<211> 20
<212> DNA
<213> Artificial sequence
<400> 42
gtgagaagcc gcaggaagtc 20
<210> 43
<211> 20
<212> DNA
<213> Artificial sequence
<400> 43
ccgtggtagg tgaacttggg 20
<210> 44
<211> 20
<212> DNA
<213> Artificial sequence
<400> 44
gaagatggtg atgggatttc 20
<210> 45
<211> 19
<212> DNA
<213> Artificial sequence
<400> 45
gaaggtgaag gtcggagtc 19
<210> 46
<211> 20
<212> DNA
<213> Artificial sequence
<400> 46
aagactcgtt ggaaccccag 20
<210> 47
<211> 20
<212> DNA
<213> Artificial sequence
<400> 47
tccagtaggt cgacagccag 20
<210> 48
<211> 21
<212> DNA
<213> Artificial sequence
<400> 48
ccaatcatcc tgctcctgag t 21
<210> 49
<211> 20
<212> DNA
<213> Artificial sequence
<400> 49
ccagaagggt ccacgtatcc 20
<210> 50
<211> 20
<212> DNA
<213> Artificial sequence
<400> 50
catcgagccc cagagcaata 20
<210> 51
<211> 21
<212> DNA
<213> Artificial sequence
<400> 51
gtggttcatc tggtggtcac t 21
<210> 52
<211> 24
<212> DNA
<213> Artificial sequence
<400> 52
cctgcgacct taagatttgt gatt 24
<210> 53
<211> 24
<212> DNA
<213> Artificial sequence
<400> 53
cagggaagat gggccggtta gaga 24
<210> 54
<211> 21
<212> DNA
<213> Artificial sequence
<400> 54
ccgacacacc gagatcctaa c 21
<210> 55
<211> 21
<212> DNA
<213> Artificial sequence
<400> 55
aggaggtggc gtttctggaa t 21