Related protein for controlling rice glume color character and coding gene thereof

文档序号：1948424 发布日期：2021-12-10 浏览：16次中文

阅读说明：本技术 一种控制水稻颖壳色彩性状的相关蛋白及其编码基因 (Related protein for controlling rice glume color character and coding gene thereof ) 是由吴挺开徐培洲吴先军王锦豪宋佳贺方永琼周婷婷夏俭西经廖泳祥陈晓琼于 2021-08-30 设计创作，主要内容包括：本发明提供了一种控制水稻颖壳色彩性状的相关蛋白,属于水稻基因工程技术领域,所述相关蛋白命名为OsBG1,所述相关蛋白的氨基酸序列如SEQ ID No.1所示,通过基因编辑敲除OsBG1蛋白的编码基因能够获得使水稻黄色颖壳变为棕色的基因,可用于三系杂交制种中筛选杂合或纯合杂交种。本发明还提供了一种控制水稻颖壳色彩性状的相关蛋白的编码基因。(The invention provides a related protein for controlling the color character of rice glume, belonging to the technical field of rice genetic engineering, wherein the related protein is named as OsBG1, the amino acid sequence of the related protein is shown as SEQ ID No.1, a gene for changing the rice yellow glume into brown can be obtained by knocking out the coding gene of OsBG1 protein through gene editing, and the related protein can be used for screening heterozygous or homozygous hybrid seeds in three-line hybrid seed production. The invention also provides a coding gene of the related protein for controlling the rice glume color character.)

1. The related protein for controlling the color traits of the rice glumes is named as OsBG1, and the amino acid sequence of the related protein is shown as SEQ ID No. 1.

2. The gene for coding the protein related to the control of the rice glume color trait of claim 1, wherein the nucleotide sequence of the coding gene is shown as SEQ ID No. 2.

3. Use of the coding gene of claim 2 in breeding brown glume rice varieties and/or screening hybrids of three lines.

4. A gene for controlling rice to produce brown glumes is characterized in that the nucleotide sequence of the gene is shown as any one of SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

5. The gene for controlling generation of brown glume in rice of claim 4, wherein the gene is obtained by performing gene editing on the encoding gene of claim 2, the gene editing is performed by CRISPR/CAS9 system, and the nucleotide sequence of the target sequence adopted by the gene editing is shown as SEQ ID No. 6.

6. Use of the gene for controlling brown glume production in rice according to claim 4 or 5 in screening heterozygous hybrids or homozygous hybrids in three-line hybrid breeding.

7. An sgRNA for knocking out the encoding gene of claim 2, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID No.7 and SEQ ID No. 8.

8. A knock-out vector for knocking out the encoded gene of claim 2, wherein the nucleotide sequence of the promoter of the knock-out vector OsU6 is shown in SEQ ID nos. 9 and 10.

9. A target sequence for knocking out the coding gene of claim 2, wherein the nucleotide sequence of the target sequence is shown as SEQ ID No.11 and SEQ ID No. 12.

10. A method of preparing a brown glume rice line, comprising:

constructing a CRISPR/CAS9 system expression vector containing the target sequence as set forth in claim 5;

transforming the expression vector into a non-brown glume rice variety;

screening and identifying transgenic homozygous lines with knocked-out encoding genes according to claim 2, and obtaining brown glume rice lines.

Technical Field

The invention belongs to the technical field of rice genetic engineering, and particularly relates to a related protein for controlling rice glume color traits and a coding gene thereof.

Background

Through years of research and development, the three-line hybrid rice seed production technology in China has matured day by day to provide a powerful guarantee for the rice production in China. However, the hybrid rice seed production technology still has the problems of low seed production efficiency, complex seed homozygosity screening work and the like. Therefore, the whole mechanized mixed seeding seed production developed successively becomes an effective path for solving the problem. Since mixed hybrid seeds of a parent and a hybrid parent exist in mixed seeding seed production, proper molecular markers or seed character markers are needed to distinguish the hybrid seeds from the parents. At present, the color of the rice glume is considered to be one of the most practical marks, so that the development of a breeding technology for quickly modifying the glume color of a rice variety can effectively promote the development of a hybrid rice mixed sowing seed production technology.

Compared with the normal rice glume color, the abnormal rice glume color has various colors, and the colors are frequently shown as follows: brown, golden yellow, black, etc. The number of cloned genes of the flavonoid compound, which are related to the lignin metabolic pathway and cause the color change of the rice glume, is mainly 3. An important gene chalcone isomerase gene OsCHI located on the No.3 chromosome of rice and in a flavonoid metabolic pathway is completely not expressed in a Dasheng transposon insertion mutant ghl, so that the total flavonoid content in ghl glumes and internodes is greatly increased, and the glumes and the internodes are golden yellow. The brown glume inhibitory factor IBFl codes a F-box protein containing a Kelch repetitive sequence domain, and can be used as an inhibitor in the biosynthesis process of flavonoid compounds and can inhibit the deposition of brown pigment in rice glume furrows. The cinnamyl alcohol dehydrogenase gene OsCAD2 has strong dehydrogenase activity, is necessary for the synthesis of coniferyl alcohol and sinapyl alcohol which are lignin precursors, is mainly responsible for the biosynthesis of lignin monomers of rice stems, is positioned on chromosome 2, and in gh2, due to the mutation of OsCAD2, the content and the composition of lignin are changed, so that golden yellow glume and internode phenotypes of rice appear. In addition, the gene Bh4 which is positioned on the long arm of the No.4 chromosome and controls the black glume of the wild rice encodes an amino acid transporter, the functional disorder of the amino acid transporter is caused by the deletion of 22bp of basic groups, so that the black glume of the wild rice is converted into the normal glume color of the common cultivated rice, and the evolution analysis shows that the gene is a long-term artificial selection process.

In order to adapt to the living environment, plants synthesize various secondary metabolites during their long-term evolution. Flavonoid compounds are a large class of secondary metabolites produced by plant bodies during adaptation to the natural environment. To date, more than 4000 flavonoid compounds are probably discovered, and the flavonoid compounds are phenylpropanoid metabolites ubiquitous in plants and play an important role in the growth and development processes of the plants. The flavonoid (Flavonoids) compound has remarkable functions in the aspects of antioxidation, antibiosis, antivirus and the like, so the flavonoid (Flavonoids) compound has a far-reaching prospect in the aspects of being used as medicines, food additives and the like. Flavonoids are present in plants in either the bound or free form. The accumulation of flavone and anthocyanin can obviously enhance the stress resistance of plants.

The synthetic pathway of flavonoid compounds in plants mainly comprises two genes, one is a structural gene in the synthetic pathway of the compounds, and the other is a regulatory gene in the synthetic pathway. In vivo flavonoid synthesis pathway in plants (fig. 18): chalcone synthase (CHS) catalyzes the first step of flavonoid biosynthesis by directing carbon flux from the general phenylpropyl metabolism to the metabolic pathway of flavonoids. CHS is the first key enzyme in the synthesis path of the flavonoid compounds, 4-coumaraphthalein-COA and propanedipiaraphthalein-COA generate dihydroflavonol chalcone isomerase (CHI) to catalyze dihydroflavonol under the action of the enzyme, and the dihydroflavonol enters the metabolic path of the flavonoid compounds to generate various flavonoid substances.

The flavonoid compound plays a vital role in the whole growth and development process of plants, is beneficial to human health and has extremely high nutritional value. According to the existing literature, the flavonoid compounds mainly have the following effects. First, flavonoids are involved in plant resistance responses to biotic and abiotic stresses. Righin verified the effect of flavones in plant resistance to UV-B radiation by constructing transgenic Arabidopsis plants expressing FNS. Second, flavonoids are involved in the reproductive development of plants. When the corn and petunia lack flavonoids, normal pollen tubes cannot be formed. The functional defect is caused by adding flavonol from an external source, and the function of the pollen is recovered immediately. Third, in connection with plant flower color formation, the DFR gene of maize is transferred into morning glory, and new flower colors appear in morning glory. The antisense CHS gene sequence is introduced into morning glory, and the flower color is changed from purple to white. Fourth, flavonoid compounds have anticancer effects, and the dietary flavonoid fisetin found in many fruits and vegetables has been shown in preclinical research make internal disorder or usurp to inhibit cancer growth by altering cell cycle, angiogenesis, invasion and metastasis without any toxicity to normal cells. In addition, flavonoids inhibit bacteria and antibiotics. Flavonoids are important secondary metabolites in plants, but the mechanism of action of flavonoids in plants is still not well understood at present.

Among plants, flavonoids are regarded as important biological functions. For example, anthocyanins can absorb visible light to promote photosynthesis in plants, and are also essential for the color of flowers and fruits of plants. The flavonoid plays a role in interaction between animals and plants, for example, the astringency of leaves in plants is caused by a large amount of polyamine contained in the plants, so that the grazing of herbivores to the plants is prevented, and the leaves of the plants are well protected. In addition, researches show that pollen fertility in plants is influenced by flavonoid pathways, and the transportation of auxin is regulated by influencing the content of flavonoid, so that pollen is developed finally. The flavonoids play an important role in controlling the physiological development of plants and also play a role in protecting a series of abiotic stresses. Flavonol and anthocyanidin accumulate in leaf epidermis to bind with DNA to form a complex, protecting plants from oxidative damage. Similarly, the low-temperature stress experiment shows that the anthocyanin in the maize and arabidopsis seedlings is obviously accumulated under the low-temperature condition, which indicates that the anthocyanin plays a potential great role in resisting the low-temperature stress of plants. The anabolism of phenolic substances (such as salicylic acid) is an important endogenous substance for plants to resist the invasion of microorganisms, and flavonoids have a very important relationship with the catabolism and anabolism of salicylic acid.

Enzymes involved in the flavonoid biosynthetic pathway have been identified in several model plants such as Arabidopsis, maize, rice. By domain classification and comparison of conserved features for all genes and enzymes in the synthetic pathway, it appears that regulation of expression of these structural genes are closely linked together in time and space and are coordinated by a ternary complex consisting of R2R3-MYB, basic helix-loop-helix (bHLH) and WD40 class transcription factors. This MYB-bHLH-WD40(MBW) complex is responsible for the regulation of the genes encoding the enzymes involved in the later steps of the pathway for anthocyanin and condensed tannin biosynthesis. Although several genes encoding these three families of transcription factors have been identified, the respective roles of the bHLH and WD40 proteins, in particular, are involved in the regulation of this biosynthetic pathway. There are many gaps in current understanding, and better understanding of the regulatory mechanisms of the flavonoid pathway may facilitate the development of new biotechnological tools to produce value-added plants with optimal flavonoid content.

MYB is an N-terminal MYB domain and consists of more than 50 amino acids (R1, R2 and R3) which constitute an important transcription factor in plants. Through research, the MYB transcription factor plays a role mainly determined by two R repeated sequences (R2R3MYB proteins). The MYB-mediated flavonoid pathway is the most important in numerous functional studies on MYB transcription factors. The first MYB transcription factors that regulate the flavonoid pathway were discovered in maize in 1987 and included C1 (colorless 1) and PL1 (purple leaf 1) in addition to P1. The identification of C1 at that time indicated that plant transcription factors are closely related to mammalian transcription factors and constitute a milestone in plant molecular biology. For example, the regulation of the PA and anthocyanin pathways is determined primarily by the interaction of R3 in MYB with bHLH. However, not all flavonoid regulators fully fit this classification. For example, in potato studies a single domain was identified that is similar to MYB73 in soybean. MYB protein expression in purple meat was 44 times greater than in white meat, all suggesting that R2R 3-type MYB transcription factors play a role in the control of anthocyanin biosynthesis.

The bHLH protein, also known as MYC, is a regulator present in the flavonoid pathway. The bHLH proteins are so named for their conserved domains and constitute a family of transcription factors that range from yeast to humans and are widely distributed in plants. The earliest bHLH transcription factors were identified in the early 90 s of the 20 th century as regulators of cell proliferation and differentiation, myogenesis, or neurogenic genes, but they are also involved in a range of additional developmental processes in mammals. In plants, the first bHLH transcription factors that regulate the flavonoid pathway were discovered in maize in 1989, including B/R family members B and R, and later LC, Sn.

WD40 or WDR (WD repeat) proteins are involved in many eukaryotic cellular processes including cell division, vesicle formation and transport, signal transduction, RNA processing and transcriptional regulation. They are particularly involved in chromatin remodeling, by modifying histones, which can affect transcription. The WD40 proteins are believed to be devoid of any catalytic activity (DNA binding or regulation of target gene expression) and appear to be a docking platform, since they can interact with several proteins simultaneously.

Disclosure of Invention

In order to solve the technical problem of quickly modifying the glume color of a rice variety, the invention provides a related protein for controlling the glume color character of rice, which is named as OsBG1, and the gene for changing the yellow glume of the rice into brown can be obtained by knocking out the coding gene of OsBG1 protein through gene editing, so that the related protein can be used for screening heterozygous or homozygous hybrid seeds in three-line hybrid seed production.

The invention also provides a coding gene of the related protein for controlling the rice glume color character.

The invention is realized by the following technical scheme:

the invention provides a related protein for controlling the glume color character of rice, which is named as OsBG1, and the amino acid sequence of the related protein is shown as SEQ ID No. 1.

Based on the same invention concept, the invention provides a coding gene of related protein for controlling the color traits of rice glumes, and the nucleotide sequence of the coding gene is shown as SEQ ID No. 2.

An application of the coding gene of the related protein for controlling the color character of rice glume in cultivating brown glume rice variety and/or screening hybridization of three-line hybrid seeds.

Based on the same invention concept, the invention provides a gene for controlling rice to generate brown glume, and the nucleotide sequence of the gene is shown as any one of SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

Further, the gene is obtained by carrying out gene editing on a coding gene of related protein OsBG1, wherein the gene editing is carried out by a CRISPR/CAS9 system, and the nucleotide sequence of a target sequence adopted by the gene editing is shown as SEQ ID No. 6.

The application of the gene for controlling brown glume generation in three-line hybrid seed production to screen hybrid or homozygous hybrid is disclosed.

An sgRNA for knocking out a coding gene of related protein OsBG1, wherein the nucleotide sequence of the sgRNA is shown as SEQ ID No.7 and SEQ ID No. 8.

A knockout vector for knocking out a coding gene of related protein OsBG1 is disclosed, wherein a nucleotide sequence of a promoter OsU6 of the knockout vector is shown as SEQ ID No.9 and SEQ ID No. 10.

A target sequence for knocking out a coding gene of related protein OsBG1 is disclosed, and the nucleotide sequence of the target sequence is shown as SEQ ID No.11 and SEQ ID No. 12.

A method of preparing a brown glume rice line, the method comprising:

constructing a CRISPR/CAS9 system expression vector containing the target sequence;

transforming the expression vector into a non-brown glume rice variety;

screening and identifying a transgenic homozygous strain with the knocked-out coding gene of related protein OsBG1 to obtain a brown glume rice strain.

A method of breeding a brown glume rice variety, the method comprising:

taking a brown glume rice strain line as a non-recurrent parent, taking a restorer line or maintainer line variety with excellent agronomic characters as a recurrent parent to carry out hybridization to obtain a hybrid progeny, wherein the brown glume rice strain is prepared by the preparation method of the brown glume rice strain;

using molecular marker to make auxiliary selection on the filial generation to obtain the material with the above-mentioned gene for controlling rice to produce brown glume and the agronomic character of which is liable to recurrent parent, continuously backcrossing 5-8 generations and selfing 1 generation to obtain BC_5-8F₂And selecting a strain with the brown glume character without separation to obtain a brown glume rice variety with stable inheritance.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

1. the related protein for controlling the color traits of the rice glumes is named as OsBG1, and the gene for changing the rice yellow glumes into brown can be obtained by knocking out the coding gene of the OsBG1 protein through gene editing, so that the related protein can be used for screening heterozygous or homozygous hybrid seeds in three-line hybrid seed production.

2. The coding gene of the related protein for controlling the color character of the rice glume can code the related protein OsBG1, a rice variety with dark brown glume can be obtained after the coding gene of OsBG1 is knocked out through gene editing, heterozygous or homozygous hybrid seeds can be screened in three-line hybrid seed production, and the application of the coding gene of OsBG1 in the field of controlling the color of the rice glume is provided for the first time.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a photograph comparing plants of wild Yixiang YX1B and mutant bg 1: wherein 1 is wild type Yixiang 1B, and 2 is bg1 as mutant.

FIG. 2 is a comparison of ears for wild type Jatropha 1B and mutant bg 1: wherein 1 is wild type Yixiang 1B, and 2 is bg1 as mutant.

FIG. 3 is a glume alignment chart for wild type Jatropha 1B and mutant bg1, respectively: wherein 1 is wild type Yixiang 1B, and 2 is bg1 as mutant.

FIG. 4 is a preliminary mapping of OsBG1 gene: wherein the preliminary designation is between the labeled primers 1-19 and 1-21.

FIG. 5 is a graph showing the measurement of leaf pigment a content: wherein 1 is a young ear period wild type Yixiang 1B, 2 is a young ear period mutant bg1, 3 is a wax ripening period wild type Yixiang 1B, and 4 is a wax ripening period mutant bg 1.

FIG. 6 is a graph showing the measurement of leaf pigment b content: wherein 1 is a young ear period wild type Yixiang 1B, 2 is a young ear period mutant bg1, 3 is a wax ripening period wild type Yixiang 1B, and 4 is a wax ripening period mutant bg 1.

FIG. 7 is a graph showing the measurement of anthocyanin content: wherein 1 is wild type Yixiang 1B, and 2 is bg1 as mutant.

FIG. 8 is a diagram of a chromosome Manhattan analysis of gene mapping combined with Mutatmap whole genome resequencing.

FIG. 9 is a sequencing diagram of SNP locus Sanger of OsBG1 gene: wherein 1 is wild type Yixiang 1B, and 2 is bg1 as mutant.

FIG. 10 is a base sequence diagram: the indicated sites were the mutation sites of mutant bg 1.

FIG. 11 is an amino acid sequence diagram: the indicated 207 site is the mutation site of mutant bg 1.

FIG. 12 is a schematic diagram of the construction of a knock-out vector.

Fig. 13 is a diagram of CRISPR/Cas9 transgenic plants: wherein 1 is receptor background material Nip, 2, 3 and 4 are positive gene knockout homozygous strains KO-1, KO-2 and KO-3.

Fig. 14 is a diagram of CRISPR/Cas9 transgenic plant spikelets: wherein 1 is receptor background material Nip, 2, 3 and 4 are positive gene knockout homozygous strains KO-1, KO-2 and KO-3.

Fig. 15 is a seed picture of CRISPR/Cas9 transgenic plants: wherein 1 is receptor background material Nip, 2, 3 and 4 are positive gene knockout homozygous strains KO-1, KO-2 and KO-3.

FIG. 16 is a diagram of transcriptome analysis: wherein 1 is the statistics of differential genes, 2 is the Wien graph of differential genes, 3 is the statistical pie graph of differential transcription factors, and 4 is the classification graph of differential transcription factors.

Figure 17 is a statistical heat map of the different substances in the metabolome analysis.

FIG. 18 is a diagram showing the metabolic pathway of flavone in the background art.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

In order to solve the technical problems, the embodiment of the invention provides the following general ideas:

the invention researches the functions of OsBG1 protein and coding genes thereof, which is based on national hybrid rice backbone parent Yixiang 1B, and obtains a glume color mutant named bg1(brown grain1) by screening in a chemical mutagenesis reagent Ethyl Methane Sulfonate (EMS) mutagenesis library. The character of glume color conversion is found to be controlled by the single recessive nuclear gene through genetic analysis. After further research, the gene mutant is found to generate needle-shaped brown spots from the glumes of the whole spike part of the gene mutant after the heading breaking period, and the color of the spots on the glumes is gradually deepened to dark brown along with the development progress.

LOC _ Os01g67220 gene (tentatively named OsBG1, brown grain1) encodes a cytoplasmic beta-glucosidase (related protein OsBG1), the main biological function of which is to hydrolyze salicin and mediate the accumulation of glume anthocyanin, so that the color of the glume anthocyanin is changed from yellow to brown, and at present, the OsBG1 gene is not cloned or is involved in a biological pathway for mediating the formation of glume anthocyanin.

Based on the above, the application provides a related protein for controlling the color traits of rice glumes and a coding gene thereof.

The following will explain in detail a related protein for controlling the color property of rice glume and its coding gene in accordance with the present application with reference to examples and experimental data.

Example 1

The embodiment provides glume color phenotype identification and genetic analysis of a brown glume mutant bg1 and a wild Yixiang 1B, and solves the application in the process of screening heterozygous/homozygous hybrid seeds in three-line hybrid seed production by analyzing the action of cytoplasmic beta-glucosidase encoded by the gene in glume anthocyanin generation mechanism research and comprehensive color glume rice variety cultivation.

(I) test materials

(1) Wild type Yixiang YX1B (indica type rice maintainer line) was bred by Sichuan Yibin farm institute, introduced by Sichuan university of agriculture rice institute and stored.

(2) The brown glume mutant bg1 is a comprehensive color glume mutant screened by the inventor from a mutant library formed by EMS (ethyl methane sulfonate) mutagenesis constructed on the background of indica rice maintainer line variety Yixiang 1B, and backcrossed with wild type Yixiang 1B for multiple generations, wherein the mutant character of the glume color can be stably inherited (as shown in figures 1-3).

(II) test method

The indica rice variety YX1B is subjected to EMS chemical mutagenesis, and a stable genetic mutant with abnormal ear color and reduced seed setting rate is obtained by multiple generations of selfing, and is named as bg1(brown grain 1). And (3) hybridizing by taking bg1 as a female parent and taking a wild type YX1B as a male parent to construct a BC1F2 population for Mutmap sequencing. At the same time, the japonica rice variety NIP is used as a male parent to be hybridized with the japonica rice variety NIP to construct F₂The genetic mapping population is used for gene mapping. All experimental materials were planted alternately in the Yannan Ling water and Chengdu Wenjiang respectively

(2) Genetic analysis test of variants of holochromy glume

Hybridizing in 2018 summer in Sichuan Wenjiang with mutant bg1 as female parent and wild japonica rice 02408 and indica rice YX1B as male parent, planting the harvested F0 seed in 2018 winter in Hainan Ling water, and harvesting₁Selfing and planting in 2019 summer in Sichuan Wenjiang, and breeding F₁And F₂The population was analyzed for phenotypic statistics.

F is found by hybridizing bg1 with a japonica rice variety 02428₁The middle and progeny appeared as normal traits, in F₂The segregation ratio of the normal trait to the mutant trait in the population was 3:1(P < 0.05), confirming that the mutant bg1 used in this example is a recessive trait controlled by a single nucleo-gene (Table 1).

Table 1: genetic analysis of bg1

Example 2

In this example, agronomic trait observation statistics of wild type Yixiang YX1B (abbreviated as 1B), heald glume mutant bg1, CRISPR/Cas9-OsBG1 knockout lines KO-1, KO-2 and KO-3 (genes for controlling brown glume generation of rice are respectively shown as SEQ ID NO.3, 4 and 5) and wild type Nip are carried out.

From summer in 2018, bg1 and wild YX1B were alternately sown in Wenjiang river in Sichuan and Yangtze river in Hainan. When agricultural character investigation is carried out, 10 plants are randomly investigated in a non-edge row of the wild type and the mutant bg1 respectively, and the specifically investigated characters comprise: plant height (Plant height), main ear length (Panicle length) and Flag leaf length (Flag length), and taking the average value; these two groups of 10 random materials were taken to laboratory tests, each material was replicated three times, and the average value was determined, mainly including the Seed setting rate (degradation rate) of the thousand-grain weight (1000-grain weight).

Example 3

In this example, the location and cloning test of the candidate gene of rice glume variant bg1 was performed

(I) test materials

Mutant bg1, wild type Yixiang 1B and Nip (japonica rice variety) were all provided by the institute of Rice genetics laboratory of Sichuan university of agriculture.

(II) test method

(1) F is constructed by hybridizing mutant bg1 and japonica rice variety Nip₁Generation group, and selfing to obtain F₂Generation populations were used for genetic mapping. Construction of BC by backcrossing mutant bg1 with Yixiang 1B₁F₃The generation population is used for MutMap sequencing to perform gene fine positioning.

(2) Near isogenic pool construction

F from hybridization of bg1 with NIP₁Generation, F₁F obtained by selfing₂The population was isolated and gene mapping and analysis were performed using BAS (bulk stratification analysis). Firstly, respectively selecting 10 at randomAnd equally mixing and extracting DNA (deoxyribonucleic acid) pools from the bg1 of a single plant and the leaves of Nip, and obtaining 2 parent DNA pools for screening the polymorphic molecular markers among parents. F resulting from the hybridization of mutant bg1 with Nip₂Selecting 10 leaves of single plants with brown phenotype and 10 leaves of single plants with wild yellow glume normal phenotype from the segregating population, mixing and extracting DNA (deoxyribonucleic acid) pools with equal amount of 10 leaves, and respectively obtaining a dominant mixed pool and a recessive mixed pool for analyzing the linkage relation between the mutation character and the chromosome. Finally, F from the hybridization of mutant bg1 with Nip₂100 single plant leaves with brown glume phenotypes are selected from the population, and the DNA is extracted by adopting an improved CTAB method to divide the single plants for gene localization.

(3) Mapping primer synthesis and Gene mapping

Firstly, carrying out PCR amplification by using 512 pairs of SSR primers (the specific sequences are shown in http:// www.gramene.org/bd/markers) which are stored in the research room and are evenly distributed on 12 chromosomes of rice, and screening out 68 pairs of primers with polymorphism between bg1 and an NIP genome by agarose gel electrophoresis; subsequently, 27 pairs of selected polymorphic primers were used to detect dominant and recessive pools, and F constructed by bg1 and NIP₂Recessive individual plants in the population are subjected to gene primary positioning; in the initially positioned interval, according to the difference between nucleotide sequences of Nipponbare target regions of indica rice variety 9311 and japonica rice variety Nipponbare published by (http:// www.gramene.org) websites, Inde1 primers Indel 13 and Indel 14 (see table 2) are designed, the test result is shown in an electrophoresis chart 4 (initially determined to be between labeled primers 1-19 and 1-21), and the near gene pool and F constructed by bg1 and Nip are continuously detected₂198 recessive individuals in the population were mapped.

TABLE 2 PCR primers used in this experiment

Primer name	Forward primer sequence (5 '-3')	Reverse primer sequence (5 '-3')
			1-19	GTGATGGGAGAGCAGGAGAAGG	CGCAAGTGGACCTCTTATTGTGC
1-21	GTTAGGTTAACGGGATCTTGTTCG	ATGCAGTCTCCATCATCGAAGC
			Indel 13	TAATTTCTGGCACGTACGCATGG	GTAGCGATGCAACTACCAGTGAGC
Indel 14	AACGTGCTACGAGATAGTGTTTGC	CGTACGACATATCGACTATACAGAGG

Wherein the PCR reaction system (20 uL): taq enzyme (5U/uL)0.2uL, Primer (10mmol/L)2uL, dNTP (10mmol/L)0.3uL, DNA template (50-200 ng/. mu.L) 2uL, 10 XBuffer (25mM)2uL, ddH₂O13.5 uL. PCR reaction procedure: 95 ℃/5 min; 95 ℃/30s, 55 ℃/30s, 72 ℃/1min, steps 2-4, 34 cycles; 72 ℃/10min, 12 ℃/1 min.

The PCR amplification product was dissolved in 3.0% (7.5g agar powder in 300ml ddH)₂O), electrophoresed for about 45min-1h under the condition of constant voltage of 180V-200V, imaged by a Gel scanning imager (Bio-rad Gel Doc 2000) and recorded.

(4) Construction of linkage map

The single plant with the same type as the bg1 electrophoresis band is marked as I, the single plant with the same type as the Nip electrophoresis band is marked as II, and the heterozygous double-band single plantThe individuals without bands are marked III and IV and the statistics are given by comparison of F with the biological analysis software Mapmake3.0 software₂And (3) carrying out linkage analysis on the separation data of the molecular marker and the mutation character in the separation population, and converting the recombination value into a genetic map distance (cM).

As a result, the characters of the two SSR markers 1-19 and 2-21 at the short arm end of chromosome 1 are found to have a close linkage relationship, and the genetic distances are 0.16cM and 0.23cM respectively, so that the OsBG1 gene is preliminarily positioned in the interval.

(5) Fine localization and prediction of candidate genes

To further narrow the localization interval and confirm candidate genes, the laboratory used mutant bg1 for backcrossing with wild type eagle 1B and then BCF₃And randomly selecting 30 mutant single plants with brown glumes and 30 single plants with wild yellow glumes respectively in the population, and forming a mutant mixed pool and a wild mixed pool respectively by using the same amount of DNA for MutMap whole genome sequencing. And analyzing and reading the whole genome high-throughput sequencing result of the mutant by taking the wild-type phenotype mixed pool genome sequence as a reference group, wherein the sequencing depth is 30 layers. The sequencing data are completely compared with published Japanese fine reference genome (MSU Osa1 Release 7Annotation) by SOAP2 software, and short sequence segments at specific positions of chromosomes are screened out according to the initial positioning interval. Analyzing and interpreting Single Nucleotide Polymorphisms (SNP) SVs and InDels between the mutant and a Nipponbare reference group by using data analysis software such as SOAPsnp, SOAPsv, SOAPindel and the like, and screening out 3 SNPs sites with the scores of 1 which are specifically existed in the mutant bg1 in a positioning interval. By calculating the Delta SNP index, high Delta SNP index readings which are continuously distributed and have F2-read of more than or equal to 15 are selected, and a scatter plot of SNP loci on 12 chromosomes is obtained through data analysis. The high Δ SNP index scores and the continuous distribution of the sequences on the long arm of chromosome I are matched with our initial localization interval (as shown in FIG. 4). Therefore, the interval of the candidate gene is positioned between 40-41M of the short arm of the chromosome III, no gene related to glume color is reported, and research results show that OsBG1 controls glume color to change from yellowBrown color of the novel gene.

Mutmap whole genome sequencing data analysis results and mutant bg1 mutant phenotype and rice genome annotation website (http://rice.plantbiology.msu.ed/cgi-bin) And (a)http://plants.ensembl.org/ index.html) And (2) combining medium indica rice databases, screening within a positioning interval according to gene function annotations, and further analyzing to obtain that most of SNP sites are positioned on intergenic, intron or synonymous mutation, and only one SNP site is positioned on the 5 th exon of the LOC _ Os01g67220 and belongs to non-synonymous mutation. In order to confirm the reliability of the result of Mutmap re-sequencing, primers were designed for three SNP sites and deletion fragment given by the analysis company, PCR amplification was performed in the wild type and mutant respectively, and Sanger sequencing was performed (as shown in FIG. 8), and the result shows that SNP in which the site is not synonymous mutation is a single base mutation that is indeed occurred in the wild type and mutant, and matches the result given by the analysis company. The 671 th base of CDS region of the gene coding the protein is converted from C (cytosine) to T (adenine), so that the 234 th amino acid coded by the gene is mutated from G (glycine) to V (valine), and the base mutation can destroy the normal coding sequence of the protein to cause the function of the protein to be destroyed, therefore, LOC _ Os01G67220 is listed as a candidate gene of bg1 mutant.

Example 4

Brown glume mutant bg1 candidate gene CRISPR/CAS9 (Gene knockout) experiment

(I) test materials

Coli competence DH5 α used in this experiment was purchased from Beijing Panzhiji Biotechnology Ltd, and Agrobacterium EHA105 competent strain was purchased from Sichuan Mare Biotechnology Ltd.

(II) test method

1. Construction of CRISPR/Cas9-OsBG1 gene knockout vector

The cDNA of the mutant bg1 and Yixiang 1B, Nip are respectively used as templates to amplify the gene, the situation that the gene has high homology in the amino acid sequences of the coding regions of indica rice Yixiang 1B and japonica rice Nip is found, and the situation shows that the protein coded by the gene can possibly exert similar biological functions in indica rice Yixiang 1B and japonica rice Nip.

A nucleotide sequence of an OsBG1(LOC _ Os01g67220) gene in japonica rice Nippon (Nip) is used as a template, a specific region is selected, 1 independent knockout target site is designed, a BWA (BWA) (V) H-CAS9 BGK03 gene knockout vector is utilized, and a CRISPR/CAS9-OsBG1 vector is constructed by referring to a kit (Hangzhou Baige biology Co., Ltd.). The specific construction process is as follows:

(1) the following adapter primers were designed and synthesized to form sgRNA target sequences:

F:5’-GTTTTAGAGCTAGAAATAGCAAGTTAAAAT-3’(SEQ ID NO.7)；

R:5’-CAAAATCTCGATCTTTATCGTTCAATTTTA-3’(SEQ ID NO.8)；

OsU6 promoter for knock-out:

F:5’-AACTTATAAACCGCGCGCT-3’(SEQ ID NO.9)；

R:5’-TTGAATATTTGGGCGCGCGA-3’(SEQ ID NO.10)。

the target sequence for knocking out the target gene is as follows:

5’-TGTGTGGAAACTGCTAGATGCTACT-3’(SEQ ID NO.11)；

5’-AAACAGTAGCATCTAGCAGTTTCCA-3’(SEQ ID NO.12)。

(2) preparation of primer dimer

Dissolving the primer pair synthesized in the step (1) to 10 mu M by adding water, mixing according to the following reaction system, heating for 3 minutes at 95 ℃ in a PCR instrument, and then slowly reducing to 20 ℃ at about 0.2 ℃/second to obtain a primer dimer. The reaction system is as follows: annealing Buffer 18ul, gRNA target primer 1ul, adding ddH₂O, make up to 20 ul.

(3) The primer dimer was constructed into BWA (V) H vector. Mixing the components on ice according to the following reaction system, uniformly mixing, reacting at 20 ℃ for 1 hour, and transforming escherichia coli for later use to obtain an expression vector containing elements such as a promoter, a target sequence, gRNA and the like. The reaction system comprises the following steps: BWA (V) 2ul of H vector, 1ul of Oligo dimer, 1ul of enzyme mixture, and ddH₂O, make up to 10 ul.

2. Transformation of E.coli

(1) Taking out a tube of prepared escherichia coli competent cells from a refrigerator at the temperature of-80 ℃, and putting the escherichia coli competent cells on ice for thawing;

(2) adding 100 μ L of competent cell suspension into each 100ng of ligation product, mixing, and standing on ice for 30 min;

(3) heat shock is carried out for 30s at 42 ℃, and the mixture is quickly taken out and immediately placed on ice for 2 min;

(4) adding 500 μ L LB liquid culture medium without antibiotic, culturing at 37 deg.C and 200rpm for 1 hr to obtain activated bacteria liquid;

(5) centrifuging the activated bacterial liquid at 5000rpm for 1min, pouring out most of supernatant under aseptic condition, gently sucking and beating the mixed precipitate by using a pipette gun, sucking 100 mu L, transferring the bacterial liquid on a super clean bench and coating the bacterial liquid on an LB screening plate containing kanamycin;

(6) placing the LB solid culture medium plate coated with the bacterial liquid for about 10 minutes from the front side upwards, inverting the culture medium coated with the plate after the bacterial liquid is completely absorbed by the LB solid culture medium, and culturing overnight in a thermostat at 37 ℃;

(7) and (4) picking a single colony, and carrying out PCR detection on the bacterial liquid by using a P-OsBG1 primer. The primer pair P-OsBG1 is as follows:

P-OsBG1 KO-F:5'CCCAGTCACGACGTTGTAAA 3'(SEQ ID NO.13)；

P-OsBG1 KO-R:5'TCTCCAGCTTTGGTTTTT 3'(SEQ ID NO.14)。

wherein the PCR reaction program: 95 ℃/5 min; 35 cycles of 95 ℃/30s, 55 ℃/30s, 72 ℃/30 s; 72 ℃/10min, 12 ℃/1 min.

(8) The positive clones were picked up in 5ml of LB medium containing kanamycin (50mg/L), cultured at 37 ℃ for about 16 hours at 200rpm, and the resulting culture broth was stored to extract plasmids.

3. The E.coli Plasmid was extracted according to the instructions of the OMEGA Plasmid Extraction Kit, and the extracted Plasmid DNA was collected in a clean centrifuge tube and stored at-20 ℃.

4. Determination of plasmid sequence and sequence analysis

The positive clone plasmid was sent to Chengdu science and technology Co., Ltd for sequencing. And (3) carrying out sequence alignment on the sequencing result by using DNAMAN software, confirming the correctness of the gRNA sequence, and naming the positive cloning plasmid as CRISPR/Cas9-OsBG 1.

5. Agrobacterium transformation

(1) Chemical transformation method of agrobacterium

According to one plasmid: quickly taking out 100ul of competent cells from-80 ℃ and then relieving the heart to thaw; adding 10ul of the constructed CRISPR/Cas9-OsBG1 plasmid into 100ul of competent cells, and placing for 1h on ice; freezing in liquid nitrogen for 1 min; water bath at 37 deg.C for 2min to melt cells; immediately adding 5 times of LB liquid culture medium without antibiotics, and performing shake cultivation for 2-3 h at 28 ℃ and 170 rpm; centrifuging at 7000rpm for 2min, and suspending the cells in 100ul of LB liquid medium; coating on rifampicin and cana resistant plate, blow drying, and culturing at 28 deg.C for 2-3 days; carrying out PCR detection on bacterial liquid by using a hygromycin molecular marker P-OsBG1 primer, adding glycerol serving as a protective agent into a positive agrobacterium monoclonal capable of amplifying a target strip, and storing at-80 ℃ for later use.

(2) Agrobacterium impregnation method for transforming rice

(a) Induction of callus: sterilizing Nipponbare seeds with 75% alcohol for 1min, rinsing with sterile water for 3 times, rinsing with 40% sodium hypochlorite for 30min, rinsing with sterile water for 5 times, placing in a culture dish with filter paper, draining, inoculating on NMB culture medium with tweezers, and culturing at 28 deg.C under illumination for 7 days. Subcultured every 7 days. After 2-3 subcultures, good calli grown from the seeds were picked, subcultured on NMB medium, and cultured in the dark at 28 ℃ for 4 days.

(b) Activation of agrobacterium strain: adding 30ul of Agrobacterium stored at-80 ℃ in (1) into 3mL of YEP liquid medium containing rifampicin and kanamycin, and performing shake culture at 28 ℃ for 14 h; then 1mL of the suspension is taken to be put into 50mLYEP liquid culture medium containing rifampicin and kanamycin, and the suspension is subjected to shaking culture for 4 hours at the temperature of 28 ℃ to obtain activated agrobacterium liquid.

(c) Co-culture transformation: centrifuging the activated bacteria liquid of (b) at 5000rpm to collect thallus, resuspending thallus with AAM liquid culture medium 30mL containing 100 μ M/L acetosyringone, soaking the callus selected in (a) in the bacteria liquid for 20min, sucking off the excess bacteria liquid, spreading on co-culture solid culture medium, and dark culturing at 28 deg.C for 2 d.

(d) Callus degerming culture and callus resistance screening: washing the callus after co-culture for 2d with sterile water until the water is clear, then shaking with sterile water containing cefamycin (500mg/L) for 30min for sterilization, thoroughly sucking the callus with sterile filter paper or absorbent paper, and then inoculating on a selective culture medium for about 3 weeks.

(e) Differentiation and rooting of transgenic plants: inoculating the newly grown resistant callus in the step (d) to a differentiation culture medium, culturing for 1-2 months under illumination, then transferring the grown seedlings with the height of about 3cm to a rooting culture medium for rooting culture, taking leaves to extract DNA when the seedlings grow to about 10cm, and finally obtaining 3 transgenic positive plants by utilizing p-OsBG1 plant seedlings of amplified target gene full-length DNA. The 5 transgenic positive plants were named: KO-1, KO-2, KO-3;

(f) and (4) hardening seedlings indoors for 2-3 days, and transplanting the positive transgenic plants into a field.

6. Detection of transgenic Rice

(1) Extracting the DNA of the positive transgenic plant obtained in the step 5 by using an improved CTAB method, amplifying the full-length sequence of the knockout target gene in the transgenic plant by using a Pemf1-2 primer pair, wherein the size of the PCR product fragment is 600 bp. The Pemf1-2 primer pair is as follows:

the Pemf1-2 primer pair is:

Pemf1-2 F:5'TGGGATCTTCCACATAAT 3'(SEQ ID NO.15)，

Pemf1-2 R:5'AACCAAGCCTACTTCACC 3'(SEQ ID NO.16)；

wherein the PCR reaction system (25 uL): tap enzyme (5U/. mu.L) 0.5ul, Primer (10 mmol/. mu.L) 2ul, dNTP (2.5 mmol/. mu.L) 0.5ul, DNA (20-100 ng/. mu.L) 2ul, 2 XBuffer (25mM)12.5ul, ddH₂O7.5 ul. The PCR reaction program is: 5min at 95 ℃; 30 cycles of 95 ℃ for 30s, 56 ℃ for 5s, and 72 ℃ for 2.5 min; 72 ℃ for 10min and 12 ℃ for 1 min.

(2) Recovery and sequencing of PCR products

Adding a bromophenol blue indicator into the product after the reaction is finished after PCR amplification, carrying out electrophoresis in 2% agarose, recovering and storing by using a Tiangen PCR product recovery kit, wherein the reaction system specifically comprises the following components:

1) after the segments are completely separated, the target strip is cut rapidly with a knife under an ultraviolet lamp and placed in a new EP tube

2) Weighing gel block on electronic balance, adding appropriate amount of Binding Buffer according to the proportion of 1g gel to 1ml Binding Buffer, and water-bathing in 60 deg.C water bath for 10min until gel block is completely dissolved, and gently inverting once every 2-3min

3) The HiBind DNA column was inserted into a 2ml collection tube

4) Transferring the gel mixture to Hibind DNA column, centrifuging at 10000xg/min for 1min

5) Discarding the filtrate, reloading the column into the collection tube (the Hibind column can contain 700 mul of solution once), and repeating the steps 4-5.

6) The column was returned to the collection tube, 300. mu.l of Bind Buffer was added thereto, and the mixture was centrifuged at 10000Xg/min for 1min, and the filtrate was discarded

7) The column was returned to the collection tube, 700. mu.l of SPW Wash Buffer, 10000Xg/min centrifugation 1 dish was added, the bottom solution was discarded (SPW Wash Buffer was diluted with absolute ethanol first)

8) Repeat step 8 once

9) Discarding the filtrate, knocking the column into collecting tube again, centrifuging at 13000Xg idle for 2min

10) The column was reloaded into a sterile 1.5ml EP tube, 40. mu.l of an Elution Buffer heated in a bath at 65 ℃ was added, the mixture was allowed to stand at room temperature for 2min, and centrifuged at 13000Xg/min for 2min to elute the DNA, followed by gel electrophoresis, spotted with Maker, the integrity and concentration of the purified DNA were analyzed, and the DNA was sent to Duckokou science and technology Co., Ltd for sequencing after detection.

All 3 independent transgenic positive lines (as shown in FIGS. 13-15) exhibited a mutant phenotype of brown glume compared to wild-type Nip. Compared with a negative control, the 3 transgenic plants are respectively subjected to single base mutation in the CDS coding region of the OsBG1 gene (see SEQ ID NO. 3-SEQ ID NO. 5). Knockout experiments of the OsBG1 gene show that the OsBG1 gene is a gene for controlling glume color change, and the OsBG1 gene is also proved to be a gene for controlling brown glume phenotype of a mutant bg 1.

7. The anthocyanin content was determined for the transgenic knock-out lines KO-1, KO-2, KO-3 and the control variety Nipponbare using the method described in example 2.

The results show that the knockout strains KO-1, KO-2, KO-3 and the mutant bg1 have a mutant phenotype that the glume color is changed from yellow to brown, compared with the control Nip, the anthocyanin content of the transgenic strains KO-1, KO-2 and KO-3 of the OsBG1 gene knockout gene is obviously lower than that of the negative control Nippon (Nip), which indicates that the mutant phenotype of the mutant bg1 brown glume can be obtained by editing (comprising one or more addition, substitution and deletion) other CDS coding regions (relative to mutant bg1 mutant sites) of the OsBG1 gene, and the OsBG1 gene is a related gene for regulating and controlling the synthesis of rice anthocyanin, and the anthocyanin content of the rice glume anthocyanin (anthocyanin) can be reduced after the gene is knocked out, so that the change of the glume color of the rice glume can be influenced.

Example 5

In this example, the measurement of the photosynthetic pigments of the brown glume mutant bg1 and the wild type xiang 1B was performed.

To determine whether the generation of brown glume and kernel reduction of the mutants was related to the photosynthetic rate in the plant leaves, photosynthetic pigment assays were performed on chlorophyll a and chlorophyll b at seedling stage and at the filling stage bg1 and YX1B, respectively, and as a result, no significant difference was found between the seedling stage and the filling stage, while the photosynthetic major pigment chlorophyll a in bg1 was significantly lower than that of YX1B at the same stage. When the photosynthetic rate is detected, the photosynthesis of the wild type YX1B is obviously higher than that of the mutant bg 1. Thus, the present application believes that the reduction in grain size may be due to insufficient filling due to reduced photosynthesis by bg 1.

Detailed description of the drawings 1-16:

as shown in fig. 1-3: phenotypic observations of mutant bg1 and wild type YX1B throughout the growth and development cycle revealed major differences in: mutant bg1 began to develop needle-like brown pigment on the glumes of the ear approximately two weeks after ear emergence. After the initial break period, the whole spikelet appears flaky light brown color spots, the color on the glumes gradually changes into dark brown along with the development process and extends to the whole spike part, and moreover, the spontages can appear the phenomenon of empty particles and are not firm;

as shown in fig. 5-7: in order to determine whether the generation of brown glume of the mutant and the reduction of seeds are related to the photosynthetic rate in plant leaves, the photosynthetic pigment measurement is carried out on chlorophyll a and chlorophyll b of bg1 and YX1B at seedling stage and flowering filling stage respectively, and as a result, the result shows that the two stages have no obvious difference at the young ear stage, while the main photosynthetic pigment chlorophyll a in bg1 is obviously lower than that of YX1B at the same time, and the anthocyanin of the mutant bg1 is also obviously fixed to the wild type YX1B at the wax ripeness stage;

as shown in fig. 4, 8-11: f constructed with mutants bg1 and 02428₂Separating a population as a gene location population, simultaneously constructing a dominant pool and a recessive pool by using 10 dominant single plants and recessive single plants, primarily screening SSR primers by using the existing 456 in a laboratory, locating bg1 genes between 1-20-1-21 of the long arm end of a chromosome I (figure 4), and subsequently finding out that the 671 site base of the 5 th exon of the LOC _ Os01g67220 coding region is changed from C to T through gene re-sequencing, so that the 234 site amino acid is changed from glycine to valine (figure 8-11);

as shown in fig. 12-15: in order to verify that LOC _ Os01g67220 is a pathogenic gene of bg1, a knockout target site (figure 12) is designed specifically at the position 25bp before a mutation site, japonica rice variety NIP is used as a background for genetic transformation, and the obtained transgenic line is subjected to positive identification. The observation shows that: glumes of knockout positive lines appeared brown spots after 2-3 days of heading (fig. 13-15);

as shown in fig. 16: in order to investigate whether there was a difference in bg1 and YX1B gene expression, transcriptome measurements were performed on corresponding tissue material before and after the occurrence of lesions, and the results showed a total of 1343 genes up-regulated and 1275 genes down-regulated (FIG. 16-1). A total of 13 genes were simultaneously altered by pairwise comparison of YX1B and bg1 before and after the lesion (FIG. 16-2). Go enrichment analysis on the differential genes shows that the differential genes mainly focus on the biological growth and development processes of carbohydrate accumulation and metabolism, lipid membrane damage, plant signal conduction and the like. While differential transcription factors (FC > 2, p < 0.05) were analyzed, the vast majority of differential transcription factors were enriched for the MBW (MYB-bHTH-WD40) module (with the MYB family accounting for 20.47% and the bHLH family accounting for 18.64%) (FIGS. 16-3, 16-4). The MBW regulation module plays an important role in plant growth and development and stress response.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

(1) the related protein for controlling the color traits of the rice glumes is named as OsBG1, and the gene for changing the rice yellow glumes into brown can be obtained by knocking out the coding gene of the OsBG1 protein through gene editing, so that the related protein can be used for screening heterozygous or homozygous hybrid seeds in three-line hybrid seed production.

(2) The coding gene of the related protein for controlling the color character of the rice glume can code the related protein OsBG1, a rice variety with dark brown glume can be obtained after the coding gene of OsBG1 is knocked out through gene editing, heterozygous or homozygous hybrid seeds can be screened in three-line hybrid seed production, and the application of the coding gene of OsBG1 in the field of controlling the color of the rice glume is provided for the first time.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Sichuan university of agriculture

<120> related protein for controlling rice glume color character and coding gene thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 483

<212> PRT

<213> 1 (Artificial sequence)

<400> 1

Met Gly Ser Thr Gly Arg Asp Ala Glu Val Thr Arg Gly Asp Phe Pro

1 5 10 15

Asp Gly Phe Val Phe Gly Val Ala Thr Ser Ala Tyr Gln Ile Glu Gly

20 25 30

Ala Arg Arg Glu Gly Gly Lys Gly Asp Asn Ile Trp Asp Val Phe Thr

35 40 45

Glu Asn Lys Glu Arg Ile Leu Asp Gly Ser Ser Gly Glu Val Ala Val

50 55 60

Asp His Tyr His Arg Tyr Lys Glu Asp Ile Glu Leu Met Ala Ser Leu

65 70 75 80

Gly Phe Arg Ala Tyr Arg Phe Ser Ile Ser Trp Pro Arg Ile Phe Pro

85 90 95

Asp Gly Leu Gly Lys Asn Val Asn Glu Gln Gly Val Ala Phe Tyr Asn

100 105 110

Asp Leu Ile Asn Phe Met Ile Glu Lys Gly Ile Glu Pro Tyr Ala Thr

115 120 125

Leu Tyr His Trp Asp Leu Pro His Asn Leu Gln Gln Thr Val Gly Gly

130 135 140

Trp Leu Ser Asp Lys Ile Val Glu Tyr Phe Ala Leu Tyr Ala Glu Ala

145 150 155 160

Cys Phe Ala Asn Phe Gly Asp Arg Val Lys His Trp Ile Thr Ile Asn

165 170 175

Glu Pro Leu Gln Thr Ala Val Asn Gly Tyr Gly Ile Gly His Phe Ala

180 185 190

Pro Gly Gly Cys Glu Gly Glu Thr Ala Arg Cys Tyr Leu Ala Ala His

195 200 205

Tyr Gln Ile Leu Ala His Ala Ala Ala Val Asp Val Tyr Arg Arg Lys

210 215 220

Phe Lys Ala Val Gln Gly Gly Glu Val Gly Leu Val Val Asp Cys Glu

225 230 235 240

Trp Ala Glu Pro Phe Ser Glu Lys Thr Glu Asp Gln Val Ala Ala Glu

245 250 255

Arg Arg Leu Asp Phe Gln Leu Gly Trp Tyr Leu Asp Pro Ile Tyr Phe

260 265 270

Gly Asp Tyr Pro Glu Ser Met Arg Gln Arg Leu Gly Asp Asp Leu Pro

275 280 285

Thr Phe Ser Glu Lys Asp Lys Glu Phe Ile Arg Asn Lys Ile Asp Phe

290 295 300

Val Gly Ile Asn His Tyr Thr Ser Arg Phe Ile Ala His His Gln Asp

305 310 315 320

Pro Glu Asp Ile Tyr Phe Tyr Arg Val Gln Gln Val Glu Arg Ile Glu

325 330 335

Lys Trp Asn Thr Gly Glu Lys Ile Gly Glu Arg Ala Ser Ser Glu Trp

340 345 350

Leu Phe Ile Val Pro Trp Gly Leu Arg Lys Leu Leu Asn Tyr Ala Ala

355 360 365

Lys Arg Tyr Gly Asn Pro Val Tyr Tyr Val Thr Glu Asn Gly Met Asp

370 375 380

Glu Glu Asp Asp Gln Ser Ala Thr Leu Asp Gln Val Leu Asn Asp Thr

385 390 395 400

Thr Arg Val Gly Tyr Phe Lys Gly Tyr Leu Ala Ser Val Ala Gln Ala

405 410 415

Ile Lys Asp Gly Ala Asp Val Arg Gly Tyr Phe Ala Trp Ser Phe Leu

420 425 430

Asp Asn Phe Glu Trp Ala Met Gly Tyr Thr Lys Arg Phe Gly Ile Val

435 440 445

Tyr Val Asp Tyr Lys Asn Gly Leu Ser Arg His Pro Lys Ala Ser Ala

450 455 460

Arg Trp Phe Ser Arg Phe Leu Lys Gly Asp Asp Ala Glu Asn Lys Ala

465 470 475 480

Asp Met Asn

<210> 2

<211> 1452

<212> DNA

<213> 2 (Artificial sequence)

<400> 2

atggggagca cggggcgcga cgcggaggtg acccgcggcg acttccccga cggcttcgtc 60

ttcggcgtcg ccacctccgc ttaccagatt gaaggggcga gacgggaggg aggcaaagga 120

gataacatat gggatgtttt cacagaaaac aaagaacgta tcttagatgg gagcagtgga 180

gaagttgcag ttgatcatta ccatcgatac aaggaagaca ttgaactcat ggccagtttg 240

ggtttccgtg cttatagatt ttctatatct tggccacgca tatttcctga tggcctgggg 300

aaaaatgtca atgagcaagg agttgccttt tataatgacc ttataaattt catgattgag 360

aaaggtattg agccatacgc aactctgtat cattgggatc ttccacataa tcttcagcag 420

actgtgggtg gttggctttc tgataagatc gtggagtact ttgcactgta tgcagaagct 480

tgctttgcaa attttggaga cagagtaaag cattggataa caatcaatga gcctcttcaa 540

actgcagtta atggttacgg aattggacat tttgcacctg gaggatgtga aggggaaact 600

gctagatgct acttggccgc ccactaccaa atcttggctc atgctgctgc tgttgatgtt 660

tacagaagga aatttaaggc tgtgcaaggt ggtgaagtag gcttggttgt cgattgtgaa 720

tgggcagagc cattttcaga gaaaacagaa gatcaggttg ctgcagaacg aaggcttgac 780

tttcagctag gatggtacct ggacccaata tatttcggtg attacccaga aagtatgcgt 840

cagcgactgg gcgatgatct tccaaccttc tcggagaaag ataaagaatt tatcaggaac 900

aaaattgact ttgttggaat aaatcaatat acttcaagat tcattgctca tcatcaggat 960

ccagaagata tttattttta ccgagtacaa caagtggaga gaatagaaaa atggaacact 1020

ggtgaaaaaa ttggtgaaag ggccgcatct gagtggcttt tcatagttcc ttggggcctc 1080

cggaaattac ttaattatgc agcaaagaga tatggaaatc ctgtgatata tgtaactgag 1140

aatggcatgg atgaggaaga tgatcaatcg gcaacgcttg accaagtctt gaatgatacg 1200

acgagggttg gttacttcat aggatacctc gcgtcagttg cacaagcaat caaggatggt 1260

gctgatgttc gtgggtactt cgcatggtcg ttcctggaca acttcgagtg ggctatggga 1320

tacaccaaga ggtttggcat tgtttatgtt gattacaaaa atgggctttc ccggcatccc 1380

aaagcatcgg cccggtggtt ctcgcgcttc ttaaagggcg atgacgctga gaacaaagct 1440

gacatgaact ag 1452

<210> 3

<211> 1451

<212> DNA

<213> 3 (Artificial sequence)

<400> 3